TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1264
miRNA Sequence: CAAGUCUUAUUUGAGCACCUGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511270 11041 ----
NM_000038chr552089 1730 1290 700 87 11456 ----
NM_000041chr191127 ------
NM_000051chr1183515 3403 2964 2876 2773 2696 1419 1197 --33088 2707 1061 --
NM_000052chrX42958 1362 929 542 --1365 --
NM_000081chr131311 210 51 --1487 --
NM_000084chrX166976 5947 5481 5439 4626 2775 2350 2126 1701 1584 1151 1014 948 512 247 201 --35701 780 283 --
NM_000090chr22784 646 --1666 --
NM_000091chr252833 2715 2617 565 374 11024 22451 675 12534
NM_000092chr264366 3524 3485 1139 542 458 --44497 3864 1453 57 --
NM_000104chr242184 2123 393 206 ----1224
NM_000109chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_000111chr71267 ------
NM_000112chr594193 2225 2121 1614 1561 789 457 388 216 35540 4695 2111 14151 24731 3535
NM_000129chr681315 1157 1134 1119 956 487 338 116 1582 1371 --
NM_000138chr1531656 839 198 32346 1815 445 1695 --
NM_000141chr102939 280 ----2338 157
NM_000158chr32439 35 ------
NM_000163chr542191 2081 2016 561 --1544 --
NM_000165chr641519 1202 549 25 21225 127 21391 616 --
NM_000167chrX31763 1456 98 ----11794
NM_000176chr573499 3247 2643 2583 1074 899 388 12765 1166 --
NM_000187chr3136 --146 --
NM_000189chr232068 2003 24 ------
NM_000202chrX63701 3167 3069 1384 979 792 --1989 --
NM_000214chr2031290 1193 519 --11663 11364
NM_000217chr1274297 3697 3606 1591 585 271 116 --23420 2027 152
NM_000248chr351185 655 337 259 172 158 ----
NM_000252chrX31260 1215 1171 1270 11470 --
NM_000259chr1545395 4203 1818 1542 15863 11446 11524
NM_000264chr932494 1241 36 ----12636
NM_000288chr61111 ------
NM_000291chrX3866 725 99 ----1686
NM_000314chr1012586 ----11144
NM_000315chr11----186 --
NM_000319chr1221127 904 ------
NM_000321chr1341680 683 563 203 ------
NM_000332chr6126660 6149 6117 5634 5351 5312 4966 2527 2220 1086 574 162 11914 11826 --
NM_000337chr586106 4610 3999 2603 2399 2335 1798 521 16308 21757 900 --
NM_000340chr361277 1093 1057 308 219 195 1615 ----
NM_000351chrX63717 3703 2925 2649 1401 753 --21313 141 --
NM_000353chr1641028 359 130 45 --1261 --
NM_000362chr2283393 2988 2674 2243 944 867 840 800 ----1738
NM_000368chr984528 4003 3576 1644 1599 1214 989 513 --14492 --
NM_000369chr1421576 371 --2678 261 --
NM_000391chr1171693 1424 1371 1288 1108 585 289 --1666 --
NM_000393chr262037 1817 694 561 476 91 ------
NM_000408chr253384 2197 1045 941 510 --12838 --
NM_000411chr2142145 2059 924 527 2894 271 13046 --
NM_000441chr772234 2057 1912 674 263 142 130 ------
NM_000448chr1182701 2472 2332 2087 954 885 498 188 --22935 2735 --
NM_000449chr131421 1387 525 --21100 410 11170
NM_000461chr373531 2838 2805 1650 1201 933 466 11521 34434 784 312 14417
NM_000478chr11245 ------
NM_000480chr1131692 1149 73 --2487 87 --
NM_000486chr1262673 2056 2025 1021 731 515 12499 2820 722 --
NM_000489chrX42509 2486 2154 289 23189 883 12400 1370
NM_000492chr731494 575 271 ----1245
NM_000493chr631050 224 125 --11109 --
NM_000495chrX3796 359 158 ------
NM_000534chr2121 ------
NM_000538chr132590 469 ------
NM_000555chrX127762 7330 7171 5306 5225 4898 2952 2476 2265 1369 792 766 --37699 5428 1524 --
NM_000572chr12998 881 ------
NM_000597chr21314 ------
NM_000599chr284547 4160 3901 3348 3282 1808 1483 962 --1822 --
NM_000601chr7----2294 57 --
NM_000615chr1172392 2255 1124 1101 1091 661 434 ------
NM_000618chr1295014 4621 2379 2249 1687 1359 1352 1154 584 14146 24387 2169 --
NM_000618chr1295014 4621 2379 2249 1687 1359 1352 1154 584 14146 24387 2169 --
NM_000633chr18125060 4732 4716 4690 3783 3724 3536 1907 1286 918 662 578 13307 45025 3313 3278 1387 1256
NM_000639chr1----1704 --
NM_000685chr31741 ------
NM_000685chr31741 ------
NM_000689chr9172 ------
NM_000719chr1276662 5166 5146 5140 4762 2470 2387 --25777 454 --
NM_000724chr1031688 671 387 ------
NM_000726chr211039 2594 260 ----
NM_000783chr101213 129 ----
NM_000793chr1494477 4395 4227 4220 3869 1661 1596 1443 1384 14322 54626 4188 3882 3646 726 1339
NM_000809chr4137975 7876 6702 6463 6201 5666 3616 3339 2114 1986 1828 1524 1165 11446 --27392 1073
NM_000813chr5145649 5472 4654 4445 3975 2074 1648 1214 654 566 524 500 320 29 --34597 1229 71 --
NM_000814chr1563306 3162 3153 2970 1393 1137 --31047 548 28 --
NM_000816chr51662 ------
NM_000817chr23929 859 843 ------
NM_000827chr542389 2257 2210 738 --32137 2026 492 --
NM_000838chr662440 2244 2113 1780 822 599 --12512 --
NM_000859chr52233 50 ----11526
NM_000868chrX42614 2167 2013 208 1172 --1976
NM_000875chr1544704 2319 925 560 --26161 1143 14555
NM_000885chr261864 1626 1502 835 339 100 12046 11406 --
NM_000895chr12130 ------
NM_000899chr1264134 717 432 263 254 240 1906 ----
NM_000902chr373161 1282 1144 994 880 661 36 1724 12340 1916
NM_000908chr51783 1272 1514 --
NM_000922chr1131117 1061 856 ----1831
NM_000926chr11229310 8646 8570 8407 8281 8147 8110 7930 7183 6946 6757 6703 6640 5928 5913 3033 2455 1320 1096 764 500 234 18366 28132 1984 --
NM_000935chr31328 --1367 --
NM_000944chr442160 1650 482 335 ----12001
NM_000949chr53946 914 806 1207 1311 --
NM_000950chrX63467 2250 1088 1016 771 439 ------
NM_000959chr1103882 3787 2841 2608 1181 1085 950 761 619 105 --22814 2666 --
NM_000961chr20103979 3876 3652 1517 1479 887 780 602 239 140 ------
NM_000962chr963043 2669 2433 2180 869 284 --12290 --
NM_001001323chr1242019 1974 392 86 22908 426 --12498
NM_001001392chr1153103 3089 1983 829 37 --22599 1056 --
NM_001001395chr1222376 1894 --22001 1023 --
NM_001001396chr174152 3730 3416 2768 1364 1311 363 1450 23334 143 --
NM_001001419chr584785 4656 4104 3432 1565 1232 1039 39 33808 3160 913 ----
NM_001001420chr584785 4656 4104 3432 1565 1232 1039 39 33808 3160 913 ----
NM_001001481chr842669 2151 574 117 22442 1136 41272 863 779 646 12961
NM_001001549chr772644 2203 1864 772 499 145 27 1164 ----
NM_001001550chr772644 2203 1864 772 499 145 27 1164 ----
NM_001001555chr772644 2203 1864 772 499 145 27 1164 ----
NM_001001556chr153610 591 326 1259 2274 57 11035
NM_001001664chr243997 3749 594 288 --22668 695 11501
NM_001001668chr19104280 4265 4108 3859 3468 2730 1179 881 391 366 --1373 23547 441
NM_001001877chrY2209 74 ------
NM_001001890chr2173667 3528 3200 1545 908 662 309 --23601 369 --
NM_001001924chr861443 761 749 200 160 57 --31981 229 180 2343 218
NM_001001925chr861443 761 749 200 160 57 --31981 229 180 2343 218
NM_001001928chr22158299 8224 7895 6191 5578 5253 5233 2931 2651 1852 1422 858 821 235 226 --22752 507 --
NM_001001931chr861443 761 749 200 160 57 --31981 229 180 2343 218
NM_001001936chr104337 203 116 23 --1307 --
NM_001001974chr1021853 59 --11807 --
NM_001001995chrX1703 11576 ----
NM_001002233chr861786 1753 1694 610 545 360 11687 2202 69 --
NM_001002243chr2------1235
NM_001002295chr10--1725 ----
NM_001002755chr2292 38 ------
NM_001002756chr2292 38 ------
NM_001002757chr2292 38 ------
NM_001002814chr8103866 3676 3302 2959 2527 1320 1285 610 545 360 --33197 202 69 --
NM_001002860chr14104404 4093 3697 3288 3280 1664 1528 1066 1050 368 ----13871
NM_001003652chr18148443 8238 7984 7801 7398 7196 7106 6955 5906 5705 3277 2338 1419 524 17758 37090 501 228 2238 33
NM_001003674chr18127030 6696 5773 2713 2548 2368 2161 1902 1008 854 825 340 16582 26901 5573 --
NM_001003675chr18127030 6696 5773 2713 2548 2368 2161 1902 1008 854 825 340 16582 26901 5573 --
NM_001003679chr141702 1379 878 201 --173 --
NM_001003712chr1274065 3234 2986 2858 1464 1337 1166 13285 ----
NM_001003810chr43805 786 62 ----2741 604
NM_001003895chrY--2295 49 ----
NM_001003937chr271694 1527 1512 1467 1151 508 153 ------
NM_001004317chr633613 1531 310 13821 13412 13403
NM_001004342chr1136090 5598 5465 5164 4598 2248 2074 1733 1310 1293 1259 374 367 --14329 --
NM_001004419chr12104454 4271 4230 4016 3105 3062 1185 592 424 296 2881 323 --13738
NM_001005335chr191215 ------
NM_001005375chrY31652 1412 323 --11535 1342
NM_001005386chr222507 283 1874 ----
NM_001005463chr1062554 2527 2502 2175 900 48 11743 2149 136 --
NM_001005473chr5146593 6261 6163 6073 4235 2533 2430 2157 1839 1315 1210 1150 1094 481 11771 11162 12259
NM_001005746chr211039 2594 260 ----
NM_001005747chr211039 2594 260 ----
NM_001005781chr2----1126 --
NM_001005849chr17152 ------
NM_001006600chr562077 1628 965 464 245 190 --22429 1618 140
NM_001006605chr14979 804 783 446 1321 ----
NM_001006605chr14979 804 783 446 1321 ----
NM_001006623chr291906 1899 1873 1848 1822 981 685 257 68 --12534 --
NM_001006641chr911122 ------
NM_001006642chr911122 ------
NM_001006643chr911122 ------
NM_001007023chr1494477 4395 4227 4220 3869 1661 1596 1443 1384 14322 54626 4188 3882 3646 726 1339
NM_001007024chr1794261 4094 3191 2886 2699 1473 1420 380 124 --13478 --
NM_001007025chr1794261 4094 3191 2886 2699 1473 1420 380 124 --13478 --
NM_001007067chr83941 758 175 2313 231 ----
NM_001007068chr83941 758 175 2313 231 ----
NM_001007069chr83941 758 175 2313 231 ----
NM_001007070chr83941 758 175 2313 231 ----
NM_001007094chr1064346 4129 1726 1130 824 806 --44505 3937 2786 905 13535
NM_001007097chr964777 4413 4406 3683 1539 586 1803 11373 --
NM_001007098chr11226 ------
NM_001007189chr5--1103 ----
NM_001007237chr152268 901 863 231 120 1293 32248 738 468 1544
NM_001007257chr131278 1071 413 1160 11461 --
NM_001007278chr1384368 3278 1614 1390 1286 806 680 70 --1744 --
NM_001007466chr643529 3333 101 24 ------
NM_001007527chr52601 595 --2725 256 2513 200
NM_001008222chrX4496 466 365 53 ----11289
NM_001008225chr7--1532 ----
NM_001008239chr1843606 2547 2449 393 --23794 1303 --
NM_001008393chr45752 663 657 580 355 1878 1731 --
NM_001008401chr1931470 1245 517 --1266 --
NM_001008408chr7115572 5125 4769 4018 3953 2265 2164 2104 1414 935 483 14364 15318 --
NM_001008564chr13--1100 ----
NM_001008712chr8165 ------
NM_001008738chr592788 2735 1991 1139 745 614 205 187 99 --11082 --
NM_001008744chr142588 489 --11363 --
NM_001008777chr172206 93 --1429 --
NM_001008895chr1341362 943 405 154 11430 1162 --
NM_001009554chr4114542 4331 4269 3540 1666 1119 988 898 636 556 98 --11401 21546 1223
NM_001009554chr4114542 4331 4269 3540 1666 1119 988 898 636 556 98 --11401 21546 1223
NM_001009555chr431683 1476 158 ------
NM_001009881chr14546 539 406 190 ------
NM_001009882chr14546 539 406 190 ------
NM_001009899chr376009 5665 2353 1896 667 575 330 35517 1005 236 15835 --
NM_001009909chr1153970 3744 3139 2839 151 11305 11354 --
NM_001009959chr242392 1658 716 341 ----12008
NM_001009993chr274576 4091 3994 3463 2849 723 674 14506 21460 93 --
NM_001010853chr632203 2129 388 32746 2371 2283 12294 --
NM_001010861chr1112653 2612 2274 2085 2054 1760 885 868 707 623 446 12219 22046 1950 --
NM_001010862chrX122817 2114 2098 1228 1022 1007 993 971 888 810 514 34 22909 1181 32640 1146 682 --
NM_001010876chr6170 ------
NM_001010891chr5146835 6619 5545 5383 4745 4345 2143 1669 1318 1240 436 320 286 106 24570 1779 ----
NM_001010895chr921407 406 --2704 178 --
NM_001010923chr631753 677 440 ------
NM_001010927chr6------1150
NM_001010932chr7----2294 57 --
NM_001010984chr172350 1912 850 774 689 328 147 1100 11845 1500
NM_001010986chrX52353 1757 745 676 334 ------
NM_001011537chr341482 652 358 106 --1216 1515
NM_001011546chr20----1245 --
NM_001011663chr1061034 1012 421 191 51 41 --2908 69 --
NM_001011666chr796515 6496 6288 5780 5557 4791 2374 116 97 15086 16549 11135
NM_001011708chr252865 2479 2123 1032 913 --12455 --
NM_001011713chr1421375 189 ----1251
NM_001011724chr132260 71 ------
NM_001011725chr132260 71 ------
NM_001012393chr11114804 4634 4391 3606 3429 3279 1832 643 571 118 52 34854 4688 4489 15066 --
NM_001012420chr1542494 1826 1140 1133 --12886 --
NM_001012423chr1531826 1140 1133 --12886 --
NM_001012732chr431224 1166 29 --11149 --
NM_001012751chr1071885 1726 1714 1445 1205 534 408 21420 1189 ----
NM_001012753chr1971226 1074 1019 935 497 229 145 --2814 376 --
NM_001012754chr1361708 1658 1562 756 651 576 1173 1124 --
NM_001012755chrX54780 4736 3321 561 508 ----1666
NM_001012761chr542544 2373 2184 779 ------
NM_001012968chrX62660 2612 1862 1804 849 777 ------
NM_001013031chr1083442 3409 2877 1408 1253 529 372 104 1348 ----
NM_001013399chr621018 56 1859 ----
NM_001013437chr18----194 --
NM_001014283chr1361951 1726 1447 840 220 26 22057 557 12112 11614
NM_001014380chr1395217 5032 4632 4164 4132 3650 2265 1504 746 15164 15729 1311
NM_001014449chr161213 1236 ----
NM_001014451chr161213 1236 ----
NM_001014797chr10148112 7368 7163 7000 6836 6422 6262 5317 5170 3279 1199 1044 961 637 25214 2023 37427 3206 1388 --
NM_001015045chr421993 227 12570 2653 420 12107
NM_001015508chr81291 ------
NM_001015880chr102490 292 --21242 302 --
NM_001015882chr91712 --2286 229 1243
NM_001017368chr1752581 1987 1754 1084 563 32768 1804 978 22757 2593 --
NM_001017395chr331265 326 179 13605 13007 12336
NM_001017440chr7117777 6511 6332 2923 2735 2478 2391 1750 1647 629 421 23036 2106 36841 5059 1788 --
NM_001017923chr14--11549 1289 11399
NM_001017926chr82533 302 11223 1607 --
NM_001017975chr1----1451 --
NM_001017999chr162118 2037 1814 1597 654 418 --11947 --
NM_001017999chr162118 2037 1814 1597 654 418 --11947 --
NM_001018000chr162118 2037 1814 1597 654 418 --11947 --
NM_001018000chr162118 2037 1814 1597 654 418 --11947 --
NM_001018001chr162118 2037 1814 1597 654 418 --11947 --
NM_001018038chr92192 44 ------
NM_001018064chr931421 810 130 --11981 1664
NM_001018067chr185273 5214 4971 4896 3854 1834 133 104 ----22142 1585
NM_001018068chr185273 5214 4971 4896 3854 1834 133 104 ----22142 1585
NM_001018069chr185273 5214 4971 4896 3854 1834 133 104 ----22142 1585
NM_001018074chr573499 3247 2643 2583 1074 899 388 12765 1166 --
NM_001018075chr573499 3247 2643 2583 1074 899 388 12765 1166 --
NM_001018076chr573499 3247 2643 2583 1074 899 388 12765 1166 --
NM_001018077chr573499 3247 2643 2583 1074 899 388 12765 1166 --
NM_001018111chr793700 3550 3425 2832 1533 1121 388 268 85 --11497 --
NM_001024094chr573499 3247 2643 2583 1074 899 388 12765 1166 --
NM_001024380chr842092 2005 173 153 --32040 798 143 --
NM_001024381chr842092 2005 173 153 --32040 798 143 --
NM_001024647chr12106837 6660 6420 6035 5663 5551 2478 1761 1017 614 15736 42846 1612 486 103 --
NM_001024649chr522852 420 --11136 12590
NM_001024660chr331285 1231 57 --11469 --
NM_001024688chr852120 1523 641 290 192 --11896 --
NM_001024924chr41470 196 ----
NM_001024947chr51309 1106 --1706
NM_001024948chr163223 2129 1122 645 140 108 1589 13210 --
NM_001024956chr11155121 5028 5011 4732 4245 4003 3972 2149 1880 1578 1303 1171 581 428 393 14978 1196 11006
NM_001024959chr31244 ------
NM_001024960chr31244 ------
NM_001025068chr361440 1295 401 285 105 89 11123 ----
NM_001025069chr361440 1295 401 285 105 89 11123 ----
NM_001025076chr1066107 4883 4816 2317 362 273 ----14170
NM_001025077chr1077465 6241 6174 4772 1720 1631 1291 15093 11310 25528 696
NM_001025079chr331233 977 835 22784 668 ----
NM_001025105chr52573 548 ----1622
NM_001025108chr274159 4060 3591 3461 3189 1149 976 21374 750 13987 --
NM_001025201chr21575 ------
NM_001025389chr1131692 1149 73 --2487 87 --
NM_001025390chr1131692 1149 73 --2487 87 --
NM_001025580chrX53991 2798 976 810 733 --43291 3250 3071 2640 --
NM_001025595chr441143 643 599 293 --11446 --
NM_001025603chr131421 1387 525 --21100 410 11170
NM_001025780chr921541 265 2458 143 ----
NM_001029858chr663205 2784 2561 2194 887 752 --12859 --
NM_001029863chr662980 2915 2852 1102 858 217 --22956 2372 13055
NM_001029875chr542756 2290 2250 1841 11884 1983 --
NM_001029883chr262869 2368 2128 2002 1001 699 22843 1944 11176 --
NM_001029998chr411014 --171 --
NM_001030002chr171375 ------
NM_001030007chr1673563 3045 2628 755 708 336 173 --11345 --
NM_001030055chr1464500 4363 3434 3426 1428 1382 --1968 24456 3806
NM_001031695chr22104901 4603 4418 4371 3668 3639 946 894 820 226 ------
NM_001031716chr21237 ----1357
NM_001031732chr452922 2882 2241 1128 772 12269 23404 2494 --
NM_001031804chr1663177 3152 2782 1582 698 352 --23743 944 33398 2810 1062
NM_001032279chr11--1421 ----
NM_001032282chr821218 292 ------
NM_001032290chr11219 --126 1195
NM_001032291chr11219 --126 1195
NM_001032394chr6102693 2522 2301 2093 2062 1073 1045 968 680 657 --32560 268 177 --
NM_001032395chr6102560 2389 2168 1960 1929 940 912 835 547 524 --32427 135 44 --
NM_001032999chr2085376 5117 4520 4448 3486 548 523 495 --21031 666 --
NM_001033044chr131871 1277 1131 21711 1684 1401 --
NM_001033056chr131871 1277 1131 21711 1684 1401 --
NM_001033087chr2052743 2480 2001 1064 762 --1948 --
NM_001033117chr374372 4023 3643 3004 1139 1115 576 1515 13958 --
NM_001033554chr171250 ------
NM_001033559chr15------1381
NM_001033723chr852235 1724 919 680 299 1286 1387 --
NM_001034850chr541336 1116 469 119 2629 623 21456 517 --
NM_001035chr15809 298 286 195 188 --11075 --
NM_001035003chr42495 306 --1157 11086
NM_001035004chr42495 306 --1157 11086
NM_001035005chr181550 ----1475
NM_001035260chr1021605 1169 1565 ----
NM_001037132chr752102 1974 1756 639 524 ------
NM_001037133chr752102 1974 1756 639 524 ------
NM_001037317chr1112653 2612 2274 2085 2054 1760 885 868 707 623 446 12219 22046 1950 --
NM_001037535chrX11451 1562 ----
NM_001037536chrX11451 1562 ----
