TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-126-5p
miRNA Sequence: CAUUAUUACUUUUGGUACGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr11133582 3492 3411 3174 3151 3040 2900 2391 1415 735 593 569 214 23220 2478 1954 12481
NM_000084chrX126995 6438 6281 5990 2267 2027 1972 934 845 839 811 488 --12069 15320
NM_000092chr2104453 3848 3806 3672 3443 1654 1583 514 476 301 --34422 3814 1373 --
NM_000096chr34882 768 229 46 1690 --2254 199
NM_000112chr5125569 5466 5169 4885 4802 4724 4651 4489 3610 3480 2155 2139 35036 4560 1739 13848 --
NM_000163chr582385 2066 1450 749 538 498 322 37 11935 31987 758 553 --
NM_000202chrX123864 3396 3325 3184 2553 2508 1236 1083 670 627 398 329 3756 738 655 21246 740 1458
NM_000232chr473209 2041 1297 831 587 225 87 1656 43217 2974 2858 658 32906 662 591
NM_000242chr10112677 2671 2602 2537 2420 2218 889 704 504 405 133 1161 12250 22137 164
NM_000248chr393042 2981 2899 2565 2065 1911 1170 846 62 --22955 89 12953
NM_000259chr1596343 3970 3933 2150 1813 1485 1415 530 259 1590 26208 470 1802
NM_000264chr993233 3154 2921 2464 2150 1183 891 536 413 12968 33379 2230 521 --
NM_000267chr17123276 3056 2954 2643 2564 2303 2241 1347 1092 1048 658 117 1460 21304 857 --
NM_000278chr10--12290 --22296 2293
NM_000332chr687198 7103 6802 6261 5305 5172 2724 2291 35810 4819 2128 26849 2226 --
NM_000337chr585685 5634 5157 4996 4885 4026 914 517 76587 5479 5361 4717 2557 2194 1195 25778 5391 --
NM_000390chrX93340 3262 3139 3072 2736 2564 977 650 125 32863 1101 842 43297 3154 3093 306 22866 444
NM_000408chr292871 2557 1257 1185 1026 932 849 425 89 1494 12563 22561 887
NM_000441chr74799 457 439 357 32145 665 502 51960 1496 712 545 272 1710
NM_000448chr11102993 2620 2254 2228 2026 1285 1258 713 452 425 --22563 1041 2766 529
NM_000489chrX72623 2208 2188 1050 742 347 97 --12346 1273
NM_000522chr731311 1305 69 11171 3360 91 78 389 76 73
NM_000555chrX157427 7353 7244 6615 6267 6144 6085 5725 3080 2507 1992 1934 1385 1083 223 12397 46187 6033 1211 750 1748
NM_000618chr12196581 6543 6491 6372 6316 6242 5792 5473 4332 2147 1885 1818 1764 797 771 688 679 238 107 34505 1877 1790 26605 470 --
NM_000618chr12196581 6543 6491 6372 6316 6242 5792 5473 4332 2147 1885 1818 1764 797 771 688 679 238 107 34505 1877 1790 26605 470 --
NM_000633chr1864724 4331 3655 3618 3549 3448 160 23747 3529 14440
NM_000686chrX51557 1334 454 279 80 187 1282 1266
NM_000793chr14175139 4861 4804 4503 3802 3205 3145 3105 2050 2022 1732 1360 968 631 605 349 215 24731 1586 11481 --
NM_000809chr4289067 8996 8981 8637 8570 8428 8281 8268 8055 7747 7645 7623 7352 7052 6281 6181 5638 3424 3086 2934 2772 2670 2288 2205 1930 1887 1303 1077 69167 8712 8367 2707 2456 506 58823 8446 2709 2464 2461 166285 2510 2507 2504 2501 2498 2495 2492 2489 2486 2483 2480 2477 2474 2471 2459
NM_000813chr5205503 5253 5142 4987 4805 4699 4441 4433 4424 4184 4111 4094 4071 2231 1827 1677 1462 1114 297 174 63800 3667 3585 1785 1439 1302 25595 483 24614 4611
NM_000824chr44308 227 190 131 3888 842 326 --2609 318
NM_000826chr492184 2170 2091 2082 1611 1594 472 316 175 11011 --11901
NM_000860chr481460 1330 1316 1101 1089 249 236 129 21517 451 1453 --
NM_000866chr381564 734 622 592 326 207 145 122 41493 682 289 72 1291 --
NM_000868chrX61833 1660 1595 790 683 199 12197 22409 2224 22257 2200
NM_000875chr15127078 7046 6801 6739 6368 5911 5720 5681 2469 362 267 254 ------
NM_000899chr12124239 3859 3816 3304 3292 2785 2768 2662 1718 1457 1359 1329 12699 14208 --
NM_000912chr851391 1253 979 709 54 43071 2558 2437 788 13510 2856 791
NM_000926chr11228883 7465 7446 6851 6666 5875 3457 3358 3129 2874 2832 2709 2308 1953 1819 1732 1262 1147 854 730 642 361 23177 670 47635 7449 3179 2053 19473
NM_000950chrX71394 819 788 660 602 585 418 33524 3103 2886 43455 3394 2929 501 22933 1131
NM_000959chr1153994 3891 3713 3581 3335 3047 3037 2953 2832 2579 1285 824 742 697 224 31172 1146 855 43668 2508 1174 1148 12870
NM_000963chr152320 2201 1910 541 502 42184 1699 1684 1660 11689 32187 1687 65
NM_001001395chr1282834 2778 2440 1730 1001 923 466 212 11836 --1496
NM_001001419chr585240 5021 4865 4583 4463 4054 3210 888 23248 574 34676 4430 3766 13684
NM_001001420chr585240 5021 4865 4583 4463 4054 3210 888 23248 574 34676 4430 3766 13684
NM_001001481chr853290 3136 2298 581 406 33210 2176 751 13212 22530 1354
NM_001001484chr10102413 2046 1884 894 766 747 605 435 256 103 2541 441 22330 1593 --
NM_001001664chr2123696 3664 3196 2863 2818 2719 2550 908 812 727 330 155 43120 2512 464 323 13122 34061 3309 980
NM_001001668chr19103647 2935 2747 2659 1639 1632 1486 1209 943 902 22594 1518 23653 2596 13651
NM_001001683chr171328 1398 --3401 386 383
NM_001002257chr293603 3374 3129 2943 2812 2784 2454 2252 987 21125 709 11075 21128 1079
NM_001002843chr1541161 1109 475 439 21127 176 2840 237 2322 235
NM_001003652chr18148108 7960 7773 7454 6510 5848 5798 3329 2949 2354 1457 1117 899 288 33383 3002 799 31728 801 243 15551
NM_001003674chr18117086 6800 6138 2768 2701 2615 2565 1780 1324 1288 1000 1183 26820 5383 16601
NM_001003675chr18117086 6800 6138 2768 2701 2615 2565 1780 1324 1288 1000 1183 26820 5383 16601
NM_001003712chr12113219 3174 2548 1606 1454 1379 1356 1130 1060 464 265 52926 2482 1510 1427 473 34031 2484 876 --
NM_001003760chr6103380 3061 1315 1098 1070 1030 1001 731 644 580 42720 2434 1321 1038 ----
NM_001004330chr1291332 1288 1257 1153 728 393 304 170 89 --11272 1465
NM_001004419chr12154639 3900 3802 3629 3378 3252 1744 1548 1439 687 303 283 230 200 124 --1690 13071
NM_001004441chr541489 1187 399 375 21224 174 31453 1226 656 --
NM_001005473chr5136648 6528 5592 4312 4154 4146 2381 2143 1819 1732 1661 1647 1540 74341 2190 1866 1675 766 619 577 64743 4442 4343 1427 857 621 34865 4347 2134
NM_001006600chr592478 2453 2119 1918 687 639 334 139 133 --11795 --
NM_001007023chr14175139 4861 4804 4503 3802 3205 3145 3105 2050 2022 1732 1360 968 631 605 349 215 24731 1586 11481 --
NM_001007246chr2161912 1905 326 192 55 26 --283 35 --
NM_001007278chr13125286 5248 4219 3215 3187 1751 1728 1674 1435 883 261 125 11912 ----
NM_001008239chr18113325 3275 2947 2904 2748 2534 679 673 607 376 237 33750 1287 312 --12620
NM_001008405chr771436 412 398 319 175 122 104 31401 1363 135 21820 337 2444 138
NM_001008408chr766423 6317 2411 2125 1306 1239 --35453 5017 400 11243
NM_001008491chr251769 1610 1589 621 608 11578 11583 21957 1581
NM_001008492chr251769 1610 1589 621 608 11578 11583 21957 1581
NM_001008539chr865342 5160 4317 1651 1014 889 --25262 1587 25423 1377
NM_001008925chr4113543 3527 3370 2487 2165 1380 1333 876 697 687 442 1853 13463 --
NM_001009554chr4114758 4420 4165 4010 3587 3334 3004 1614 1606 1141 1094 --44318 4315 756 244 --
NM_001009554chr4114758 4420 4165 4010 3587 3334 3004 1614 1606 1141 1094 --44318 4315 756 244 --
NM_001009571chr751367 1237 1148 670 344 --41693 1093 1071 1064 11081
NM_001009899chr3116197 5156 4634 4245 4225 1344 1099 945 401 349 30 14890 16493 --
NM_001009909chr11183921 3909 3752 3688 3437 3217 2874 2825 2560 1431 1251 1096 1057 1043 1000 719 545 524 33270 1391 351 13272 13125
NM_001009959chr291744 1642 961 892 634 366 253 176 140 ----12496
NM_001010000chr1863244 2748 2593 2465 1332 467 13291 12935 12922
NM_001010861chr1112769 2601 2474 2445 2388 2041 1043 815 670 559 553 11970 1112 --
NM_001010888chrX114445 4226 4046 3846 1762 1706 1601 905 830 76 68 13718 32922 1039 84 23270 53
NM_001010891chr5166895 6543 5521 4952 4660 4504 4224 2149 2029 1987 1137 1070 625 194 91 46 --14239 1637
NM_001010984chr1102618 2505 2411 2377 1694 869 770 348 182 130 12581 11037 22138 261
NM_001010986chrX72327 2150 2124 1794 493 408 121 41936 471 298 237 12304 --
NM_001011513chr4114086 3903 3775 3712 2908 2898 2565 1608 1088 331 316 41537 492 457 107 1109 24109 4106
NM_001011666chr7126596 5903 5766 5617 4661 4149 4074 2605 2239 2059 1124 710 2824 548 21067 867 12635
NM_001012755chrX114869 4558 4525 4286 4252 3948 3840 3718 3204 970 744 24121 1865 74998 4940 4640 3602 1834 1831 1805 54638 1856 1853 1850 1829
NM_001012968chrX92828 2822 2520 2332 2255 2213 2059 1830 233 12068 22641 2335 12607
NM_001013620chr12178179 8154 7913 7250 6702 6684 6599 5573 5305 1482 1226 636 562 445 409 384 214 56167 2439 1942 1753 568 36172 6169 40 28508 2675
NM_001013693chr112975 ----31042 1039 1030
NM_001013693chr112975 ----31042 1039 1030
NM_001013746chr7102351 2270 2007 1907 1879 1763 823 812 736 368 1786 ----
NM_001014380chr13145888 4845 4251 3575 2013 1931 1866 1418 1391 1305 1142 471 166 41 24723 1446 34705 4214 2024 14816
NM_001014797chr10188171 8135 6357 6198 6024 5798 5759 5279 4998 2222 1999 1016 713 620 600 531 353 323 45789 5753 5154 1273 76411 5805 2953 2596 2466 2129 1563 11276
NM_001018065chr985172 4735 4563 1768 1752 1447 752 195 54346 4188 4068 4039 4024 24884 4348 --
NM_001018066chr985172 4735 4563 1768 1752 1447 752 195 54346 4188 4068 4039 4024 24884 4348 --
NM_001018067chr1125049 4992 4818 4765 4369 4307 3417 3392 2125 1383 1330 1279 13359 23384 1644 13438
NM_001018068chr1125049 4992 4818 4765 4369 4307 3417 3392 2125 1383 1330 1279 13359 23384 1644 13438
NM_001018069chr1125049 4992 4818 4765 4369 4307 3417 3392 2125 1383 1330 1279 13359 23384 1644 13438
NM_001024647chr12107570 7547 6029 5845 5562 5059 1581 1556 875 599 37613 7251 345 37194 1803 347 22399 1790
NM_001024948chr1123334 3306 2985 2845 2697 2659 2516 1253 694 491 484 375 42478 1187 498 474 32540 2468 320 --
NM_001024956chr11215503 5449 5141 4970 4859 4553 4335 4241 3871 3734 3694 2171 2110 1430 1199 909 757 577 153 106 68 35790 816 81 1475 2479 385
NM_001025076chr1095796 5488 4710 2491 1731 1150 1143 842 555 25999 1916 1518 --
NM_001025077chr10117154 6846 6068 4631 2508 2501 2200 1913 1300 894 216 17357 24605 1876 2785 782
NM_001025079chr3164106 3975 3390 3383 3239 3036 2798 2759 1525 1368 1089 360 297 200 194 39 33108 518 273 11558 11556
NM_001025108chr2134209 4022 3829 3630 3532 3511 3209 2636 1499 1474 849 560 135 13066 11068 --
NM_001025233chr1292621 2579 747 605 528 417 401 368 267 22743 2249 --32568 2252 1981
NM_001029858chr632330 2236 739 1792 --22620 901
NM_001029875chr592771 2258 2108 927 765 742 710 654 155 1488 --1358
NM_001030007chr16104052 3853 2791 2652 2638 2536 1585 882 803 741 13915 1507 14032
NM_001030055chr14114412 4321 3810 3416 1680 1403 1329 724 337 182 100 34389 4174 3002 44530 4176 3004 673 --
