TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1265
miRNA Sequence: CAGGAUGUGGUCAAGUGUUGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr142896 90 2728 415 ----
NM_000037chr852512 2072 787 633 134 ------
NM_000052chrX103368 2931 2884 2358 2155 1067 756 567 557 479 12212 ----
NM_000081chr121637 748 --21324 694 --
NM_000084chrX106410 5045 4706 2488 1794 1768 1463 1033 530 353 11250 25030 4824 --
NM_000089chr72702 113 1619 ----
NM_000091chr252343 1826 878 467 270 138 22824 1786 --
NM_000092chr254462 4379 3922 1252 340 13711 23408 1278 --
NM_000109chrX31058 539 523 12246 --22214 782
NM_000112chr554719 4173 1872 1011 336 21415 1209 21632 618 --
NM_000114chr2021151 154 --1205 --
NM_000151chr1731832 602 113 --31846 1207 1186 --
NM_000158chr31518 1230 ----
NM_000165chr631614 1474 483 11051 --1426
NM_000167chrX2691 222 --2498 281 --
NM_000168chr763062 2995 2698 2560 1257 790 11092 12573 12732
NM_000176chr573254 2951 2510 1279 1257 1167 244 12707 ----
NM_000208chr1943731 1486 1359 1171 23785 145 --11415
NM_000214chr2011456 ------
NM_000217chr12105219 5202 3585 1918 1773 1663 1573 1536 1497 654 --1431 --
NM_000227chr18185 --1303 --
NM_000238chr72397 150 ------
NM_000245chr742018 1411 819 504 --22259 2052 --
NM_000248chr332330 2025 1043 1991 ----
NM_000252chrX11321 --11380 --
NM_000259chr1584038 3957 2438 2339 1990 1911 1600 218 16169 25961 5272 --
NM_000264chr933070 1261 778 ------
NM_000267chr1723004 2818 1397 12931 22799 2313
NM_000276chrX62230 1872 1423 867 791 588 21806 360 --1165
NM_000284chrX41736 1509 588 531 1342 11282 --
NM_000291chrX2898 166 1242 1194 --
NM_000314chr1053298 2747 2546 620 159 ----41201 748 481 406
NM_000318chr8102929 2675 2529 2399 2389 2287 1036 946 520 88 167 11184 --
NM_000325chr4----1198 --
NM_000329chr12807 649 ------
NM_000332chr695798 4418 2875 2758 2358 2009 1720 1156 247 ------
NM_000337chr596243 5733 5314 4234 4159 2514 329 317 259 --36230 2644 204 35807 1514 1444
NM_000338chr15--11139 1914 --
NM_000362chr2263413 2741 2300 1145 745 173 ------
NM_000367chr652116 2099 2024 920 798 --22226 675 --
NM_000369chr1411832 --11810 11682
NM_000382chr1781883 738 676 622 612 598 188 180 ----1768
NM_000393chr221905 159 --1711 --
NM_000408chr283469 2769 2694 2604 999 921 524 129 13475 1289 --
NM_000426chr61216 ------
NM_000430chr1773484 3474 3196 2895 2869 2744 2701 --12334 --
NM_000436chr531558 1142 496 --21531 479 --
NM_000439chr5----3639 218 111 --
NM_000442chr1741144 162 37 23 --1246 --
NM_000448chr1132269 2154 1992 12052 --12343
NM_000449chr181266 1150 939 569 471 248 112 31 ------
NM_000461chr321482 1426 --11029 --
NM_000462chr15--11795 11389 --
NM_000474chr73523 267 251 ----1576
NM_000484chr21----11110 --
NM_000489chrX43415 857 821 382 --13132 --
NM_000508chr44991 939 897 125 ------
NM_000523chr21342 --1444 --
NM_000533chrX2746 467 176 ----
NM_000544chr6_cox_hap143132 1013 832 302 12086 1488 --
NM_000555chrX87842 7543 5596 5345 4816 3134 3044 230 12411 35262 2403 948 11234
NM_000574chr121153 496 --21063 187 --
NM_000598chr731065 462 196 --11382 --
NM_000612chr1173621 3571 873 834 208 107 40 1848 22915 2523 --
NM_000615chr1183006 2957 2881 2867 2198 1174 953 126 --1683 --
NM_000618chr1266393 5649 4237 1485 1205 156 --46110 4219 2318 2283 --
NM_000618chr1266393 5649 4237 1485 1205 156 --46110 4219 2318 2283 --
NM_000633chr1854473 4357 4053 3171 1935 23802 3644 33375 1636 1572 14618
NM_000663chr1632172 723 257 --22821 2138 --
NM_000675chr221255 ------
NM_000724chr103745 708 61 21590 752 ----
NM_000726chr21909 21357 72 ----
NM_000756chr81354 --1431 --
NM_000782chr205840 248 170 126 37 180 ----
NM_000793chr1454932 4385 3839 306 281 --11788 --
NM_000794chr521055 160 ------
NM_000809chr4109269 8422 7165 7140 6258 6158 3577 1782 854 244 --16305 --