NM_001037540chrX11451 1562 ----
NM_001037582chr411096 ------
NM_001037637chr51236 ----1378
NM_001037663chr2244 36 ------
NM_001037872chr21692 --1589 --
NM_001037954chr1193493 3443 3425 2859 2765 2718 2660 2395 526 --13187 --
NM_001038707chr162323 2141 1993 928 537 216 1552 1147 --
NM_001038707chr162323 2141 1993 928 537 216 1552 1147 --
NM_001039538chr2103405 3322 3011 2403 2377 1464 1139 715 512 314 --11217 --
NM_001039570chr22114373 4275 3692 3620 3207 1845 1622 1031 938 223 48 --24488 23 --
NM_001039571chr22114373 4275 3692 3620 3207 1845 1622 1031 938 223 48 --24488 23 --
NM_001039573chr171155 --1495 --
NM_001039577chr174372 2827 2794 1783 1529 872 88 14242 33938 734 505 --
NM_001039580chr465050 4689 3747 2014 1686 1339 2617 61 41590 1517 557 244 14124
NM_001039582chrX2119 44 ------
NM_001039585chr1114139 4044 3098 2865 1438 1342 1207 1018 876 362 107 --23071 2923 --
NM_001039590chrX114000 3677 3348 3015 2547 1547 964 584 522 301 32 12455 --24021 910
NM_001039591chrX114000 3677 3348 3015 2547 1547 964 584 522 301 32 12455 --24021 910
NM_001039618chr1184800 4665 2328 1873 1088 890 521 447 15358 14006 15201
NM_001039693chr222789 394 195 21080 65 14130
NM_001039709chr2085376 5117 4520 4448 3486 548 523 495 --21031 666 --
NM_001039802chr131216 927 77 ------
NM_001039840chrX85628 5222 4736 1495 1006 653 188 63 --24428 554 --
NM_001039937chr1373461 3312 3159 2853 2749 1281 63 --13254 23543 3364
NM_001039960chr1211487 --125 --
NM_001040057chr7--11104 11276 --
NM_001040102chr1062493 1950 1924 1728 1014 687 12264 ----
NM_001040103chr1062493 1950 1924 1728 1014 687 12264 ----
NM_001040151chr11124478 3855 3658 3154 1649 1634 1510 1317 882 802 672 217 21442 912 ----
NM_001040152chr774514 4409 4345 1880 1644 703 204 --24781 1693 15146
NM_001040157chr472739 623 594 561 380 341 334 12192 131 --
NM_001040202chr462390 2338 2302 1570 697 79 1484 11639 --
NM_001040284chr1685485 4264 4067 3963 1046 597 227 160 12010 45959 5823 5007 1844 23908 274
NM_001040429chr1373412 3005 2832 2453 992 866 474 --1120 2794 755
NM_001040446chr562388 2182 1997 466 335 177 ------
NM_001040633chr73199 186 179 --1163 --
NM_001040653chr352146 977 576 285 215 11715 ----
NM_001040665chr73485 394 123 13582 31801 667 401 13819
NM_001040875chr852418 1948 510 440 397 --1934 --
NM_001040876chr431823 533 434 1770 1287 --
NM_001042383chr343493 3199 2938 235 --43067 2628 2195 192 13121
NM_001042404chr151630 807 682 419 401 --21447 639 --
NM_001042413chr952493 1046 884 232 148 24123 3416 --22620 631
NM_001042424chr463193 2840 2380 1283 465 365 13136 23285 630 --
NM_001042453chrX165 --1124 --
NM_001042473chr1041855 1423 188 28 1249 ----
NM_001042481chr1442665 1001 442 372 ------
NM_001042486chr20----1193 --
NM_001042510chr822091 1954 --12011 --
NM_001042511chr822091 1954 --12011 --
NM_001042537chrX82504 2298 2164 1576 926 763 663 644 --22021 1919 --
NM_001042543chr421461 1112 1421 2992 572 --
NM_001042555chr1233853 3763 393 22930 299 1639 --
NM_001042599chr2107684 6414 6245 6013 4805 1834 1774 1398 1211 180 26996 2057 12825 --
NM_001042601chr353183 2946 2375 2233 1204 ----12359
NM_001042603chr1264927 4910 4175 1446 922 801 33822 1880 370 45386 4646 2092 1138 14342
NM_001042604chr354773 4081 3064 2966 168 --34888 4647 3030 --
NM_001042681chr182012 1946 1823 996 984 729 404 190 --2112 61 --
NM_001042682chr182012 1946 1823 996 984 729 404 190 --2112 61 --
NM_001042682chr182012 1946 1823 996 984 729 404 190 --2112 61 --
NM_001042683chr651690 1272 677 203 27 1500 --11203
NM_001042749chrX41679 1594 1581 95 11297 11461 --
NM_001042750chrX41679 1594 1581 95 11297 11461 --
NM_001042751chrX41679 1594 1581 95 11297 11461 --
NM_001044385chr2104038 3521 3507 3120 1180 1012 984 712 671 101 ----11378
NM_001046chr562856 887 866 737 730 173 11048 --12878
NM_001068chr32253 71 ------
NM_001071775chr1331359 1234 56 --21815 1451 --
NM_001079874chr132016 1327 160 --11522 --
NM_001099678chr385911 5680 5217 5005 4615 4517 3922 2528 --45867 5274 2450 1730 15473
NM_001100108chr197327 7137 6525 5679 5214 3117 3003 345 95 27232 5397 56571 6401 3079 966 58 13248
NM_001106chr3159106 8534 8388 8275 7951 7484 7414 6839 6418 6282 5961 3896 3592 2755 438 --49149 8924 1715 1191 --
NM_001109977chr4----2731 90 --
NM_001117chr1821807 505 12360 12477 --
NM_001121chr102530 120 21349 1290 11640 --
NM_001122679chr511270 11041 ----
NM_001128chr1673563 3045 2628 755 708 336 173 --11345 --
NM_001128144chr2121 ------
NM_001135chr152836 340 ------
NM_001153chr23357 270 229 ------
NM_001167chrX116532 6389 6281 4780 4752 4553 2432 2424 2308 2131 1662 35925 2673 351 32524 2454 732 1928
NM_001173chr1464500 4363 3434 3426 1428 1382 --1968 24456 3806
NM_001179chr4----1259 --
NM_001186chr2142082 797 752 578 1688 12339 1600
NM_001198chr642054 1647 429 322 --22215 788 1517
NM_001200chr20--1300 2862 119 1233
NM_001201chr493521 3480 3157 3135 2477 482 158 116 58 22535 416 23229 212 --
NM_001204chr2127723 7690 7362 6478 6271 5747 5095 2529 1547 1289 1155 144 --37753 4724 129 --
NM_001206chr963176 2680 2541 1987 388 368 22932 2512 1647 --
NM_001207chr51236 ----1378
NM_001219chr72651 85 1224 --1850
NM_001233chr792387 2326 2297 2271 1982 1784 1756 750 374 1246 21766 192 --
NM_001237chr41984 11014 ----
NM_001237chr41984 11014 ----
NM_001257chr1641528 1177 406 79 ------
NM_001259chr755100 5075 4819 869 515 15367 25811 3952 --
NM_001274chr11174 ------
NM_001288chr61184 ------
NM_001293chr11125 ------
NM_001331chr1152802 2535 2527 2341 462 --31005 820 439 --
NM_001343chr521564 631 ------
NM_001346chr372407 2355 2065 1817 1153 596 315 21968 239 12474 12733
NM_001349chr22393 222 ------
NM_001351chr31228 ----1246
NM_001356chrX32375 1760 876 --1211 --
NM_001357chr1----1247 --
NM_001364chr11124362 3920 3845 3835 3088 3048 1608 1355 798 784 598 78 --2914 217 --
NM_001390chr1842506 1292 503 238 22687 1099 43460 2402 1393 281 --
NM_001401chr95636 590 461 382 301 --2312 163 --
NM_001402chr631710 1573 103 --11765 21889 1850
NM_001412chrX93591 3515 3039 2993 810 760 424 78 40 22710 2687 22359 586 --
NM_001417chr1231647 609 390 21898 478 ----
NM_001418chr111512 ------
NM_001418chr111512 ------
NM_001419chr1984482 3996 3985 3432 1550 1460 1071 320 --14500 --
NM_001431chr61824 21179 1110 153 --
NM_001438chr152669 2640 1050 731 137 --11013 --
NM_001453chr621591 479 ----11397
NM_001460chr1113631 3175 2787 2648 2291 1034 988 447 298 258 87 1713 ----
NM_001465chr571898 1817 1613 1589 1566 820 203 ----12051
NM_001482chr152870 386 --1834 --
NM_001483chr72393 317 1868 ----
NM_001490chr983138 2738 2380 1460 1440 1248 1016 766 1336 11098 12956
NM_001514chr11364 1494 ----
NM_001518chr72953 285 ------
NM_001530chr141998 ------
NM_001533chr191215 ------
NM_001542chr152268 901 863 231 120 1293 32248 738 468 1544
NM_001554chr11519 --1621 --
NM_001584chr111378 1939 11239 1975
NM_001616chr293159 2824 2677 1254 1141 555 409 327 202 1163 ----
NM_001621chr753006 2575 2240 1195 308 ----12866
NM_001621chr753006 2575 2240 1195 308 ----12866
NM_001649chrX52425 2225 1631 1544 106 --22104 825 --
NM_001650chr1862944 2810 2537 80 53 31 12921 23068 297 14040
NM_001664chr32420 108 1887 ----
NM_001668chr142234 1704 1423 216 --21897 208 --
NM_001682chr121106 22622 140 --12212
NM_001684chr183869 3447 3133 1539 1526 1081 1028 80 1167 13051 --
NM_001698chr9--1200 ----
NM_001699chr1981556 1532 1368 1338 1287 1267 1245 263 ----11212
NM_001709chr1122255 1049 11118 22239 1784 12530
NM_001717chr1551007 483 398 352 268 --11494 --
NM_001718chr651292 1258 1175 433 102 --21374 145 --
NM_001723chr6--1767 --1186
NM_001745chr541147 1105 357 281 ------
NM_001746chr522852 420 --11136 12590
NM_001753chr741792 1440 1292 449 ------
NM_001754chr2173667 3528 3200 1545 908 662 309 --23601 369 --
NM_001777chr331233 977 835 22784 668 ----
NM_001791chr131216 927 77 ------
NM_001796chr161277 ------
NM_001806chr1952923 2436 2117 1180 991 12275 12590 --
NM_001819chr201297 ------
NM_001822chr21575 ------
NM_001850chr3138 ------
NM_001854chr121376 1011 --11321 --
NM_001858chr6114748 4245 4233 4067 3459 2025 1496 1433 1404 1143 952 1399 --34776 3798 3340
NM_001872chr13----2380 112 --
NM_001873chr4175 1271 --2441 247
NM_001880chr2--1231 ----
NM_001892chr52573 548 ----1622
NM_001901chr61128 --1209 --
NM_001918chr1148702 8164 8027 7507 6886 6518 5759 3454 3307 2624 2587 951 280 158 29258 5698 29015 7334 --
NM_001921chr431224 1166 29 --11149 --
NM_001931chr1141290 1212 809 214 ------
NM_001945chr551208 902 538 424 105 --31298 397 86 --
NM_001949chr643176 2193 809 666 --12317 --
NM_001950chr163794 716 201 1676 --1686
NM_001951chr82486 56 --1627 --
NM_001957chr442150 1957 1853 270 --1411 --
NM_001959chr2244 36 ------
NM_001967chr31132 ------
NM_001968chr43312 53 33 ------
NM_001969chr1433945 1284 1026 --23270 1175 --
NM_001980chr1262151 1988 1851 1399 243 35 12122 32249 693 360 --
NM_001981chr111930 1554 --21646 668
NM_001987chr1254007 3939 2721 1460 931 --23832 3032 --
NM_001999chr531358 132 74 1475 1188 --
NM_002006chr4115346 4831 4688 4250 4059 3837 2183 1859 1203 925 284 11072 21549 897 --
NM_002009chr1582428 1894 1716 430 322 146 112 42 1217 32259 1867 190 11940
NM_002015chr1352857 644 618 235 160 1770 1303 --
NM_002021chr1--141 ----
NM_002024chrX52226 2036 383 248 181 --1736 --
NM_002025chrX148896 8509 8493 7839 6707 5943 3607 3365 2756 2019 1800 1749 1482 1073 1854 37410 2299 624 13201
NM_002026chr2--1916 2823 275 1683
NM_002033chr1184135 3344 2707 2655 1312 1221 497 478 --23636 3030 --
NM_002035chr1883404 3366 2535 1145 1101 605 230 25 --33899 3020 393 14044
NM_002040chr2131178 269 21 1785 23034 929 --
NM_002044chr153610 591 326 1259 2274 57 11035
NM_002051chr10--1725 ----
NM_002065chr131871 1277 1131 21711 1684 1401 --
NM_002069chr73755 728 120 ------
NM_002089chr41186 ------
NM_002092chr474473 3749 3574 2025 1360 1257 68 --11343 --
NM_002114chr61493 ------
NM_002126chr1773730 3247 3097 2643 1289 1071 384 1603 ----
NM_002128chr1382299 2096 1837 980 938 829 793 99 --32278 1766 110 --
NM_002129chr42138 119 ------
NM_002130chr521181 406 --21126 24 --
NM_002136chr123260 170 71 ------
NM_002138chr43805 786 62 ----2741 604
NM_002147chr17--1631 ----
NM_002154chr5----197 --
NM_002158chr233209 463 70 11056 31185 335 243 1613
NM_002160chr91401 ------
NM_002163chr1621194 452 1437 1322 1501
NM_002165chr201304 ------
NM_002166chr21752 --1226 --
NM_002196chr203832 808 727 --1695 --
NM_002196chr203832 808 727 --1695 --
NM_002199chr44988 880 741 179 ------
NM_002203chr533738 1662 357 13268 --13219
NM_002207chr32694 93 ------
NM_002210chr222724 2660 163 32690 483 97 --
NM_002214chr783570 2106 1774 989 557 218 137 60 11937 34209 3518 2052 --
NM_002223chr1283884 3160 2657 1558 1201 695 480 264 --33937 745 252 --
NM_002241chr192837 2783 2646 2508 2477 2431 2209 1118 430 22846 1930 12968 --
NM_002242chr272040 1689 1633 1618 1510 1341 1282 1585 --11727
NM_002253chr471161 1110 921 508 443 176 58 ------
NM_002264chr3104934 4420 3186 2015 1584 961 530 391 338 252 14512 24735 1494 14282
NM_002267chr1372379 2068 1804 824 491 409 89 --11702 --
NM_002268chr31704 --1166 --
NM_002269chr6158 --1332 --
NM_002270chr584981 4598 3543 3528 1809 1305 1136 55 1823 23643 1038 --
NM_002271chr1341640 924 669 236 1811 1948 1547
NM_002285chr274159 4060 3591 3461 3189 1149 976 21374 750 13987 --
NM_002293chr132303 2296 78 --1665 --
NM_002310chr5105699 5109 5033 4551 4422 795 496 480 285 219 25728 4302 12207 --
NM_002312chr131775 --1765 --
NM_002336chr1284747 3843 3697 3675 3490 1951 945 201 1873 34122 3156 1210 --
NM_002350chr871101 1057 867 834 498 340 215 ------
NM_002374chr2103405 3322 3011 2403 2377 1464 1139 715 512 314 --11217 --
NM_002375chr341657 1569 1543 1410 ------
NM_002387chr594838 4408 3755 3736 3372 3224 649 475 106 --43601 1098 502 357 34819 1048 785
NM_002395chr621047 591 --1108 11476
NM_002397chr552109 1663 1561 249 242 11753 21932 834 --
NM_002398chr251541 1239 979 588 41 ----21318 1122
NM_002399chr1521399 553 --21122 377 1996
NM_002408chr14------1172
NM_002449chr51237 ------
NM_002451chr963796 3660 3450 2477 1146 163 ----1440
NM_002481chr187806 7541 6945 6762 5912 5605 2474 2317 35537 1249 1236 1355 16593
NM_002485chr852120 1523 641 290 192 --11896 --
NM_002487chr152812 558 ------
NM_002491chr2------1108
NM_002508chr131960 1735 175 21884 250 --1722
NM_002515chr14------1260
NM_002545chr11114804 4634 4391 3606 3429 3279 1832 643 571 118 52 34854 4688 4489 15066 --
NM_002556chr1141965 800 753 376 --11886 1456
NM_002577chr3102474 1441 1372 1219 818 774 756 712 437 285 12935 ----
NM_002581chr9114351 3959 2114 2067 1254 1193 1175 1120 771 637 153 14735 24659 3680 1798
NM_002590chr131495 --1569 --
NM_002594chr2011727 1523 ----
NM_002603chr8----1141 --
NM_002612chr741482 652 348 187 ----11850
NM_002633chr11501 ------
NM_002635chr121383 1152 ----
NM_002645chr1152933 2917 1195 1160 824 --1287 --
NM_002646chr1111761 1344 1338 782 649 493 464 454 193 74 59 --1814 --
NM_002655chr864530 1485 1085 993 661 562 15206 1243 13696
NM_002656chr631076 964 96 --183 --
NM_002662chr362131 1734 1553 592 479 166 1700 2185 28 --
NM_002667chr62141 135 --2970 900 --
NM_002670chr351522 1493 1454 1372 285 ------
NM_002687chr1431093 1075 244 --146 --
NM_002703chr421621 136 --1688 --
NM_002709chr263197 2842 2636 1382 780 33 13153 21351 1168 11153
NM_002713chr12991 925 --2823 215 1470
NM_002715chr51287 1996 --1968
NM_002718chr362674 2633 2129 2027 1783 499 --194 --
NM_002719chr1472412 2178 1914 1634 1594 841 800 1693 1420 --
NM_002725chr173459 3195 3068 1631 183 174 44 --1285 --
NM_002731chr152647 2616 631 550 475 --12110 --
NM_002734chr1741579 1566 456 220 12164 22118 350 --
NM_002736chr731840 1664 169 12145 1863 --
NM_002737chr1786192 5905 5588 5509 2363 1988 1834 1594 12653 25361 2237 15539
NM_002740chr352141 2075 849 824 415 ----12456
NM_002745chr2274521 4028 2827 1677 1596 434 28 --13673 2818 804
NM_002752chr51222 ------
NM_002755chr152629 141 ------
NM_002758chr172421 363 ----1222
NM_002763chr1177 ------
NM_002767chr171388 ------
NM_002787chr74653 643 238 82 ------
NM_002822chr1231510 1287 167 --1652 --
NM_002835chr73723 538 294 166 ----
NM_002837chr1254584 2823 1658 441 315 ----11004
NM_002843chr1172997 2839 2624 2364 2321 766 332 ----13446
NM_002844chr62176 115 --194 11404
NM_002848chr1221062 859 ----1159
NM_002851chr71542 --1180 --
NM_002886chr375180 4800 4425 4323 4061 3745 3539 33808 3477 2024 34692 1450 999 --
NM_002890chr52670 147 ------
NM_002892chr1411300 ------
NM_002906chr1132321 2175 280 --1813 --
NM_002911chr192641 569 ------
NM_002922chr12706 676 ------
NM_002940chr431823 533 434 1770 1287 --
NM_002942chr31496 11295 ----
NM_002956chr1241280 545 398 82 1905 ----
NM_002959chr1114458 3601 3058 2923 2760 2728 1642 1107 1061 1053 801 43517 1080 1072 837 13551 --
NM_002977chr233441 2745 1117 --12988 1684
NM_003003chr171214 ------
NM_003011chr9----11724 --
NM_003016chr1731233 468 333 --21530 1513 --
NM_003022chrX2847 802 21126 95 11082 --
NM_003024chr21--1348 ----
NM_003034chr12137391 6855 6714 6242 5137 5056 4944 3218 1507 809 428 222 23 32473 2460 505 --22165 1112
NM_003045chr1374014 4002 3709 3613 3510 968 853 44818 4517 3893 3577 14386 --
NM_003048chr252858 2586 2477 1832 792 --22321 328 --
NM_003051chr141884 549 506 270 ----1473
NM_003068chr811067 --1968 1336
NM_003070chr91225 ----1590
NM_003095chr121136 --151 --
NM_003099chr15105615 5434 5128 5122 4783 4274 4147 2503 2438 696 44173 1840 1784 106 15251 --
NM_003101chr131201 115 37 ----11261
NM_003107chr6102364 2033 1888 1672 956 922 623 563 432 389 --11047 --
NM_003108chr2117311 6321 6222 6015 5433 5117 4794 4759 2113 1277 1202 --35237 1305 1022 24775 1228
NM_003113chr2196 --1107 --
NM_003118chr552092 1981 1910 571 376 1121 --11736
NM_003128chr21222 ----12552
NM_003142chr21224 ------
NM_003155chr852250 2110 780 601 150 1827 11750 --
NM_003156chr1111404 ------
NM_003161chr1743193 3154 2855 544 --23201 1101 --
NM_003182chr71395 ------
NM_003182chr71395 ------
NM_003199chr1854096 3719 1225 707 290 13881 35609 3457 758 1947
NM_003204chr1741744 1543 1386 1298 2701 92 ----
NM_003217chr1251877 725 696 334 31 --21715 678 --
NM_003222chr2051179 1069 873 164 45 ------
NM_003262chr365153 4618 2019 1512 494 483 1956 15301 --
NM_003286chr20----2953 870 --
NM_003292chr15652 487 459 215 35 ------
NM_003298chr3126263 5892 5815 5585 5248 4972 4613 4039 1233 308 224 164 --24222 2128 --
NM_003304chr32236 52 ------
NM_003309chr641796 1573 1337 161 ------
NM_003338chr1041400 578 389 179 21839 1722 ----
NM_003340chr441106 458 318 243 ----1169
NM_003342chr1793006 2825 2126 1162 1012 908 501 378 98 ------
NM_003359chr4--1448 1871 --
NM_003367chr191121 ------
NM_003369chr1172642 2610 1945 1114 187 132 24 21865 1837 1201 --
NM_003371chr941879 1740 31 22 --21434 609 --
NM_003380chr101119 ------
NM_003392chr354322 3568 3291 2876 813 11497 23511 255 --
NM_003405chr222755 303 ------
NM_003410chrX42839 1037 779 456 11987 ----
NM_003412chr342600 1937 1000 42 12497 22361 224 --
NM_003421chr1064346 4129 1726 1130 824 806 --44505 3937 2786 905 13535
NM_003439chr793174 2475 1134 861 640 558 355 238 210 --42611 2215 964 586 --
NM_003463chr663191 2906 2496 343 206 151 ------