NM_001031679chr1233025 472 76 1962 13472 2968 965
NM_001031700chr482537 2298 2239 1854 1556 755 359 323 11016 22440 885 22502 883
NM_001031732chr4103686 3382 1444 1239 1011 913 833 414 350 78 12718 32777 2720 984 --
NM_001031804chr1674199 3990 3891 1301 971 369 35 23374 3058 23016 3013 13586
NM_001033045chr2103913 3904 3735 3500 3385 2987 1129 765 661 655 64126 3753 3583 1677 1169 934 31679 1121 239 --
NM_001034954chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_001034955chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_001034956chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_001034957chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_001037164chr781932 1849 825 808 767 559 532 256 11596 --1568
NM_001037174chr241921 795 241 96 21547 533 --21550 536
NM_001037317chr1112769 2601 2474 2445 2388 2041 1043 815 670 559 553 11970 1112 --
NM_001037334chr1862376 2176 1621 1543 944 765 1591 21833 677 3746 743 594
NM_001039538chr283125 2759 2450 1337 657 597 546 109 43107 1313 164 28 43580 2849 1280 131 131
NM_001039569chr273273 2807 2067 801 791 616 108 2809 785 4811 461 442 363 1508
NM_001039585chr1174251 4148 3970 3838 3592 3304 3294 3210 3089 2836 2640 1542 1081 999 954 481 265 31429 1403 1112 43925 2765 1431 1405 13127
NM_001039618chr11145720 5510 5407 5299 5207 4580 4561 4251 2374 2133 2111 2038 1310 1143 21624 119 14487 1181
NM_001039840chrX165760 5602 5528 5265 5166 4627 4506 4127 4026 3964 3842 1478 1344 1301 1196 731 25842 1446 21731 863 25105 4816
NM_001039937chr13153824 3696 3244 3208 3070 2982 2966 2869 2774 2530 1625 1606 588 564 549 13504 ----
NM_001040142chr242466 2294 1911 909 21810 197 21812 345 2343 340
NM_001040143chr242466 2294 1911 909 21810 197 21812 345 2343 340
NM_001040152chr7114981 4944 4915 4894 4662 3984 3751 3346 1427 1421 1379 54700 4612 4254 629 32 24887 3157 --
NM_001040202chr482159 1910 1715 782 502 490 464 118 1725 22259 996 2994 166
NM_001040284chr16195836 5568 5098 4319 4197 3871 3854 3654 3630 2307 2256 1712 1477 971 776 712 624 240 39 22048 336 44571 3825 1248 541 1557
NM_001040429chr1383621 2978 2557 2286 846 803 75 60 --22693 232 13571
NM_001040441chr1104571 4403 4208 3848 3480 3392 3341 1446 1436 119 14792 25363 4911 24784 4781
NM_001040450chr1592775 2003 1964 1911 1017 988 705 406 320 12537 12539 12543
NM_001040453chr1592775 2003 1964 1911 1017 988 705 406 320 12537 12539 12543
NM_001040665chr7114747 4717 3899 3643 3548 3501 3293 1274 1072 839 364 15045 35047 4989 3924 43390 3387 648 306
NM_001040712chr9103610 3157 3054 2940 2574 2505 826 816 449 206 13370 1189 13058
NM_001042355chr16124724 4337 4187 3659 3289 1927 1720 1644 1073 565 433 181 14298 1816 1814
NM_001042404chr161739 1621 1489 1394 1243 1225 --1273 2716 450
NM_001042412chr16124724 4337 4187 3659 3289 1927 1720 1644 1073 565 433 181 14298 1816 1814
NM_001042473chr1062209 2115 1595 1522 641 211 --2365 289 12159
NM_001042492chr17123276 3056 2954 2643 2564 2303 2241 1347 1092 1048 658 117 1460 21304 857 --
NM_001042543chr471246 1172 1000 463 411 194 107 11082 21137 579 1323
NM_001042550chr941597 1367 1292 332 11802 2660 606 31985 628 574
NM_001042599chr2187339 6938 6558 6264 6119 6099 6080 6028 5008 2921 2894 2866 2748 2513 2225 1714 1447 460 57211 5170 2235 1827 140 1621 --
NM_001042604chr3134897 3960 3202 3059 1702 1588 1060 831 774 743 639 406 241 54472 4025 375 273 104 44239 4027 734 477 --
NM_001042683chr641638 310 225 41 2536 252 2694 524 1452
NM_001044385chr2143975 3663 3391 3261 3229 3045 2812 2731 2629 333 221 208 97 26 --33978 3500 486 --
NM_001046chr592867 2665 2450 2215 2061 1211 991 159 56 12240 --12935
NM_001083620chr492182 2168 2089 2080 1610 1593 471 315 175 11010 --11899
NM_001099678chr3195763 5708 5623 5164 4759 4709 4560 4490 4312 2550 2367 2011 1998 1725 1543 1404 1270 1215 730 74596 4219 4171 4037 1807 1345 215 34719 4039 2439 11348
NM_001106chr3189066 9059 8205 6859 6529 6462 6049 6029 3574 3503 3467 3231 3194 2603 2407 1647 1629 1522 19801 --19804
NM_001117chr1872483 2174 1950 1644 709 485 116 --12375 2151 148
NM_001128chr16104052 3853 2791 2652 2638 2536 1585 882 803 741 13915 1507 14032
NM_001135chr15------2856 853
NM_001167chrX96602 6474 4946 4616 2192 1559 1186 1035 77 15082 --31473 1470 591
NM_001173chr14114412 4321 3810 3416 1680 1403 1329 724 337 182 100 34389 4174 3002 44530 4176 3004 673 --
NM_001186chr21113272 2995 2708 2201 2101 2043 1020 604 456 229 185 1260 1397 1272
NM_001201chr4143948 3737 3584 3578 2983 2799 2738 2561 2416 1475 719 449 372 219 23303 3090 13761 23784 3759
NM_001204chr2207800 7474 7220 6674 5388 4951 3084 2849 2750 2459 2433 2397 2353 1637 1541 1177 1105 1025 813 517 25456 3061 37194 5458 334 36780 2604 1425
NM_001233chr7142404 2188 2098 2076 1843 1800 1761 1741 895 508 466 341 182 165 51818 1611 911 410 278 2308 294 --
NM_001241chr252139 1879 1763 983 265 21500 526 22311 104 12123
NM_001241chr252139 1879 1763 983 265 21500 526 22311 104 12123
NM_001259chr7156018 5828 5566 4790 4732 4612 4454 2139 1835 1686 1498 1343 1168 572 500 25261 2049 15170 --
NM_001304chr17103803 3333 2968 2823 2508 1401 1368 1337 1238 1047 23756 3553 33344 3055 282 --
NM_001412chrX63723 2805 2645 1370 1219 621 --23284 164 23622 162
NM_001432chr4123850 3565 3510 3360 3018 2705 1492 1307 964 483 384 232 22785 2735 33813 2787 418 175
NM_001438chr143416 1118 983 898 23424 3210 23388 123 43436 3433 3430 3427
NM_001527chr6134608 4289 4016 3990 3811 3586 1530 1390 1241 1128 440 396 278 44556 3975 3856 601 43977 3881 498 443 13790
NM_001609chr10143693 3377 3354 3266 3027 2993 2984 2945 1556 1398 1283 1008 657 122 11143 32977 1145 1021 --
NM_001621chr773087 3068 2295 1231 751 736 510 23060 2689 1739 11114
NM_001621chr773087 3068 2295 1231 751 736 510 23060 2689 1739 11114
NM_001656chr542050 716 479 378 51513 810 700 510 280 --1685
NM_001663chr14102131 2080 2002 1059 1021 942 915 635 611 484 1643 2572 344 1342
NM_001777chr3164106 3975 3390 3383 3239 3036 2798 2759 1525 1368 1089 360 297 200 194 39 33108 518 273 11558 11556
NM_001821chr1134775 4198 4128 4003 3975 3825 3702 3051 3044 1462 643 426 87 54723 4343 2965 1348 376 21822 326 2530 365
NM_001858chr6145144 4736 4667 4482 4272 4042 3744 3528 3304 2043 1855 1616 678 657 ----13991
NM_002006chr4124608 4541 3514 2226 2216 1760 1622 1286 248 137 108 67 54744 4483 1605 1598 863 35766 5400 865 15025
NM_002009chr1582104 988 879 583 452 280 273 221 --4861 339 336 101 4726 391 388 385
NM_002025chrX189031 7996 7723 7614 7068 7005 6733 6096 5938 5869 5854 5686 3550 2843 2136 2003 1032 338 39228 1612 1272 13117 47769 7137 1036 674
NM_002069chr7101890 1880 1844 1363 1294 1183 697 569 528 471 11283 11285 --
NM_002126chr17104015 3427 2650 1432 1159 836 731 687 489 424 --33827 1224 572 --
NM_002128chr1372356 1753 1678 798 730 587 352 12605 22596 1924 11579
NM_002210chr2153435 3234 3209 3124 2974 2941 2751 2733 2652 2170 1317 1094 922 576 191 2304 228 12822 --
NM_002214chr7155095 4757 4588 4372 3959 3632 3592 2155 2039 1712 1537 802 503 422 390 25505 4802 23602 46 1754
NM_002270chr5195700 5664 5549 5305 5209 5175 4897 4788 4672 4438 4413 4352 4190 3616 3463 3448 1356 904 365 34312 2019 440 15630 24474 4263
NM_002285chr2134209 4022 3829 3630 3532 3511 3209 2636 1499 1474 849 560 135 13066 11068 --
NM_002310chr5146482 6335 6032 5799 5384 4991 4263 4150 2298 2040 1764 1518 1165 576 16305 22162 1744 14387
NM_002336chr12165083 4708 4416 3728 3485 3443 3417 3392 3279 3190 3104 1934 1622 1530 1288 492 1328 24074 908 --
NM_002351chrX91647 1603 1549 1465 1192 1181 315 261 208 21306 74 11568 --
NM_002356chr6122469 2420 2242 2205 2191 2094 1785 994 942 766 467 24 11905 22840 1925 --
NM_002374chr283125 2759 2450 1337 657 597 546 109 43107 1313 164 28 43580 2849 1280 131 131
NM_002451chr9113575 3063 2983 2894 2473 1251 1186 965 833 216 173 1897 21116 549 33566 565 553
NM_002481chr1127447 6272 5311 5180 4953 1789 1488 1287 1268 1203 1025 599 37934 2534 2337 --37937 2343 2340
NM_002577chr3104044 3279 3162 3043 2800 1423 1028 678 487 316 23831 1022 22877 718 13484
NM_002581chr965692 5279 4174 3710 2135 875 55617 5423 4314 3550 2236 15619 --
NM_002655chr864859 4724 2118 1476 343 280 35236 1364 513 53502 1874 781 698 469 55239 4900 779 776 773
NM_002677chr8102754 2726 2691 2663 2384 1055 571 556 511 326 52390 2354 2122 1102 300 143 33017 1105 303
NM_002687chr1441336 423 309 54 1228 --2234 231
NM_002718chr382551 2520 2465 1779 852 802 775 439 11013 11767 3920 856 471
NM_002731chr173001 2473 2099 2053 882 868 690 --2913 448 1751
NM_002736chr792125 2055 1919 1822 1527 496 307 269 219 --2358 159 1665
NM_002737chr1796698 5678 5287 1273 1263 1204 973 839 679 --36701 5459 1332 15457
NM_002837chr12134444 4100 3801 3416 2865 1560 1393 1166 1144 1117 1050 753 718 23603 3468 11531 --
NM_002839chr9103610 3157 3054 2940 2574 2505 826 816 449 206 13370 1189 13058
NM_002977chr263152 2133 1220 453 268 58 22394 1036 1896 1894
NM_003034chr12178153 7249 7159 5755 5529 5382 2905 2748 2673 2237 2191 2021 1973 1883 1777 408 233 25561 527 47734 5954 1976 554 37190 7187 401
NM_003046chr865342 5160 4317 1651 1014 889 --25262 1587 25423 1377
NM_003099chr15116482 5851 5728 5519 4824 2480 2118 1914 488 371 203 --24993 901 11546
NM_003108chr2127318 6404 6027 5536 5172 4613 4527 4466 1609 1571 1130 166 27252 5953 35512 92 89 14985
NM_003112chr783237 3182 2846 1222 1177 1119 567 500 42951 2705 455 390 23165 392 --
NM_003221chr642992 1526 1157 900 --12925 31312 284 275
NM_003262chr3155232 4849 4824 4789 4712 4393 4345 3980 3406 3252 2120 1267 1101 1063 544 25178 3327 41635 1529 1253 221 11744
NM_003292chr181962 1724 1612 847 701 572 399 125 42311 2083 806 686 31931 246 60 --
NM_003298chr365637 5473 5397 2020 1987 1587 24669 346 24671 515 1411
NM_003342chr17103280 2710 2394 2337 1124 628 600 333 222 21 1286 22586 651 --
NM_003369chr1122715 352 22738 346 284 81 1335
NM_003392chr394155 4046 3482 3436 1225 886 797 667 194 2907 558 1560 1898
NM_003411chrY91465 1379 1312 1181 486 335 234 228 190 1643 41405 645 600 454 --
NM_003412chr383149 3122 3075 2821 2741 1148 565 410 12446 32779 2761 2705 22777 2765
NM_003463chr6123396 2767 2529 2369 2160 1264 1201 1117 1025 844 95 86 13025 ----
NM_003478chr1172881 2702 2267 2089 758 678 575 --13244 1543
NM_003506chr841338 1060 527 180 1153 1235 1222