NM_000813chr552052 1938 1788 367 132 --15049 --
NM_000814chr1583325 3246 1532 1229 1186 978 888 862 --33105 521 454 --
NM_000824chr4--1359 1821 --
NM_000826chr452224 2192 1605 299 242 1779 21698 336 --
NM_000827chr532478 2090 392 ------
NM_000829chr1142070 909 731 434 2643 129 ----
NM_000831chr1105829 5544 4346 4318 4166 4135 1305 970 192 72 26189 5496 --14951
NM_000833chr1641421 1378 1224 1131 ------
NM_000844chr311066 --1174 --
NM_000860chr441391 1168 562 473 --11572 --
NM_000864chr161115 1083 980 781 751 323 --1988 --
NM_000868chrX52277 2097 883 778 519 --1460 --
NM_000875chr1566577 5534 2668 1975 1560 1470 25132 1109 --15375
NM_000891chr1753248 1139 1130 1081 989 13067 ----
NM_000899chr1273220 3046 1339 1306 792 635 413 11439 23944 120 --
NM_000926chr1199407 7965 7126 6442 3771 3624 2038 1330 981 --38226 7257 904 --
NM_000933chr2031752 659 487 ----11505
NM_000944chr432043 1769 1552 12219 12341 --
NM_000945chr24778 644 289 70 --1446 1576
NM_000950chrX53150 2595 2415 726 545 --1757 12873
NM_000956chr141849 2979 773 ----
NM_000958chr521355 313 1108 21021 131 --
NM_000964chr171363 --1325 --
NM_000983chr1171 --1400 --
NM_001001323chr1252827 2797 2611 1035 101 12945 167 --
NM_001001395chr1232769 2263 575 1684 2766 43 --
NM_001001396chr153658 2731 1776 1090 692 22971 1435 21511 600 --
NM_001001433chr2062706 1975 1127 872 480 136 13016 13213 --
NM_001001436chr16184 --1845 --
NM_001001481chr832737 1084 153 ----22348 2312
NM_001001521chr2--1218 ----
NM_001001556chr1511459 1187 1493 --
NM_001001557chr821595 478 11915 ----
NM_001001870chr173801 607 270 ------
NM_001001890chr2164072 3868 3348 3239 3233 118 --33964 1464 1173 --
NM_001001933chr12624 599 ------
NM_001001938chr963550 3419 3221 1285 1072 83 22515 563 13111 --
NM_001001971chr103922 873 68 --21363 1165 --
NM_001001974chr1052227 2093 910 887 38 --1412 --
NM_001002009chr7164 --192 1556
NM_001002010chr7164 --192 1556
NM_001002233chr831859 378 193 ------
NM_001002255chr6162 --198 --
NM_001002257chr273577 3407 2650 2328 947 496 468 1998 1850 --
NM_001002838chrX41747 1205 237 169 ------
NM_001002860chr1474309 3990 3542 3458 3394 800 42 24685 3432 1751 --
NM_001002909chr174897 665 507 285 ------
NM_001003652chr18138329 7917 7635 6840 6217 5719 5498 3320 2376 1607 1445 935 645 35255 3249 1514 16888 --
NM_001003674chr18156854 6218 6046 5906 5289 4693 4520 2644 2041 2018 1602 1369 1215 975 706 --1684 15024
NM_001003675chr18156854 6218 6046 5906 5289 4693 4520 2644 2041 2018 1602 1369 1215 975 706 --1684 15024
NM_001003688chr421058 814 ----1225
NM_001003712chr1233784 1559 1114 1182 ----
NM_001003760chr673457 3280 3159 2561 1191 665 564 --33591 2388 2378 --
NM_001003786chr174542 243 79 24 1632 1116 --
NM_001003787chr174542 243 79 24 1632 1116 --
NM_001003788chr174542 243 79 24 1632 1116 --
NM_001003800chr962853 2759 1402 818 294 35 --33214 1147 266 --
NM_001003894chrY180 ------
NM_001004065chr953926 3322 2897 2585 1583 ------
NM_001004303chr12806 297 --1685 --
NM_001004303chr12806 297 --1685 --
NM_001004306chr1721754 713 11664 ----
NM_001004313chr1722059 498 ------
NM_001004317chr674261 4111 3623 1483 1447 1328 561 1813 13844 --
NM_001004342chr1145839 5757 5645 4563 3805 2377 2019 2004 1599 1429 1019 688 64 41 --14374 --
NM_001004360chr21348 ------
NM_001004419chr1244485 3663 3573 506 24471 1470 ----
NM_001004441chr521136 83 --123 --
NM_001004722chr221179 120 ------
NM_001005353chr11108 11238 ----
NM_001005353chr11108 11238 ----
NM_001005366chr122236 85 ----1285
NM_001005375chrY21632 1616 ----11675
NM_001005404chr1791732 1378 1350 1072 818 749 539 145 125 --157 --
NM_001005463chr1031869 795 590 12231 ----
NM_001005473chr535251 5200 2458 24537 1358 12012 15856
NM_001005474chr31232 ----11322
NM_001005502chr1275255 4228 3937 1218 1170 1136 1082 ----1861