NM_003468chr274284 4266 3818 3642 2918 1254 1012 ----12758
NM_003471chr331868 437 329 12042 12149 11894
NM_003472chr6138 11218 ----
NM_003478chr1132281 653 95 --33009 2988 1283 --
NM_003482chr1252233 2083 1973 885 418 --22558 918 --
NM_003483chr1262688 2652 2242 1942 524 180 12026 ----
NM_003507chr231836 311 151 --2225 212 11528
NM_003558chr9----1538 --
NM_003566chr1232494 180 45 ----12911
NM_003574chr1865292 5253 5125 3583 2154 132 14466 45102 4613 4476 59 25339 952
NM_003583chr1233875 2552 540 --33457 3022 1468 1994
NM_003589chr1341362 943 405 154 11430 1162 --
NM_003590chr292822 2800 2514 1535 1318 1199 652 442 187 --34010 2969 2936 14058
NM_003597chr212258 --12018 12223
NM_003607chr1104372 4326 3725 3685 3526 3323 1554 342 332 201 ------
NM_003615chr363626 3215 2949 1379 1177 158 --13392 --
NM_003617chr164303 4141 1454 1312 343 308 11186 44241 1234 654 490 --
NM_003620chr1721022 333 ------
NM_003633chr552608 1687 578 125 67 1666 ----
NM_003644chr17105922 5786 5591 5555 5525 5463 4781 4745 4701 348 --32611 855 584 --
NM_003645chr15189 ----1175
NM_003651chr121133 --1144 --
NM_003659chr21337 1886 ----
NM_003663chr353269 2696 805 642 371 --43466 2750 2470 798 1603
NM_003664chr5----1477 --
NM_003671chr963313 3197 2221 684 41 33 12603 ----
NM_003672chr14418 354 217 155 ------
NM_003677chr1252132 1799 780 353 313 11787 11581 --
NM_003690chr2--1137 1586 --
NM_003716chr31154 ------
NM_003722chr34639 364 329 284 --12160 --
NM_003743chr251893 1690 1580 446 78 --1322 --
NM_003750chr101624 ------
NM_003758chr1531493 648 500 --11521 --
NM_003758chr1531493 648 500 --11521 --
NM_003759chr453558 2772 973 823 604 13782 --13184
NM_003766chr17--1587 2608 36 --
NM_003772chr113459 364 93 1895 --1446
NM_003774chr1282722 2634 2550 1021 948 683 479 77 1305 ----
NM_003791chr164533 265 235 185 1212 1415 --
NM_003794chr32373 182 ------
NM_003825chr1511305 11206 1301 --
NM_003846chr11617 1120 ----
NM_003861chr1472452 2342 1802 1095 1059 802 277 1502 ----
NM_003872chr253045 2545 1124 1008 59 1764 12204 --
NM_003873chr1032369 1821 122 22079 1639 22358 917 --
NM_003884chr341518 505 212 102 --1429 --
NM_003888chr1541129 687 672 113 ----11707
NM_003890chr19----127 --
NM_003908chr202561 250 1515 1113 --
NM_003913chr6103421 3306 2737 1237 1203 914 802 333 224 43 --13646 --
NM_003941chr762367 2203 1965 1666 1658 295 --12440 --
NM_003948chr482452 2292 1904 1858 831 795 681 191 12119 22581 169 --
NM_003953chr142049 681 403 292 1621 ----
NM_003958chr673429 3297 2984 1462 600 127 30 ------
NM_003966chr556919 6130 2510 1834 81 35334 3134 1748 15088 --
NM_003980chr621281 1146 ----2902 133
NM_003994chr1264134 717 432 263 254 240 1906 ----
NM_004004chr1351219 1056 1047 106 76 ------
NM_004006chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004007chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004009chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004010chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004011chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004012chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004013chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004014chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004015chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004016chrX52529 1610 573 312 129 32103 1009 734 22025 502 1915
NM_004017chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004018chrX52529 1610 573 312 129 32103 1009 734 22025 502 1915
NM_004020chrX52615 1696 659 398 215 22189 820 22111 588 11001
NM_004021chrX52529 1610 573 312 129 32103 1009 734 22025 502 1915
NM_004022chrX52529 1610 573 312 129 32103 1009 734 22025 502 1915
NM_004023chrX52529 1610 573 312 129 32103 1009 734 22025 502 1915
NM_004028chr1862944 2810 2537 80 53 31 12921 23068 297 14040
NM_004037chr11889 ------
NM_004050chr1482791 2626 2496 2439 2358 2282 1104 1034 2840 333 21914 707 1641
NM_004061chr52141 41 ------
NM_004065chrX2199 59 124 3234 217 35 --
NM_004067chr721448 1225 --11167 --
NM_004077chr1241337 982 407 250 --1150 189
NM_004081chrY31652 1412 323 --11535 1342
NM_004085chrX1835 ----1722
NM_004087chr33776 394 315 ------
NM_004094chr1462551 2515 1191 430 334 68 ------
NM_004098chr1021067 158 21155 953 2883 488 11300
NM_004113chr351958 634 305 224 132 11549 11870 --
NM_004114chrX3977 791 244 --11117 11033
NM_004124chr1453414 2205 1274 598 241 --2830 443 --
NM_004133chr832640 2062 1908 11752 199 --
NM_004161chr21484 --11245 --
NM_004171chr11139402 7546 7510 7401 6655 6545 3388 3163 2718 1510 1324 908 371 48465 2939 2617 136 --13625
NM_004172chr52627 127 11661 1460 11871
NM_004180chr21579 ------
NM_004185chr11236 ------
NM_004187chrX11265 ------
NM_004232chr1833064 2867 2515 12826 --1521
NM_004272chr53369 81 59 11929 11242 --
NM_004274chr1442261 1249 1139 313 11118 --12029
NM_004279chr752274 1930 1610 296 133 ------
NM_004293chr983868 3487 3131 2669 2631 1389 1243 393 1241 --31203 718 299
NM_004329chr1031338 414 396 --21189 276 --
NM_004331chr882381 2260 1893 1055 953 916 802 697 1773 --12535
NM_004337chr82613 91 1796 21780 47 12180
NM_004338chr18127030 6696 5773 2713 2548 2368 2161 1902 1008 854 825 340 16582 26901 5573 --
NM_004354chr41611 --1306 --
NM_004369chr21495 ------
NM_004380chr1621865 822 --2487 377 --
NM_004397chr1183674 2707 1480 1407 1185 868 165 30 ----1117
NM_004407chr431024 954 50 --1360 --
NM_004412chr1066011 5437 4896 3799 2312 1245 15367 21041 777 --
NM_004430chr862318 1990 1930 1014 582 411 --12447 --
NM_004432chr932293 353 150 ----1813
NM_004437chr183593 2680 2368 423 380 107 99 92 13478 22659 1199 --
NM_004438chr263165 3040 2166 1048 716 456 ------
NM_004440chr631222 297 147 --1448 1129
NM_004450chr141122 ------
NM_004457chr211513 --1499 21350 1192
NM_004458chrX42606 2489 1794 548 1919 12123 --
NM_004459chr1721707 1437 --1106 --
NM_004464chr443716 3051 1438 675 --33212 2946 786 13562
NM_004482chr21209 --1387 --
NM_004496chr1431314 1026 167 --11357 --
NM_004500chr1411749 --1564 11393
NM_004504chr252622 2532 2184 2133 1975 22547 834 22002 722 --
NM_004505chr17----31669 1609 352 --
NM_004514chr1762137 2082 946 492 340 102 --23044 2943 --
NM_004529chr911086 ------
NM_004537chr1221163 1032 ------
NM_004538chrX1544 ------
NM_004555chr16139 ------
NM_004575chr451176 1169 518 436 128 --1349 --
NM_004586chrX31801 1753 190 24582 3754 54826 4303 3579 3496 3479 --
NM_004598chr572906 2516 1221 671 585 279 76 13254 ----
NM_004602chr201984 ----21029 955
NM_004612chr974782 4080 3572 3174 2951 1819 454 --23735 1671 11108
NM_004654chrY21230 493 --11426 11156
NM_004660chrY31693 536 517 1841 ----
NM_004663chr152634 27 159 ----
NM_004666chr631526 181 66 ------
NM_004670chr102490 292 --21242 302 --
NM_004673chr121520 354 --11586 --
NM_004680chrY--2295 49 ----
NM_004694chr172695 291 ------
NM_004703chr17102506 1947 1806 1674 599 306 256 229 148 116 1885 ----
NM_004711chr2263652 3444 2621 2455 980 575 ------
NM_004715chr181687 ------
NM_004717chr75553 538 464 312 215 11256 11229 --
NM_004726chrX95045 4799 4658 2194 1854 1744 1550 894 885 1521 14712 1641
NM_004734chr1373007 2190 681 159 150 80 57 --13201 --
NM_004742chr32673 411 ------
NM_004744chr4143711 3573 3515 3429 3369 3348 3102 2843 2708 2590 1437 1306 1038 353 1205 22970 176 1363
NM_004745chr876294 5843 5741 5688 5122 2078 1287 17004 16133 --
NM_004759chr131785 1481 549 12184 ----
NM_004760chr722239 164 2488 189 130 --
NM_004763chr271131 1106 1039 968 826 382 106 ------
NM_004774chr1722654 572 --32679 2552 504 1691
NM_004775chr1842419 1586 616 428 ----1640
NM_004776chr2072926 2624 2451 1219 1037 212 60 ----12255
NM_004779chr52821 396 --31336 1075 134 --
NM_004781chr141379 1292 556 373 1218 149 --
NM_004781chr141379 1292 556 373 1218 149 --
NM_004788chr1172260 2201 2096 745 701 551 171 2762 486 ----
NM_004796chr1432157 1574 680 11875 1365 --
NM_004799chr1285 34 ----1320
NM_004801chr221041 449 --31418 560 135 --
NM_004808chr1073175 2821 2798 2598 1038 984 229 --32835 2730 2669 --
NM_004815chr174197 3742 3457 3145 1765 1098 103 --21477 583 11691
NM_004834chr242817 2247 1136 218 1461 22435 2199 --
NM_004835chr31741 ------
NM_004835chr31741 ------
NM_004842chr61121 1701 ----
NM_004845chrX83999 3921 3870 2719 2590 1347 288 203 --11245 --
NM_004849chr63586 483 139 ----21228 236
NM_004850chr261778 1119 318 250 113 62 ------
NM_004855chr152190 80 ------
NM_004857chr1463979 3792 3401 904 866 147 2517 96 --14127
NM_004859chr1732468 2071 469 --1123 12674
NM_004863chr14114928 4449 4176 4040 3676 3483 2105 1855 1303 584 354 --11404 --
NM_004867chrX1255 146 ----
NM_004871chr1794261 4094 3191 2886 2699 1473 1420 380 124 --13478 --
NM_004888chr9--1174 1192 --
NM_004896chr1021520 1084 1480 ----
NM_004898chr442824 2164 1884 445 --11946 --
NM_004904chr796515 6496 6288 5780 5557 4791 2374 116 97 15086 16549 11135
NM_004906chr6----1691 --
NM_004929chr831437 1240 1136 1539 1288 --
NM_004939chr2----125 --
NM_004949chr1862048 1681 1469 1383 724 59 ------
NM_004956chr7104267 3662 3366 3352 2984 2833 1775 1615 420 278 --14245 11478
NM_004964chr1165 ------
NM_004965chr212539 531 --1737 --
NM_004972chr931019 805 288 21070 37 ----
NM_004973chr651690 1508 696 412 205 --2341 114 --
NM_004976chr1154894 4702 3684 770 255 14161 15119 14306
NM_004985chr1263322 1794 1549 1252 947 694 13427 43765 3306 807 252 13140
NM_004999chr673616 3370 1500 1309 649 286 120 44371 4126 3824 72 13902 --
NM_005010chr752102 1974 1756 639 524 ------
NM_005012chr1------161
NM_005022chr171238 ------
NM_005028chr1011805 ------
NM_005036chr22158299 8224 7895 6191 5578 5253 5233 2931 2651 1852 1422 858 821 235 226 --22752 507 --
NM_005040chr112329 107 ------
NM_005044chrX104198 3690 3498 3152 1224 1201 655 325 242 36 24124 301 11149 --
NM_005056chr1285171 5154 4419 3457 1690 1166 1045 128 34066 2124 614 35630 4890 1382 14586
NM_005057chr131816 1648 1565 --2551 233 --
NM_005063chr1052827 2733 2382 844 479 --21417 644 --
NM_005065chr1484209 4091 4029 2092 1808 1781 1376 1221 11548 34400 2012 1575 --
NM_005066chr11634 ------
NM_005080chr221621 ------
NM_005088chrX2775 676 ------
NM_005093chr2085376 5117 4520 4448 3486 548 523 495 --21031 666 --
NM_005105chr151920 1747 214 70 36 ----1619
NM_005109chr352541 1798 1669 927 920 ------
NM_005113chr143452 99 45 ----1431
NM_005114chr4--1485 1280 1509
NM_005121chr1752763 2683 1491 1476 1199 12454 33267 3055 2377 --
NM_005124chr62773 741 --1110 --
NM_005126chr382168 1721 1580 1456 442 419 273 117 11407 --1355
NM_005133chr11--1421 ----
NM_005141chr4------1408
NM_005153chr16----1648 --
NM_005156chr9104682 4626 4113 3941 2035 1858 928 653 391 296 1566 12133 --
NM_005164chr1272480 2195 2142 1003 604 391 43 1283 21854 126 --
NM_005180chr101192 --1234 --
NM_005188chr11108188 8056 7379 6180 5648 5294 5117 2696 2521 414 27709 3219 87941 7701 5484 5317 3227 489 342 148 27233 336
NM_005190chr621018 56 1859 ----
NM_005197chr1496052 5306 4752 4207 3782 1405 1079 799 61 25526 1435 15425 --
NM_005207chr2253432 3371 2763 875 536 32642 2333 1265 13056 --
NM_005221chr71109 --1249 --
NM_005233chr32990 780 11734 1383 11749
NM_005235chr2107684 6414 6245 6013 4805 1834 1774 1398 1211 180 26996 2057 12825 --
NM_005238chr1172887 2332 1309 1025 532 289 266 2905 776 32602 1393 189 --
NM_005239chr2131585 1493 354 21428 688 1794 1626
NM_005240chr12288 167 --2629 62 --
NM_005241chr331257 76 64 1444 --11393
NM_005243chr22--140 1227 --
NM_005245chr41303 ------
NM_005249chr141305 ------
NM_005254chr152251 108 41392 972 560 129 1449 --
NM_005257chr1861394 513 405 307 265 152 --1321 --
NM_005261chr81231 --1168 --
NM_005277chr41739 1754 1299 --
NM_005302chr7--128 ----
NM_005310chr171375 ------
NM_005311chr772644 2203 1864 772 499 145 27 1164 ----
NM_005316chr112300 168 --21109 818 --
NM_005329chr1672377 1995 1955 1832 1799 815 498 ------
NM_005338chr783815 3713 3524 2899 2813 2504 1360 155 ------
NM_005339chr453332 1391 305 138 85 13916 22886 1611 13212
NM_005359chr18136329 6171 6147 6125 5414 5408 5022 4215 4189 2022 1464 1128 222 12560 35676 5595 1344 15473
NM_005370chr192872 501 ------
NM_005375chr63838 771 266 1454 ----
NM_005387chr112283 249 1172 ----
NM_005388chr94467 236 215 25 ----11230
NM_005397chr793700 3550 3425 2832 1533 1121 388 268 85 --11497 --
NM_005398chr101111 ------
NM_005399chr1134210 4111 3897 3614 3372 2836 1619 1510 1077 1050 833 88 80 --41766 1222 970 329 --
NM_005400chr272853 2773 2133 469 370 55 21 --12552 --
NM_005406chr1871072 583 485 353 124 111 57 ------
NM_005410chr53543 145 104 ------
NM_005433chr1872220 2067 1815 1775 954 878 60 ------
NM_005443chr41433 ------
NM_005460chr52451 237 ------
NM_005465chr151816 1456 680 579 368 ----1443
NM_005475chr1253036 2380 1009 971 374 ----1104
NM_005493chr6186 ------
NM_005494chr71161 --181 --
NM_005497chr1786177 5737 5396 5318 2335 2051 1385 539 13987 36148 5932 4664 15809
NM_005504chr1296325 5912 5558 4721 4022 2202 1492 661 87 22416 843 24778 470 12529
NM_005509chr521721 1270 --11494 --
NM_005522chr741317 553 176 51 21344 538 ----
NM_005534chr212533 77 --1507 --
NM_005542chr751874 1681 1331 341 74 --2448 38 --
NM_005575chr51630 --1699 --
NM_005578chr3125141 4930 4496 3635 3494 1649 1433 1111 967 644 399 148 13463 45153 3889 802 226 --
NM_005584chr132801 568 --1226 --
NM_005585chr15--1129 ----
NM_005593chr121130 --2103 63 --
NM_005596chr9115939 4782 4622 4521 4123 4117 2313 2294 772 521 183 21917 647 ----
NM_005599chr12549 325 --11436 --
NM_005602chr321006 933 ------
NM_005603chr1861887 1855 1476 1402 476 59 11993 2184 69 --
NM_005607chr81818 ------
NM_005625chr83941 758 175 2313 231 ----
NM_005655chr821218 292 ------
NM_005662chr8126 ------
NM_005667chr21449 --1284 --
NM_005668chr574168 3469 3435 3094 1134 481 449 13127 34293 664 57 --
NM_005669chr532284 1447 127 --12245 --
NM_005694chr3150 ------
NM_005707chr1521161 376 ----1208
NM_005711chr511072 ------
NM_005717chr12438 365 --1969 --
NM_005718chr31244 ------
NM_005721chr22865 295 ------
NM_005722chr222507 283 1874 ----
NM_005725chr162120 1946 904 859 729 433 --12425 --
NM_005730chr12103144 2620 2217 1016 661 605 398 388 320 42 --22967 1002 --
NM_005746chr752466 2378 457 383 320 --1793 --
NM_005748chr1263090 2515 2262 1294 1152 156 1192 13240 --
NM_005749chr17----1587 --
NM_005776chr144884 804 581 171 --1202 --
NM_005778chr3----1453 --
NM_005788chr112698 631 2751 241 ----
NM_005795chr212379 12265 282 53 --
NM_005798chr1384368 3278 1614 1390 1286 806 680 70 --1744 --
NM_005813chr241947 606 446 429 --1500 1422
NM_005822chr652384 2194 760 741 693 11746 12334 --
NM_005828chr17124929 4854 4654 4289 3962 3726 3504 3310 3225 1822 1760 1349 --1229 --
NM_005832chr32582 466 11137 11457 --
NM_005840chrX147349 7111 6696 6402 5850 5524 5183 2260 1795 1346 1279 1237 1102 291 --15174 15922
NM_005853chr162545 25 1484 ----
NM_005859chr51413 --11022 --
NM_005863chr1041394 1232 1095 34 11113 1907 --
NM_005866chr9----1896 --
NM_005880chr1641552 1178 314 239 ------
NM_005885chr551057 201 155 71 55 --1380 --
NM_005888chr121383 1152 ----
NM_005898chr1193200 3148 3056 2790 2059 674 553 338 145 ------
NM_005901chr18148443 8238 7984 7801 7398 7196 7106 6955 5906 5705 3277 2338 1419 524 17758 37090 501 228 2238 33
NM_005902chr15134505 3514 3324 3116 3081 2813 1805 1679 1651 1248 560 375 32 --14571 --
NM_005903chr584785 4656 4104 3432 1565 1232 1039 39 33808 3160 913 ----
NM_005904chr1831428 1215 1117 11238 ----
NM_005909chr553200 3040 1523 1206 704 13678 --13487
NM_005910chr1793976 3544 3339 3058 2924 2742 992 832 169 13945 11023 --
NM_005927chr541195 919 476 345 ----1234
NM_005933chr1192348 2206 2065 1154 987 786 625 577 281 ----11105
NM_005935chr4104527 3847 3616 2054 1379 1247 1194 1175 1120 543 --1783 --
NM_005941chr883178 3024 2751 1261 1178 604 322 99 --13962 13152
NM_005955chr195314 5141 4961 4062 3812 3498 3450 1526 1023 1954 14099 --
NM_005966chr251939 911 499 132 111 143 22420 1648 1266
NM_005999chr121532 1138 1477 1400 164
NM_006007chr974451 4052 2955 1052 988 415 21 --54519 3604 3327 3273 923 --
NM_006015chr111180 --21353 281 --
NM_006016chr632152 2010 26 1563 --11578
NM_006031chr21----151 --
NM_006033chr1872341 2266 1847 1544 809 384 260 --21458 40 --
NM_006037chr264911 3910 3713 3572 3490 1376 --14252 --
NM_006047chr2073424 3112 1420 1300 1101 427 161 22731 2404 1720 --
NM_006055chr273233 3162 2362 1990 1232 543 110 11176 11957 --
NM_006060chr764372 3882 1516 774 753 57 23416 3275 1187 --
NM_006067chr161280 --1341 1765
NM_006079chr62684 535 ------
NM_006080chr752499 2455 1167 264 180 1246 22800 2195 --
NM_006095chr443995 2878 1091 852 31630 1498 418 ----
NM_006106chr1163044 2284 2091 673 531 524 1359 22745 2413 12361
NM_006107chr174350 211 192 37 --152 --
NM_006108chr1152303 2140 1501 535 301 11944 12109 11739
NM_006113chr132016 1327 160 --11522 --
NM_006136chr711302 ------
NM_006139chr261797 1088 707 390 194 171 --12540 --
NM_006147chr12423 182 3332 143 72 ----
NM_006154chr1522878 557 ------
NM_006159chr12124 ------
NM_006160chr1711013 ------
NM_006164chr2--1302 ----
NM_006166chr1282457 2302 1984 707 701 490 303 81 --11855 --
NM_006180chr931421 810 130 --11981 1664
NM_006186chr22791 323 --1467 --