NM_003566chr12123389 2657 2505 2415 2389 2163 2120 1367 1245 1049 65 52 53135 2668 1096 832 26 23024 2643 22194 596
NM_003574chr18144837 4317 3567 2224 2178 2122 2097 1767 1731 1610 1138 1076 993 297 25465 828 45344 1030 342 145 --
NM_003583chr1273921 3520 3231 2951 2547 2474 1403 21349 267 11351 12459
NM_003590chr2114036 4016 3983 3879 3160 2981 1351 1060 821 741 506 13423 33425 771 675 13769
NM_003615chr3163859 3418 2718 2700 2617 2437 1563 1420 1256 1127 1019 908 801 739 171 144 23843 2817 2675 572 22748 576
NM_003617chr1154605 4476 3674 3595 3506 3498 3094 1937 1428 1342 1323 1106 985 475 51 43447 1651 1221 338 24613 1326 14408
NM_003622chr1242587 643 347 151 --22675 2087 22579 2085
NM_003749chr1352427 2382 1518 1508 1486 1704 1706 12001
NM_003759chr4144166 4081 3952 3456 3362 3354 3129 3059 1554 1515 778 381 308 103 24132 259 13535 21199 1196
NM_003772chr1181179 1076 899 510 499 423 404 191 11012 1478 --
NM_003774chr1253299 3197 3086 2697 2663 --23246 2311 12309
NM_003799chr1844284 2889 570 296 11333 23694 673 43303 3097 1548 1545
NM_003822chr182784 2717 2339 1158 984 637 184 172 --23206 158 --
NM_003838chr151237 1044 559 523 92 --3238 235 133 1398
NM_003913chr684101 3941 3840 3376 2711 1354 928 639 23585 1270 11451 33988 2728 303
NM_003966chr5137811 7341 6368 5934 5919 5252 5198 5151 2381 2181 1807 1525 1467 36599 5912 3126 32061 1706 1018 36602 2246 1016
NM_003987chr10--12290 --22296 2293
NM_003988chr10--12367 --22373 2370
NM_003989chr10--12226 --22232 2229
NM_003990chr10--12226 --22232 2229
NM_003994chr12124239 3859 3816 3304 3292 2785 2768 2662 1718 1457 1359 1329 12699 14208 --
NM_004087chr351986 1678 1359 710 424 ----21533 1530
NM_004100chr642046 893 716 505 1848 1884 22050 2036
NM_004124chr1493398 2691 2506 1146 1071 927 895 727 472 12194 33168 671 176 23068 1262
NM_004133chr8112575 2560 2549 2502 2163 1986 1756 1747 1082 769 327 1382 22385 2382 --
NM_004136chr1563291 3201 3113 2231 149 131 53137 2979 2147 941 181 --12150
NM_004161chr251563 1005 636 593 237 1617 21197 503 21457 1195
NM_004171chr11109407 8918 8805 7964 7301 6464 2888 856 492 193 25972 1349 56987 2997 2979 1406 723 17425
NM_004229chrX61805 835 512 410 186 165 42235 2090 1791 254 22178 341 1637
NM_004232chr18113396 2996 2978 2938 2752 1355 1290 1214 694 460 251 13292 23834 1307 12395
NM_004274chr14163008 2803 2601 2545 2354 2269 2190 2088 2003 1205 985 888 843 717 602 465 --22277 1274 --
NM_004337chr861829 1546 1415 827 743 125 22165 322 2726 55 21514 1448
NM_004338chr18117086 6800 6138 2768 2701 2615 2565 1780 1324 1288 1000 1183 26820 5383 16601
NM_004386chr1942305 1906 1407 650 11928 --21934 1931
NM_004397chr1183363 3249 3071 2839 2772 1207 355 334 1522 21314 651 22846 2843
NM_004404chr251769 1610 1589 621 608 11578 11583 21957 1581
NM_004458chrX52417 2358 942 860 598 2528 503 --2657 506
NM_004464chr494312 4155 4141 3614 3321 3000 2622 1460 1373 53140 1665 1641 1052 621 13591 --
NM_004501chr1133860 3683 3609 3265 3164 3124 3090 3040 2627 1493 1289 911 398 --12937 23715 3712
NM_004586chrX165470 5392 5160 5082 4766 4489 4310 4085 4005 2014 1822 1258 1066 574 263 172 24172 2061 34678 4174 1219 --
NM_004598chr5103226 3205 3151 2737 2667 2575 2523 2328 1274 1198 1751 12287 23289 2438
NM_004612chr974687 3667 3431 1843 1550 880 130 24154 1163 33110 1782 1198 24240 3114
NM_004622chr262350 2331 937 869 642 432 22320 1635 11705 22323 1703
NM_004684chr44420 319 288 134 --1295 1311
NM_004685chr13102990 2914 2639 2379 2135 2108 697 372 94 26 42114 928 378 141 32195 747 125 --
NM_004726chrX115787 5409 4840 4439 3898 3776 1039 908 800 489 449 34240 836 605 25532 4285 13919
NM_004745chr8127050 6978 6823 6793 6607 6520 5315 5090 4931 2292 2009 1283 16050 25830 369 --
NM_004757chr42707 637 147 2470 234 3645 566 462
NM_004795chr1381903 1888 1840 728 595 192 183 37 11525 31742 442 382 21921 1371
NM_004815chr184414 4258 3719 3582 3363 1787 1512 339 11806 14678 11239
NM_004857chr1494454 4363 3969 3269 3207 1900 1876 336 41 44748 3611 3518 1171 31289 1267 373 34738 4062 3118
NM_004859chr1753004 2680 2368 1105 217 11997 12770 22003 2000
NM_004866chr5114606 4592 3330 3112 2020 1709 1459 1203 846 577 521 44686 3687 1370 691 3811 297 176 14626
NM_004869chr1841388 1133 580 547 41354 1231 447 360 1538 11234
NM_004898chr4102710 2563 2193 2115 1877 1806 1017 502 488 342 --2491 334 --
NM_004904chr7126596 5903 5766 5617 4661 4149 4074 2605 2239 2059 1124 710 2824 548 21067 867 12635
NM_004921chr1102444 2352 2195 1710 1696 860 414 311 302 152 1817 ----
NM_004956chr7123923 3481 3266 3237 3197 2925 1096 1075 798 645 354 199 21655 114 34367 4182 1014 53632 3629 3626 3623 117
NM_004985chr12104540 4533 4031 3971 3858 3784 2975 1435 702 337 --74008 3809 3798 3787 3000 1399 796 14035
NM_004993chr1471235 1117 1107 969 228 172 132 --3478 404 175 2476 473
NM_004999chr6133452 3020 2768 1770 1742 1720 1432 1223 1022 899 852 620 432 33193 1650 386 11047 1635
NM_005028chr1042125 1879 631 521 1531 4554 551 536 533 --
NM_005054chr241689 1232 1189 415 1564 11755 3573 570 567
NM_005056chr12115278 4990 4857 4813 4310 4070 2073 1903 1664 1354 203 --24709 4696 13394
NM_005063chr10103876 3814 3803 3564 3162 1343 833 784 638 79 13453 --43456 2860 2648 1004
NM_005065chr14125401 4312 4108 3975 3916 3429 1775 1654 1563 1300 1153 286 11253 ----
NM_005151chr1862376 2176 1621 1543 944 765 1591 21833 677 3746 743 594
NM_005156chr9125388 4495 3816 3279 1602 1281 833 724 629 593 415 270 21212 803 33391 1214 745 --
NM_005160chr2286467 5713 5492 5402 4728 4142 1459 910 36683 1649 1057 46374 6053 5725 4279 12165
NM_005197chr1495785 5395 5058 4719 1882 1770 1347 970 404 25885 4651 25887 69 --
NM_005226chr932503 2446 1003 32641 2417 2072 --52647 2644 2081 2078 2075
NM_005235chr2187339 6938 6558 6264 6119 6099 6080 6028 5008 2921 2894 2866 2748 2513 2225 1714 1447 460 57211 5170 2235 1827 140 1621 --
NM_005296chrX2167 95 2928 323 --2275 84
NM_005339chr4124104 3881 3507 3062 2957 2868 2637 1524 1478 861 782 339 43973 2916 826 349 2231 114 11140
NM_005358chr1351702 638 605 387 297 11345 41567 1347 1219 300 --
NM_005359chr18126512 5992 5144 5017 4922 1564 1179 1015 992 933 461 361 24627 1590 24316 529 --
NM_005400chr283088 2890 2570 2269 2075 2017 784 216 12401 11947 12210
NM_005436chr10124141 3317 3172 3033 2711 1424 1385 1374 1248 677 633 451 11572 44015 3040 1574 429 --
NM_005497chr17125950 4570 4180 2135 2099 1434 885 693 492 476 411 63 45458 2353 1536 212 45460 5050 5003 4582 35007 4517 4514
NM_005502chr983271 2218 2134 2053 2009 648 369 357 22626 2406 32918 2768 2408 12916
NM_005504chr12196543 6000 5579 5571 5426 5260 4861 4534 4455 4312 4240 4183 4044 2338 2111 1852 740 274 209 75656 5585 5311 4906 2373 1890 316 36391 4809 4033 --
NM_005506chr482957 1808 1174 849 812 717 662 246 11900 22292 262 11913
NM_005509chr591833 1702 1584 1373 1341 1245 513 472 214 11663 --31357 443 226
NM_005541chr21980 1340 1360 4358 355 346 343
NM_005578chr395129 5046 4483 4227 3673 3283 1776 1525 678 35021 4237 1516 14562 11519
NM_005596chr9125598 4668 4615 3976 3952 1930 1448 1067 973 445 293 136 45911 4858 2254 236 --35219 5126 2549
NM_005603chr1852026 2019 1716 1552 123 11319 --2750 747
NM_005665chr194901 4442 3946 3828 3077 1958 1538 1409 74 24819 1151 14084 --
NM_005668chr594475 4377 3616 2941 1640 1634 1470 617 209 23430 1183 23454 1310 14273
NM_005738chr781932 1849 825 808 767 559 532 256 11596 --1568
NM_005746chr7102758 2558 1900 1889 1860 1729 1713 895 805 646 22009 1087 22020 2011 --
NM_005759chr2124691 4398 4123 3915 3537 3181 3118 3068 1235 1205 1192 36 2982 109 ----
NM_005798chr13125286 5248 4219 3215 3187 1751 1728 1674 1435 883 261 125 11912 ----
NM_005813chr2112375 2334 2269 2066 914 729 715 616 363 153 118 21654 181 12354 12447
NM_005840chrX147540 7047 6307 6146 6091 5719 5169 5089 4911 977 928 808 789 91 26919 6102 35487 2215 1124 26105 2225
NM_005843chr251956 1620 1303 1272 743 31896 1849 642 31898 1851 644 --
NM_005868chr772287 1852 1739 761 746 189 62 22401 786 42374 694 542 529 1457
NM_005901chr18148108 7960 7773 7454 6510 5848 5798 3329 2949 2354 1457 1117 899 288 33383 3002 799 31728 801 243 15551
NM_005903chr585240 5021 4865 4583 4463 4054 3210 888 23248 574 34676 4430 3766 13684
NM_005906chr631607 1489 279 41534 1426 1050 285 21536 1428 11540
NM_005909chr573629 3127 2982 1580 1544 1499 430 24216 3651 --33633 1584 1548
NM_005935chr4105322 5224 4966 4913 4885 3356 1975 1625 535 503 ----1587
NM_005941chr8164010 3994 3981 3774 3689 3585 3518 3405 3383 3160 3051 1210 1168 1072 996 685 14022 44122 4071 3997 854 21299 699
NM_005966chr282084 2037 1971 736 575 507 366 79 42175 1784 217 52 ----
NM_005999chr161420 1301 1247 1239 1211 1183 --1341 11389
NM_006007chr974508 3976 3445 3389 3196 1265 855 21474 263 21622 1154 23398 2780
NM_006036chr262195 1873 1656 456 214 87 --22087 625 11743
NM_006073chr6102248 2242 2183 2081 1815 1501 797 648 374 319 32004 1384 674 62153 1401 676 549 487 302 12151
NM_006080chr772962 2708 2180 1854 1118 1048 176 21091 504 22643 2437 --
NM_006095chr4104070 3941 3861 3490 3458 3351 3274 2953 1124 521 64418 4081 3212 2829 1396 385 23473 3124 --
NM_006154chr1571940 1035 1021 936 381 307 182 32243 2170 150 12248 12246
NM_006155chr251769 1610 1589 621 608 11578 11583 21957 1581
NM_006203chr595581 4956 4750 4474 1996 1952 1255 1128 523 --31545 1206 1182 --
NM_006206chr462621 2106 958 820 681 602 52958 2796 2035 580 263 52734 1848 1069 698 582 --
NM_006251chr593373 3206 2923 2848 2662 2503 2322 464 48 22497 2156 ----
NM_006252chr1176277 5554 4659 4595 2764 2599 2454 2057 1812 1692 1493 1326 846 840 271 237 211 87414 6614 6199 5873 5482 1298 672 80 22843 1300 16202
NM_006300chr1941988 801 633 560 --2787 61 21615 929
NM_006330chr851438 1264 535 494 337 2279 146 41469 1446 1429 479 1527
NM_006380chr17164407 4206 4116 3232 3125 3038 3002 2867 1086 1034 859 841 830 810 621 495 11142 74195 3719 3235 3155 1292 1281 991 21202 1145
NM_006393chr1094227 3761 3385 987 479 410 305 190 106 --23838 2908 13535
NM_006420chr2073330 3300 2885 2453 744 700 401 12313 53272 1194 872 855 634 --
NM_006434chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_006457chr4114086 3903 3775 3712 2908 2898 2565 1608 1088 331 316 41537 492 457 107 1109 24109 4106
NM_006482chr1273921 3520 3231 2951 2547 2474 1403 21349 267 11351 12459
NM_006520chrX61718 1454 1061 570 529 416 41483 493 335 72 51601 1461 495 165 74 1523