NM_001005527chr331356 378 318 1972 1228 --
NM_001005609chrX93746 3461 3343 3212 3040 2666 2590 538 388 22603 2322 ----
NM_001005732chr212436 224 1209 ----
NM_001005733chr21--1209 ----
NM_001005746chr21909 21357 72 ----
NM_001005747chr21909 21357 72 ----
NM_001005753chr241448 848 545 128 --22302 866 --
NM_001005849chr17----295 59 --
NM_001005861chr3----2698 282 --
NM_001006115chr341963 1922 1761 544 --11040 --
NM_001006605chr131000 232 219 --2841 742 --
NM_001006605chr131000 232 219 --2841 742 --
NM_001006610chr162399 243 ------
NM_001006617chr931301 1272 441 11215 ----
NM_001006619chr931301 1272 441 11215 ----
NM_001006620chr931301 1272 441 11215 ----
NM_001006621chr931301 1272 441 11215 ----
NM_001006623chr251741 842 829 401 197 --1300 --
NM_001006657chr232069 2050 700 --12646 12020
NM_001006681chrX----1117 --
NM_001006682chrX----1117 --
NM_001006683chrX----1117 --
NM_001007023chr1454932 4385 3839 306 281 --11788 --
NM_001007067chr831045 399 198 ------
NM_001007068chr831045 399 198 ------
NM_001007069chr831045 399 198 ------
NM_001007070chr831045 399 198 ------
NM_001007097chr9104986 4930 4583 4244 4216 4127 3369 1676 1651 1208 ----23287 3144
NM_001007102chr661636 1541 1474 666 212 32 ------
NM_001007156chr1561865 1692 1350 642 324 304 ------
NM_001007237chr12749 280 12655 ----
NM_001007246chr2121679 1587 ------
NM_001007466chr665015 4950 3712 1961 1489 468 11141 13560 --
NM_001007553chr11429 ------
NM_001007565chr3--1322 ----
NM_001007794chr13264 185 154 ------
NM_001008225chr7------1539
NM_001008239chr1863694 3076 3003 2954 965 51 1431 ----
NM_001008391chr111175 --2281 209 --
NM_001008392chr313375 --2816 463 --
NM_001008408chr756195 5539 5052 3974 1136 --34451 885 220 --
NM_001008541chr1041734 713 671 318 1764 1943 --
NM_001008541chr1041734 713 671 318 1764 1943 --
NM_001008564chr132437 89 148 2896 168 --
NM_001008567chr91100 ------
NM_001008660chr1121264 529 --11185 --
NM_001009183chr14129 --1128 1156
NM_001009552chr82624 415 1577 ----
NM_001009554chr494734 4030 3394 3169 3158 2960 2907 1532 885 --11371 --
NM_001009554chr494734 4030 3394 3169 3158 2960 2907 1532 885 --11371 --
NM_001009555chr42318 233 11444 --11672
NM_001009899chr386434 5403 5391 4873 4389 2175 1079 295 25079 880 26389 5503 --
NM_001009993chr264432 4378 1722 1493 658 136 ----11820
NM_001010853chr632796 2781 236 ------
NM_001010861chr122482 292 22702 501 --1618
NM_001010870chr61520 160 1471 --
NM_001010891chr5106715 6306 5730 4807 4405 4245 1731 1720 1574 630 11422 44673 2308 1366 754 15990
NM_001010895chr941958 802 626 471 --1518 --
NM_001010924chr1031208 1081 900 --149 --
NM_001010942chr121250 --1274 2167 98
NM_001010986chrX42474 2436 2232 819 1415 ----
NM_001011513chr411223 33522 854 277 ----
NM_001011546chr204654 554 116 47 --1318 --
NM_001011553chr72928 722 ------
NM_001011658chrX22103 2059 --1160 --
NM_001011663chr103700 387 294 ------
NM_001011666chr7106523 6024 5113 4093 2399 1762 1433 1414 301 53 21735 1566 14294 1430
NM_001011713chr1421381 478 ------
NM_001011885chr1531801 1296 462 --1224 --
NM_001012270chr1741847 1660 1610 1280 1570 ----
NM_001012279chr6--1156 ----
NM_001012393chr11124931 4919 4653 4513 3908 3539 3370 1428 1056 595 557 431 21158 549 1319 14670
NM_001012456chr7--130 ----
NM_001012507chr6139 ------
NM_001012732chr42434 71 11160 --11240
NM_001012751chr1011667 ------
NM_001012755chrX85064 5022 4471 4383 3499 3183 995 100 14605 34885 3195 1710 --
NM_001012968chrX41076 812 403 316 --22685 382 --
NM_001012989chrX1275 --1120 --
NM_001012993chr961219 951 403 305 276 249 ------
NM_001013398chr731065 462 196 --11382 --
NM_001013415chr421355 1059 11408 1633 --
NM_001013642chr12920 776 --1821 --
NM_001013659chr1945333 4069 356 141 ------
NM_001013699chr122570 119 ------