NM_006195chr921211 563 ----1233
NM_006197chr831487 852 753 2302 183 ----
NM_006203chr5114939 4798 4625 4318 4250 3863 3616 3552 3389 579 328 15405 45115 4091 1981 234 15008
NM_006206chr482662 2419 2178 2117 1082 606 413 378 --197 --
NM_006218chr31274 ------
NM_006241chr372370 2220 2171 878 731 586 152 --21928 1504 --
NM_006251chr532810 2281 2046 1254 ----
NM_006252chr1127333 6926 5718 5131 2344 1758 1475 1265 660 579 445 401 --42677 2292 515 257 --
NM_006255chr143958 344 220 ------
NM_006256chr122444 1117 32135 1006 639 2743 136 12497
NM_006258chr1071506 1500 608 579 445 310 88 ----1156
NM_006265chr841227 612 234 97 --11075 --
NM_006273chr172430 157 --1327 --
NM_006275chr2031996 1565 257 --1405 1469
NM_006281chr811036 --191 --
NM_006281chr811036 --191 --
NM_006282chr2084276 3591 3583 3353 1212 467 266 40 --21052 350 --
NM_006283chr884193 4179 4111 4104 4040 3716 1009 715 ----13203
NM_006298chr673340 2839 2539 2460 1326 1288 782 23415 3225 ----
NM_006306chrX125527 4684 4671 4564 4548 4175 4163 3783 3625 1799 1568 735 14866 35488 5127 3730 --
NM_006308chr51117 ------
NM_006313chr1231721 664 138 ------
NM_006315chr441471 1443 404 102 ----1491
NM_006317chr51664 ------
NM_006320chr42806 743 --1150 --
NM_006359chrX82504 2298 2164 1576 926 763 663 644 --22021 1919 --
NM_006363chr20195 --2595 63 --
NM_006371chr384789 4762 4129 3707 3533 1662 760 21 11706 ----
NM_006378chr941272 1068 581 377 ----11393
NM_006379chr742219 877 577 236 ------
NM_006380chr1754241 3849 1592 763 575 --12688 --
NM_006390chr1241674 1290 303 266 ------
NM_006393chr1084442 3727 3140 1782 1386 1303 920 299 --13274 13632
NM_006420chr2022290 2221 12145 --22179 172
NM_006421chr831083 956 338 11030 2836 480 --
NM_006459chr1021519 427 185 ----
NM_006471chr18158 ------
NM_006482chr1233875 2552 540 --33457 3022 1468 1994
NM_006489chr14------1260
NM_006504chr1042204 636 484 376 11078 --12908
NM_006520chrX11624 ----11112
NM_006526chr2042205 1884 1676 1633 ------
NM_006529chr421452 1103 1412 1563 --
NM_006534chr2042160 962 556 158 --12508 --
NM_006537chr151573 ----179
NM_006538chr254164 3700 3221 1012 778 1967 13274 --
NM_006540chr821563 430 21428 1152 31434 1025 437 --
NM_006544chr14125849 5202 4651 4088 2178 2105 1558 1331 1020 998 910 715 16081 11802 --
NM_006546chr1766115 5013 4947 4511 1114 1005 24609 1345 56032 5643 4661 1907 988 --
NM_006549chr1252790 1808 1034 845 708 --22050 180 --
NM_006559chr111154 1211 1385 1486
NM_006561chr1066107 4883 4816 2317 362 273 ----14170
NM_006572chr1783446 3393 2276 1414 1062 578 291 212 12512 22318 196 --
NM_006577chr22929 853 --1403 --
NM_006587chr43454 240 21 1301 21110 216 --
NM_006599chr16137726 6375 5770 5218 3306 2804 1832 1671 1576 1246 452 319 128 --15979 15973
NM_006601chr123999 707 241 --3881 156 56 --
NM_006603chrX41679 1594 1581 95 11297 11461 --
NM_006609chr222468 325 ----12644
NM_006614chr3----31461 1065 109 --
NM_006620chr664534 3833 3467 3331 1498 1030 24600 4378 1480 24881 264
NM_006624chr101290 --11709 --
NM_006626chr942343 2310 2069 1707 --1874 --
NM_006628chr1553398 3131 1702 1565 102 1925 21130 488 --
NM_006646chr1342879 2623 375 330 --32402 1939 46 --
NM_006654chr1233853 3763 393 22930 299 1639 --
NM_006667chrX11087 --2478 305 --
NM_006682chr762492 2321 1947 1860 1068 559 22063 251 --12852
NM_006699chr152431 2323 528 318 136 ------
NM_006700chr123519 117 110 ------
NM_006704chr132381 105 ------
NM_006706chr5------1604
NM_006708chr641354 1192 84 27 ------
NM_006710chr23400 389 23 --1281 --
NM_006717chr962992 2910 2485 1124 1075 777 --166 --
NM_006718chr631076 964 96 --183 --
NM_006722chr351185 655 337 259 172 158 ----
NM_006729chrX105483 4999 4794 4324 4132 3662 2204 956 862 165 14955 1309 --
NM_006731chr9145394 5281 4620 4597 4357 2166 1726 1550 1475 1452 1226 1125 498 463 12233 ----
NM_006738chr1594040 3934 2892 2860 1327 572 409 323 227 14304 24540 679 --
NM_006746chrX11451 1562 ----
NM_006750chr16116983 6481 6413 6388 6005 2473 2409 1934 1273 1052 208 25721 1196 --47757 6041 796 642
NM_006751chr221030 741 1210 1201 11002
NM_006755chr111118 ------
NM_006777chrX52596 2234 1781 1165 937 1601 31066 810 651 --
NM_006800chrX1582 ------
NM_006805chr541731 1699 1166 137 --2599 411 --
NM_006807chr1731300 1253 1108 11373 ----
NM_006813chr61352 ------
NM_006814chr2092679 2581 2208 1906 779 657 446 281 29 --12485 11752
NM_006824chr12171 45 ------
NM_006827chr1443405 3151 1018 187 --22839 396 --
NM_006851chr1242677 2537 1015 219 --12723 1632
NM_006854chr731660 708 627 --2298 218 --
NM_006856chr122818 444 ------
NM_006870chr20----1245 --
NM_006873chr252946 2745 2308 1296 1020 12494 13060 --
NM_006874chr42461 23 1133 2298 93 --
NM_006885chr1624108 1674 1902 2783 595 11642
NM_006897chr121420 ------
NM_006898chr2--1522 ----
NM_006901chr151136 --1516 --
NM_006914chr921426 1419 1396 --176
NM_006915chrX3638 522 378 11585 123 --
NM_006916chr21242 ------
NM_006918chr11155121 5028 5011 4732 4245 4003 3972 2149 1880 1578 1303 1171 581 428 393 14978 1196 11006
NM_006920chr242070 1599 1583 76 ------
NM_006924chr1764376 3552 3090 2953 2819 2734 43370 3224 1085 1073 34448 1613 1033 --
NM_006930chr521307 620 11582 11251 11644
NM_006937chr17152 ------
NM_006939chr1411184 ------
NM_006950chrX1117 ------
NM_006981chr952197 2133 2014 1953 434 12521 32533 777 135 11151
NM_007005chr921569 27 --41478 1048 564 308 --
NM_007006chr1662938 1101 653 427 416 252 22437 1117 23032 2578 12985
NM_007007chr1274641 4603 3863 3642 3585 3563 756 --54563 3881 3016 2940 1211 --
NM_007008chr21963 ----1875
NM_007011chr15156923 5724 5652 5108 4825 4576 2753 2383 2115 1822 1815 1337 1002 972 488 --46715 6275 2074 352 --
NM_007023chr23902 691 395 1848 ----
NM_007027chr3175 --1379 --
NM_007038chr2165702 5575 5405 5166 1915 1206 --35979 3710 1607 15751
NM_007042chr362176 1770 810 586 573 74 1391 22200 332 --
NM_007050chr20136767 6500 5722 5184 2623 2463 2315 2246 1854 1500 436 213 126 26729 3211 22944 871 --
NM_007054chr521566 128 13141 182 --
NM_007064chr331285 1231 57 --11469 --
NM_007078chr1061863 963 816 556 232 202 --1828 1743
NM_007106chr1352414 2085 2068 1095 372 ------
NM_007107chr332440 2223 1760 --22105 926 --
NM_007114chr332294 2169 68 1267 13339 1221
NM_007118chr51599 ----1327
NM_007125chrY21191 969 ----1170
NM_007129chr132992 799 --1395 --
NM_007137chrX105035 5020 4806 4661 4636 4081 1950 1697 1447 40 13525 ----
NM_007145chr1941392 1121 430 395 --11162 --
NM_007146chr1752352 2183 1999 1125 101 12891 ----
NM_007157chrX42484 2094 1923 931 1143 ----
NM_007159chr341112 1081 288 258 11468 --1534
NM_007172chr22103137 2070 1235 1164 1064 453 373 325 291 134 --22963 243 --
NM_007187chr13--2108 48 2817 781 --
NM_007195chr1843611 2946 1085 953 23576 3490 ----
NM_007198chr821204 44 --21077 1041 11654
NM_007200chr1594040 3934 2892 2860 1327 572 409 323 227 14304 24540 679 --
NM_007204chr11511 --1120 --
NM_007207chr12620 165 ------
NM_007212chr152074 1705 481 330 25 --32097 368 168 --
NM_007214chr611019 1507 --1191
NM_007222chr82533 302 11223 1607 --
NM_007231chrX42283 1997 525 304 1844 12153 --
NM_007242chr161213 1236 ----
NM_007246chr43286 188 160 ----1247
NM_007249chr13168712 8077 6160 6153 6133 5989 3625 3604 3367 3344 3235 2461 2378 1674 1190 1050 29211 7332 27752 1025 --
NM_007276chr7161 1362 1863 --
NM_007287chr373161 1282 1144 994 880 661 36 1724 12340 1916
NM_007288chr373161 1282 1144 994 880 661 36 1724 12340 1916
NM_007289chr373161 1282 1144 994 880 661 36 1724 12340 1916
NM_007294chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007295chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007296chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007297chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007298chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007299chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007300chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007302chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007303chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007304chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007305chr1751267 1245 927 897 847 --51311 960 249 178 149 --
NM_007315chr2----11348 --
NM_007324chr1285 34 ----1320
NM_007345chr1852275 1652 430 377 157 ------
NM_007350chr1264276 4161 3870 3315 2854 1219 14152 33824 218 39 --
NM_007358chr14735 554 477 440 1212 21294 233 --
NM_007361chr14----3491 150 24 --
NM_007362chr321536 521 --1101 --
NM_007363chrX1762 ------
NM_007371chr92185 49 ----1735
NM_007372chr171595 --152 --
NM_007373chr1031651 1551 454 2462 104 --1185
NM_007375chr182525 2327 1791 860 822 765 744 313 --42749 2711 2633 1009 --
NM_009585chr31741 ------
NM_009585chr31741 ------
NM_012081chr543665 3581 3571 2785 --52854 2844 2660 1136 214 --
NM_012090chr11812 ------
NM_012095chr1032893 1374 1105 --32321 629 230 --
NM_012096chr383463 3349 2290 1147 715 662 529 147 22415 358 53734 3709 3385 1420 776 --
NM_012102chr182012 1946 1823 996 984 729 404 190 --2112 61 --
NM_012104chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_012104chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_012137chr152779 2119 2088 808 650 11996 ----
NM_012141chr1373461 3312 3159 2853 2749 1281 63 --13254 23543 3364
NM_012154chr83758 745 163 ------
NM_012158chr133564 488 135 ----11560
NM_012164chr986550 6526 6306 5437 2889 2163 1440 848 14961 15381 17170
NM_012175chr112742 54 ------
NM_012183chr11491 1407 ----
NM_012193chr11105249 5054 4508 3885 3488 1972 1282 1201 227 190 2914 856 24845 1295 --
NM_012199chr184530 4225 3770 1732 1678 486 480 327 23557 3094 24070 577 --
NM_012207chr10154 167 1281 --
NM_012214chr2196432 6305 6289 6178 5966 5734 5698 5142 4715 4701 4382 4274 4019 2369 1136 722 617 494 195 1841 22405 714 16015
NM_012218chr1983079 2992 2878 1057 822 702 671 21 13049 21923 425 --
NM_012224chr42173 123 1113 --1303
NM_012233chr23866 432 218 --1145 --
NM_012234chr342661 2510 1494 747 ------
NM_012243chr11673 1351 2261 74 --
NM_012249chr243600 2626 1191 796 1729 22551 711 --
NM_012255chr20----166 --
NM_012262chr131978 1647 294 13977 21781 731 --
NM_012281chr732195 1684 414 ------
NM_012287chr354233 4204 3811 3238 450 33089 670 259 24073 2936 14326
NM_012288chr685476 5417 5396 5219 4694 4270 4137 417 --24077 1312 --
NM_012290chr251619 1295 1205 592 570 --11380 --
NM_012297chr441907 635 226 211 1731 21675 752 --
NM_012302chr13955 398 256 --1449 --
NM_012304chr532415 1996 701 ------
NM_012307chr181430 ------
NM_012309chr1184967 4495 4444 4219 3329 1486 1163 258 --34300 3911 1373 --
NM_012316chr185341 5166 4881 3970 3475 596 309 125 ------
NM_012328chr7--2926 345 ----
NM_012329chr1771286 1217 294 271 243 231 149 ------
NM_012330chr1031705 1588 705 ------
NM_012333chr131623 1535 1406 11054 11145 --
NM_012334chr574343 4014 3724 1814 1243 1137 110 21447 377 11275 1976
NM_012342chr10--1171 --1341
NM_012343chr531099 157 122 ------
NM_012347chr682740 2118 1866 1122 883 610 462 346 1335 12201 --
NM_012388chr1552923 2746 2722 1251 1056 22385 2102 --12532
NM_012399chr2241916 1763 1678 379 --11328 --
NM_012402chr1121370 557 ------
NM_012414chr11337 --1706 --
NM_012417chr172622 85 --1207 --
NM_012420chr1042154 1942 1872 1843 12250 ----
NM_012425chr1052457 2244 2155 1969 1762 --32681 2542 686 --
NM_012428chr151914 ------
NM_012431chr763673 2979 2624 572 317 102 22904 348 52996 2693 990 839 755 --
NM_012433chr2------1262
NM_012443chr101227 199 ----
NM_012448chr1752312 2119 1913 599 375 1953 11734 --
NM_012454chr6------1150
NM_012464chr432343 2168 256 --21088 1073 1362
NM_012471chrX21857 537 ------
NM_012484chr5125 ------
NM_013227chr152836 340 ------
NM_013231chr1464309 4198 3114 785 730 632 --11526 14145
NM_013233chr21127 ----1501
NM_013235chr56839 760 702 568 338 191 ------
NM_013236chr2231093 951 496 ----193
NM_013255chr7168706 8413 8199 8110 7868 6964 5743 2346 1931 1839 1548 1398 1158 1104 326 102 27696 2824 11874 --
NM_013261chr442931 2649 379 72 12688 13588 --
NM_013262chr641457 1251 396 23 --11488 --
NM_013269chr12104381 4198 4157 3943 3032 2989 1112 519 351 223 2808 250 --13665
NM_013286chr363784 3145 2726 2415 1042 169 ------
NM_013309chr1572543 2257 1990 875 475 181 51 11979 ----
NM_013316chr7--2744 700 ----
NM_013320chr121184 --164 --
NM_013322chr711072 ----11497
NM_013341chr252865 2479 2123 1032 913 --12455 --
NM_013357chr82851 790 ----1307
NM_013372chr1522384 2256 --13001 13024
NM_013374chr373174 3039 2979 2205 1027 746 186 ----12922
NM_013381chr1242334 2078 458 101 --1802 --
NM_013396chr2161486 1463 1423 1100 514 147 ------
NM_013402chr1162499 1924 1017 805 505 42 22561 347 --11974
NM_013411chr172517 2209 2039 1943 1089 770 22 --12069 --
NM_013434chr2199 ------
NM_013434chr2199 ------
NM_013438chr931180 275 202 ----1446
NM_013442chr9146 ------
NM_013449chr1262699 2456 1842 1198 808 584 1466 ----
NM_013943chr152791 2685 611 585 121 --12718 --
NM_013986chr22--140 1227 --
NM_013989chr1494477 4395 4227 4220 3869 1661 1596 1443 1384 14322 54626 4188 3882 3646 726 1339
NM_013995chrX52632 867 735 537 348 ------
NM_013996chr71395 ------
NM_013996chr71395 ------
NM_013997chr71395 ------
NM_013997chr71395 ------
NM_013998chr71395 ------
NM_013998chr71395 ------
NM_014011chr282217 2199 1773 847 603 473 214 92 31982 1050 635 11945 --
NM_014016chr32452 37 21135 204 ----
NM_014021chr1103296 3228 2672 2189 793 752 736 524 397 126 --13397 23019 533
NM_014028chr673124 3051 2306 1254 964 307 184 --43206 3170 395 119 1607
NM_014034chr621437 447 ------
NM_014035chr531397 437 373 ------
NM_014043chr331449 1359 67 ----11657
NM_014048chr16124700 3727 3562 3412 2039 1386 1219 1203 1153 417 262 51 --2970 550 --
NM_014089chr13--1100 ----
NM_014106chr1552690 2531 2181 892 371 11135 11170 --
NM_014110chr12991 925 --2823 215 1470
NM_014112chr874305 3600 3533 1333 582 551 172 11126 11191 --
NM_014141chr785083 4862 4358 3409 1984 1650 1425 158 14455 1815 14387
NM_014153chr164652 476 245 91 --1712 --
NM_014155chr11117528 6739 6470 5538 5278 4650 2801 2178 1838 1737 1536 1507 45486 5104 4955 1693 --
NM_014170chr3124 ------
NM_014178chr142562 503 ------
NM_014181chr242503 2021 1799 864 21952 91 ----
NM_014241chr10144 ------
NM_014243chr43418 255 225 ------
NM_014263chr1031377 1084 321 ------
NM_014278chr4--1373 ----
NM_014283chr11250 --130 11358
NM_014294chr841153 1095 488 73 --1509 --
NM_014299chr1992198 1638 1358 612 563 413 239 198 100 11870 ----
NM_014309chr22104891 4593 4408 4361 3658 3629 936 884 810 216 ------
NM_014313chr121427 1108 ----1362
NM_014323chr223218 184 101 ------
NM_014325chr1241940 1441 1395 128 --1656 11530
NM_014331chr4157430 6423 5106 4782 2962 2601 2393 2303 2036 1636 1576 1204 349 342 273 --25826 4819 11161
NM_014333chr114845 662 539 123 --2596 133 --
NM_014350chr5192 --51015 976 300 156 113 --
NM_014352chr1111476 --2471 327 --
NM_014372chr121883 326 --11588 11654
NM_014382chr321535 1094 --31669 146 86 1140
NM_014423chr5135653 5410 4641 4054 2184 1917 1804 1697 1569 1446 997 260 197 --23794 1729 1351
NM_014429chr3152 ------
NM_014445chr322383 349 --12398 --
NM_014447chr441142 643 599 293 --11445 --
NM_014452chr61327 ------
NM_014456chr1021868 545 31894 1425 504 ----
NM_014488chr111490 ------
NM_014500chrX1238 ------
NM_014515chr124894 863 355 274 1940 21043 28 --
NM_014517chr321847 63 1706 1679 11751
NM_014574chr1451612 1448 634 213 114 --21310 31 --
NM_014606chr441409 1105 528 115 ----21342 1135
NM_014608chr15168 ------
NM_014614chr211023 ------
NM_014616chr383328 3036 2944 2912 2887 2825 1080 888 --12782 11398
NM_014618chr92345 24 --1454 --
NM_014636chr9143782 3515 3143 2886 2860 2721 1715 1425 1052 804 551 449 398 34 --24174 3449 --
NM_014637chr83281 253 24 --11025 --
NM_014647chr1651749 1716 1696 1436 1421 12023 21947 1687 --
NM_014660chr741068 895 727 229 2439 409 ----
NM_014666chr53957 309 137 --11074 --
NM_014670chr241575 1355 662 215 --21625 1285 --
NM_014673chr8129 1208 --1215
NM_014679chr1161173 1140 552 366 146 132 --21195 1013 --
NM_014682chr861589 943 893 807 497 180 --1874 --
NM_014701chr15102672 2640 2581 2388 2162 2089 1289 893 454 364 1759 --11087
NM_014702chr663407 2575 2510 2155 796 581 22937 2501 23362 1270 11125
NM_014705chr721936 253 --1434 --
NM_014715chr114739 314 193 77 --2892 600 --
NM_014719chr751098 1061 769 242 192 --1972 --
NM_014721chr687488 6931 5668 5427 1553 1040 808 31 26563 2288 25807 546 11134
NM_014729chr821603 243 11686 1373 --
NM_014730chr12104238 4218 4178 3976 3284 2096 2007 1121 748 315 14833 1444 21087 505
NM_014730chr12104238 4218 4178 3976 3284 2096 2007 1121 748 315 14833 1444 21087 505
NM_014739chr654068 3998 3304 2611 413 --12629 --
NM_014743chr453144 2134 570 413 390 13047 1186 --
NM_014746chr284183 2983 2784 1029 999 762 383 327 1605 ----
NM_014751chr8--11332 2753 95 --
NM_014757chr542187 2082 1780 366 --1453 --
NM_014764chr1211288 --11301 --
NM_014781chr8----1884 --
NM_014802chr124725 464 321 122 181 1967 --
NM_014810chr1103654 3399 3117 2971 2731 2444 1064 699 187 123 12739 ----
NM_014812chr151630 807 682 419 401 --21447 639 --
NM_014819chr552342 2149 2085 557 377 --11723 11832
NM_014820chr351443 1305 706 648 219 1433 11613 --
NM_014826chr1104372 4326 3725 3685 3526 3323 1554 342 332 201 ------