NM_006529chr471662 1237 1163 454 402 185 98 31719 1637 1073 21128 570 1314
NM_006544chr14156016 5891 5147 4991 4808 4751 4504 3896 2081 1130 743 732 619 496 445 15662 13956 25744 398
NM_006561chr1095796 5488 4710 2491 1731 1150 1143 842 555 25999 1916 1518 --
NM_006599chr16208196 7947 7860 7824 7488 7038 6913 6862 6011 5872 5580 5093 2495 2136 1505 1088 753 718 414 217 68071 7027 3114 745 443 355 26555 3257 13117
NM_006602chr203723 312 265 --3259 245 235 2257 243
NM_006609chr262624 942 850 652 634 399 --32897 2660 1027 42901 166 163 160
NM_006614chr363266 2506 2224 1040 1002 796 23212 2831 12769 12767
NM_006620chr6114776 4724 4565 3983 3315 3271 1242 1079 627 497 240 1285 44097 3944 1902 159 14327
NM_006682chr7122760 2633 2312 2261 2163 1904 1833 1136 656 318 106 40 1619 12614 22612 2609
NM_006722chr393042 2981 2899 2565 2065 1911 1170 846 62 --22955 89 12953
NM_006726chr431261 1255 240 1477 31264 479 132 --
NM_006731chr995584 4990 4773 3904 3518 1627 946 929 345 64181 1870 1858 1633 1501 1342 --11873
NM_006750chr16197787 7772 7642 7416 7394 6297 6164 6136 6084 5405 5384 5068 3034 2841 2824 2395 2299 955 261 25681 2893 17256 26746 5157
NM_006777chrX72954 2676 2621 2014 1832 1028 710 42519 2093 1948 919 32521 1133 143 --
NM_006851chr12102891 2850 2717 2629 2277 1967 1100 602 306 226 22023 675 32623 2401 2025 1678
NM_006868chr1843211 3140 2033 729 12128 12303 2966 953
NM_006873chr282604 2328 2167 1085 865 848 482 433 1571 33412 1071 573 --
NM_006902chr193339 3229 2046 1308 1027 957 756 551 170 22793 2337 22339 2111 --
NM_006915chrX122571 1628 1615 958 943 874 793 727 585 230 173 131 12048 32352 1013 337 22485 67
NM_006918chr11215503 5449 5141 4970 4859 4553 4335 4241 3871 3734 3694 2171 2110 1430 1199 909 757 577 153 106 68 35790 816 81 1475 2479 385
NM_006922chr292606 2380 2085 972 922 826 782 775 489 ----42447 2267 2264 2261
NM_006924chr17114064 4038 3332 3245 3096 2766 956 717 561 473 176 14303 23493 3342 13340
NM_006948chr21112218 2155 2118 2069 1983 1761 1510 800 672 619 296 1229 1420 --
NM_007006chr1662813 2214 1292 1174 995 901 22515 147 43283 2534 1068 193 --
NM_007007chr12104848 4800 4599 4487 4295 3975 3062 1701 510 417 --34588 610 368 11884
NM_007011chr1586181 5102 2727 2610 2194 1913 1349 1172 ----24713 4710
NM_007034chr16965 766 727 341 295 32 --1242 2856 779
NM_007038chr21186114 5263 5064 4649 4324 4138 4039 2246 2226 2071 1920 1819 1799 1454 1398 1229 1202 568 25678 1996 43959 3956 1998 1577 --
NM_007052chrX2448 54 1482 --2469 456
NM_007054chr583814 3363 3297 1296 1096 1089 1074 463 1138 23273 140 --
NM_007107chr382376 2201 2094 1485 842 614 602 359 ----1344
NM_007114chr383348 2644 2242 2035 783 729 589 397 22616 832 1752 1156
NM_007124chr662027 706 575 353 244 193 21890 1382 --11893
NM_007125chrY71390 1380 1196 1110 552 534 516 31246 205 127 1888 21458 1455
NM_007137chrX145563 5474 5423 4899 4756 1929 1915 1721 1601 1133 520 389 347 222 45347 3390 1194 419 23847 3392 15358
NM_007173chr1192203 2046 1599 1591 949 824 660 623 578 11987 --12075
NM_007220chrX64885 4032 1810 1772 1561 1132 23936 284 21623 1554 21621 99
NM_007249chr13229166 8977 7825 7792 7595 7543 7194 7182 7130 7123 7111 6691 5858 3351 3305 2645 2562 2108 1896 1846 1011 984 36565 6414 3718 29143 2000 --
NM_007347chr15123216 3209 3154 3144 2940 2751 1294 1263 1038 351 310 95 22095 1077 32565 404 254 --
NM_012096chr393782 3749 3372 2667 1299 1081 1019 863 515 1833 11427 11074
NM_012097chr241921 795 241 96 21547 533 --21550 536
NM_012120chr6122680 2538 2107 2060 1078 974 666 652 642 408 362 104 53018 2826 2190 2067 1947 21877 966 12200
NM_012141chr13153824 3696 3244 3208 3070 2982 2966 2869 2774 2530 1625 1606 588 564 549 13504 ----
NM_012164chr9207330 7255 7081 6850 6556 5904 5685 5626 5604 5152 5041 4896 2835 2610 2553 2175 1865 1346 1055 323 47574 6862 5340 940 47576 6754 4885 4761 --
NM_012214chr2136443 6330 6238 5996 5033 5026 4878 4814 1908 1247 1113 1090 791 24408 1173 25789 161 16255
NM_012238chr1071692 1342 1166 1160 1151 289 153 1632 ----
NM_012249chr2103506 3076 2566 2307 2289 1432 1416 1141 635 91 23318 3215 13320 1809
NM_012252chr7215270 5261 5218 4325 4266 3777 3499 3369 3341 2126 2032 2006 1917 1801 1742 1383 1050 902 519 334 179 63677 1933 1725 1596 1581 1567 65136 5102 4598 4200 3502 1953 --
NM_012262chr1155178 5007 4990 4708 4388 3961 3493 3482 3469 3270 1524 1167 1004 438 338 35274 1948 1306 24630 3284 11309
NM_012287chr3134532 4256 3938 3915 3803 3740 3471 3345 3053 2885 2849 1414 1219 11606 34053 3774 1829 --
NM_012382chr5173880 3594 1798 1659 1622 1549 1346 963 789 719 687 674 366 319 312 240 182 64455 4430 4088 3128 1215 631 33004 2818 1349 13083
NM_012420chr10102332 2245 2010 1643 695 685 663 533 323 117 1850 1492 --
NM_013227chr15------2856 853
NM_013231chr1484359 4295 3353 3251 1342 879 716 93 21112 423 21308 917 --
NM_013255chr7268884 8740 8005 7853 7136 6766 6740 6468 6151 5796 5786 5725 5714 5475 3218 3140 2932 2699 2431 2306 2251 2044 849 777 286 209 36731 6714 840 --1706
NM_013261chr483777 3552 3441 3363 3236 2692 1345 1009 22638 222 33412 3195 692 12641
NM_013269chr12154566 3827 3729 3556 3305 3179 1671 1475 1366 614 230 210 157 127 51 --1617 12998
NM_013322chr731382 1101 613 --11502 2652 75
NM_013372chr1593403 3368 3056 2721 2696 2545 2303 2209 1116 --13059 12471
NM_013381chr1262410 2300 1974 1581 1572 598 52396 2367 1839 1702 510 12127 11794
NM_013386chr171726 1599 1481 1453 1336 1317 448 11525 51329 1287 1141 244 29 --
NM_013989chr14175139 4861 4804 4503 3802 3205 3145 3105 2050 2022 1732 1360 968 631 605 349 215 24731 1586 11481 --
NM_014021chr1123419 3125 2941 2555 2334 2167 2132 1000 979 705 204 94 22525 2256 1990 62681 1184 1181 1178 1030 943
NM_014048chr1655190 4705 1760 864 715 44803 4619 1399 310 34621 4068 3320 24846 1402
NM_014057chr971622 1594 1464 1437 1013 609 161 21061 204 41472 1063 318 47 --
NM_014106chr1582023 1938 1188 1087 965 920 298 135 12402 --11117
NM_014112chr8195281 5087 5048 4669 4548 4472 3930 3849 3816 3645 3473 1954 1887 1651 1543 1521 1494 1272 281 25505 5135 45351 4867 1345 447 34865 4862 4850
NM_014155chr11116417 6395 6078 6043 5858 5444 5090 4802 1767 1742 1211 12932 25252 1957 --
NM_014331chr4157328 6077 5536 5218 4915 3000 2880 2549 2089 1994 1960 1261 1214 832 103 56856 6355 4829 1775 933 56114 4898 1782 974 935 --
NM_014365chr121847 ----6870 867 864 861 858 855
NM_014421chr492114 2018 1995 838 708 607 596 231 117 ------
NM_014423chr5175638 5169 5121 5110 4118 4108 3726 2068 2060 2041 1645 1191 710 290 256 232 108 34370 4068 1520 34270 1522 147 14071
NM_014584chr1461553 1032 1019 370 279 75 21098 206 1216 21168 325
NM_014635chr261667 1653 1452 1195 1152 379 1526 11733 2532 529
NM_014636chr953976 1753 1599 1548 1308 23944 1325 24324 3949 24322 3947
NM_014637chr871260 1152 1037 469 451 146 87 11129 1404 1953
NM_014701chr1573441 3320 3218 2772 2735 2568 248 --32338 1078 674 12576
NM_014702chr6123325 2769 2555 2402 2389 1021 889 823 685 603 475 153 21070 632 ----
NM_014721chr6136683 6425 6416 5802 4549 4535 2442 2278 2157 1811 1776 962 434 16271 ----
NM_014733chr592290 2063 1891 1629 659 498 343 332 143 --2751 335 --
NM_014739chr6134144 4096 3856 3710 3702 3682 3545 3476 3158 2906 2634 1171 977 53446 3299 1650 1240 164 24078 3685 11013
NM_014766chr753165 2880 2631 874 837 43776 3681 3044 2964 1696 13684
NM_014787chr141924 1725 362 151 11890 1589 31844 587 380
NM_014812chr161739 1621 1489 1394 1243 1225 --1273 2716 450
NM_014819chr582188 1734 676 643 631 396 285 75 --21573 997 --
NM_014829chr542252 1842 1569 481 22331 266 12157 21852 590
NM_014873chr1144864 4698 3560 3530 3483 3470 3417 3322 3312 3112 1931 1684 992 187 23328 3148 1713 2764 181
NM_014877chr1797792 7213 6690 6532 5877 4860 2044 850 822 67493 5897 5889 2863 2398 389 27809 5899 12132
NM_014898chr1982157 1709 1702 982 510 504 447 149 22352 464 ----
NM_014900chr251167 908 470 278 251 2944 901 1181 1947
NM_014906chr17104127 3980 3856 3683 3409 3390 3315 1618 1034 541 12797 23775 2555 --
NM_014920chr683765 3697 3100 3055 1404 1378 921 308 42820 2746 2600 353 --1384
NM_014936chr6122872 2743 2466 2330 2223 1128 625 381 208 196 176 68 42211 1934 1833 1748 21982 1814 --
NM_014946chr282646 2502 2063 1255 1159 973 672 548 43134 1935 410 305 52580 2077 1012 412 307 12506
NM_014950chr14101767 1631 1553 1512 708 584 561 515 410 52 11536 21642 1257 21539 1186
NM_014953chr1394370 4273 4018 3749 3605 1444 839 638 213 --3895 892 118 --
NM_014982chr1485154 3585 1897 1733 1365 818 545 374 25003 4123 43792 3789 3302 1116 11493
NM_014988chr4102827 2660 2539 2532 2369 2343 2217 2192 1033 334 --31957 1910 244 1547
NM_015000chr12112779 2473 2428 2364 2232 2155 2098 2054 1968 637 442 --11945 --
NM_015026chr12194397 4372 4225 4015 3720 3543 3458 1805 1600 1493 1462 1395 759 533 508 237 214 150 96 24778 3237 2565 323 --
NM_015032chr1392888 2644 2413 2338 1864 1852 772 640 399 --32503 2341 866 --
NM_015045chr1052254 2209 1961 786 497 21898 1646 21447 525 1611
NM_015049chr2123314 3155 2832 2726 2542 2522 2257 2248 2062 1022 679 475 1304 12486 --
NM_015068chr7123833 3796 3767 3746 3514 2836 2603 1304 1147 279 273 231 33552 3464 3106 13739 --
NM_015076chr6114091 3931 3692 3650 3140 1232 883 747 581 366 245 13882 31716 1703 1263 --
NM_015110chr962524 2239 1846 840 183 156 --2470 142 1468
NM_015137chr81107 22494 572 1110 32497 1869 537
NM_015156chr1454053 3538 3390 2530 1285 33940 3851 2673 23835 2675 1492
NM_015186chr91148 1423 --3491 488 426
NM_015192chr20122740 2639 2534 2141 1951 1867 1207 836 818 800 382 297 22388 991 12956 22404 2117
NM_015206chr1583762 3545 3202 2952 2832 1488 1325 1031 22904 1042 12398 42472 1431 1053 1050
NM_015208chr18123741 3354 2615 2584 1327 1113 1047 515 410 201 136 108 23442 323 23444 2773 --
NM_015247chr16124724 4337 4187 3659 3289 1927 1720 1644 1073 565 433 181 14298 1816 1814
NM_015271chr494336 3927 3796 3589 3312 2826 1095 750 550 11101 23437 1003 --
NM_015310chr8208363 8346 8129 8043 7854 7719 7666 7124 6905 6146 5853 5723 5080 2810 2629 2331 1791 1348 768 407 16059 21996 121 26062 1492
NM_015313chr1194611 4602 4177 3846 3625 3136 3077 1539 738 34553 3032 1384 13742 13498
NM_015336chr12142639 2373 2206 1922 1643 954 939 874 698 644 635 554 221 213 1892 2894 674 --
NM_015347chr1282591 2256 2240 2119 1186 1021 651 169 --1236 12886