NM_001014380chr1395529 5449 5309 4742 3922 2350 2204 1288 429 1741 25237 1397 11044
NM_001014435chr16139 ------
NM_001014797chr10148035 7883 7453 7263 6039 5779 3140 3079 2939 2851 2405 1142 774 29 16155 27859 5637 --
NM_001014812chr151397 --1307 --
NM_001014839chr1162 ------
NM_001014841chr1162 ------
NM_001015877chrX43000 2315 2244 44 ------
NM_001015881chrX11212 --1379 --
NM_001017368chr1742535 2003 804 421 ------
NM_001017395chr362831 2760 2649 2623 1378 457 --13446 --
NM_001017440chr7167978 7956 7916 7412 6548 6389 5640 5351 3106 3022 2462 2183 2063 845 395 307 25711 1054 --11499
NM_001017963chr141869 --2628 385 --
NM_001017992chr541013 966 497 174 --11102 --
NM_001017995chr5114242 4228 4222 3906 3733 3714 3181 1895 509 253 83 11630 ----
NM_001018050chr2232097 693 576 ----12592
NM_001018052chr2232097 693 576 ----12592
NM_001018056chr9------1191
NM_001018064chr912087 11878 21833 66 --
NM_001018065chr9135903 5665 5422 4834 4032 3787 2217 2155 1520 1218 1101 1068 893 --25342 119 --
NM_001018066chr9135903 5665 5422 4834 4032 3787 2217 2155 1520 1218 1101 1068 893 --25342 119 --
NM_001018067chr155370 4622 3505 998 261 --11491 1781
NM_001018068chr155370 4622 3505 998 261 --11491 1781
NM_001018069chr155370 4622 3505 998 261 --11491 1781
NM_001018074chr573254 2951 2510 1279 1257 1167 244 12707 ----
NM_001018075chr573254 2951 2510 1279 1257 1167 244 12707 ----
NM_001018076chr573254 2951 2510 1279 1257 1167 244 12707 ----
NM_001018077chr573254 2951 2510 1279 1257 1167 244 12707 ----
NM_001018108chr1532301 828 593 11613 ----
NM_001020825chr51426 1182 ----
NM_001023560chr62239 223 --11055 --
NM_001023567chr1532388 989 208 22033 440 ----
NM_001023587chr321174 391 1108 ----
NM_001024094chr573254 2951 2510 1279 1257 1167 244 12707 ----
NM_001024218chr143549 327 56 --1123 --
NM_001024372chr851611 1549 847 655 59 12253 ----
NM_001024401chr1662840 1967 1084 866 464 422 --11920 --
NM_001024455chrX72025 1031 924 752 596 154 47 ------
NM_001024460chr61392 11032 ----
NM_001024601chr1----134 --
NM_001024649chr542059 449 162 94 --1282 --
NM_001024660chr331709 488 209 ------
NM_001024808chr1272581 2175 2080 1983 1873 472 456 ------
NM_001024809chr171363 --1325 --
NM_001024847chr342513 950 905 779 1184 12283 --
NM_001024855chr34559 367 153 27 --11211 --
NM_001024948chr153370 2340 743 102 64 ------
NM_001024956chr1195601 4913 4877 3714 3635 1229 1018 612 84 21399 1078 22273 1275 --
NM_001025068chr331773 1382 131 ------
NM_001025069chr331773 1382 131 ------
NM_001025076chr1095667 4724 4316 4006 2449 2411 1542 1246 390 --151 --
NM_001025077chr1097025 6082 5674 5364 2900 2604 1748 1049 345 --11409 --
NM_001025079chr382942 2705 1307 1176 1095 628 605 555 13687 12540 13554
NM_001025105chr531077 443 182 --1493 --
NM_001025108chr263612 3473 3312 2643 1613 1382 --43878 3286 3179 1318 --
NM_001025233chr1241895 1065 658 503 11083 ----
NM_001025252chr842365 2052 585 261 --32727 772 62 13103
NM_001025253chr842365 2052 585 261 --32727 772 62 13103
NM_001025266chr393817 3486 1565 1222 981 778 632 423 211 11491 24240 180 1990
NM_001025595chr441633 1366 1084 282 --1422 --
NM_001025603chr181266 1150 939 569 471 248 112 31 ------
NM_001029858chr663002 2290 2220 1296 1150 223 --22115 1182 --
NM_001029863chr633168 2270 2215 12930 ----
NM_001029875chr562825 2794 2569 2183 557 33 --11920 --
NM_001029998chr431378 1326 546 --41348 1336 1120 952 --
NM_001030001chr142347 28 ------
NM_001030007chr1662948 782 481 463 291 23 11040 13803 --
NM_001030055chr1453901 3851 1020 571 108 --23479 437 14101
NM_001030287chr13249 206 168 11170 ----
NM_001031623chr621417 1323 11726 ----
NM_001031679chr1293281 3230 2894 2604 2348 2257 2211 759 263 12484 ----
NM_001031689chr9----1121 --