NM_014827chr161374 1351 1101 515 270 170 151 1662 11185
NM_014829chr532340 1764 1659 --191 1584
NM_014838chr2292833 1982 1804 1116 1074 957 649 349 254 ------
NM_014839chr132563 2557 2084 --12000 --
NM_014841chr64879 290 68 56 --11120 --
NM_014850chr374372 4023 3643 3004 1139 1115 576 1515 13958 --
NM_014864chr153351 3123 3040 1138 845 11111 44410 1539 1485 1152 --
NM_014873chr1104715 4125 4087 3759 1668 1171 914 623 295 44 --13925 --
NM_014877chr17107741 4824 4795 3029 2901 2090 1785 817 146 73 12754 26791 5188 --
NM_014883chr421993 227 12570 2653 420 12107
NM_014892chr62480 444 ------
NM_014893chrY61683 1567 854 766 454 444 --22076 818 --
NM_014897chr17103282 3112 2814 1033 785 593 385 334 274 165 ------
NM_014901chr522195 194 ----11744
NM_014902chr20----1193 --
NM_014903chr1241786 1679 837 312 12357 2753 29 --
NM_014904chr1083135 2701 1498 1046 806 339 251 86 11438 --23040 1112
NM_014905chr241909 1890 1371 573 --1418 122
NM_014906chr1783912 3760 3477 1640 1521 645 587 514 --13395 1616
NM_014912chr1053286 2919 2490 2471 826 13031 13178 1437
NM_014917chr16936 865 812 744 279 185 ----1989
NM_014918chr1541483 1466 137 126 --11277 --
NM_014920chr693085 2772 2487 818 803 600 421 367 196 ------
NM_014923chr1342092 2048 366 110 11811 ----
NM_014926chr331048 291 244 --1927 --
NM_014932chr341640 535 494 60 11436 1739 2263 86
NM_014934chr1343918 1395 621 123 --33893 1058 220 13696
NM_014939chr1811164 ------
NM_014946chr252826 2733 2212 2167 1225 1161 32305 2288 104 --
NM_014953chr1373351 3216 2841 2717 1290 1191 28 --14144 14269
NM_014962chr2042404 807 732 662 --21974 224 --
NM_014969chr1--144 --1901
NM_014982chr1464138 4091 3697 1853 593 494 31613 1329 513 14966 14723
NM_014988chr42448 119 3896 713 288 11759 12645
NM_014990chr14126 ----1346
NM_014991chr423096 3079 11163 32204 1324 372 1462
NM_014992chr142891 734 ----2861 223
NM_014997chr782883 2850 2447 2143 2116 1931 457 49 ----1701
NM_014999chr1251607 1586 1345 1277 66 ----11535
NM_015000chr1272604 2308 1926 1888 874 153 57 32578 946 548 ----
NM_015008chr331265 326 179 13605 13007 12336
NM_015009chr31778 1793 ----
NM_015020chr1673809 3520 3481 1377 1278 682 55 1991 ----
NM_015025chr221840 739 --41974 850 481 129 11673
NM_015026chr1253762 3573 1012 182 165 1370 2921 208 --
NM_015027chr1671935 592 566 479 412 153 23 1557 --11452
NM_015032chr1322674 2206 --22795 2418 1735
NM_015035chr20106619 6216 6201 5123 4794 1818 1513 1045 622 26 --34885 4259 1106 --
NM_015042chr1563865 3388 3062 3029 1538 603 11713 12766 13011
NM_015045chr1041932 1736 856 844 ------
NM_015051chr992883 2801 2475 2267 2145 1218 1198 798 781 --23276 2165 1333
NM_015056chr2152492 2319 1016 523 28 --12605 --
NM_015061chr9----1907 --
NM_015064chr1283660 3443 3323 2646 2214 1109 852 743 --23333 3003 --
NM_015068chr7103366 3261 3197 1603 1381 1241 973 941 732 496 --23633 545 13998
NM_015071chr5116394 6097 5903 5332 5136 2356 2183 1769 1432 1400 1291 1486 21285 251 15528
NM_015074chr1154655 4623 4186 4136 4111 4073 3835 3435 3256 1654 1547 1341 795 720 500 --24730 3565 --
NM_015076chr663859 1746 1623 1298 185 153 --24121 3272 --
NM_015090chr184662 2178 1316 1221 1210 952 940 351 16159 36124 5555 849 --
NM_015092chr1684662 3904 3871 3460 3154 3103 536 529 14154 34207 3812 451 --
NM_015101chr152326 1061 812 614 548 32301 2269 1983 22293 2078 --
NM_015110chr931665 693 510 --32376 2348 845 --
NM_015138chr1572448 2132 2079 1765 691 262 116 --12456 11105
NM_015144chr1674033 2989 2510 1611 1161 1064 576 21301 992 13698 --
NM_015147chr282169 1302 1148 1107 731 658 509 408 12629 ----
NM_015149chr152210 1718 1633 321 231 11988 ----
NM_015153chr6173 --1256 1283
NM_015155chr1033263 3048 1238 --11287 13372
NM_015156chr1431298 1207 997 13681 23730 2477 --
NM_015161chr1641078 1038 578 491 --21115 157 --
NM_015163chr1431911 1841 278 21446 716 ----
NM_015170chr841586 1528 463 190 198 12250 --
NM_015180chr143910 677 119 --1762 --
NM_015187chr42684 266 ------
NM_015191chr1172740 2469 1886 1760 1691 988 712 ----12607
NM_015192chr202948 233 ----21114 676
NM_015199chr322337 553 22360 352 --11131
NM_015200chr482240 2100 922 878 840 584 250 144 12346 ----
NM_015209chr162118 2037 1814 1597 654 418 --11947 --
NM_015215chr143000 2582 2057 304 --11981 12861
NM_015216chr561412 1286 1009 969 452 427 ------
NM_015225chr913081 1902 2984 219 --
NM_015238chr51243 ------
NM_015250chr921976 627 ------
NM_015252chr21249 ------
NM_015269chr14546 539 406 190 ------
NM_015271chr454021 3960 3121 966 535 11316 13639 --
NM_015272chr16169 --21496 465 1217
NM_015275chr1252058 861 226 201 173 ----1680
NM_015277chr1861805 1603 1435 1385 397 73 1483 --21268 247
NM_015285chr1882589 2273 1789 1727 1678 851 799 503 ------
NM_015291chr163515 2334 103 72 36 21 1955 11107 11137
NM_015299chr1472963 2682 2610 773 522 294 288 ----11153
NM_015313chr1164664 4658 4483 4106 3850 1727 1316 23928 3785 --
NM_015323chr621680 1433 ------
NM_015335chr1232106 1758 452 11023 12570 --
NM_015336chr1232045 2000 1742 ------
NM_015344chr851990 1892 1810 166 33 --22194 1452 --
NM_015346chr1451718 1518 744 370 96 --11444 --
NM_015347chr121997 22899 94 1100 12691
NM_015349chr642443 2063 1949 1093 1393 13103 --
NM_015352chr2093753 3731 3169 3140 2837 1502 934 349 333 11044 1186 --
NM_015355chr1741890 1731 1650 688 ------
NM_015358chr2111212 ------
NM_015359chr842952 1965 911 847 --32704 2457 1976 169
NM_015365chrX53991 2798 976 810 733 --43291 3250 3071 2640 --
NM_015378chr163015 2948 2821 1909 609 503 --22498 1136 --
NM_015384chr5--1168 ----
NM_015387chr221824 214 21889 1320 ----
NM_015396chr341213 455 413 198 21004 142 ----
NM_015397chr951898 1767 708 684 389 127 ----
NM_015439chr61482 ------
NM_015460chr32555 177 11338 11682 11894
NM_015464chr73274 68 52 126 ----
NM_015475chr23908 376 161 2387 175 ----
NM_015477chr151313 1894 --1412
NM_015483chr7------1817
NM_015497chr1521030 356 --11122 --
NM_015534chr12919 84 ------
NM_015550chr793415 2843 2662 2506 2377 806 570 322 257 12990 11409 --
NM_015554chr1562799 2403 1848 628 510 411 --12550 --
NM_015564chr572980 2910 2745 2528 2305 1349 527 31106 436 125 12694 22374 865
NM_015565chr2151877 1788 1613 894 326 --11811 --
NM_015568chr2063815 3056 1689 1488 1279 469 --23474 306 --
NM_015569chr174323 3978 1011 822 539 509 211 23943 2964 11208 21656 1610
NM_015570chr731594 184 60 ------
NM_015571chr642025 1850 934 704 11068 ----
NM_015575chr292646 2544 1417 1036 829 765 259 160 132 12609 13271 12832
NM_015578chr1932045 1437 191 2788 288 1835 11328
NM_015595chr31408 --133 --
NM_015602chr12387 355 --11163 21652 1233
NM_015626chr171466 --11248 1104
NM_015630chr23941 792 418 ------
NM_015635chr972188 1809 1637 573 235 90 83 --22133 1473 --
NM_015640chr185273 5214 4971 4896 3854 1834 133 104 ----22142 1585
NM_015652chr101573 ------
NM_015677chr21630 --1138 --
NM_015700chr2292 38 ------
NM_015711chr192721 595 ------
NM_015713chr863256 3044 2631 1075 960 99 1785 23153 2594 --
NM_015850chr812451 1707 ----
NM_015866chr131278 1071 413 1160 11461 --
NM_015878chr831998 1680 562 2211 192 ----
NM_015879chr18166567 5932 5921 5711 5555 5458 2660 2566 2554 2405 2285 2166 1942 1306 315 206 1169 45585 2883 2463 2338 --
NM_015888chr162850 2735 2602 2420 2315 2181 --33271 848 493 --
NM_015902chr8153 ------
NM_015906chr161800 1581 1468 1153 512 362 13184 34398 3587 1491 11280
NM_015999chr13697 560 287 --1746 --
NM_016009chr194732 4653 3720 3625 3587 3052 830 734 105 11798 11063 --
NM_016027chr81391 ------
NM_016032chrX4496 466 365 53 ----11289
NM_016039chr14--1131 ----
NM_016059chr6--1369 2855 832 --
NM_016072chr1282120 2007 1969 1635 353 266 179 21 --11529 --
NM_016073chr151799 1277 21109 264 --
NM_016083chr663785 3248 2436 1545 985 508 --1695 --
NM_016087chr751743 1561 1217 682 374 ------
NM_016096chr822091 1954 --12011 --
NM_016098chr6166 ------
NM_016125chr173583 530 151 ----1129
NM_016128chr31130 ------
NM_016129chr41277 ------
NM_016132chr1542937 2795 2134 344 12863 1470 --
NM_016203chr73199 186 179 --1163 --
NM_016206chr3198962 8914 8489 7833 7796 7546 7298 7003 6958 6922 6080 3432 3123 3020 2339 1483 1450 1444 865 28317 3013 68379 7757 6330 3607 3505 2440 1682
NM_016217chr623248 1212 --23533 970 --
NM_016221chr541637 952 946 526 ------
NM_016227chr11250 --130 11358
NM_016231chr1751704 1426 1202 653 169 --1430 --
NM_016248chr1343461 1451 837 475 13187 ----
NM_016255chr632185 1124 36 ----13263
NM_016257chr1133453 3144 2925 2906 2645 2408 2298 2212 1322 1237 1192 974 647 12937 22287 2140 --
NM_016260chr2137324 7181 6955 6399 5998 5692 3066 2819 2153 1531 1301 844 314 --25378 396 17578
NM_016270chr19----1451 --
NM_016271chr1832154 566 556 12164 21736 1574 --
NM_016272chr2242783 2748 2722 1821 --22342 98 --
NM_016277chr641179 1052 337 95 1129 ----
NM_016279chr51186 ------
NM_016287chr161968 1959 581 458 351 230 ------
NM_016289chr252157 2058 1729 650 237 --11811 --
NM_016308chr151842 1753 1744 1636 1345 1809 1616 --
NM_016315chr2--11323 --11644
NM_016316chr21692 --1589 --
NM_016356chr641053 971 850 651 --12963 --
NM_016374chr151596 1470 580 564 269 --11480 --
NM_016374chr151596 1470 580 564 269 --11480 --
NM_016377chr61121 1701 ----
NM_016395chr1581938 1644 1223 417 397 359 301 246 ------
NM_016396chr154877 750 353 162 22867 852 12138 1793
NM_016422chr1163170 2305 1251 1211 906 304 --12280 --
NM_016424chr1741855 1716 1697 1542 --21788 1557 --
NM_016436chr2042700 2419 1983 544 --1844 --
NM_016441chr231890 941 423 ----11971
NM_016448chr171870 1668 1318 1308 1221 711 409 ------
NM_016463chr51127 ------
NM_016472chr1441364 336 146 131 11041 ----
NM_016485chr61141 1622 198 --
NM_016513chr693085 2772 2487 818 803 600 421 367 196 ------
NM_016530chr1543682 2876 1533 1003 --12569 13216
NM_016531chr484182 3527 3069 2646 1635 1469 559 495 ------
NM_016542chrX165 --1124 --
NM_016587chr7161 1362 1863 --
NM_016588chr6----3932 841 639 --
NM_016603chr562237 1470 878 732 517 289 ------
NM_016608chrX1267 --1363 --
NM_016621chr1194504 4072 3921 3899 1664 625 505 202 62 ------
NM_016628chr104622 197 168 90 1779 ----
NM_016653chr241137 839 209 150 ----1825
NM_016654chr152251 108 41392 972 560 129 1449 --
NM_016824chr102530 120 21349 1290 11640 --
NM_016834chr1793976 3544 3339 3058 2924 2742 992 832 169 13945 11023 --
NM_016835chr1793976 3544 3339 3058 2924 2742 992 832 169 13945 11023 --
NM_016841chr1793976 3544 3339 3058 2924 2742 992 832 169 13945 11023 --
NM_016929chr664250 1573 1219 505 57 38 --24484 3007 --
NM_016952chr1163957 3482 3218 1491 737 435 ----11285
NM_016953chr2116021 4034 2347 2036 1565 1154 892 835 738 617 261 15462 --15108
NM_016954chrX------1138
NM_017415chr594377 4139 4034 3878 2962 1644 1326 1082 471 ------
NM_017420chr1421456 128 --13083 12508
NM_017423chr482112 1605 1388 729 610 395 197 55 ------
NM_017425chr11----192 --
NM_017426chr4------1206
NM_017436chr22173 ------
NM_017437chr1431608 881 133 --1635 --
NM_017447chr2173968 2982 2747 1435 1248 946 743 --24253 3080 --
NM_017452chr201984 ----21029 955
NM_017453chr201984 ----21029 955
NM_017454chr201984 ----21029 955
NM_017455chr151914 ------
NM_017519chr6136 1901 11192 --
NM_017544chrX4819 729 235 43 1380 ----
NM_017548chr372058 1559 1385 588 395 363 343 12024 11843 1511
NM_017563chr395568 5259 2334 1898 1772 1582 1242 838 344 --22410 1371 12554
NM_017577chr331613 502 120 --11492 --
NM_017610chr1531718 208 93 22047 834 ----
NM_017617chr951339 1212 1056 328 297 --11537 --
NM_017628chr495080 4914 4568 4351 4178 3530 1728 1427 31 14110 51475 1394 932 619 357 15222
NM_017629chr151883 589 473 362 259 --2487 286 --
NM_017633chr633670 2612 517 ----22785 735
NM_017634chr821783 555 ------
NM_017635chr111254 11263 11221 --
NM_017637chr9148426 8114 7350 6973 6795 6588 6557 6355 6177 5986 5831 2553 2528 1647 27251 2921 48602 8437 7703 2667 19475
NM_017643chr1762504 2005 954 420 129 48 12375 22277 116 --
NM_017644chr374847 4015 3533 1694 1613 1347 876 13608 12088 --
NM_017650chr795104 4965 4955 4289 1280 1149 1106 469 232 --41556 1434 1009 501 --
NM_017657chr2------1235
NM_017658chr1453705 1775 952 269 125 --23056 234 --
NM_017666chrX32180 1826 630 ------
NM_017672chr151357 --1874 --
NM_017693chr1361589 1578 1437 1354 593 55 --31637 321 77 --
NM_017712chr1985954 5602 4848 4488 2493 1023 644 395 34465 1046 734 15662 --
NM_017719chr3--1679 1639 --
NM_017741chr441869 1754 627 441 11743 ----
NM_017742chr1831396 1272 109 1210 ----
NM_017752chrX21928 486 ------
NM_017754chr684457 4439 3872 3131 1537 1449 624 417 11625 33542 3475 1680 14614
NM_017761chr121114 234 ------
NM_017770chr621066 64 11990 1676 --
NM_017778chr82155 37 --21482 57 --
NM_017786chr81684 --1504 --
NM_017799chr1421958 452 --21783 652 --
NM_017811chr953052 2364 693 601 576 1955 11065 --
NM_017813chr875086 4939 4550 3542 373 219 84 1142 11689 --
NM_017824chr1052422 2249 976 546 88 12111 ----
NM_017830chr41167 ------
NM_017845chr42733 33 ------
NM_017848chrX134108 3536 3291 2987 2853 1716 1679 1546 832 699 228 170 102 --33280 3134 1670 1399
NM_017919chr9135620 4991 4698 4616 2005 1914 1580 1340 1212 1095 337 257 241 1665 65106 4913 3949 3547 1312 304 --
NM_017923chr42530 302 --1653 --
NM_017925chr921339 48 --31860 213 35 --
NM_017935chr41132 --1621 --
NM_017938chrX71884 1823 1658 1558 530 262 227 --1498 --
NM_017944chr1121970 1940 ----1986
NM_017946chr741460 1422 1382 1056 --2420 221 1904
NM_017952chr2104539 3931 3924 3405 3390 1745 1470 1191 363 112 2906 167 24416 3276 1217
NM_017987chr1031847 1644 436 12109 52047 886 590 456 292 --
NM_017994chr782483 2426 2064 2005 1981 650 245 31 12126 ----
NM_018014chr221002 537 ------
NM_018017chr1082763 2740 2598 2390 2002 1131 181 74 ------
NM_018018chr1231884 633 111 ------
NM_018027chr1093110 2840 2657 2437 2301 1331 1041 702 465 --12486 --
NM_018036chr1463849 3213 2761 863 837 258 --13375 --
NM_018043chr1121486 518 --11011 11028
NM_018048chr1232020 1883 804 ------
NM_018051chr71312 145 ----
NM_018078chr41286 11057 ----
NM_018084chr242184 1293 964 138 11096 --1249
NM_018086chr241190 707 483 155 1337 ----
NM_018090chr151156 900 415 282 274 --11093 --
NM_018099chr12174 ------
NM_018105chr81258 21180 1058 1933 --
NM_018117chr102314 134 --1223 1598
NM_018121chr1043116 2322 1285 580 12757 13148 --
NM_018133chr33859 849 372 --21738 795 --
NM_018149chr171210 ------
NM_018155chr332479 1150 45 --21290 849 --
NM_018156chr163015 2948 2821 1909 609 503 --22498 1136 --
NM_018157chr1243235 3210 3011 2748 1558 --1334
NM_018159chrX31623 577 289 --11162 --
NM_018179chr122641 202 --1104 --
NM_018182chr1732260 434 225 11751 2550 448 --
NM_018184chr322084 343 --2803 218 --
NM_018200chr1552573 2412 2112 791 630 --1354 --
NM_018214chr6------11155
NM_018254chr12892 358 11574 --32243 786 269
NM_018257chr2072369 2246 1918 794 322 273 227 ------
NM_018261chr41470 196 ----
NM_018287chr1051355 1025 410 367 49 --11283 --
NM_018293chr342982 2099 811 567 --1802 --
NM_018296chr16192 ------
NM_018299chr842669 2151 574 117 22442 1136 41272 863 779 646 12961
NM_018318chr121962 ------
NM_018319chr142588 489 --11363 --
NM_018334chr72114 56 ------
NM_018351chr1264264 3766 3735 3657 2921 1544 --14110 11107
NM_018361chr853410 3206 1070 282 123 21224 921 23303 881 1747
NM_018362chr1163903 3302 1250 801 283 260 13652 13511 14049
NM_018364chr133290 1300 1054 --33836 3051 1326 1390
NM_018370chr1232059 1634 233 1341 1124 1515
NM_018373chr14176395 6162 6045 5209 4980 4830 4808 4528 4015 2540 1914 1905 1796 1553 723 289 102 24564 1264 42417 1602 250 209 --
NM_018374chr784904 4809 4470 4181 4070 3590 3313 3256 --1417 --
NM_018383chr272030 1898 1892 1772 1694 1349 164 ------
NM_018399chr63810 555 187 ------
NM_018400chr11124478 3855 3658 3154 1649 1634 1510 1317 882 802 672 217 21442 912 ----
NM_018401chr481854 1626 1536 658 605 271 128 29 ------
NM_018403chr393618 3117 3016 2675 1174 722 293 123 54 13092 13967 22782 342
NM_018412chr71115 ------
NM_018413chr12----146 --
NM_018429chr542456 1786 351 228 --32294 440 403 --
NM_018439chr1821885 452 1204 1984 --
NM_018440chr888571 7624 7248 6410 3411 1266 1035 835 --27128 436 17747
NM_018444chr851712 1589 785 202 55 --4923 850 720 635 --
NM_018448chr122928 132 --1495 --
NM_018452chr6_random93558 3292 2677 2666 1403 1299 1164 210 76 12535 ----
NM_018465chr92203 99 --184 --
NM_018466chrX3311 292 204 ----2670 655
NM_018472chrX1138 ------
NM_018553chr1731681 276 243 11666 11504 --
NM_018557chr21388 --11481 11323
NM_018566chr164667 3820 3613 3395 158 51 23852 1466 11050 --
NM_018571chr2------1662
NM_018638chr1275594 4182 2227 2144 1676 1317 402 45660 4081 3650 3446 25614 1565 --
NM_018640chr1222376 1894 --22001 1023 --
NM_018641chr71150 ------
NM_018650chr132111 1877 309 ----12157
NM_018695chr562077 1628 965 464 245 190 --22429 1618 140
NM_018697chr782259 2231 2018 2005 1977 715 665 423 12173 ----
NM_018698chrX21935 778 1480 21868 679 --
NM_018704chr151901 555 358 65 42 ------
NM_018710chr831394 1238 476 --2529 126 --
NM_018717chr452559 2422 2133 660 616 --1533 --
NM_018718chr742339 1923 1617 917 --31863 1819 437 --
NM_018841chr163876 3741 3641 2445 828 638 170 ----
NM_018845chr11210 ------
NM_018948chr1----1487 --
NM_018970chr742743 1000 655 457 22891 475 1421 --