NM_015352chr2043841 3228 2683 2659 23971 3586 23341 1096 23592 3589
NM_015355chr17102003 1914 1883 1551 1539 1413 1305 800 716 125 22026 1776 --11779
NM_015385chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_015387chr271975 1715 1613 1411 1356 572 245 11865 12012 1562
NM_015394chr12122430 2241 2098 2066 2034 1801 1719 1594 884 788 626 223 31735 405 374 1699 12202
NM_015436chr4103362 3346 3189 2306 1199 1152 695 516 506 261 1672 13282 --
NM_015446chr181560 1203 1082 1052 576 315 87 51 11195 11098 11346
NM_015455chr583417 3321 2580 2570 1305 515 135 107 13144 --13147
NM_015458chr8155352 5325 4633 4547 4508 4482 4364 4238 3677 3613 3604 3361 1308 530 158 --15130 14877
NM_015550chr752938 2398 1401 1015 245 43187 3041 1263 1197 23189 1394 12693
NM_015560chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_015565chr2152129 1687 1609 383 347 32215 2093 766 31544 768 148 22218 500
NM_015569chr1144513 4036 3388 3362 3132 3060 1872 1862 1819 1041 1020 426 62 35 --11248 13341
NM_015571chr6142564 2545 2498 2437 1802 1793 1691 1654 922 815 570 319 184 133 22665 454 12062 1261
NM_015640chr1125049 4992 4818 4765 4369 4307 3417 3392 2125 1383 1330 1279 13359 23384 1644 13438
NM_015713chr8103613 3268 2492 2213 1382 1188 745 514 489 479 32662 357 48 12664 32954 465 360
NM_015852chr7143645 3639 3357 3013 2995 2833 2714 2665 2492 2360 1451 1328 785 365 --13039 --
NM_015878chr892147 2134 1547 1490 893 487 198 182 77 11958 1719 2848 129
NM_015879chr18138064 8023 6916 5995 5539 5521 2938 2692 2391 2377 1789 1469 215 1852 28067 544 1289
NM_015886chr8105282 4757 3813 3573 2247 1954 1814 818 767 638 42193 899 569 531 74541 4053 756 571 533 242 31 44480 4322 2281 425
NM_015888chr1173377 3344 3210 3076 2963 2877 2860 2706 2650 2377 2335 2239 1327 842 736 327 217 2600 359 33366 2935 913 --
NM_015906chr1164745 4691 4618 4243 3811 3704 3669 3239 3135 3101 1899 1142 984 377 245 164 23246 2976 13564 --
NM_016009chr184933 1518 984 934 850 667 544 245 34148 1447 385 14680 11877
NM_016018chr8112722 2661 2292 2167 2115 2014 1857 971 647 363 82 --198 --
NM_016019chr741023 846 724 237 1787 --2793 790
NM_016040chr182804 2714 2124 1920 943 900 249 167 1530 2859 446 1825
NM_016072chr1242002 1943 1649 844 41843 1703 1662 823 41985 1817 962 244 --
NM_016121chr171181 1051 988 294 161 148 21 1720 2832 722 --
NM_016132chr1583460 3027 2556 804 715 595 243 54 33008 1239 76 52926 2128 1080 938 620 2645 556
NM_016144chr54702 694 520 217 1498 4648 645 603 592 1601
NM_016206chr3178952 7908 7339 6945 6377 6338 6210 6169 5698 5610 5546 3472 3000 1730 897 814 745 46917 6312 1624 764 58801 8798 5748 5745 1182 11928
NM_016217chr693603 3587 3408 2860 2739 1063 1021 893 691 23681 596 32778 1287 453 122
NM_016218chr53935 238 115 11235 11245 21243 872
NM_016220chr7102351 2270 2007 1907 1879 1763 823 812 736 368 1786 ----
NM_016260chr2127294 6792 6320 6193 5318 4893 4642 2232 1743 1701 829 519 35837 2190 769 57055 6472 6151 2192 131 16103
NM_016271chr1882102 1624 1593 1513 466 173 108 101 --2681 576 --
NM_016275chr3112570 2558 2518 2397 2126 2054 1864 1112 874 839 689 22172 219 1984 12175
NM_016281chr1221150 1065 1398 --2404 401
NM_016297chr283007 2987 2569 1092 1076 368 124 117 --2727 612 21102 259
NM_016356chr6122920 2793 2345 2276 2192 2085 1111 868 746 392 350 182 22307 794 12075 --
NM_016472chr1451109 1061 605 545 156 21492 347 3535 434 159 --
NM_016513chr683765 3697 3100 3055 1404 1378 921 308 42820 2746 2600 353 --1384
NM_016530chr15104148 3746 3582 3528 3160 3114 2785 1092 1063 661 1781 24119 1495 --
NM_016531chr4123761 3664 3523 3496 3394 3261 3154 2734 1504 1405 972 282 --12673 1428
NM_016559chr311060 11043 21106 27 21514 1511
NM_016603chr572246 1768 1490 1443 827 589 153 22173 1901 --11513
NM_016626chr1871778 1677 1490 1383 1201 292 140 21554 1231 188 1547
NM_016831chr152133 2114 1813 811 786 --1789 22361 1724
NM_016953chr296142 5677 5233 4847 4215 4204 4142 1069 236 25390 5050 25519 5052 --
NM_017420chr14113816 3372 3348 3341 2974 1547 1017 866 828 670 574 33420 1128 386 43073 2836 1423 831 --
NM_017447chr2174353 4016 3546 3459 2779 660 345 12756 11231 13879
NM_017628chr4145174 5063 5050 4808 4783 4585 4096 3744 3657 1362 1278 720 368 133 85270 3878 3521 3212 1932 1603 1469 411 34184 3880 413 14330
NM_017633chr683610 3504 1548 1193 1111 543 168 119 21467 1244 23222 874 1466
NM_017637chr9198422 8177 8086 7742 7442 7300 7009 6499 5965 5934 5849 3759 3732 2992 2566 1910 1756 852 357 11232 47553 6078 3510 2417 12415
NM_017644chr3165173 4603 4386 4293 4041 4000 3260 3182 1987 1831 1684 1171 808 546 535 165 52032 1945 1813 118 109 1120 --
NM_017650chr795851 5775 5761 5453 5060 2011 1961 1611 194 198 22398 1866 --
NM_017658chr14143857 3656 3642 3467 3197 3179 3015 1592 1448 1361 1132 597 367 197 21324 25 34332 3347 1326 --
NM_017661chr1541161 1109 475 439 21127 176 2840 237 2322 235
NM_017762chr1562511 2362 984 634 398 91 2598 111 31915 1877 113 --
NM_017769chr1493012 2983 2871 2103 2088 947 308 117 49 11063 33041 1212 210 --
NM_017779chr192493 1886 1781 1729 454 379 142 97 44 1758 12539 11850
NM_017831chr1894772 4709 4297 3919 3903 3832 3354 463 86 23176 307 34717 4147 478 --
NM_017847chr162238 2177 2142 862 458 281 32191 673 61 1675 1711
NM_017848chrX104692 4673 4336 4062 4055 1782 803 407 294 266 14438 --1381
NM_017919chr9145320 5288 4984 4760 4581 4288 4274 3658 1798 1537 1190 799 298 139 24027 3675 25342 553 11711
NM_017954chr751367 1237 1148 670 344 --41693 1093 1071 1064 11081
NM_017994chr7112374 2230 2091 1892 1838 1827 946 931 616 501 192 1512 2934 493 --
NM_018003chr15112465 2315 2216 2196 891 823 739 663 556 331 279 1989 1901 1743
NM_018084chr2113150 2515 2492 2261 2201 1327 1228 1017 909 760 639 33111 2772 2357 22774 980 --
NM_018085chr1147648 6466 6071 5009 3256 3206 3079 2530 2366 2156 1535 1050 981 895 ------
NM_018133chr392111 1890 1677 1396 1341 837 826 170 159 12216 32004 1875 806 --
NM_018155chr3123325 3095 3057 3021 2940 2813 2357 2337 1180 930 679 97 1959 42995 961 658 151 --
NM_018227chr493001 2718 2639 2397 2263 1226 1111 1013 427 11154 33148 2128 2057 22884 2055
NM_018247chr693069 2797 2516 2473 2353 2326 1212 1166 413 22443 469 --12446
NM_018254chr162363 2326 1703 764 744 87 --12329 12095
NM_018299chr853290 3136 2298 581 406 33210 2176 751 13212 22530 1354
NM_018312chr114724 668 323 244 11765 --3295 289 286
NM_018323chr471885 1661 1466 1283 433 423 417 31827 688 556 11526 165
NM_018330chr1051750 1559 1507 1299 1291 21642 1400 21562 1408 11406
NM_018362chr11113693 3596 2929 2915 2873 2825 2552 1489 1358 999 85 23110 943 33720 3057 2619 --
NM_018364chr1154126 4004 3973 3407 3338 3212 2836 2783 2772 2502 944 906 811 753 668 22908 856 33793 861 213 32911 1208 859
NM_018373chr14136471 6362 6097 6064 5955 5350 5057 4820 4770 1628 1072 862 601 26431 714 46433 5245 542 392 --
NM_018374chr7155155 5005 4962 4915 4351 3963 3832 3768 3609 1081 767 603 343 291 79 35011 3328 3291 13745 1181
NM_018403chr364122 3552 1523 1362 931 594 11195 43306 1307 1197 166 11159
NM_018409chr493142 2783 2445 2358 2070 779 739 647 344 32308 2257 435 32259 1177 437 12895
NM_018438chr11162 1463 --3472 469 466
NM_018440chr8148716 8611 8491 8241 8194 6124 5296 3303 3200 2417 2186 1750 1348 1155 28295 7809 28367 1814 18245
NM_018452chr6_random123436 3412 3237 1244 1112 945 671 629 364 333 322 272 33506 372 224 33626 674 226 --
NM_018566chr154761 4234 3664 1118 649 55006 4706 3203 1200 1017 33808 3205 1019 --
NM_018638chr12185609 5551 5242 4874 4700 4414 4173 4156 3626 1989 1578 1188 1059 868 742 512 398 168 15073 45354 5075 3763 265 --
NM_018640chr1282834 2778 2440 1730 1001 923 466 212 11836 --1496
NM_018695chr592478 2453 2119 1918 687 639 334 139 133 --11795 --
NM_018841chr1103710 3588 3163 3104 3010 1547 789 660 128 102 1748 33656 3018 2555 22553 2504
NM_018844chr771678 654 640 561 417 364 346 41643 1605 377 42 42062 579 246 44 2686 380
NM_018945chr663719 3298 3206 3141 1459 1186 1513 12446 2496 493
NM_018947chr774726 4394 3081 1633 1264 851 74 21696 645 2923 264 1197
NM_018970chr7133069 2886 2618 2437 2266 2200 2148 993 651 394 362 266 146 22757 1939 42825 2759 2582 798 12207
NM_018976chr12122722 2699 2224 1797 897 846 658 651 635 608 579 543 --12368 --
NM_018979chr1242626 2093 1989 272 21669 1653 12260 22404 2258
NM_018999chr10104947 4651 3827 3468 3422 3152 1689 779 499 438 24820 4769 11164 --
NM_019001chr3134897 3960 3202 3059 1702 1588 1060 831 774 743 639 406 241 54472 4025 375 273 104 44239 4027 734 477 --
NM_019022chr18123232 3113 2993 2436 2363 2161 1955 841 628 508 470 369 ------
NM_019069chr3112673 2635 2433 2344 2298 2146 2100 2085 741 711 317 1300 --12158
NM_019072chr574300 3434 1278 504 310 225 123 23261 1320 54303 1254 1047 981 518 1729
NM_019083chr1111573 1434 1426 1406 1370 1282 665 539 522 193 142 21290 98 --21396 1393
NM_019094chr12103856 3359 2898 2837 2792 2489 2463 729 190 173 23824 657 --13295
NM_019117chrX93501 3245 3189 741 566 467 453 293 39 21115 493 1103 33494 3396 230
NM_019596chr2192988 2297 2279 2133 2093 1975 1875 779 382 22810 766 22351 2267 42217 1866 772 769
NM_020177chr5153382 3328 3099 2870 2819 2543 2495 2430 2334 2116 2092 1097 1007 984 76 --23053 2595 --
NM_020337chr4113014 2757 2704 2617 2605 2593 2459 912 581 324 280 1160 11158 --
NM_020346chr1131735 1398 1155 ----21462 684
NM_020347chr331697 502 334 22322 395 22324 885 11788
NM_020390chr3124930 4798 4567 4154 3430 3367 3026 3005 1941 1805 1474 323 34851 3628 878 1159 24664 881
NM_020394chr1111620 1594 1536 1471 1353 1294 1178 524 458 316 103 11492 11503 --
NM_020432chr771416 877 636 600 591 579 288 12056 11624 1652
NM_020443chr1136853 6280 6207 5610 5383 4974 4946 4620 4500 4422 4355 368 249 ----14415
NM_020466chr6195026 4557 4430 4340 4314 4105 3994 3816 3683 3522 3463 3179 3120 1938 1832 1771 1568 1428 1341 21712 646 --1649
NM_020647chr852329 2200 1980 1652 1414 11922 1270 21925 268
NM_020648chr1892880 2629 2510 2429 2325 2001 768 496 33 140 11902 --
NM_020673chr20177783 7137 7093 6735 6690 5761 4803 2932 2644 1752 1592 1509 1386 1246 1148 944 522 37686 598 170 35021 5018 2677 --
NM_020704chr7112536 2506 2351 2141 1935 1917 1840 1789 1767 718 163 --1961 --
NM_020711chr291744 1642 961 892 634 366 253 176 140 ----12496
NM_020718chr1685983 5843 2455 2253 2220 2146 316 250 26358 5743 14648 15987