NM_001031690chr782924 2881 2862 2849 2114 879 745 548 12451 ----
NM_001031695chr2255168 5091 3377 1808 1218 1642 11867 --
NM_001031709chr101343 ------
NM_001031717chr31103 ------
NM_001031732chr423427 3184 1302 23249 3207 --
NM_001031746chr1041400 1076 1062 135 ------
NM_001031804chr1623261 876 --13757 --
NM_001031806chr1781939 794 732 678 668 654 244 236 ----1824
NM_001031812chr522316 499 --3941 555 159 --
NM_001032221chr951797 1203 1180 667 139 1227 ----
NM_001032282chr821068 469 ------
NM_001032283chr1211069 1276 ----
NM_001032284chr1211069 1276 ----
NM_001032288chr2041137 562 306 215 --11541 --
NM_001032296chr134961 910 369 51 12339 12276 --
NM_001032363chr152089 1445 530 362 90 11600 ----
NM_001032363chr152089 1445 530 362 90 11600 ----
NM_001032380chr1051910 1690 1416 1236 491 11696 ----
NM_001033045chr242824 2717 719 259 24033 2885 43949 3891 861 698 11004
NM_001033047chr462172 303 296 249 62 42 --12583 --
NM_001033057chr331830 832 759 --12067 --
NM_001033081chr11165 --11922 --
NM_001033082chr11165 --11922 --
NM_001033087chr2062758 2080 702 325 249 235 11222 1931 --
NM_001033117chr374898 4339 4328 4075 3277 541 171 24829 1924 2891 329 --
NM_001033557chr211240 ----1371
NM_001033566chr17--1796 152 --
NM_001033568chr17--1796 152 --
NM_001033723chr841862 1093 731 549 --11987 --
NM_001034841chr1655246 4256 3626 853 230 25252 3925 21760 187 14743
NM_001035chr141117 1037 379 255 --1519 --
NM_001035005chr184674 599 155 60 ------
NM_001035521chr21734 ------
NM_001037132chr72897 873 148 ----
NM_001037133chr72897 873 148 ----
NM_001037164chr7----1347 --
NM_001037317chr122482 292 22702 501 --1618
NM_001037332chr572563 2100 2094 1689 516 360 179 1572 11945 --
NM_001037333chr572563 2100 2094 1689 516 360 179 1572 11945 --
NM_001037334chr1841567 874 424 409 12432 ----
NM_001037339chr11297 11855 1561 131
NM_001037340chr11297 11855 1561 131
NM_001037341chr11297 11855 1561 131
NM_001037341chr11297 11855 1561 131
NM_001037872chr2--1473 ----
NM_001038702chr562687 2389 2290 852 810 682 1817 ----
NM_001038707chr1102005 1867 1538 1438 817 795 698 692 43 29 12182 11821 --
NM_001038707chr1102005 1867 1538 1438 817 795 698 692 43 29 12182 11821 --
NM_001039111chr31183 ------
NM_001039199chr2054875 4515 3409 3169 24 --1317 --
NM_001039348chr25966 911 783 669 100 ------
NM_001039349chr25966 911 783 669 100 ------
NM_001039395chr962231 2166 1778 1618 1517 66 ------
NM_001039459chr751153 937 175 123 93 1300 21137 456 --
NM_001039479chr1431973 1586 233 21938 903 ----
NM_001039538chr243144 2957 645 86 --32329 2290 328 --
NM_001039547chr377460 6445 6436 3131 1647 648 530 16347 57831 7335 7191 1748 1665 --
NM_001039550chr22720 298 ------
NM_001039577chr164076 3905 3777 1672 428 54 ------
NM_001039580chr413398 31539 1181 841 24932 1140 --
NM_001039590chrX11566 --13505 --
NM_001039591chrX11566 --13505 --
NM_001039618chr1165960 5773 5478 4150 1332 354 --45900 2207 991 82 --
NM_001039690chr1632045 1707 909 1833 ----
NM_001039693chr283637 3396 3389 3149 2805 2550 451 192 1389 21405 540 12671
NM_001039762chr103895 639 606 --31742 1675 824 12052
NM_001039802chr131393 1018 539 --11037 1402
NM_001039840chrX65882 5733 4950 937 911 680 33996 2301 1459 44603 4075 1016 167 14437
NM_001039916chr124932 353 338 154 ------
NM_001039917chr124932 353 338 154 ------
NM_001039918chr124932 353 338 154 ------
NM_001039919chr124932 353 338 154 ------
NM_001039920chr124932 353 338 154 ------
NM_001039935chr51418 2453 110 ----
NM_001039937chr1354147 3332 2714 1140 1097 34046 3132 3036 --1581
NM_001040002chr173939 598 498 --1113 --
NM_001040020chr721466 103 ------
NM_001040057chr71191 --2553 337 --
NM_001040101chr421159 629 ------
NM_001040142chr222346 981 ----1940
NM_001040143chr222346 981 ----1940
NM_001040144chr1632045 1707 909 1833 ----