NM_018972chr852418 1948 510 440 397 --1934 --
NM_018975chr161146 1749 ----
NM_018992chr1621542 1274 11427 1625 21575 1342
NM_018999chr10114394 4373 3983 3690 3487 1815 1681 1588 1574 1260 412 13296 13740 --
NM_019000chr541336 1116 469 119 2629 623 21456 517 --
NM_019001chr354773 4081 3064 2966 168 --34888 4647 3030 --
NM_019006chr151123 1196 ----
NM_019009chr1172570 2225 2038 1792 1048 124 84 ----12082
NM_019022chr1853044 3022 819 491 305 --133 1418
NM_019027chr441595 828 358 173 22363 124 2660 218 --
NM_019049chr12569 250 ------
NM_019053chr102850 340 ------
NM_019063chr232305 227 106 12050 ----
NM_019071chr71318 --259 47 --
NM_019072chr534173 3991 3026 34046 1119 306 --14070
NM_019084chr1082388 1837 393 368 320 299 174 136 ------
NM_019087chr551477 1307 356 346 85 ------
NM_019089chr1133550 3298 3280 3197 3179 3069 2762 2629 1319 1255 1217 953 581 --1981 --
NM_019116chr1653771 3704 3291 1383 29 1531 13390 --
NM_019591chr123341 244 44 ------
NM_019592chr96735 715 665 275 181 130 --1881 --
NM_019593chr2053123 2086 2005 876 844 22454 1186 ----
NM_019610chr131629 1591 86 1871 1442 1827
NM_019842chr61395 --1305 --
NM_019857chrX71714 1490 1366 712 705 663 446 --2544 524 --
NM_019903chr102530 120 21349 1290 11640 --
NM_020122chr2145964 5597 5265 4965 4075 3763 2146 1891 1832 1685 1484 1234 1008 252 25894 1354 22377 1309 --
NM_020123chr1041421 1158 444 91 ------
NM_020130chr861352 891 549 187 165 122 --11237 1381
NM_020148chr1863006 2869 2717 788 569 124 12769 11906 --
NM_020159chr421414 381 --11292 --
NM_020194chr2--1486 155 --
NM_020198chr172431 414 ------
NM_020199chr5--1260 11319 --
NM_020205chr153516 3311 2239 2146 1234 13234 --13466
NM_020228chr1182271 2225 2100 1992 1705 731 385 238 --11691 192
NM_020231chr3------1166
NM_020239chr162323 2141 1993 928 537 216 1552 1147 --
NM_020336chr2042725 1272 1091 439 --33262 299 165 --
NM_020342chr241858 683 384 127 --1263 --
NM_020347chr362211 2109 862 850 272 120 1295 --12024
NM_020348chr1072538 2150 1871 1757 951 497 158 --32740 2704 2304 12766
NM_020351chr3138 ------
NM_020357chr341150 189 126 80 --1585 --
NM_020362chr14786 713 696 330 2855 704 ----
NM_020390chr374391 4206 3501 1679 1242 937 673 24370 411 1741 13886
NM_020405chr1783940 3934 3815 3604 2740 1444 1229 911 --21680 28 1461
NM_020420chrY31652 1412 323 --11535 1342
NM_020443chr1156987 6315 6250 5105 5063 2450 2443 2375 2183 1930 1821 1473 1412 756 439 --12003 --
NM_020455chr6102693 2522 2301 2093 2062 1073 1045 968 680 657 --32560 268 177 --
NM_020463chr221332 168 ----1529
NM_020474chr1871286 716 597 389 240 216 147 --21540 398 --
NM_020532chr21963 ----1875
NM_020642chr111590 ------
NM_020644chr113713 639 120 --1781 --
NM_020648chr1832360 2150 929 --42763 2434 718 116 --
NM_020654chr321582 39 11217 1501 --
NM_020666chr52633 54 ------
NM_020673chr20126720 6441 4807 2977 2786 1632 1206 1030 919 510 158 23 27416 4861 47615 7497 6312 313 23050 1505
NM_020682chr1041097 858 830 379 --11124 --
NM_020704chr752176 848 508 426 288 11010 --1416
NM_020711chr242392 1658 716 341 ----12008
NM_020717chrX104952 4431 4055 3924 3417 3145 1955 1913 1893 375 11937 1687 --
NM_020718chr1664885 4850 4585 1914 930 843 14682 34537 1190 419 11788
NM_020726chr51105 ------
NM_020727chr2173790 3737 3272 1525 825 617 42 --12789 --
NM_020732chr6136 1901 11192 --
NM_020734chr1253051 3022 2837 2564 2527 --33350 608 401 --
NM_020742chrX52604 2364 827 609 473 --12144 --
NM_020747chr54844 662 369 140 ------
NM_020748chr1742019 1966 1824 320 --3629 565 500 --
NM_020749chr861443 761 749 200 160 57 --31981 229 180 2343 218
NM_020752chr1062740 1104 869 355 304 193 12573 12293 --
NM_020760chr231565 680 583 ------
NM_020768chr532577 1301 187 22590 469 22151 692 --
NM_020771chr651319 1114 285 253 217 ------
NM_020772chr17117584 5413 3404 3096 2201 1728 1636 921 756 229 199 58609 6143 6089 2770 328 45489 3372 2794 69 18115
NM_020774chr18106067 5904 5853 5697 4929 3908 2264 1686 1238 60 ------
NM_020781chr742610 1209 663 581 12898 12286 --
NM_020782chr1284329 4311 4082 3555 3218 3004 1807 917 --11939 --
NM_020783chr1821584 974 ----1357
NM_020792chr352706 2615 2323 398 286 21078 778 1568 --
NM_020796chr563016 2203 2036 738 645 536 12865 1271 --
NM_020803chr421501 443 --162 1900
NM_020805chr1841773 708 531 315 ------
NM_020810chr1473305 3094 2660 1337 994 783 163 23229 35 13505 --
NM_020824chr101634 ----1726
NM_020830chr222150 222 13009 1438 12940
NM_020834chr1461745 1317 1272 542 445 193 ----11634
NM_020839chr33564 289 267 --2448 99 --
NM_020841chr1274065 3234 2986 2858 1464 1337 1166 13285 ----
NM_020870chr452239 2219 2135 1953 87 --11364 1304
NM_020872chr371548 1384 1110 692 658 287 233 --1578 1402
NM_020898chr12----1160 --
NM_020917chr1942384 509 479 471 33344 3016 374 --11264
NM_020918chr1063533 3388 3275 2413 321 293 1602 1749 13339
NM_020921chr1463539 3166 3037 2929 2828 2749 1620 33604 1232 211 11353
NM_020935chr294116 3973 3774 3633 3254 3103 1726 1642 775 ------
NM_020940chr1022436 61 --12055 12049
NM_020948chr121291 165 1281 22820 686 12410
NM_020960chr975032 4096 4000 3801 3232 1031 664 1443 13516 --
NM_021032chr351958 634 305 224 132 11549 11870 --
NM_021033chr1383226 3027 2932 2522 2169 2143 1416 716 13326 12702 --
NM_021064chr671789 1625 1107 596 584 222 134 1189 ----
NM_021072chr592643 2103 1768 1628 694 683 577 278 49 ----11064
NM_021090chr2254126 4007 1754 1444 130 15000 34546 4095 1593 --
NM_021116chr7178942 8871 7979 7771 7352 7190 7169 6947 6513 5479 3527 3277 3094 2856 2743 2035 1518 --17071 --
NM_021121chr2244 36 ------
NM_021132chr1071377 1113 388 338 311 190 156 ------
NM_021159chr441675 1485 1388 1188 --2610 158 --
NM_021176chr271613 1336 1180 750 645 338 88 --1554 11289
NM_021183chrX52517 2015 930 908 520 --12489 --
NM_021190chr121257 995 --1881 --
NM_021204chr41729 --1849 --
NM_021205chr172437 2216 2003 1808 1071 661 25 --12579 --
NM_021215chr2082396 2071 1597 623 576 232 224 23 ------
NM_021228chr19----1231 --
NM_021239chr1421349 33 --159 --
NM_021240chr93699 664 266 ----1284
NM_021252chr1021603 1570 11728 --11495
NM_021255chr1483124 3008 2748 2579 1386 1314 667 69 --33569 328 50 1876
NM_021622chr1021853 59 --11807 --
NM_021629chr375005 4972 3451 1985 1370 792 652 24323 3793 33640 1697 102 --
NM_021635chr641620 1450 1297 753 ------
NM_021638chr473802 3749 3240 1963 1565 503 32 33544 3460 3328 24782 209 --
NM_021639chr14657 651 643 221 1684 ----
NM_021644chr10154 167 1281 --
NM_021645chr1362281 2197 1851 1781 1638 288 ------
NM_021647chr4114542 4331 4269 3540 1666 1119 988 898 636 556 98 --11401 21546 1223
NM_021648chr662283 2212 2067 1068 896 156 --12170 11874
NM_021728chr141742 ------
NM_021813chr6115665 5600 5185 5006 4345 3841 3829 1619 1606 1402 705 --22184 1555 --
NM_021911chr5145649 5472 4654 4445 3975 2074 1648 1214 654 566 524 500 320 29 --34597 1229 71 --
NM_021912chr1563306 3162 3153 2970 1393 1137 --31047 548 28 --
NM_021913chr1981556 1532 1368 1338 1287 1267 1245 263 ----11212
NM_021914chr1451852 1790 1725 1562 426 --11747 --
NM_021925chr22215 88 161 11330 --
NM_021947chr1751235 1089 460 422 188 ----21304 123
NM_021956chr631005 170 138 --11166 --
NM_021960chr121880 625 1274 2541 265 1301
NM_021961chr1166456 5398 5311 4548 2813 1074 21322 504 25785 1685 26637 2954
NM_021964chr3136639 6327 6264 6206 5476 5321 2355 2297 1977 1726 1319 977 617 193 32018 1931 287 --
NM_021977chr673663 3140 1380 1084 1044 501 458 12438 1693 --
NM_022037chr21128 1980 --178
NM_022048chr15116303 6281 6146 4515 4018 2224 1544 1509 1191 316 204 11467 1404 15271
NM_022051chr11634 --1158 --
NM_022080chr2042762 2257 1044 335 --12699 12378
NM_022123chr14----2558 550 --
NM_022133chr811766 21621 735 --11632
NM_022154chr421281 382 --21005 526 --
NM_022166chr1675463 4309 2508 1139 1109 823 323 13995 25437 5334 --
NM_022173chr21128 1980 --178
NM_022334chr271131 1106 1039 968 826 382 106 ------
NM_022340chr382935 2896 2744 2547 1378 1316 1044 286 13356 ----
NM_022343chr93547 430 337 133 ----
NM_022351chr853033 2557 1239 728 383 23624 2628 ----
NM_022353chr21478 ----1186
NM_022374chr21111 ------
NM_022456chr12106837 6660 6420 6035 5663 5551 2478 1761 1017 614 15736 42846 1612 486 103 --
NM_022458chr752679 2143 940 597 351 12621 --1362
NM_022459chr1386392 6181 6073 4949 4735 4398 1737 1423 15418 35031 4602 1047 --
NM_022461chr331445 905 90 11108 11160 1540
NM_022473chr15102731 1765 1740 1540 1133 1067 1057 592 438 407 1206 12854 --
NM_022474chr1472593 2088 647 568 83 62 32 ------
NM_022475chr42613 72 ------
NM_022477chr2041401 1228 462 298 1414 ----
NM_022484chr71427 ------
NM_022494chr102466 437 ------
NM_022650chr52670 147 ------
NM_022726chr641697 1210 590 304 ------
NM_022731chr1127 ------
NM_022733chr1----11146 --
NM_022735chr131267 672 162 ------
NM_022739chr1751087 762 361 313 26 ------
NM_022753chr132203 2171 756 ----1733
NM_022763chr363132 2825 2427 774 692 508 2284 120 ----
NM_022771chr122374 351 ----1156
NM_022781chr962912 2879 2543 2482 1004 298 --23202 221 --
NM_022784chr152926 85 ------
NM_022824chr51213 11329 1254 --
NM_022841chr1552663 1895 1807 480 156 1913 1523 --
NM_022893chr212155 --12053 --
NM_022894chr231514 1428 657 ------
NM_022898chr1474314 4071 3922 3367 2998 1352 311 --24726 1672 --
NM_022900chr731104 1077 405 ------
NM_022918chr1141798 1587 489 215 ------
NM_022970chr102939 280 ----2338 157
NM_022977chrX42606 2489 1794 548 1919 12123 --
NM_023000chr1411300 ------
NM_023001chr1411300 ------
NM_023075chr183827 796 723 ------
NM_023105chr812451 1707 ----
NM_023106chr812451 1707 ----
NM_023110chr812451 1707 ----
NM_023111chr812451 1707 ----
NM_023929chr852527 2372 2084 480 181 --21925 80 --
NM_024007chr55988 870 506 361 129 --12906 --
NM_024077chr91673 --2538 57 --
NM_024090chr461615 1395 694 325 304 193 --1385 --
NM_024099chr112256 99 ------
NM_024423chr1844143 3848 643 65 --22802 1091 --
NM_024429chr73199 186 179 --1163 --
NM_024430chr1811280 2717 139 1103 2467 436
NM_024494chr11236 ------
NM_024501chr2--171 1685 --
NM_024511chr453551 2891 2767 2724 55 --32810 1415 810 12398
NM_024512chr363493 3454 3029 2708 866 830 --21239 1132 --
NM_024522chr181597 678 568 207 174 168 162 150 ------
NM_024524chr342113 858 791 346 11008 12450 --
NM_024539chrX1518 ------
NM_024551chr1272357 2338 1996 1851 864 832 678 --31569 507 486 --
NM_024551chr1272357 2338 1996 1851 864 832 678 --31569 507 486 --
NM_024557chr1181607 1404 1219 1058 645 614 516 62 --1408 1387
NM_024558chr145701 672 100 86 26 1747 1955 --
NM_024561chr1331303 1111 862 ------
NM_024569chr152126 758 480 369 32 1698 ----
NM_024576chr6--1188 ----
NM_024582chr42905 400 1841 ----
NM_024607chr874349 4269 3341 3316 3045 1405 1220 --13724 --
NM_024613chr841775 1564 205 69 11259 ----
NM_024615chr5174 ----1182
NM_024617chr92130 99 1207 ----
NM_024631chr112534 158 --1491 --
NM_024635chr9--1260 ----
NM_024639chr652669 2024 821 611 82 21850 776 32860 2677 860 --
NM_024663chr20177 ------
NM_024665chr334524 3498 859 33401 1374 438 43338 1624 1553 1237 --
NM_024670chr1071785 1401 1308 1224 1167 1128 357 --1658 --
NM_024674chr183082 2926 2699 2474 1129 1043 993 118 ----13252
NM_024686chr11513 ----2484 218
NM_024692chr261515 1341 1303 1276 744 244 ------
NM_024713chr1541396 475 412 244 ----1366
NM_024726chr22506 103 ------
NM_024744chr262564 2298 2291 2100 1980 533 11772 ----
NM_024751chr451900 1852 712 204 158 11619 --12077
NM_024770chr286603 5633 5163 2508 2287 821 52 36 24895 364 ----
NM_024811chr1161486 1431 684 165 67 42 1462 2367 225 --
NM_024828chr951395 470 377 352 118 --11138 --
NM_024837chr1541208 627 248 81 --21921 1419 --
NM_024852chr11160 ------
NM_024881chr1973775 3477 3256 2918 2691 1313 992 ----13761
NM_024899chr182524 185 1445 --123
NM_024911chr11184 ----2695 585
NM_024930chr542755 2674 2655 2052 --1619 12519
NM_024947chr3119542 9349 9089 8440 8094 7690 6406 3599 1917 1688 1667 17119 28988 238 17133
NM_024948chr102185 61 ------
NM_024949chr494930 4716 2001 1720 1397 1018 277 147 60 13451 21295 68 --
NM_024953chr1272703 2458 1125 1003 762 697 492 --1126 1931
NM_024969chr23617 352 339 --1205 1370
NM_024989chr2117584 7365 6158 5395 5203 5164 2778 2597 713 619 262 67190 6990 6107 5824 2005 323 57324 5693 5059 5047 4965 15624
NM_024993chr221214 89 1285 21639 598 1433
NM_025054chr884061 3854 3542 3333 1439 603 539 115 14089 13376 --
NM_025073chr154525 1662 1184 225 96 14351 --1386
NM_025076chr22186 26 --189 --
NM_025133chr22753 102 11075 1225 172
NM_025134chr163962 174 148 ------
NM_025151chr861786 1753 1694 610 545 360 11687 2202 69 --
NM_025160chr154334 4008 2874 1531 936 22622 269 34227 875 401 14245
NM_025180chr343492 3198 2938 235 --43067 2628 2195 192 13121
NM_025182chr931063 267 97 ------
NM_025191chr1113295 2911 2496 1251 1172 956 674 301 275 100 85 --13237 23539 2616
NM_025221chr42495 306 --1157 11086
NM_030621chr1483752 3494 3275 3105 2708 1336 1046 578 ----181
NM_030623chr251638 1235 1075 693 497 11157 31272 1122 512 --
NM_030625chr1042443 1998 1841 1773 12041 ----
NM_030627chr523738 601 11128 23296 1625 --
NM_030629chr1621544 238 ----1532
NM_030634chr13626 414 77 1744 42165 1672 963 541 --
NM_030637chr142286 80 2630 474 ----
NM_030647chr775262 4101 4058 1046 867 749 346 --45550 5084 4790 404 11630
NM_030648chr4145573 4733 4610 4487 4307 3793 3398 1957 1839 1707 1605 1399 1156 961 21873 180 11528 --
NM_030665chr1751354 1299 903 268 173 ------
NM_030667chr1221062 859 ----1159
NM_030668chr1221062 859 ----1159
NM_030669chr1221062 859 ----1159
NM_030670chr1232094 1891 592 ------
NM_030671chr1232094 1891 592 ------
NM_030674chr12115666 4844 4155 3940 3912 3637 3608 1640 1419 1314 844 44934 4519 4218 2270 21066 189 11581
NM_030755chr1452155 1908 840 342 51 33038 2968 1956 --1250
NM_030762chr12--11908 ----
NM_030773chr201416 11565 11772 11628
NM_030780chr81269 ------
NM_030786chr151319 642 613 591 167 --11691 --
NM_030789chr201275 ------
NM_030799chr562215 2011 1723 1492 667 309 21904 106 --1706
NM_030806chr1209439 8565 8492 8291 7649 7518 6907 6838 6787 6416 5865 5817 3727 3613 3491 3022 2813 2265 1970 915 12827 27217 6812 --
NM_030816chr122791 1077 --12245 --
NM_030884chr341657 1569 1543 1410 ------
NM_030906chr113562 504 217 --1425 --
NM_030918chr164175 4163 3633 620 574 359 --23530 1413 --
NM_030920chr1--1247 21292 638 11936
NM_030934chr131713 724 415 --1648 --
NM_030962chr1131527 617 416 --21390 1241 --
NM_031157chr123260 170 71 ------
NM_031216chr185505 469 445 303 235 --21899 888 --
NM_031217chr111574 ------
NM_031284chr153745 185 160 --1930 --
NM_031296chr412176 --21822 616 22289 79
NM_031314chr1411749 --1564 11393
NM_031362chr252759 2641 2543 491 300 1950 22377 601 12460
NM_031365chr252895 2777 2679 627 436 11086 22513 737 12596
NM_031366chr252895 2777 2679 627 436 11086 22513 737 12596
NM_031369chr43805 786 62 ----2741 604
NM_031370chr43805 786 62 ----2741 604
NM_031371chr151596 1470 580 564 269 --11480 --
NM_031371chr151596 1470 580 564 269 --11480 --
NM_031372chr43536 487 68 --2462 109 --
NM_031418chr114832 639 341 167 ----12478
NM_031427chr14115718 5600 5307 4886 4830 4350 3840 1793 1305 511 85 --25348 1423 --
NM_031431chr1321451 209 --21884 610 --
NM_031435chr1263358 3307 3165 2951 2482 1179 1214 1132 --
NM_031442chrX42376 2328 1173 316 32759 1236 951 1616 --
NM_031468chr7117777 6511 6332 2923 2735 2478 2391 1750 1647 629 421 23036 2106 36841 5059 1788 --
NM_031469chr693235 2912 2676 1603 1562 1542 1408 735 561 12696 1480 --
NM_031483chr2063570 1112 1057 1048 564 225 22549 145 22206 388 12920
NM_031845chr2103405 3322 3011 2403 2377 1464 1139 715 512 314 --11217 --
NM_031847chr2103405 3322 3011 2403 2377 1464 1139 715 512 314 --11217 --
NM_031850chr31741 ------
NM_031850chr31741 ------
NM_031890chr2253089 2914 2896 2716 78 --11983 --
NM_031914chr142793 625 1811 1711 --
NM_031922chr61579 ------
NM_031935chr13828 675 253 ------
NM_031940chr842092 2005 173 153 --32040 798 143 --
NM_032012chr964345 3911 1996 1889 1463 616 --65078 4233 3622 3544 1754 1285 --
NM_032013chr2041401 1228 462 298 1414 ----
NM_032018chr12595 157 --190 --
NM_032027chr1124 --175 --
NM_032042chr562645 1067 746 452 445 257 12556 11123 --
NM_032049chr31741 ------
NM_032049chr31741 ------
NM_032050chr223218 184 101 ------
NM_032102chr1163052 2844 2660 1157 529 235 --2513 38 --
NM_032105chr187939 7674 7078 6895 6045 5738 2607 2450 45670 1382 1369 150 1488 16726
NM_032116chr1395217 5032 4632 4164 4132 3650 2265 1504 746 15164 15729 1311
NM_032138chr132461 103 ------
NM_032144chr2--11120 ----
NM_032145chr641740 1474 670 390 --11421 --
NM_032154chr1061034 1012 421 191 51 41 --2908 69 --
NM_032160chr1854350 1629 1490 1254 902 33125 3020 914 --12944
NM_032175chr54614 127 74 47 --11469 --
NM_032221chr2041762 1298 704 111 ------
NM_032226chr93806 627 221 ------
NM_032228chr1142412 2166 843 635 12185 42192 1112 928 917 12456
NM_032233chr143879 262 184 --1640 --
NM_032239chr4--11307 135 21006 404
NM_032242chr3--13319 ----
NM_032246chr151878 --11255 --
NM_032288chr341482 652 358 106 --1216 1515
NM_032291chr1165 ------
NM_032293chr91234 ------
NM_032299chr112263 256 ------
NM_032312chr21267 ------
NM_032324chr11195 --1231 --