NM_020727chr21114029 3376 3348 3249 3241 3012 2970 1516 657 525 505 52778 1436 663 605 100 2161 150 --
NM_020748chr1792057 1993 1729 1562 1510 1359 693 595 66 31754 515 465 1520 1518
NM_020772chr17208264 7501 7358 6848 6289 6119 5950 3442 3341 3181 2765 1509 1390 1382 1217 1172 709 467 317 192 58329 6987 6700 1096 127 16492 27464 5910
NM_020774chr18175938 5804 5485 5464 5442 5404 4995 3904 2111 2043 1724 1422 1403 600 396 236 56 35297 2259 712 44877 4874 4109 714 14113
NM_020782chr1294678 4539 4220 3147 3071 1803 1678 677 323 11795 34662 4280 558 --
NM_020787chr1751171 1116 1055 999 195 --21433 415 1149
NM_020809chr1192195 2027 1971 1952 1629 479 430 142 61 --12266 252 49
NM_020810chr1493638 3579 3033 2399 1419 1399 515 275 69 1388 22377 483 12388
NM_020841chr12113219 3174 2548 1606 1454 1379 1356 1130 1060 464 265 52926 2482 1510 1427 473 34031 2484 876 --
NM_020844chr8207711 7400 7378 7300 6509 6210 6170 5598 5590 5160 4960 4875 3041 2740 2717 1894 1755 1598 394 357 65429 4884 1692 1322 947 438 67346 5858 2804 1758 1734 1155 77647 962 959 956 953 950 623
NM_020859chr4114009 3782 3287 2800 2739 2470 1428 865 596 407 252 23689 1084 34000 2760 970 --
NM_020871chrX122452 2316 2281 2269 2235 1742 962 648 354 216 203 96 1698 42425 1606 313 251 --
NM_020921chr14103681 3634 3544 3347 3253 2682 2403 1415 1040 235 23237 2648 32973 1189 456 --
NM_020935chr2124265 4017 3737 3361 3281 2904 1847 1782 1370 568 529 380 1918 --12853
NM_020948chr1143247 3200 3155 3059 2842 2703 2351 2319 1424 1331 962 838 609 216 12632 42685 2472 1297 862 12383
NM_021007chr242466 2294 1911 909 21810 197 21812 345 2343 340
NM_021038chr363395 2360 1180 1133 904 542 22135 527 33128 2334 1222 12490
NM_021148chr782452 2172 1897 765 543 442 202 62 --31786 1620 680 --
NM_021163chr783453 3270 1506 1431 1371 808 657 41 21179 649 53696 2890 1498 1184 1181 --
NM_021191chr1282503 2251 2027 1009 761 748 510 117 31913 1633 483 22327 2229 2792 589
NM_021255chr1483940 3705 3129 3105 2529 1184 1135 884 21556 982 32807 1247 246 --
NM_021629chr3124891 4678 4582 4521 4398 4206 3805 3750 3730 712 698 628 21607 426 24088 1272 23922 1363
NM_021647chr4114758 4420 4165 4010 3587 3334 3004 1614 1606 1141 1094 --44318 4315 756 244 --
NM_021815chr2133074 3020 2898 2691 2393 1995 1055 1008 930 831 774 310 47 23107 2411 ----
NM_021911chr5205503 5253 5142 4987 4805 4699 4441 4433 4424 4184 4111 4094 4071 2231 1827 1677 1462 1114 297 174 63800 3667 3585 1785 1439 1302 25595 483 24614 4611
NM_021914chr1472346 2299 2271 1916 1707 1597 521 169 22232 2094 12230
NM_021950chr1162242 2055 2019 1564 870 461 32163 2147 759 21794 761 --
NM_021961chr1177432 7309 5053 5046 968 813 644 15449 --26784 4667
NM_021964chr3166574 6461 5983 5778 5766 4979 4276 1809 1434 1390 1191 1118 807 313 141 110 65015 1876 1369 596 529 25 25110 341 16522
NM_021999chr135818 692 678 340 209 1231 --2549 234
NM_022049chr141738 1565 1403 607 11260 31584 1574 736 --
NM_022058chr272027 1935 1771 1752 1587 600 151 --51349 1308 745 566 445 --
NM_022091chr692785 2680 1863 1721 1703 643 595 490 478 1526 42573 2516 328 200 --
NM_022456chr12107570 7547 6029 5845 5562 5059 1581 1556 875 599 37613 7251 345 37194 1803 347 22399 1790
NM_022459chr13125809 5189 4982 4775 4673 4067 2109 1867 1200 1133 938 522 12260 16047 16359
NM_022484chr771293 1145 928 318 185 143 28 --1358 1356
NM_022497chr393808 3712 3260 3235 2989 2750 2431 1532 231 ----13194
NM_022658chr121889 1845 11261 41367 1259 851 848
NM_022745chr172711 2012 885 841 349 111 97 22378 386 1200 12381
NM_022824chr541971 1776 1335 1290 --11579 21912 1909
NM_022977chrX52417 2358 942 860 598 2528 503 --2657 506
NM_023016chr2102578 2418 1017 967 740 552 425 353 299 45 12425 11037 --
NM_024007chr551255 1096 1014 59 30 12453 22458 2455 22472 2469
NM_024345chr9135942 5777 5548 4985 4575 4536 4125 4048 3999 2106 1465 867 554 45770 5588 5204 1907 25590 4022 21913 1910
NM_024416chr971622 1594 1464 1437 1013 609 161 21061 204 41472 1063 318 47 --
NM_024423chr18124265 4214 3760 3567 3416 3359 3308 3091 1201 968 215 166 43631 3282 1645 272 --23996 492
NM_024524chr3103236 3186 3009 2570 2510 2409 2398 2027 1000 431 33085 2757 927 22243 929 12413
NM_024639chr642192 1163 885 645 12452 22624 994 22248 2214
NM_024641chr693024 2702 2483 2265 2259 1968 509 457 425 21022 146 32599 1842 23 11191
NM_024646chr1103798 3643 3594 3561 3457 2730 1473 1200 1098 1081 11222 43440 3032 1111 131 13489
NM_024665chr3164599 3668 3533 3463 3448 3405 3266 3135 3117 1755 1666 1599 1548 1514 1285 823 --11402 --
NM_024713chr1571642 1369 1217 631 564 154 142 --31527 1493 1303 --
NM_024744chr292130 1854 920 894 840 658 293 231 92 42320 2110 815 274 12139 --
NM_024770chr2116611 6021 5806 5274 5222 4135 2573 1304 1132 368 301 26176 2356 16181 16179
NM_024834chr1052009 1410 1338 693 25 --4278 237 234 218 1641
NM_024884chr1464425 3575 3518 3044 1242 137 32945 317 154 2328 156 43367 326 323 320
NM_024930chr582814 2572 2419 2305 745 614 542 384 1983 2570 181 1568
NM_024947chr3339154 8901 8776 8462 8029 7789 6956 6867 6716 6636 6354 6339 6328 6038 6000 5908 3483 3437 3338 2769 2349 2254 2128 2024 1211 1084 1004 904 443 340 288 190 22 29590 7765 62741 2257 1851 1568 348 164 --
NM_024949chr494696 4680 4445 3705 3611 3504 3492 3406 1090 13524 24784 3391 --
NM_024989chr2258109 7878 7870 7764 7670 7456 7441 7394 7242 7223 7126 6431 6358 6234 5809 5796 5596 5291 5277 4942 3054 2608 281 53 29 36789 2637 1705 68187 8156 7236 5772 5769 209 13156
NM_024991chr10103263 3217 2776 2698 2566 2418 2231 2132 1060 924 ----12518
NM_025054chr863917 3297 3173 3037 2626 799 34227 4175 4146 34177 3883 3694 33734 3460 3457
NM_025073chr1134771 4521 4422 4279 4214 3629 3063 3003 1683 1675 1424 1206 1034 31890 1387 446 1924 --
NM_025134chr1672116 1732 848 829 750 424 409 41788 1691 1024 1010 31768 1012 55 --
NM_025146chr382294 2201 2023 857 663 570 297 181 11060 12334 12332
NM_025152chr1471582 1544 1361 779 685 551 505 41256 603 354 91 1344 --
NM_025208chr1132337 2300 635 --21887 224 2664 222
NM_030621chr14144160 4038 3848 3763 3641 3010 2857 975 897 585 567 455 301 135 --24230 275 13256
NM_030625chr1042260 2171 847 839 31663 655 129 2579 131 1135
NM_030627chr5104086 3495 3099 2900 2691 2512 1442 1359 858 131 21554 703 13302 1364
NM_030648chr485556 5446 5426 4988 2128 1862 528 304 14995 35092 3965 908 --
NM_030660chr1471235 1117 1107 969 228 172 132 --3478 404 175 2476 473
NM_030664chr10102413 2046 1884 894 766 747 605 435 256 103 2541 441 22330 1593 --
NM_030755chr14112946 2737 2262 2172 2009 1948 1931 741 533 210 39 22017 1108 22142 711 1270
NM_030774chr1151372 1218 485 177 42 2166 118 2991 313 1989
NM_030791chr1441719 1152 115 23 3389 339 212 1714 21371 392
NM_030806chr1139452 9067 7768 6331 5726 3765 2708 2599 2230 1625 1242 637 160 16120 29331 859 16123
NM_030816chr1113546 2724 2711 2642 2423 1142 888 543 519 245 159 33280 3142 132 33584 2714 230 --
NM_030885chr382358 2242 2056 1567 653 625 583 415 --1270 1587
NM_030912chr101945 3746 710 685 --4728 725 716 713
NM_030935chr71122 1409 1417 2415 412
NM_031216chr1842008 585 569 417 ----2598 595
NM_031296chr4102735 2719 2662 2574 2081 2061 1879 1857 1753 387 32473 2262 1908 21910 1728 1357
NM_031418chr1172771 2668 2103 1091 1084 50 30 1669 --22107 2029
NM_031435chr12153476 2580 2162 1380 978 882 812 762 707 660 563 300 230 92 58 33269 2560 306 --1679
NM_031453chr1052606 2367 1695 431 228 --11023 32098 1021 663
NM_031461chr8141590 1539 1431 795 684 639 568 488 474 464 390 327 191 142 42127 2063 1676 1457 ----
NM_031469chr663563 996 669 529 282 159 44129 3934 3765 1091 23939 572 23937 2745
NM_031844chr1133860 3683 3609 3265 3164 3124 3090 3040 2627 1493 1289 911 398 --12937 23715 3712
NM_031845chr283125 2759 2450 1337 657 597 546 109 43107 1313 164 28 43580 2849 1280 131 131
NM_031847chr283125 2759 2450 1337 657 597 546 109 43107 1313 164 28 43580 2849 1280 131 131
NM_031935chr11902 ----3666 663 660
NM_031942chr221264 478 2943 374 --21225 377
NM_032012chr964785 4462 4138 4004 3468 741 23608 542 44914 4636 1830 1793 --
NM_032105chr1127580 6405 5444 5313 5086 1922 1621 1420 1401 1336 1158 732 38067 2667 2470 --38070 2476 2473
NM_032116chr13145888 4845 4251 3575 2013 1931 1866 1418 1391 1305 1142 471 166 41 24723 1446 34705 4214 2024 14816
NM_032160chr1884346 3250 3065 2893 2775 1717 1414 1214 11683 33467 2987 1616 43465 2985 2912 35
NM_032228chr1193353 3108 2531 2509 1380 1087 1075 650 610 63043 2701 1225 534 411 340 11284 33120 1255 994
NM_032246chr1541325 1307 1200 328 2398 280 2400 302 1306
NM_032373chr10165654 4971 4888 4853 4844 4815 4485 2163 1943 1539 1105 871 755 748 503 341 --45073 2194 1139 429 --
NM_032435chr1122408 2297 2222 2132 1995 1524 1505 600 519 506 345 125 1637 ----
NM_032439chr1091524 1430 1215 1197 622 549 540 331 204 21355 1236 11357 --
NM_032446chr5123821 3445 3217 3175 2984 2965 1332 1240 1182 887 841 813 31326 663 520 23085 881 1943
NM_032457chr483566 3452 3143 2830 2789 2512 2470 1062 33537 2795 1132 --13604
NM_032466chr871685 1627 1431 1379 1343 1094 1076 21365 1357 2391 334 --
NM_032468chr871685 1627 1431 1379 1343 1094 1076 21365 1357 2391 334 --
NM_032491chr1231271 333 139 --31244 1070 42 6936 56 53 50 40 37
NM_032634chr91388 1395 --1398
NM_032804chr10112593 2546 2502 2492 2302 2046 1968 1910 857 559 291 22582 2557 --12118
NM_032839chr31520 --1174 3456 194 172
NM_032859chr13133856 2969 2729 2719 2647 2631 2555 1508 1497 1331 857 258 151 23514 50 13292 --
NM_032869chr861824 1706 1602 1521 1291 132 21672 389 21759 391 22066 1447
NM_032873chr11104568 3970 3677 3588 2912 1588 1538 1098 1075 108 14040 23278 1156 14043
NM_032968chrX74273 3859 3171 3157 1128 617 156 23235 2925 1779 13238
NM_032969chrX74273 3859 3171 3157 1128 617 156 23235 2925 1779 13238
NM_032973chrY84265 3851 3166 3152 1128 617 429 156 23230 2920 1779 13233
NM_033014chr971622 1594 1464 1437 1013 609 161 21061 204 41472 1063 318 47 --
NM_033020chr1164745 4691 4618 4243 3811 3704 3669 3239 3135 3101 1899 1142 984 377 245 164 23246 2976 13564 --
NM_033114chr126893 656 274 252 70 44 123 1726 1929
NM_033132chr1382337 2315 2111 2063 1974 1813 1547 22 133 ----
NM_033135chr1132337 2300 635 --21887 224 2664 222
NM_033211chr571995 1659 1391 681 582 559 283 12018 21751 428 12096
NM_033224chr7237310 6520 5999 5935 5501 4940 3212 3161 3099 3057 2811 2242 2234 2164 2110 1867 1517 1290 770 577 377 308 152 57050 5660 2723 2092 1820 15504 --