NM_001040146chr1632045 1707 909 1833 ----
NM_001040151chr1173870 3448 2994 392 153 121 53 14107 34117 1734 1485 --
NM_001040152chr7114772 4505 4381 4294 3425 3173 3164 1829 851 339 92 21135 353 11268 11320
NM_001040153chr13----2363 199 --
NM_001040157chr442639 2630 418 368 1990 1355 --
NM_001040159chr41458 ------
NM_001040181chr32204 141 ------
NM_001040182chr32204 141 ------
NM_001040183chr32204 141 ------
NM_001040199chr32204 141 ------
NM_001040200chr32204 141 ------
NM_001040202chr442050 1679 866 248 1359 1536 --
NM_001040214chr662215 2194 1974 1485 813 248 --1434 --
NM_001040273chr1032095 1839 576 --12107 --
NM_001040284chr16125658 5142 5020 4149 4134 3981 3938 3881 3612 1309 1302 646 1640 25117 3732 --
NM_001040402chr463219 3104 2913 2690 1266 801 --2756 238 --
NM_001040429chr1352548 1346 653 594 133 --12619 --
NM_001040441chr154540 2020 1959 247 165 --24120 539 15497
NM_001040446chr51577 --1952 12055
NM_001040619chr14656 618 177 126 11620 ----
NM_001040665chr794941 4675 4467 4362 3887 3464 1654 1245 1009 --11223 --
NM_001040666chr73643 169 64 ------
NM_001040712chr972752 1299 1172 1032 905 805 47 23314 311 ----
NM_001042355chr1695122 5103 4771 2017 1830 1407 1159 1029 84 34638 3579 57 15273 15255
NM_001042404chr131932 1786 1612 1433 11846 --
NM_001042412chr1695122 5103 4771 2017 1830 1407 1159 1029 84 34638 3579 57 15273 15255
NM_001042413chr973602 3441 1184 1156 1121 1069 608 12823 11414 --
NM_001042440chr511865 1673 21334 440 2352 148
NM_001042441chr511865 1673 21334 440 2352 148
NM_001042442chr511865 1673 21334 440 2352 148
NM_001042443chr511865 1673 21334 440 2352 148
NM_001042444chr511865 1673 21334 440 2352 148
NM_001042445chr511865 1673 21334 440 2352 148
NM_001042446chr511865 1673 21334 440 2352 148
NM_001042453chrX31711 1668 360 --21366 656 --
NM_001042459chr3177 --1248 --
NM_001042473chr1022009 1535 ------
NM_001042492chr1723004 2818 1397 12931 22799 2313
NM_001042494chr1581444 1279 1038 1023 678 619 593 473 1432 43637 3329 999 51 --
NM_001042495chr1581444 1279 1038 1023 678 619 593 473 1432 43637 3329 999 51 --
NM_001042496chr1581444 1279 1038 1023 678 619 593 473 1432 43637 3329 999 51 --
NM_001042497chr1581444 1279 1038 1023 678 619 593 473 1432 43637 3329 999 51 --
NM_001042510chr852108 1933 1865 424 223 ------
NM_001042511chr852108 1933 1865 424 223 ------
NM_001042533chr353273 3148 2706 2457 466 ----1672
NM_001042537chrX32219 2049 708 12257 1147 --
NM_001042555chr1274652 3960 3530 2906 1658 1323 137 24640 1817 11088 --
NM_001042599chr297609 6914 6130 5624 2025 1600 1467 867 444 36920 6895 5927 37293 2194 1522 --
NM_001042601chr362181 2073 2006 738 449 391 33073 3040 2442 ----
NM_001042603chr1254332 4042 1981 600 80 --1173 --
NM_001042604chr374849 2960 1868 1832 1662 1020 341 1683 ----
NM_001042683chr621854 589 --11627 --
NM_001042749chrX2645 408 1483 11981 11823
NM_001042750chrX2645 408 1483 11981 11823
NM_001042751chrX2645 408 1483 11981 11823
NM_001042762chr72335 140 1787 ----
NM_001043318chr1483943 3288 3274 2636 1667 1660 1440 1184 --43251 3150 2575 1594 --
NM_001043351chr142100 1828 1425 332 ------
NM_001044385chr272828 2525 1574 1250 928 763 127 22955 204 13634 --
NM_001044722chr522316 499 --3941 555 159 --
NM_001044723chr522316 499 --3941 555 159 --
NM_001046chr552833 1988 1132 971 781 --22818 368 --
NM_001071775chr1331540 741 326 ----1206
NM_001079874chr111491 --21968 122 --
NM_001083620chr452222 2190 1604 298 241 1778 21697 335 --
NM_001095chr1231319 181 80 --31266 641 339 --
NM_001106chr3119502 8286 7712 7044 6711 2553 2540 1599 1358 707 695 28846 8086 23617 951 --
NM_001113490chrX83593 3286 2528 2362 1196 1161 673 445 --12337 --
NM_001116chr1652631 1199 863 383 178 --13034 --
NM_001128chr1662948 782 481 463 291 23 11040 13803 --