NM_032352chr14----11440 --
NM_032373chr10135181 5059 5043 4682 3752 3644 2345 2013 1795 1621 1157 315 105 25882 3705 13793 15601
NM_032375chr191128 ------
NM_032424chr113641 319 45 ------
NM_032434chr271334 1060 555 490 107 84 73 ------
NM_032439chr1011226 11508 ----
NM_032440chr1052702 1968 1048 749 117 ------
NM_032445chr1572569 2535 2077 1633 707 555 371 --1608 --
NM_032446chr553687 3506 3307 616 568 --23521 2472 --
NM_032457chr463657 3090 1536 1346 1114 609 ------
NM_032458chrX52928 2858 1335 507 151 12112 31115 1013 88 --
NM_032491chr1221062 238 --184 1195
NM_032499chr1541537 1320 1088 334 1709 ----
NM_032505chr332300 851 132 22084 518 21943 414 12175
NM_032509chr872029 1933 1924 1606 960 673 29 ------
NM_032521chr2053252 3241 2211 2014 298 12684 145 --
NM_032550chr104337 203 116 23 --1307 --
NM_032557chr41880 ------
NM_032558chr9--11154 2409 225 --
NM_032574chr2--144 ----
NM_032581chr741557 266 152 127 --1205 --
NM_032582chr1721571 1244 --31677 1632 363 --
NM_032622chr431544 1038 486 1582 11288 21410 1367
NM_032632chr1441404 1269 412 88 11764 ----
NM_032636chr11219 --126 1195
NM_032682chr382909 2845 2810 2335 1165 327 242 34 1684 23348 2472 --
NM_032782chr541185 888 793 225 2820 814 ----
NM_032804chr1052541 2038 881 796 764 12264 --1617
NM_032810chr1011457 ----1518
NM_032813chr131147 ------
NM_032826chr7105473 5394 4727 4258 1669 1015 599 531 341 141 --11204 23421 317
NM_032832chr641111 658 211 110 ------
NM_032833chr142580 2533 2266 648 12064 12448 --
NM_032837chr1751946 1433 1373 708 50 11812 11355 --
NM_032842chr731306 1200 307 1130 ----
NM_032866chr1552723 970 849 466 353 11291 13196 1361
NM_032870chr62481 174 ------
NM_032873chr1164388 4341 3997 3753 478 151 --43479 3128 227 172 --
NM_032905chr1051187 1108 861 271 107 --1120 --
NM_032932chr1796106 5613 4862 4763 1951 1651 1458 1036 627 26282 4361 25117 1626 --
NM_032949chr131495 --1569 --
NM_032961chr431063 228 123 ------
NM_032968chrX54082 3544 1591 1078 90 --14043 2975 248
NM_032969chrX54082 3544 1591 1078 90 --14043 2975 248
NM_032973chrY54074 3540 1590 1078 90 --14035 2975 248
NM_032975chr1842506 1292 503 238 22687 1099 43460 2402 1393 281 --
NM_032980chr1842506 1292 503 238 22687 1099 43460 2402 1393 281 --
NM_032999chr72953 285 ------
NM_033000chr72953 285 ------
NM_033001chr72953 285 ------
NM_033020chr161800 1581 1468 1153 512 362 13184 34398 3587 1491 11280
NM_033030chr2----11549 --
NM_033044chr11812 ------
NM_033055chr13850 425 102 --121 --
NM_033081chr2031171 1150 576 21420 112 1154 --
NM_033121chr1221851 1176 ------
NM_033132chr1351817 1779 1676 242 104 12249 ----
NM_033143chr464047 3382 1769 1006 265 180 --33543 3277 1117 13893
NM_033181chr663785 3248 2436 1545 985 508 --1695 --
NM_033207chr1062493 1950 1924 1728 1014 687 12264 ----
NM_033211chr521669 1579 --1271 --
NM_033222chr9--11392 ----
NM_033224chr7128035 7674 7077 6034 5641 5344 2961 2951 2845 2021 1888 1057 --1602 --
NM_033225chr883229 2604 2021 827 681 309 268 22 1857 ----
NM_033280chr181137 ------
NM_033281chr51600 --2671 57 --
NM_033285chr884138 4023 3980 3400 3306 1708 914 526 1157 ----
NM_033331chr963313 3197 2221 684 41 33 12603 ----
NM_033360chr1253443 1670 1373 1068 815 13548 43886 3427 928 373 13261
NM_033380chrX3796 359 158 ------
NM_033381chrX3796 359 158 ------
NM_033389chr17104796 4614 4003 3259 3107 1766 1758 1474 1428 1362 11712 14583 --
NM_033393chr461880 1842 1809 1175 1126 47 --1368 1290
NM_033402chr81550 --1139 --
NM_033425chr1193493 3443 3425 2859 2765 2718 2660 2395 526 --13187 --
NM_033429chr1523247 990 22776 432 42564 1184 477 197 1911
NM_033430chr443629 3166 1387 171 23386 2835 ----
NM_033437chr443629 3166 1387 171 23386 2835 ----
NM_033480chr682740 2118 1866 1122 883 610 462 346 1335 12201 --
NM_033481chr682740 2118 1866 1122 883 610 462 346 1335 12201 --
NM_033505chr266353 5379 5352 5282 1927 746 22633 2399 34483 2321 1810 12684
NM_033631chr1113600 3406 3266 2690 2651 2594 1295 966 805 577 181 1534 --1468
NM_033642chrX3977 791 244 --11117 11033
NM_033656chr21135804 5244 4905 4440 4218 4115 4057 3852 2209 2072 1841 1832 1299 1885 25711 5233 --
NM_048368chr181806 ------
NM_052811chr1384368 3278 1614 1390 1286 806 680 70 --1744 --
NM_052832chr872862 2486 2226 2142 965 486 197 --22903 2127 --
NM_052834chr1882589 2273 1789 1727 1678 851 799 503 ------
NM_052840chr1551368 1030 547 355 129 1307 ----
NM_052867chr1341449 1184 1151 955 ------
NM_052879chr1263978 3574 1298 1108 614 292 32537 1193 326 --23179 1174
NM_052886chr852015 1991 1850 398 127 11876 ----
NM_052901chr911122 ------
NM_052905chr221694 1565 1124 --1652
NM_052910chr1352037 2022 1608 1558 1389 ------
NM_052918chr1073641 3608 3076 1452 728 571 303 1547 ----
NM_052927chr552168 2031 2009 1377 62 --11848 --
NM_052937chr852316 2058 2003 654 302 1324 22720 265 --
NM_052958chr81278 ------
NM_052965chr13872 360 40 --2492 170 --
NM_053016chr9117149 6961 6860 6768 6277 5309 5032 4850 3168 2452 1903 12695 11919 --
NM_053023chr1183005 2834 2513 2124 2110 1148 299 38 ------
NM_053042chr462220 280 262 193 106 69 1849 ----
NM_053043chr7115572 5125 4769 4018 3953 2265 2164 2104 1414 935 483 14364 15318 --
NM_053067chr91275 ------
NM_057157chr101213 129 ----
NM_057159chr95636 590 461 382 301 --2312 163 --
NM_057164chr21495 ------
NM_057165chr21495 ------
NM_057166chr21495 ------
NM_057167chr21495 ------
NM_057168chr751743 1561 1217 682 374 ------
NM_057175chr42919 368 ------
NM_057178chr1752581 1987 1754 1084 563 32768 1804 978 22757 2593 --
NM_078469chr1041048 889 453 349 --1511 --
NM_078470chr1062176 1669 920 522 413 277 12245 12223 --
NM_078473chr842092 2005 173 153 --32040 798 143 --
NM_078625chr631390 1135 129 --11043 --
NM_078629chrX1582 ------
NM_078630chrX1582 ------
NM_080546chr941988 1981 468 335 ------
NM_080591chr963043 2669 2433 2180 869 284 --12290 --
NM_080617chr2021106 337 --1930 1263
NM_080629chr121376 1011 --11321 --
NM_080630chr121376 1011 --11321 --
NM_080664chr14164 ------
NM_080676chr2052743 2480 2001 1064 762 --1948 --
NM_080678chr21582 ------
NM_080723chr611112 --2433 83 --
NM_080738chr161778 1700 1643 785 680 350 ----1334
NM_080743chr632451 1575 690 1412 --1751
NM_080764chr2263183 2841 2430 824 428 141 --12735 --
NM_080792chr2052229 1930 684 644 552 --22312 483 --
NM_080867chr1464970 4823 3377 3173 1694 1040 13208 34609 4080 1996 --
NM_080872chr872512 2500 1416 1307 1136 1059 251 22838 2690 ----
NM_080874chr461717 1486 712 701 619 583 11294 ----
NM_100264chr104622 197 168 90 1779 ----
NM_100486chr104622 197 168 90 1779 ----
NM_130434chr151436 ------
NM_130435chr1042204 636 484 376 11078 --12908
NM_130438chr2183127 2625 2118 2083 733 421 360 218 --13052 --
NM_130446chr364207 3955 3373 2676 1550 877 --11708 --
NM_130469chr14----1740 --
NM_130782chr131142 1037 282 --177 --
NM_130798chr1511305 11206 1301 --
NM_130809chr562777 2691 2160 1148 28 22 31102 663 277 12974 --
NM_130847chr1155035 4713 3963 3616 2369 13950 45807 4233 3711 121 11056
NM_133170chr20136767 6500 5722 5184 2623 2463 2315 2246 1854 1500 436 213 126 26729 3211 22944 871 --
NM_133264chr1753832 3464 2915 1280 1171 33425 2729 1224 31405 1269 1081 1438
NM_133330chr463193 2840 2380 1283 465 365 13136 23285 630 --
NM_133331chr463193 2840 2380 1283 465 365 13136 23285 630 --
NM_133334chr4106334 5936 5653 5046 5027 2310 1416 978 366 250 --36047 4216 1432 1792
NM_133335chr463193 2840 2380 1283 465 365 13136 23285 630 --
NM_133370chr452922 2882 2241 1128 772 12269 23404 2494 --
NM_133372chr592788 2735 1991 1139 745 614 205 187 99 --11082 --
NM_133477chr493236 3129 2276 2245 2084 1252 1056 930 870 22110 86 1952 21295 991
NM_133489chr12----1274 --
NM_133493chr644002 3730 2831 170 --34346 3555 1831 14274
NM_133494chr1188 ------
NM_133496chr1114571 4542 4061 3893 3735 3619 3170 1456 1370 1040 203 1183 24488 4215 --
NM_133499chrX1187 ------
NM_133510chr141139 --1383 --
NM_133638chr521141 1090 1535 ----
NM_133645chr62601 442 --2450 21 --
NM_133646chr2105586 5453 5427 5064 4928 4603 4056 2146 2085 951 14828 21393 275 --
NM_134265chr171466 --11248 1104
NM_138270chrX42509 2486 2154 289 23189 883 12400 1370
NM_138286chr1943412 3394 1477 227 12795 ----
NM_138288chr1431562 1556 121 1679 21766 460 1518
NM_138292chr1183515 3403 2964 2876 2773 2696 1419 1197 --33088 2707 1061 --
NM_138316chr1021174 399 1956 11164 --
NM_138423chr1521569 201 11419 11723 12246
NM_138444chr1384731 4722 4625 3273 1160 849 558 546 13466 44853 4309 987 408 --
NM_138459chr683602 3489 3359 2672 1441 1083 740 33 1780 ----
NM_138468chr2116007 5913 5656 5298 4866 4649 4506 3988 1982 1627 1174 25935 1721 2774 533 12016
NM_138473chr1265146 5111 3962 3270 1527 1141 11579 24682 4247 --
NM_138485chr3124 ------
NM_138492chr531510 566 547 ------
NM_138558chr12991 925 --2823 215 1470
NM_138559chr22992 527 ------
NM_138571chr6----290 22 --
NM_138576chr1474314 4071 3922 3367 2998 1352 311 --24726 1672 --
NM_138621chr254164 3700 3221 1012 778 1967 13274 --
NM_138633chr61121 1701 ----
NM_138635chr742860 1088 160 61 12891 --1323
NM_138638chr1451852 1790 1725 1562 426 --11747 --
NM_138713chr16137726 6375 5770 5218 3306 2804 1832 1671 1576 1246 452 319 128 --15979 15973
NM_138714chr16137726 6375 5770 5218 3306 2804 1832 1671 1576 1246 452 319 128 --15979 15973
NM_138731chr1463664 2722 1226 1044 673 215 21156 479 34022 2969 2646 23697 3276
NM_138735chr221041 449 --31400 560 135 --
NM_138771chr721422 1113 11302 ----
NM_138782chr512174 1727 12350 --
NM_138959chr1136034 5786 5757 5539 5428 5048 4250 2561 2498 1252 932 374 227 --26307 5021 12390
NM_138970chr1432157 1574 680 11875 1365 --
NM_138971chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_138971chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_138972chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_138972chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_138973chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_138973chr1163196 2619 2584 1346 525 157 --23659 3598 --
NM_139045chr91225 ----1590
NM_139048chr32368 25 2434 417 ----
NM_139070chr51222 ------
NM_139131chr112283 249 1172 ----
NM_139135chr111180 --21353 281 --
NM_139156chr11889 ------
NM_139168chr531894 1620 338 --1517 11247
NM_139207chr1231837 1706 1560 11544 11469 --
NM_139242chr1541174 432 396 79 11092 ----
NM_139245chr341779 673 545 315 --139 --
NM_139279chr2103381 3230 2881 2818 2578 2433 2350 566 482 288 53413 2318 2184 1362 317 23066 1388 13541
NM_139286chr9--170 ----
NM_139312chr1031377 1084 321 ------
NM_139321chr20114100 3533 3274 3219 2933 2913 2768 2705 1108 801 109 --11302 --
NM_144571chr446435 4921 4716 1975 15538 26484 138 --
NM_144578chr1495341 5146 4925 4420 4085 3788 3544 1413 749 --14028 --
NM_144590chr1072754 1934 1139 844 805 498 68 12164 ----
NM_144599chr1575481 4904 3773 3558 1935 1360 1156 --11485 14989
NM_144600chr1631535 1468 617 ----1636
NM_144632chr252441 2047 569 336 36 --21927 1539 --
NM_144664chr1132144 1726 665 --12610 1962
NM_144710chr21333 ------
NM_144721chr432643 1831 1739 --3986 516 149 --
NM_144728chr12620 165 ------
NM_144729chr12620 165 ------
NM_144767chr1594040 3934 2892 2860 1327 572 409 323 227 14304 24540 679 --
NM_144778chr1372529 2306 2176 841 822 812 792 ------
NM_144949chr282217 2199 1773 847 603 473 214 92 31982 1050 635 11945 --
NM_144963chr872192 2171 1080 881 689 615 274 --2657 432 --
NM_144967chrX3973 709 298 --11036 --
NM_144973chr1264842 4399 4244 1889 737 67 ----13419
NM_144979chr41483 ------
NM_144982chr123624 608 69 ------
NM_145010chr1041824 1544 672 436 --21935 208 --
NM_145044chr351791 1230 710 486 79 1514 131 --
NM_145052chrX2985 687 --1963 --
NM_145055chr1843606 2547 2449 393 --23794 1303 --
NM_145117chr1142851 2392 849 408 --52821 2424 2173 1248 930 --
NM_145176chr643145 3127 3113 568 --32604 1126 874 --
NM_145178chr101218 ------
NM_145206chr1032816 2414 2358 11226 11289 12283
NM_145207chr465104 4943 4154 2094 668 150 1491 14322 15126
NM_145235chr101118 ------
NM_145244chr461734 1127 347 321 209 22 --21633 1273 --
NM_145259chr276597 6310 5479 5132 4742 2745 980 26843 1352 36557 5017 469 --
NM_145274chr17--1194 ----
NM_145284chrX52384 1627 404 375 108 1670 ----
NM_145307chr1064035 3791 1654 1472 902 336 13179 ----
NM_145320chr793415 2843 2662 2506 2377 806 570 322 257 12990 11409 --
NM_145321chr793415 2843 2662 2506 2377 806 570 322 257 12990 11409 --
NM_145322chr793415 2843 2662 2506 2377 806 570 322 257 12990 11409 --
NM_145332chr6----2858 191 --
NM_145333chr6----2858 191 --
NM_145341chr1021868 545 31894 1425 504 ----
NM_145686chr242817 2247 1136 218 1461 22435 2199 --
NM_145687chr242817 2247 1136 218 1461 22435 2199 --
NM_145693chr282183 2141 1715 1582 882 700 565 495 --12609 --
NM_145698chr1041855 1423 188 28 1249 ----
NM_145753chr311519 --31540 1421 1398 --
NM_145756chr1831400 1058 268 ------
NM_145861chr161778 1700 1643 785 680 350 ----1334
NM_145891chr16----11750 --
NM_145892chr16----11750 --
NM_145909chr621193 1100 --2422 139 --
NM_147156chr102594 403 --11413 --
NM_147157chr9----1896 --
NM_147175chrX42021 1685 612 360 --1829 11502
NM_147181chr42495 306 --1157 11086
NM_147182chr42495 306 --1157 11086
NM_147183chr42495 306 --1157 11086
NM_147223chr252076 1873 1763 629 261 --1505 --
NM_147233chr251893 1690 1580 446 78 --1322 --
NM_148174chr831998 1680 562 2211 192 ----
NM_148894chr441243 1044 893 77 126 ----
NM_148955chr15105615 5434 5128 5122 4783 4274 4147 2503 2438 696 44173 1840 1784 106 15251 --
NM_148957chr1382605 2484 2402 2052 993 766 383 211 167 1920 --
NM_148977chr1021174 399 1956 11164 --
NM_148978chr1021174 399 1956 11164 --
NM_152265chr11477 137 11260 --
NM_152277chr572105 1912 1755 1674 579 205 198 1829 ----
NM_152291chr411083 1113 11105 --
NM_152305chr332038 1591 1460 ----1166
NM_152317chr12145 ------
NM_152330chr1442665 1001 442 372 ------
NM_152352chr1863050 2869 2060 901 872 261 12954 1414 --
NM_152388chr2104038 3521 3507 3120 1180 1012 984 712 671 101 ----11378
NM_152390chr22510 173 ------
NM_152400chr411725 --11583 --
NM_152406chr551665 1490 1232 633 92 ----21504 1338
NM_152409chr552906 1166 1128 977 39 --12366 --
NM_152429chr1051241 969 491 483 292 11287 ----
NM_152437chr1232134 589 282 21860 707 ----
NM_152444chr1451276 1164 827 779 34 1506 2405 254 --
NM_152450chr1551365 836 658 448 330 --1261 --
NM_152510chr22--2805 731 ----
NM_152556chr741957 1704 1602 774 12195 ----
NM_152557chr721310 1099 ------
NM_152574chr9--1148 1280 --
NM_152584chrY2209 74 ------
NM_152605chr1921397 303 ------
NM_152613chr223176 99 27 --21035 916 1821
NM_152622chr562208 1019 1011 837 753 219 --22308 2147 --
NM_152624chr5177123 6886 6761 6732 6423 6314 5861 5742 5503 5371 5091 2154 1759 1426 950 804 703 27062 201 26522 6484 15470
NM_152629chr952493 1046 884 232 148 24123 3416 --22620 631
NM_152638chr122872 508 ------
NM_152667chr2021245 416 1433 ----
NM_152678chr372559 1965 1045 649 423 273 139 ------
NM_152688chr61353 ------
NM_152699chr373567 3148 1476 1389 967 692 312 --1743 --
NM_152707chr102863 358 ------
NM_152713chr11----163 --
NM_152721chr181723 ------
NM_152724chr1052457 2244 2155 1969 1762 --32681 2542 686 --
NM_152725chr102444 297 ------
NM_152726chr131418 ------
NM_152754chr712850 ------
NM_152756chr593702 3449 3406 2720 1714 798 638 627 453 24029 601 14228 --
NM_152758chr843007 2589 796 291 ------
NM_152765chr842011 948 524 384 12314 ----
NM_152787chrX63952 3903 3841 3710 3582 438 1407 11205 --
NM_152789chr7--11104 11276 --
NM_152793chr754559 4328 3599 3413 1998 11034 --13684
NM_152826chr15105615 5434 5128 5122 4783 4274 4147 2503 2438 696 44173 1840 1784 106 15251 --
NM_152835chr132616 517 118 --22071 960 --
NM_152836chr811766 21621 735 --11632
NM_152837chr811766 21621 735 --11632
NM_152838chr2073424 3112 1420 1300 1101 427 161 22731 2404 1720 --
NM_152857chr65882 774 396 100 93 --127 --
NM_152858chr65882 774 396 100 93 --127 --
NM_152896chr9------1302
NM_152902chr131694 611 107 2584 206 ----
NM_152903chr1352536 2056 794 756 422 ----12120
NM_152904chr171250 ------
NM_152924chr15156923 5724 5652 5108 4825 4576 2753 2383 2115 1822 1815 1337 1002 972 488 --46715 6275 2074 352 --
NM_152996chr12792 304 --1597 --
NM_152999chr73485 394 123 13582 31801 667 401 13819
NM_153020chr641589 1398 1337 434 ------
NM_153035chr173263 3225 3171 2803 983 952 111 21241 1035 11981 --
NM_153042chr651853 1454 1230 643 321 21792 200 11760 --
NM_153050chr2254126 4007 1754 1444 130 15000 34546 4095 1593 --
NM_153051chr2254126 4007 1754 1444 130 15000 34546 4095 1593 --
NM_153183chrX--3905 895 28 1357 --
NM_153184chr3--11604 ----
NM_153188chr584981 4598 3543 3528 1809 1305 1136 55 1823 23643 1038 --
NM_153207chr1231105 703 249 11278 43530 3320 2803 297 --
NM_153226chr10----41180 1064 978 797 --
NM_153234chr532411 2344 110 12854 ----
NM_153235chr652010 957 658 158 24 21915 110 32128 331 316 11854
NM_153262chr172708 2384 2052 2000 1278 1148 1061 12019 21981 821 --
NM_153267chr9----1804 --
NM_153341chr1--190 1343 --
NM_153365chr452697 2429 2417 646 552 12770 22610 1883 --
NM_153371chr132135 46 1244 ----
NM_153374chr15172 ------
NM_153377chr121297 ------
NM_153453chr65425 395 202 115 107 ------
NM_153456chr1395718 5654 5506 4064 3974 3868 2378 1145 898 15209 26298 4222 --