NM_033290chrX93629 3570 3174 3145 2829 1104 759 654 94 --42330 907 867 194 --
NM_033360chr12104661 4654 4152 4092 3979 3905 3096 1556 823 458 --74129 3930 3919 3908 3121 1520 917 14156
NM_033505chr2206766 6751 6691 6596 6512 5597 5364 5127 4250 2484 2113 1951 1892 1646 1100 805 641 477 401 354 45300 2643 549 132 36736 4273 2645 45481 5303 4232 2690
NM_033656chr21165933 5795 5704 5613 5412 4810 4337 4295 2411 2317 2305 2163 2081 1795 1169 904 45098 3985 3809 1211 21815 690 --
NM_052811chr13125286 5248 4219 3215 3187 1751 1728 1674 1435 883 261 125 11912 ----
NM_052832chr8113044 2717 2683 2615 2439 1954 1031 563 398 190 136 --22812 877 --
NM_052867chr1331131 996 214 2500 240 152 1228
NM_052879chr12113265 2964 2928 2613 2556 1546 1306 1142 1119 1083 577 33250 3021 2746 33302 3184 2889 21627 1523
NM_052885chr12204991 4971 4576 4391 4258 4113 3917 3568 3302 1951 1837 1587 1324 1078 1071 1043 1000 839 706 263 44299 3357 3064 3057 1226 --
NM_052904chr631083 1011 328 1531 21255 1178 1534
NM_052932chr11112470 2372 2356 1890 1685 1661 1558 1537 772 308 242 2601 102 32416 739 71 --
NM_052937chr8102684 2637 2601 2551 2339 2254 541 421 347 150 --133 --
NM_053016chr9168023 6445 6079 5132 5076 2911 2549 2500 2409 2353 2325 1790 1777 1458 1402 1378 46067 5469 2974 1415 66360 2948 2503 2458 2172 1422 16351
NM_053043chr766423 6317 2411 2125 1306 1239 --35453 5017 400 11243
NM_053064chr1493090 2916 2607 2564 2557 2469 2008 575 406 1766 1941 12739
NM_058170chr161454 1385 1305 1263 1016 48 31460 631 483 21537 289 11292
NM_080743chr652600 1809 1685 1637 155 32097 1939 1910 --42100 1913 647 330
NM_080867chr14174781 4506 3351 3334 3163 3123 1991 1945 1609 1597 1292 1110 862 817 555 381 137 33315 1345 27 11620 2821 30
NM_130386chr183666 587 576 ----2447 444
NM_130391chr9103610 3157 3054 2940 2574 2505 826 816 449 206 13370 1189 13058
NM_130392chr9103610 3157 3054 2940 2574 2505 826 816 449 206 13370 1189 13058
NM_130393chr9103610 3157 3054 2940 2574 2505 826 816 449 206 13370 1189 13058
NM_130809chr552782 2587 730 562 86 31113 1080 548 42893 2731 2717 1115 13002
NM_130831chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_130832chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_130833chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_130834chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_130835chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_130836chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_130837chr3102907 2742 2653 2070 1893 1830 1142 934 822 132 22453 241 32570 759 511 --
NM_133329chr291910 1899 1329 1287 1203 1179 681 265 200 2741 544 11684 11633
NM_133334chr485641 5126 2248 1996 939 899 215 121 31670 1029 1005 21007 99 11020
NM_133370chr4103686 3382 1444 1239 1011 913 833 414 350 78 12718 32777 2720 984 --
NM_133473chr1991954 1907 1744 1313 746 573 490 407 229 ----11766
NM_133646chr253517 843 495 311 21 85272 5199 3729 3490 1996 1861 1814 1150 63492 1606 1246 1085 516 421 --
NM_138270chrX72623 2208 2188 1050 742 347 97 --12346 1273
NM_138286chr19174365 3526 3055 2918 2762 1604 1598 1575 1454 1423 1287 807 622 606 475 239 61 34394 3729 3694 11624 --
NM_138292chr11133582 3492 3411 3174 3151 3040 2900 2391 1415 735 593 569 214 23220 2478 1954 12481
NM_138333chr982334 2158 2072 652 568 368 136 47 11675 21677 667 2665 198
NM_138348chr595038 5006 4980 4647 2566 2221 2201 405 163 54863 2382 2181 1785 1629 32000 1787 1449 11998
NM_138423chr1562334 813 615 589 323 141 --21940 601 12123
NM_138444chr13114927 4740 4506 3743 3530 3369 3280 3177 1165 1129 610 44664 3933 3430 1615 13092 --
NM_138459chr693594 3048 2894 2866 2690 2541 1248 858 399 22995 448 22997 2425 --
NM_138468chr2116215 6190 5405 4806 4363 1988 1203 686 634 556 308 65583 4070 1826 892 764 456 --15850
NM_138638chr1472346 2299 2271 1916 1707 1597 521 169 22232 2094 12230
NM_138713chr16208196 7947 7860 7824 7488 7038 6913 6862 6011 5872 5580 5093 2495 2136 1505 1088 753 718 414 217 68071 7027 3114 745 443 355 26555 3257 13117
NM_138714chr16208196 7947 7860 7824 7488 7038 6913 6862 6011 5872 5580 5093 2495 2136 1505 1088 753 718 414 217 68071 7027 3114 745 443 355 26555 3257 13117
NM_138731chr1483584 3384 2872 2753 1557 732 643 583 54087 4046 4033 3163 3010 22713 1573 --
NM_138782chr5102413 2275 2225 1826 1796 1574 572 359 202 183 1173 11594 11536
NM_138811chr74412 382 376 369 21247 1087 ----
NM_139279chr2113520 3344 3139 3124 2986 2701 2486 2294 921 427 272 12847 3192 70 49 --
NM_139319chr1241690 1596 661 190 31631 1227 1206 1640 1204
NM_144567chr182844 2647 2516 2480 685 448 314 263 12688 2526 179 12140
NM_144571chr4166552 6509 6464 6326 5298 5017 4858 4506 2541 2348 1693 1651 1476 760 418 280 24994 4627 12365 --
NM_144578chr14144804 4629 4120 4040 3705 1925 865 800 720 598 535 445 270 255 55549 3870 3592 3495 1274 12177 35188 3595 1277
NM_144599chr1555035 4393 727 601 117 35500 1815 795 15175 31355 818 574
NM_144632chr241727 937 873 395 21549 452 --111579 1576 1573 1570 1567 1564 1561 1558 1555 1552 298
NM_144664chr11102429 2295 1820 1669 989 948 903 823 759 571 2308 247 42253 2121 1783 858 --
NM_144973chr1255044 4375 4130 830 261 34669 4156 1139 33677 1141 1053 13695
NM_145055chr18113325 3275 2947 2904 2748 2534 679 673 607 376 237 33750 1287 312 --12620
NM_145207chr484493 4450 4201 3905 3697 3613 1684 1035 35095 4957 3648 13993 --
NM_145259chr2177003 5858 5610 5063 4697 4640 4538 4503 4495 1892 1698 1551 1523 1286 948 788 251 97078 6861 6778 6164 5902 5400 5218 2636 2341 36863 4700 744 26831 6167
NM_145284chrX52548 2434 1009 855 87 12494 --31944 1941 1634
NM_145307chr10114048 2916 1503 1480 1436 916 867 152 120 114 73 13440 54533 3610 3442 1108 346 11507
NM_145320chr752938 2398 1401 1015 245 43187 3041 1263 1197 23189 1394 12693
NM_145321chr752938 2398 1401 1015 245 43187 3041 1263 1197 23189 1394 12693
NM_145322chr752938 2398 1401 1015 245 43187 3041 1263 1197 23189 1394 12693
NM_145698chr1062209 2115 1595 1522 641 211 --2365 289 12159
NM_145810chr221264 478 2943 374 --21225 377
NM_148174chr892147 2134 1547 1490 893 487 198 182 77 11958 1719 2848 129
NM_148955chr15116482 5851 5728 5519 4824 2480 2118 1914 488 371 203 --24993 901 11546
NM_152261chr1252575 2527 1891 1879 566 22192 916 42468 918 544 421 --
NM_152263chr155993 5396 895 846 797 12008 54613 4474 2010 866 412 11291
NM_152332chr14102907 2878 2817 2341 2301 1094 987 641 168 155 11889 22438 825 --
NM_152388chr2143975 3663 3391 3261 3229 3045 2812 2731 2629 333 221 208 97 26 --33978 3500 486 --
NM_152407chr5103279 3165 2652 2508 2428 2199 2149 877 775 266 --32817 2661 941 --
NM_152409chr5133221 3134 2948 2851 2567 2387 2345 802 621 422 374 320 48 13471 ----
NM_152433chr1151717 542 490 86 29 2512 59 --21093 1090
NM_152529chr2103913 3904 3735 3500 3385 2987 1129 765 661 655 64126 3753 3583 1677 1169 934 31679 1121 239 --
NM_152608chr172541 2233 2205 1955 272 219 111 --22323 385 12545
NM_152622chr593187 3042 2659 2610 2297 2204 1092 669 517 --1870 --
NM_152624chr5206808 6749 6419 6334 6213 6014 5802 5320 4860 4832 4800 4693 2823 2774 2408 2144 1811 1521 406 299 37329 941 371 36784 2645 2311 1374
NM_152641chr1292948 2864 2853 2452 2280 2237 742 445 272 22697 939 12791 12515
NM_152754chr7143854 3814 3529 3508 3437 3064 2617 2412 931 772 749 737 297 124 23274 1092 42993 2380 792 78 --
NM_152756chr5104363 3574 3032 2884 2750 1746 987 379 337 322 2893 396 --14073
NM_152774chr7122746 2740 2334 2248 1708 1690 1096 996 452 353 334 210 22716 266 11693 --
NM_152826chr15116482 5851 5728 5519 4824 2480 2118 1914 488 371 203 --24993 901 11546
NM_152835chr192907 2781 2690 2410 2265 2042 1900 584 226 12182 22049 1812 11119
NM_152866chr1162242 2055 2019 1564 870 461 32163 2147 759 21794 761 --
NM_152924chr1586181 5102 2727 2610 2194 1913 1349 1172 ----24713 4710
NM_152996chr171776 1721 1393 830 740 440 110 11664 1160 32027 1780 93
NM_152999chr7114747 4717 3899 3643 3548 3501 3293 1274 1072 839 364 15045 35047 4989 3924 43390 3387 648 306
NM_153020chr621207 71 --21094 1066 21092 1064
NM_153188chr5195700 5664 5549 5305 5209 5175 4897 4788 4672 4438 4413 4352 4190 3616 3463 3448 1356 904 365 34312 2019 440 15630 24474 4263
NM_153207chr12123605 3507 3423 3391 3136 1371 1239 1094 796 568 520 500 42508 1191 1074 143 13263 --
NM_153234chr582858 2480 2390 2248 633 499 340 216 2578 433 --2584 581
NM_153262chr1133204 3029 2927 2819 2797 2321 2154 2097 2039 1133 965 811 260 23229 2934 12660 --
NM_153332chr8112970 2698 2391 1146 1026 981 958 852 623 410 227 43245 2766 2681 2167 32768 2683 2251 --
NM_153456chr13126325 6163 5952 5569 4982 3969 3949 3908 1973 1834 1348 319 36278 6209 824 ----
NM_153607chr5103110 2585 2567 2378 2202 2179 1240 1234 1223 660 22907 305 12909 --
NM_153619chr1562731 2479 2230 1118 659 235 53617 3243 2551 2272 690 12772 13223
NM_153689chr292325 2001 1986 1549 1468 585 382 347 73 1159 21860 246 --
NM_153810chr1054804 3641 1499 1038 234 --11847 21913 1323
NM_170710chr4163216 2975 2714 2679 2636 2571 2211 791 729 556 546 521 495 405 365 266 43031 2227 1962 217 11286 --
NM_172069chr242372 2312 1475 1458 21783 416 22001 1801 2777 451
NM_172070chr2122250 2226 2149 1766 1734 1575 768 634 507 291 254 205 ----1524
NM_172071chr1227503 7388 6967 6619 6607 6282 6008 5887 5424 5360 5297 5272 4779 4728 4624 2565 2487 2468 1383 1113 363 280 57494 7148 5278 5257 2729 --15344
NM_172103chr642046 893 716 505 1848 1884 22050 2036
NM_172105chr642046 893 716 505 1848 1884 22050 2036
NM_172178chr12131421 1325 1263 1225 1146 1096 1053 1034 547 455 339 148 89 296 81 21332 98 1102
NM_172344chr291910 1899 1329 1287 1203 1179 681 265 200 2741 544 11684 11633
NM_173214chr16208196 7947 7860 7824 7488 7038 6913 6862 6011 5872 5580 5093 2495 2136 1505 1088 753 718 414 217 68071 7027 3114 745 443 355 26555 3257 13117
NM_173468chr4216095 5989 5707 5053 4988 4949 4922 4813 4794 4686 4258 3920 2417 2360 2324 2093 2029 1992 1303 502 208 21865 1581 1831 1271
NM_173496chr10112874 2854 2371 2354 2115 1953 1894 1856 760 662 559 --32742 2718 1873 12034
NM_173519chr871727 1611 1472 1326 801 479 282 31792 1598 468 --11373
NM_173531chr19103907 3743 3645 2970 2679 903 698 258 138 108 21269 1025 21545 1027 --
NM_173536chr4115038 4992 4965 4894 4743 4556 1814 1199 842 480 319 24881 123 11265 21884 1020