NM_001148chr452121 1657 367 327 206 --11881 --
NM_001152chrX168 ------
NM_001153chr22696 668 --1906 1578
NM_001156chr103451 257 52 ------
NM_001167chrX65933 5000 1642 1362 1271 1197 ------
NM_001173chr1453901 3851 1020 571 108 --23479 437 14101
NM_001177chr1241932 1733 1529 876 ------
NM_001204chr267176 4907 3079 1058 1042 91 36444 6303 809 26283 485 --
NM_001206chr932195 2050 617 22502 1074 ----
NM_001219chr742306 2095 1686 539 --11732 --
NM_001253chr61217 ------
NM_001256chr1762433 1039 962 777 672 599 --22326 1150 --
NM_001257chr164987 438 411 184 ------
NM_001259chr744986 4557 2409 1116 25107 723 12513 --
NM_001260chr13----1111 --
NM_001261chr91490 --31119 1097 1052 --
NM_001273chr122448 112 ------
NM_001274chr11179 --1141 --
NM_001290chr42848 278 ------
NM_001304chr1732730 1479 1265 23319 1360 1981 --
NM_001310chr1252779 2766 2699 2000 207 ------
NM_001316chr201118 ------
NM_001329chr1051405 1210 1017 561 395 ------
NM_001331chr1132200 1989 952 --12303 --
NM_001332chr521223 1086 --1981 --
NM_001346chr372611 2499 2126 1910 619 550 284 --1177 --
NM_001351chr321605 1461 --11590 1633
NM_001356chrX42276 1585 708 630 ------
NM_001363chrX2525 175 ------
NM_001364chr1183349 3336 3107 1917 1689 1250 968 405 11849 24171 445 --
NM_001378chr22456 173 --1464 --
NM_001379chr191199 ------
NM_001380chr101746 --1297 --
NM_001385chr81277 ------
NM_001386chr851575 982 647 347 217 --157 1547
NM_001391chr181925 --1200 --
NM_001396chr2152226 564 260 227 204 11961 --12338
NM_001399chrX93746 3461 3343 3212 3040 2666 2590 538 388 22603 2322 ----
NM_001401chr931329 204 32 ------
NM_001406chr1781252 664 489 462 448 296 90 24 11343 ----
NM_001412chrX73460 3343 2931 2489 965 29 23 --23193 2594 --
NM_001416chr17----198 --
NM_001419chr1963611 3570 3476 3067 927 763 --13080 --
NM_001423chr1231839 475 443 --11539 --
NM_001438chr173472 2579 512 378 305 203 28 12976 ----
NM_001440chr882733 2722 993 901 565 545 319 89 --1684 --
NM_001448chrX--171 --11344
NM_001449chrX11302 1896 21264 1221 --
NM_001453chr631162 650 143 1418 ----
NM_001455chr674747 4714 4624 3923 626 466 335 --11114 --
NM_001460chr172970 2662 2529 1188 1149 279 50 --22680 2307 --
NM_001463chr22777 702 ------
NM_001478chr122348 255 ------
NM_001482chr153818 777 67 ----1683
NM_001494chr101650 --1205 --
NM_001514chr11145 ------
NM_001521chr21734 ------
NM_001530chr142904 79 --21161 981 --
NM_001542chr12749 280 12655 ----
NM_001552chr1721035 941 ------
NM_001560chrX62294 1689 1679 1657 208 55 12193 ----
NM_001587chrX62230 1872 1423 867 791 588 21806 360 --1165
NM_001609chr1044156 3043 1135 383 21722 576 24383 3311 --
NM_001616chr233304 3236 1179 21224 854 11072 --
NM_001617chr241288 1170 1062 118 11013 ----
NM_001629chr132248 80 ------
NM_001635chr72991 375 ------
NM_001649chrX92466 2394 2242 2142 1931 1682 938 636 418 ------
NM_001650chr1834119 3676 451 11383 ----
NM_001655chr1142159 1783 863 785 --1184 --
NM_001656chr531455 1340 79 --21691 240 --
NM_001659chr1252674 2441 1017 1011 898 ------
NM_001664chr32646 127 ------
NM_001674chr13249 206 168 11170 ----
NM_001678chr1771632 1615 1355 1262 1163 518 317 --21216 133 --
NM_001682chr1242541 2511 2325 749 12659 ----
NM_001688chr12311 186 ------
NM_001690chr342549 2506 2215 177 --1249 --
NM_001693chr841252 1159 1091 188 --1812 --
NM_001695chr8104215 3591 3445 3357 1535 1417 1269 1175 447 94 --24127 1343 --
NM_001701chr971470 1327 1292 1244 1213 1165 1126 ------
NM_001703chr11224 ------
NM_001704chr61203 --2512 448 --
NM_001706chr32961 389 ------
NM_001709chr1182446 2053 1873 1769 790 759 395 225 12091 1854 --
NM_001731chr121815 ------
NM_001742chr731862 488 82 ------
NM_001746chr542059 449 162 94 --1282 --
NM_001750chr511865 1673 21334 440 2352 148
NM_001754chr2164072 3868 3348 3239 3233 118 --33964 1464 1173 --