NM_153605chr361304 1266 1152 526 419 146 ------
NM_153607chr532263 752 733 1331 22498 2121 --
NM_153645chr22103137 2070 1235 1164 1064 453 373 325 291 134 --22963 243 --
NM_153686chr432041 1719 1687 --2995 346 --
NM_153695chr91269 ------
NM_153704chr82394 26 ----1137
NM_153705chr11122503 2133 2058 1745 898 617 473 466 203 196 86 53 12666 1213 --
NM_153713chr12306 28 ----165
NM_153810chr10114852 4668 3683 3424 1603 1294 1114 383 199 137 59 21802 1560 ----
NM_153828chr21963 ----1875
NM_153831chr81818 ------
NM_170606chr731352 417 90 11867 ----
NM_170665chr1263443 3334 3186 970 349 132 --1168 11837
NM_170674chr1521399 553 --21122 377 1996
NM_170677chr1521399 553 --21122 377 1996
NM_170686chr742610 1209 663 581 12898 12286 --
NM_170696chr1541129 687 672 113 ----11707
NM_170697chr1541129 687 672 113 ----11707
NM_170731chr1122255 1049 11118 22239 1784 12530
NM_170732chr1122255 1049 11118 22239 1784 12530
NM_170733chr1122255 1049 11118 22239 1784 12530
NM_170734chr1122255 1049 11118 22239 1784 12530
NM_170735chr1122255 1049 11118 22239 1784 12530
NM_170768chr1161747 1684 1452 1268 1175 53 11694 ----
NM_171998chrX42034 2020 1794 440 ------
NM_171999chr18----1588 --
NM_172069chr232159 2022 1841 ----12132
NM_172070chr231820 1481 894 ------
NM_172071chr197364 6636 5862 5713 5308 4765 2533 2389 1901 46715 5433 1137 795 35219 5204 2130 --
NM_172127chr412097 1366 --1357
NM_172128chr412053 1322 --1313
NM_172159chr331868 437 329 12042 12149 11894
NM_172160chr331868 437 329 12042 12149 11894
NM_172216chr1252790 1808 1034 845 708 --22050 180 --
NM_172242chr101234 1106 ----
NM_172315chr1521399 553 --21122 377 1996
NM_172316chr1521399 553 --21122 377 1996
NM_172337chr141742 ------
NM_172350chr13721 384 365 1215 ----
NM_172359chr13725 388 369 1219 ----
NM_172373chr1341092 979 313 246 ------
NM_173039chr11----2204 58 --
NM_173078chrX2456 179 ------
NM_173082chr651427 1009 640 502 414 1237 ----
NM_173083chr131163 1125 69 --31202 934 881 --
NM_173163chr16133 ------
NM_173165chr161162 ------
NM_173171chr22791 323 --1467 --
NM_173172chr241099 1089 631 104 --1253 --
NM_173173chr22791 323 --1467 --
NM_173198chr952197 2133 2014 1953 434 12521 32533 777 135 11151
NM_173200chr952197 2133 2014 1953 434 12521 32533 777 135 11151
NM_173214chr16137726 6375 5770 5218 3306 2804 1832 1671 1576 1246 452 319 128 --15979 15973
NM_173468chr476001 5372 4584 4272 4264 1123 1039 14522 24785 1005 14717
NM_173469chr1551412 1296 1225 1058 324 11521 ----
NM_173470chrX62633 2101 1943 761 440 329 ----12459
NM_173475chr1631574 1483 532 ----1523
NM_173500chr1531279 574 365 21035 1005 ----
NM_173510chr2272323 2183 2101 1848 736 83 62 --1632 --
NM_173511chr2103592 3507 3501 3291 2704 1202 1187 482 290 132 --13522 --
NM_173519chr82300 254 --1184 --
NM_173536chr494887 4120 4059 3612 1413 1355 1304 418 373 --24934 3655 24503 574
NM_173560chr62625 76 ----1484
NM_173562chr693354 3001 2624 2282 2194 2186 927 584 301 12825 21010 873 --
NM_173576chr1021451 378 12328 22071 2046 --
NM_173582chr1166022 5176 4691 4128 1505 1316 25882 1026 12168 14259
NM_173602chr1273585 2589 1305 894 820 592 75 32701 1220 970 ----
NM_173607chr143629 578 410 3802 682 84 ----
NM_173642chr1208862 8752 8428 8163 8142 8090 7934 7267 6656 6468 6411 6227 6164 3097 2954 2916 2617 1080 816 230 11498 18063 11577
NM_173670chr52934 392 1304 ----
NM_173694chrX52419 1823 811 742 400 ------
NM_173797chr53863 438 142 ------
NM_173808chr164378 4033 3601 3573 515 377 --23132 23 --
NM_173822chr271799 1706 679 495 431 322 110 --21779 1446 --
NM_173825chr343092 3036 2423 2001 --52964 2716 2580 2300 2231 12694
NM_173851chr853159 1340 1273 1102 1043 ----12673
NM_174911chr863901 3512 3459 2963 1479 280 --33267 1078 652 --
NM_174916chr1541886 1578 481 50 1901 ----
NM_175056chr34811 642 470 390 1495 133 1256
NM_175061chr72374 361 --2845 498 --
NM_175611chr21149 ------
NM_175623chr12106837 6660 6420 6035 5663 5551 2478 1761 1017 614 15736 42846 1612 486 103 --
NM_175624chr12116932 6755 6515 6130 5758 5646 4736 2573 1856 1112 709 15831 42941 1707 581 198 --
NM_175625chr12116932 6755 6515 6130 5758 5646 4736 2573 1856 1112 709 15831 42941 1707 581 198 --
NM_175736chr12107498 7491 7096 6562 6462 6377 6194 5806 1951 1425 22929 415 1873 --
NM_175854chr1321954 570 1233 32462 2211 313 --
NM_175856chr51209 ------
NM_175859chrX71714 1490 1366 712 705 663 446 --2544 524 --
NM_175861chr1275426 3686 2052 1567 280 257 102 21029 912 44819 1988 757 169 --
NM_175863chr6136 1901 11192 --
NM_175895chr1211002 --11103 --
NM_175907chr1842665 2374 1834 346 1758 12064 11996
NM_175920chr51630 --1699 --
NM_176081chr1066011 5437 4896 3799 2312 1245 15367 21041 777 --
NM_176083chr1066011 5437 4896 3799 2312 1245 15367 21041 777 --
NM_176814chr711360 --31034 381 53 --
NM_177422chr11160 ------
NM_177438chr1483752 3494 3275 3105 2708 1336 1046 578 ----181
NM_177925chr1242914 2600 2055 1230 12761 --12639
NM_177968chr242165 2026 1479 767 ------
NM_177974chr1521569 201 11419 11723 12246
NM_177999chr983501 3442 2856 2309 1439 1083 762 281 13298 23535 2388 --
NM_178011chr1072661 2527 894 874 624 471 139 1708 23109 687 --
NM_178033chr12467 201 ------
NM_178037chr1283660 3443 3323 2646 2214 1109 852 743 --23333 3003 --
NM_178038chr1283660 3443 3323 2646 2214 1109 852 743 --23333 3003 --
NM_178135chr451239 557 485 360 147 --1502 --
NM_178140chr562529 1980 1769 1067 873 732 ----1538
NM_178151chrX127762 7330 7171 5306 5225 4898 2952 2476 2265 1369 792 766 --37699 5428 1524 --
NM_178152chrX127762 7330 7171 5306 5225 4898 2952 2476 2265 1369 792 766 --37699 5428 1524 --
NM_178153chrX127762 7330 7171 5306 5225 4898 2952 2476 2265 1369 792 766 --37699 5428 1524 --
NM_178313chr271910 1816 1692 821 668 459 424 --1236 --
NM_178423chr731002 189 171 --1463 1914
NM_178425chr731002 189 171 --1463 1914
NM_178426chr142334 1804 1523 316 --21997 308 --
NM_178427chr142234 1704 1423 216 --21897 208 --
NM_178483chr20174 ------
NM_178507chr111742 ------
NM_178509chr17103413 3395 3373 3301 2702 949 671 254 136 128 11256 23273 1413 --
NM_178526chr19----11971 --
NM_178539chr1251934 1803 677 213 30 --3203 164 90 --
NM_178557chr411733 ------
NM_178578chr2092679 2581 2208 1906 779 657 446 281 29 --12485 11752
NM_178581chr201275 ------
NM_178584chr21333 ------
NM_178585chr423096 3079 11163 32204 1324 372 1462
NM_178586chr1472412 2178 1914 1634 1594 841 800 1693 1420 --
NM_178812chr821485 52 ------
NM_178815chr1062683 2011 1079 534 430 21 --22304 161 --
NM_178818chr1651756 615 354 330 87 ------
NM_181054chr1411144 ------
NM_181332chrX52604 2364 827 609 473 --12144 --
NM_181351chr1172392 2255 1124 1101 1091 661 434 ------
NM_181354chr81409 11391 ----
NM_181358chr133094 960 497 --23306 2911 11148
NM_181361chr32582 466 11137 11457 --
NM_181443chr2042404 807 732 662 --21974 224 --
NM_181457chr221214 1016 1251 ----
NM_181458chr221347 1149 1384 ----
NM_181481chr18127030 6696 5773 2713 2548 2368 2161 1902 1008 854 825 340 16582 26901 5573 --
NM_181482chr18127030 6696 5773 2713 2548 2368 2161 1902 1008 854 825 340 16582 26901 5573 --
NM_181483chr18127030 6696 5773 2713 2548 2368 2161 1902 1008 854 825 340 16582 26901 5573 --
NM_181503chr13128 ------
NM_181504chr553683 1205 1076 791 180 ----1683
NM_181519chr10128 ------
NM_181521chr16116537 5396 5135 5111 4868 2598 1861 1169 752 270 80 --21381 316 --
NM_181523chr553683 1205 1076 791 180 ----1683
NM_181524chr553683 1205 1076 791 180 ----1683
NM_181659chr2042160 962 556 158 --12508 --
NM_181659chr2042160 962 556 158 --12508 --
NM_181672chrX51917 1806 1552 513 149 11342 2782 634 11949
NM_181673chrX51917 1806 1552 513 149 11342 2782 634 11949
NM_181702chr81231 --1168 --
NM_181705chr5145030 5022 4607 4433 3711 3689 3549 2177 2018 1807 1705 1339 1027 733 15285 15015 --
NM_181714chr641544 247 196 78 11857 21720 782 11419
NM_181723chr831902 1467 930 1463 ----
NM_181782chr661992 1666 1648 1576 158 37 --22326 226 11619
NM_181783chr1211613 --1142 --
NM_181836chr541850 684 561 319 21655 362 22492 1645 --
NM_181886chr441106 458 318 243 ----1169
NM_181887chr441106 458 318 243 ----1169
NM_181888chr441106 458 318 243 ----1169
NM_181889chr441106 458 318 243 ----1169
NM_181890chr441106 458 318 243 ----1169
NM_181891chr441106 458 318 243 ----1169
NM_181892chr441153 505 365 290 ----1216
NM_181893chr441106 458 318 243 ----1169
NM_181897chr362674 2633 2129 2027 1783 499 --194 --
NM_182515chr19136410 5909 5402 4842 4444 4323 4269 4215 1701 1582 1055 680 112 --16489 --
NM_182641chr1721707 1437 --1106 --
NM_182645chr64395 202 115 107 ------
NM_182701chr61278 ------
NM_182734chr2051195 480 187 80 66 ----22065 923
NM_182757chr673313 2546 2205 880 595 457 124 --23535 1091 --
NM_182762chr7126188 6160 5594 5523 4760 1773 1719 955 907 791 759 427 --45483 4680 4439 3786 1723
NM_182763chr121869 614 1263 2530 254 1290
NM_182765chr102814 520 11772 --2927 612
NM_182830chr1441393 263 96 29 1718 11580 --
NM_182898chr796515 6496 6288 5780 5557 4791 2374 116 97 15086 16549 11135
NM_182899chr796515 6496 6288 5780 5557 4791 2374 116 97 15086 16549 11135
NM_182901chr111590 ------
NM_182907chr642054 1647 429 322 --22215 788 1517
NM_182910chr143910 677 119 --1762 --
NM_182913chr143910 677 119 --1762 --
NM_182914chr143910 677 119 --1762 --
NM_182943chr31328 --1367 --
NM_182948chr152647 2616 631 550 475 --12110 --
NM_182964chr1142851 2392 849 408 --52821 2424 2173 1248 930 --
NM_182972chr172435 2073 1780 1102 727 394 107 12809 ----
NM_182975chr1----144 --
NM_182976chr11697 1212 1649 --
NM_182977chr531099 157 122 ------
NM_183004chr1433945 1284 1026 --23270 1175 --
NM_183006chr20----1193 --
NM_183075chr462876 2584 2310 2277 1960 1862 ------
NM_183227chr641179 1052 337 95 1129 ----
NM_183376chr1532305 118 88 --1396 12168
NM_183393chr31154 ------
NM_183394chr31154 ------
NM_183397chr2085148 4695 4466 4080 1979 1402 470 190 --1260 --
NM_183416chr141804 1375 1275 288 ------
NM_194071chr7114978 4499 4339 4301 4239 3824 1896 754 618 281 150 --23972 1436 23927 2102
NM_194247chr254183 1270 800 708 191 14047 ----
NM_194282chr472277 2216 937 675 480 394 235 ------
NM_194283chr593874 3450 3290 2961 2684 1555 1331 118 39 --1882 12871
NM_194285chr1163272 3161 2975 2562 1073 816 41319 1170 707 94 13039 --
NM_194286chr12115433 5179 4953 4070 3964 2334 1922 1791 1660 1424 546 12495 24041 1950 --
NM_194291chr82941 852 --1432 --
NM_194292chr131608 195 121 ------
NM_194298chr1061705 1686 1340 713 367 92 --2476 298 --
NM_194301chr14------1174
NM_194314chr1124460 3976 3846 1909 1734 1323 638 619 578 452 226 25 22008 1067 24428 1164 13486
NM_194328chr962912 2879 2543 2482 1004 298 --23202 221 --
NM_194329chr962912 2879 2543 2482 1004 298 --23202 221 --
NM_194330chr962912 2879 2543 2482 1004 298 --23202 221 --
NM_194332chr962912 2879 2543 2482 1004 298 --23202 221 --
NM_194356chr1262274 2111 1974 1522 366 158 12245 32372 816 483 --
NM_194434chr1865292 5253 5125 3583 2154 132 14466 45102 4613 4476 59 25339 952
NM_194463chrX1518 ------
NM_197970chr2----11549 --
NM_198066chr1462928 2089 588 377 153 44 ------
NM_198128chr1832154 566 556 12164 21736 1574 --
NM_198158chr351185 655 337 259 172 158 ----
NM_198159chr351185 655 337 259 172 158 ----
NM_198177chr351185 655 337 259 172 158 ----
NM_198178chr351185 655 337 259 172 158 ----
NM_198189chr23400 389 23 --1281 --
NM_198212chr792349 2288 2259 2233 1944 1746 1718 712 336 1208 21728 154 --
NM_198240chr1241280 545 398 82 1905 ----
NM_198268chr133094 960 497 --23306 2911 11148
NM_198269chr133094 960 497 --23306 2911 11148
NM_198270chrX23260 918 22699 489 176 23177 2841
NM_198279chrX1445 11102 ----
NM_198281chr433090 2379 92 ------
NM_198324chr1241337 982 407 250 --1150 189
NM_198336chr741786 1593 1243 253 --1360 --
NM_198390chr1621544 238 ----1532
NM_198399chr361440 1295 401 285 105 89 11123 ----
NM_198400chr1522878 557 ------
NM_198428chr73315 300 153 --1515 --
NM_198465chrX92940 2800 1012 921 759 477 303 107 65 --21102 381 --
NM_198468chr694240 3769 3396 3179 1597 1584 739 571 319 --23686 3341 --
NM_198503chr132069 1778 1575 --22267 2001 --
NM_198513chr841457 661 562 169 11748 1790 --
NM_198529chr17----1416 --
NM_198569chr6102560 2389 2168 1960 1929 940 912 835 547 524 --32427 135 44 --
NM_198581chr267422 7142 6906 6003 4719 196 14712 --22960 2016
NM_198595chr473802 3749 3240 1963 1565 503 32 33544 3460 3328 24782 209 --
NM_198716chr1--1310 ----
NM_198717chr1--1310 ----
NM_198721chr4182 ------
NM_198793chr331229 973 831 22780 664 ----
NM_198859chr3155078 4828 4444 4192 3772 3401 1792 1430 1393 1361 1159 502 490 390 242 --24876 3932 --
NM_198900chr12107498 7491 7096 6562 6462 6377 6194 5806 1951 1425 22929 415 1873 --
NM_198903chr51662 ------
NM_198904chr542129 1445 741 662 11556 ----
NM_198968chr1343918 1395 621 123 --33893 1058 220 13696
NM_198990chr742883 1164 90 39 11018 22511 296 11149
NM_199000chr71760 --12331 --
NM_199003chr81542 21464 1342 11217 --
NM_199072chr741148 1099 702 81 23231 943 22938 2746 11162
NM_199188chr1263978 3574 1298 1108 614 292 32537 1193 326 --23179 1174
NM_199190chr1263978 3574 1298 1108 614 292 32537 1193 326 --23179 1174
NM_199229chr241672 1441 575 242 --11697 --
NM_199320chr481961 1909 1816 1142 717 483 440 240 1642 --1297
NM_199320chr481961 1909 1816 1142 717 483 440 240 1642 --1297
NM_199351chr1----1114 --
NM_199418chr112329 107 ------
NM_199421chr1464970 4823 3377 3173 1694 1040 13208 34609 4080 1996 --
NM_199436chr252826 2733 2212 2167 1225 1161 32305 2288 104 --
NM_199437chr1182271 2225 2100 1992 1705 731 385 238 --11691 192
NM_199438chr1182271 2225 2100 1992 1705 731 385 238 --11691 192
NM_199439chr1182271 2225 2100 1992 1705 731 385 238 --11691 192
NM_199482chr221824 214 21889 1320 ----
NM_201266chr253045 2545 1124 1008 59 1764 12204 --
NM_201279chr253045 2545 1124 1008 59 1764 12204 --
NM_201348chr173459 3195 3068 1631 183 174 44 --1285 --
NM_201432chr17105922 5786 5591 5555 5525 5463 4781 4745 4701 348 --32611 855 584 --
NM_201433chr17105922 5786 5591 5555 5525 5463 4781 4745 4701 348 --32611 855 584 --
NM_201570chr1031688 671 387 ------
NM_201571chr1031688 671 387 ------
NM_201572chr1031688 671 387 ------
NM_201590chr1031688 671 387 ------
NM_201591chr41739 1754 1299 --
NM_201592chr41739 1754 1299 --
NM_201593chr1031688 671 387 ------
NM_201596chr1031688 671 387 ------
NM_201597chr1031688 671 387 ------
NM_201613chr122783 185 ------
NM_201999chr42461 23 1133 2298 93 --
NM_203301chr1451619 1265 1207 254 220 1399 1510 --
NM_203341chr13686 390 329 --1671 --
NM_203342chr183593 2680 2368 423 380 107 99 92 13478 22659 1199 --
NM_203343chr183593 2680 2368 423 380 107 99 92 13478 22659 1199 --
NM_203372chr211513 --1499 21350 1192
NM_203382chr521515 667 1336 ----
NM_203390chr811675 ----1300
NM_203391chrX31763 1456 98 ----11794
NM_203403chr9----11100 --
NM_203404chr11889 ------
NM_203406chr53745 283 124 ------
NM_203437chr2------1235
NM_203446chr214797 318 102 54 1597 22407 781 12147
NM_203453chr951451 1323 540 461 108 11792 1327 --
NM_203459chr132148 334 235 --42095 903 814 93 12382
NM_203463chr284974 3676 3632 3418 1103 987 645 116 11745 31889 1365 672 --
NM_203488chr141330 ------
NM_203499chr171595 --152 --
NM_203504chr441907 635 226 211 1731 21675 752 --
NM_203505chr441907 635 226 211 1731 21675 752 --
NM_205836chr52481 79 --2271 160 1559
NM_205846chr531510 566 547 ------
NM_206594chr152669 2640 1050 731 137 --11013 --
NM_206595chr152669 2640 1050 731 137 --11013 --
NM_206832chr171251 --1207 --
NM_206853chr643792 3127 1370 315 1974 23255 2937 11274
NM_206854chr675053 4388 3587 1576 1259 902 446 --64516 4198 3673 3293 222 170 1258
NM_206855chr696018 5353 4552 2541 2224 1867 1411 983 39 1336 75481 5163 4638 4258 1187 1135 707 11223
NM_206866chr2142082 797 752 578 1688 12339 1600
NM_206876chr263197 2842 2636 1382 780 33 13153 21351 1168 11153
NM_206907chr532810 2281 2046 1254 ----
NM_206937chr131775 --1765 --
NM_207012chr1032893 1374 1105 --32321 629 230 --
NM_207015chr332106 1810 69 ----2235 87
NM_207043chr192216 2112 1677 1599 904 827 600 377 240 ------
NM_207044chr192216 2112 1677 1599 904 827 600 377 240 ------
NM_207047chr192216 2112 1677 1599 904 827 600 377 240 ------
NM_207291chr191121 ------
NM_207303chr1054110 3594 3306 2618 936 23760 230 44178 1656 487 334 13388
NM_207304chr1372416 2193 2063 728 709 699 679 ------
NM_207306chr184501 3905 3877 3170 1691 1516 380 130 14395 ----
NM_207337chr124893 729 325 74 --1906 11011
NM_207371chr103615 400 247 ------
NM_207380chr15103453 3058 2735 2626 2471 2410 2278 1330 1056 414 --32230 903 337 --
NM_207406chr4125038 4852 4331 3963 2410 2380 2251 1862 1321 1246 771 189 11454 36331 5554 455 14247
NM_207520chr21963 ----1875
NM_207521chr21963 ----1875
NM_207645chr11------1459
NM_212471chr1741579 1566 456 220 12164 22118 350 --
NM_212472chr1741579 1566 456 220 12164 22118 350 --
NM_212474chr2--1916 2823 275 1683
NM_212475chr2--1916 2823 275 1683
NM_212476chr2--1916 2823 275 1683
NM_212478chr2--1916 2823 275 1683
NM_212482chr2--1916 2823 275 1683
NM_213589chr235614 5105 3998 --2509 329 --
NM_213590chr1384368 3278 1614 1390 1286 806 680 70 --1744 --
NM_213594chr1221062 238 --184 1195
NM_213611chr121383 1152 ----