NM_173582chr11125654 4918 4273 4152 2357 1569 1210 1048 878 661 255 201 56318 4940 4542 2111 1919 --11922
NM_173607chr1482062 1806 1699 1640 1495 853 481 239 1844 31484 367 278 --
NM_173642chr1109195 8876 8437 8110 7561 6634 6135 3668 3604 3518 58376 6853 1989 1849 407 21963 1851 --
NM_173694chrX72393 2216 2190 1860 559 474 187 42002 537 364 303 12370 --
NM_173808chr1134487 4050 3629 3477 3078 3015 1660 1621 1517 1415 852 841 456 33770 628 470 33772 3364 3103 --
NM_173825chr352226 2175 686 608 266 32336 2053 1224 12185 2640 542
NM_173826chr361749 1605 652 569 473 362 31755 1708 330 2338 332 1336
NM_173829chr5236230 6216 6125 6101 5628 5574 5354 5114 4527 4411 4288 2337 2264 2184 2166 2092 2011 1933 1396 724 445 394 360 11992 42159 1997 1166 680 --
NM_174916chr1572344 2330 1768 1703 1589 1475 45 1733 1415 12134
NM_175056chr382210 2204 1999 1911 1564 625 466 117 1277 21485 1404 1149
NM_175623chr12107570 7547 6029 5845 5562 5059 1581 1556 875 599 37613 7251 345 37194 1803 347 22399 1790
NM_175624chr12107665 7642 6124 5940 5657 5154 1676 1651 970 694 37708 7346 440 37289 1898 442 22494 1885
NM_175625chr12107665 7642 6124 5940 5657 5154 1676 1651 970 694 37708 7346 440 37289 1898 442 22494 1885
NM_175861chr12185795 5519 4994 4869 4180 3702 2345 2101 2073 2019 2010 1788 1743 1341 1033 505 97 32 55549 4798 4550 4107 830 35932 5472 1833 --
NM_177438chr14144160 4038 3848 3763 3641 3010 2857 975 897 585 567 455 301 135 --24230 275 13256
NM_177974chr1562334 813 615 589 323 141 --21940 601 12123
NM_177985chr241921 795 241 96 21547 533 --21550 536
NM_178011chr1043147 3045 2299 2279 1591 53200 2752 2333 2330 992 1759
NM_178123chr25996 964 749 382 316 --1814 1295
NM_178135chr441322 1216 1206 49 --137 2101 41
NM_178140chr562763 2368 2056 855 758 608 12682 12046 12044
NM_178151chrX157427 7353 7244 6615 6267 6144 6085 5725 3080 2507 1992 1934 1385 1083 223 12397 46187 6033 1211 750 1748
NM_178152chrX157427 7353 7244 6615 6267 6144 6085 5725 3080 2507 1992 1934 1385 1083 223 12397 46187 6033 1211 750 1748
NM_178153chrX157427 7353 7244 6615 6267 6144 6085 5725 3080 2507 1992 1934 1385 1083 223 12397 46187 6033 1211 750 1748
NM_178505chr1083665 3513 2878 2817 2808 2474 2238 1240 12721 33181 3157 95 --
NM_178509chr1733238 381 217 43967 3901 3622 1340 23633 403 11343
NM_178566chr941717 1486 691 290 21858 1579 31244 1200 149 166
NM_180989chr13112367 2326 2256 2131 1944 1639 961 370 358 324 173 --31972 1891 343 --
NM_181265chr4163216 2975 2714 2679 2636 2571 2211 791 729 556 546 521 495 405 365 266 43031 2227 1962 217 11286 --
NM_181354chr871557 1437 1153 688 627 308 271 21136 501 11673 11671
NM_181453chr261667 1653 1452 1195 1152 379 1526 11733 2532 529
NM_181481chr18117086 6800 6138 2768 2701 2615 2565 1780 1324 1288 1000 1183 26820 5383 16601
NM_181482chr18117086 6800 6138 2768 2701 2615 2565 1780 1324 1288 1000 1183 26820 5383 16601
NM_181483chr18117086 6800 6138 2768 2701 2615 2565 1780 1324 1288 1000 1183 26820 5383 16601
NM_181521chr16147293 7254 7230 6808 6775 6135 6103 5810 4436 2115 1456 1239 1159 972 --25119 2553 --
NM_181705chr585580 5066 4713 4592 4236 980 782 667 45448 4296 957 404 11380 --
NM_181723chr8112241 2204 1944 1686 1504 1416 853 844 777 522 362 12085 12087 --
NM_181780chr382063 1862 1855 792 653 430 160 36 41429 553 261 83 31874 1871 433 --
NM_181782chr622123 2043 31697 1602 1593 --31611 1608 1605
NM_181783chr1272007 1960 1937 1907 1230 447 310 31981 1951 328 21421 330 --
NM_181787chr8103907 3407 3246 1186 1034 727 672 402 392 367 --13695 1631
NM_181789chr1583231 2836 2716 2435 2132 1240 805 407 ----22224 2221
NM_181836chr572611 2286 1998 1931 713 412 239 --22440 2367 --
NM_181869chr1252014 399 148 91 49 1235 --22031 1939
NM_181897chr382551 2520 2465 1779 852 802 775 439 11013 11767 3920 856 471
NM_182485chr4113753 3717 3689 3241 3124 2336 2309 1505 1273 545 389 2533 412 21458 414 13222
NM_182503chr6155581 5403 4403 3855 3762 3749 3733 3715 3643 1991 1907 928 879 660 626 55614 5123 3827 1832 1778 34772 3829 1423 --
NM_182515chr19106115 6075 4118 2410 2093 1599 1274 736 563 228 46596 5869 5413 2168 32436 2284 1602 24996 2610
NM_182551chr293603 3374 3129 2943 2812 2784 2454 2252 987 21125 709 11075 21128 1079
NM_182646chr4113753 3717 3689 3241 3124 2336 2309 1505 1273 545 389 2533 412 21458 414 13222
NM_182762chr7185957 5761 5727 5647 5630 4662 4615 4530 4276 3885 3875 2326 2268 1971 1581 935 393 237 74945 4607 4554 4158 3942 1421 698 124947 4609 4556 4160 4141 4115 4105 4092 4075 4033 4007 3944 44139 4113 4051 964
NM_182765chr1042161 848 576 564 --21860 797 12060
NM_182898chr7126596 5903 5766 5617 4661 4149 4074 2605 2239 2059 1124 710 2824 548 21067 867 12635
NM_182899chr7126596 5903 5766 5617 4661 4149 4074 2605 2239 2059 1124 710 2824 548 21067 867 12635
NM_182948chr173001 2473 2099 2053 882 868 690 --2913 448 1751
NM_194282chr463124 2416 2205 666 351 22 3774 736 527 1833 1814
NM_194285chr1153284 2460 1174 935 637 21352 828 22421 830 12403
NM_194291chr8122662 2278 2137 2116 2029 1091 946 915 771 732 113 49 --12862 1494
NM_194314chr1185347 5267 5079 4806 4792 4580 4569 4562 4535 4399 3972 3715 3528 2243 1943 1523 1296 658 45423 5309 1677 647 65425 3643 2161 1546 649 427 22260 2159
NM_194434chr18144837 4317 3567 2224 2178 2122 2097 1767 1731 1610 1138 1076 993 297 25465 828 45344 1030 342 145 --
NM_197941chr583072 3065 2990 2767 668 608 558 332 32889 2560 1223 43099 3096 2891 2732 --
NM_198128chr1882102 1624 1593 1513 466 173 108 101 --2681 576 --
NM_198150chr51466 2589 402 31133 407 90 2614 405
NM_198158chr393042 2981 2899 2565 2065 1911 1170 846 62 --22955 89 12953
NM_198159chr393042 2981 2899 2565 2065 1911 1170 846 62 --22955 89 12953
NM_198177chr393042 2981 2899 2565 2065 1911 1170 846 62 --22955 89 12953
NM_198178chr393042 2981 2899 2565 2065 1911 1170 846 62 --22955 89 12953
NM_198212chr7142366 2150 2060 2038 1805 1762 1723 1703 857 470 428 303 144 127 51780 1573 873 372 240 2270 256 --
NM_198270chrX113421 3170 2534 2500 1145 1028 776 722 568 497 470 1967 22791 2607 --
NM_198273chr593170 2241 1014 840 821 730 658 602 311 2355 74 22754 1117 --
NM_198281chr473366 3283 2986 966 646 501 489 2853 259 13403 22264 2261
NM_198400chr1571940 1035 1021 936 381 307 182 32243 2170 150 12248 12246
NM_198439chr1151717 542 490 86 29 2512 59 --21093 1090
NM_198465chrX132837 2673 2659 2594 2576 2210 2113 2044 1058 645 153 145 102 32292 2082 734 11872 --
NM_198468chr6124609 4440 4417 4006 1810 1648 1593 1468 1286 1150 191 107 54347 3623 785 414 395 1397 24626 1269
NM_198503chr182296 2274 2210 2141 1531 949 908 850 32423 2335 1490 52440 2337 2216 853 274 12214
NM_198581chr2187477 7404 7343 6646 5854 4752 2899 2804 2223 1934 1840 1335 1321 1288 1164 902 806 327 46874 6755 6338 6022 34684 1446 204 17573
NM_198715chr1135300 4904 4222 3992 2289 2268 1890 1631 1513 1305 951 283 201 56218 5463 4788 4157 2019 54472 1992 1478 1149 590 14470
NM_198793chr3164102 3971 3386 3379 3235 3032 2794 2755 1521 1364 1085 356 293 196 190 35 33104 514 269 11554 11552
NM_198859chr3113763 3643 2041 2004 1839 1596 1502 1471 1317 441 364 --1764 14425
NM_198935chr2073258 2752 2474 2412 1089 1054 869 11238 12468 22303 1241
NM_199040chr12103856 3359 2898 2837 2792 2489 2463 729 190 173 23824 657 --13295
NM_199188chr12113265 2964 2928 2613 2556 1546 1306 1142 1119 1083 577 33250 3021 2746 33302 3184 2889 21627 1523
NM_199190chr12113265 2964 2928 2613 2556 1546 1306 1142 1119 1083 577 33250 3021 2746 33302 3184 2889 21627 1523
NM_199421chr14174781 4506 3351 3334 3163 3123 1991 1945 1609 1597 1292 1110 862 817 555 381 137 33315 1345 27 11620 2821 30
NM_199436chr282646 2502 2063 1255 1159 973 672 548 43134 1935 410 305 52580 2077 1012 412 307 12506
NM_199482chr271975 1715 1613 1411 1356 572 245 11865 12012 1562
NM_203390chr8101853 1733 1505 1411 1286 1233 626 508 399 99 21695 143 1749 1747
NM_203394chr1252756 2310 2296 1000 166 12159 32161 1003 621 1619
NM_203406chr592943 2720 2655 2571 2449 2024 1996 1117 796 --31999 1148 73 32874 2588 1146
NM_203458chr1123622 3607 3558 3477 3351 2396 1003 991 641 497 111 31 11491 53404 2518 1297 1227 1211 12516
NM_203463chr2114929 4646 4361 3970 3612 1940 1787 1390 982 136 60 23803 1705 33518 1733 1633 34158 3806 1731
NM_205852chr1242191 2181 1907 308 11512 31487 47 44 21485 838
NM_205860chr182784 2717 2339 1158 984 637 184 172 --23206 158 --
NM_206594chr143416 1118 983 898 23424 3210 23388 123 43436 3433 3430 3427
NM_206595chr143416 1118 983 898 23424 3210 23388 123 43436 3433 3430 3427
NM_206853chr6154139 3523 2889 2544 1297 1219 1136 677 650 573 482 456 381 348 184 53995 3727 3640 3310 3040 ----
NM_206854chr6175400 4784 4150 3805 3614 3476 1938 1911 1834 1743 1717 1642 1609 1445 1057 404 237 65256 4988 4901 4571 4301 930 --1933
NM_206855chr6156365 5749 5115 4770 4579 4441 4158 3981 2410 2022 1369 1202 787 150 48 66221 5953 5866 5536 5266 1895 --11898
NM_206866chr21113272 2995 2708 2201 2101 2043 1020 604 456 229 185 1260 1397 1272
NM_206907chr593373 3206 2923 2848 2662 2503 2322 464 48 22497 2156 ----
NM_206909chr8208363 8346 8129 8043 7854 7719 7666 7124 6905 6146 5853 5723 5080 2810 2629 2331 1791 1348 768 407 16059 21996 121 26062 1492
NM_207292chr363395 2360 1180 1133 904 542 22135 527 33128 2334 1222 12490
NM_207293chr363395 2360 1180 1133 904 542 22135 527 33128 2334 1222 12490
NM_207294chr363395 2360 1180 1133 904 542 22135 527 33128 2334 1222 12490
NM_207295chr363395 2360 1180 1133 904 542 22135 527 33128 2334 1222 12490
NM_207296chr363395 2360 1180 1133 904 542 22135 527 33128 2334 1222 12490
NM_207297chr363420 2385 1205 1158 929 567 22160 552 33153 2359 1247 12515
NM_207322chr1552144 2007 1825 578 272 2868 568 21371 570 31369 874 871
NM_207366chr751536 818 800 743 248 21477 904 21737 778 1907
NM_207406chr4176292 6239 5898 5291 5160 5069 5034 4923 4576 4354 4346 1602 1399 1385 956 739 240 34728 4224 1740 1520 --
NM_207491chr451334 1081 1000 994 186 21415 201 31420 1417 203 --
NM_212460chr781932 1849 825 808 767 559 532 256 11596 --1568
NM_212558chr9104291 4115 3312 2829 1357 1134 627 448 364 128 44054 4034 1191 805 44056 3505 896 431 --
NM_213590chr13125286 5248 4219 3215 3187 1751 1728 1674 1435 883 261 125 11912 ----
NM_213594chr1231271 333 139 --31244 1070 42 6936 56 53 50 40 37
NM_213651chr171726 1599 1481 1453 1336 1317 448 11525 51329 1287 1141 244 29 --