NM_001755chr1642206 659 493 79 12016 11625 --
NM_001759chr12114854 4696 4585 3952 3831 3459 3209 1721 1220 1182 1168 --21963 701 --
NM_001777chr382942 2705 1307 1176 1095 628 605 555 13687 12540 13554
NM_001788chr72928 722 ------
NM_001791chr131393 1018 539 --11037 1402
NM_001795chr1641160 1081 253 177 ------
NM_001796chr16138 ------
NM_001797chr161326 1577 ----
NM_001806chr1912844 --11127 1612
NM_001812chr4----1321 --
NM_001826chr1----161 --
NM_001830chrX93378 3128 1388 1214 1119 801 688 569 423 13880 1761 --
NM_001845chr1341087 1027 1021 357 --184 --
NM_001855chr93311 299 254 --2883 329 --
NM_001859chr933322 3018 2881 1279 ----
NM_001873chr42681 190 1265 ----
NM_001874chr1275255 4228 3937 1218 1170 1136 1082 ----1861
NM_001892chr531077 443 182 --1493 --
NM_001901chr62420 57 1318 ----
NM_001918chr1128504 8434 6857 6788 6739 5680 2711 2696 2037 1143 781 79 --11152 18765
NM_001920chr122525 204 --1623 --
NM_001921chr42434 71 11160 --11240
NM_001935chr2--2983 159 ----
NM_001938chr12562 97 --21898 1738 --
NM_001942chr181311 11557 11874 --
NM_001968chr43795 656 238 1118 ----
NM_001969chr1473716 3079 2912 2465 1372 393 170 ----1589
NM_001977chr431694 1594 293 1434 ----
NM_001980chr1241430 65 47 28 1843 ----
NM_001981chr122290 858 11896 ----
NM_001987chr1253286 3253 1138 787 381 --14093 --
NM_001993chr11159 ------
NM_001999chr51944 ------
NM_002006chr495571 5430 4949 4843 4186 3916 2308 1407 660 --15541 1652
NM_002009chr15--1741 ----
NM_002015chr1362917 2834 2795 2054 522 389 ------
NM_002017chr112243 27 --1985 --
NM_002019chr131760 ----1912
NM_002024chrX----1338 --
NM_002025chrX188905 7962 7924 6500 6481 6354 6305 6083 6065 3448 2227 1942 1859 1770 1726 1418 638 253 --58761 7773 7334 6782 2542 --
NM_002044chr1511459 1187 1493 --
NM_002054chr2125 ------
NM_002074chr121522 1373 ----21540 76
NM_002076chr1253173 2571 2253 1023 279 13054 ----
NM_002077chr93571 255 197 ------
NM_002078chr3155 ------
NM_002086chr1732051 1593 273 12095 ----
NM_002092chr494754 4743 4063 3536 3378 1723 1289 909 459 1696 158 --
NM_002107chr1131 ------
NM_002126chr1744025 2965 1052 1040 12957 13528 --
NM_002128chr133668 567 319 --1428 --
NM_002131chr661050 1013 1004 467 288 134 --11339 --
NM_002136chr12------1595
NM_002140chr92128 90 ------
NM_002146chr171447 --1397 --
NM_002147chr171812 ------
NM_002158chr233614 2706 2699 --1550 22575 1387
NM_002176chr9150 ------
NM_002193chr251797 1783 1727 255 108 ------
NM_002196chr202876 712 ------
NM_002196chr202876 712 ------
NM_002211chr1011065 --11086 --
NM_002214chr795693 4071 4021 3883 3847 1306 870 641 149 14551 23949 3655 --
NM_002227chr11497 --1808 --
NM_002232chr12196 137 --1307 --
NM_002247chr1012114 --1924 --
NM_002252chr23295 129 32 ------
NM_002253chr421143 318 --1165 --
NM_002254chr232239 2175 404 1932 1488 --
NM_002264chr3125048 5013 4890 4461 4052 1836 1662 1459 1157 1133 584 160 --34906 4567 854 --
NM_002265chr173831 244 54 ------
NM_002267chr1331900 32 22 ------
NM_002268chr32517 377 ------
NM_002270chr545220 4206 881 213 24096 3840 35448 5006 3850 23573 763
NM_002271chr1342118 1932 833 119 ------
NM_002285chr263612 3473 3312 2643 1613 1382 --43878 3286 3179 1318 --
NM_002293chr141709 1108 451 27 2975 278 3780 524 175 12261
NM_002310chr5115629 5246 5025 4602 4528 4288 4142 1825 1777 1264 79 25744 4226 26631 5414 15722
NM_002334chr112719 253 --1241 --
NM_002351chrX11639 ------
NM_002355chr1251366 1345 1274 1107 143 ------
NM_002356chr682178 2050 1875 1068 897 836 324 206 ------
NM_002372chr51698 ------
NM_002374chr243144 2957 645 86 --32329 2290 328 --
NM_002375chr331620 486 480 --1883 --
NM_002376chr14199 ------
NM_002387chr574576 4494 4397 3572 777 397 370 23648 1530 25167 4476 24062 3188
NM_002395chr61977 11076 ----
NM_002401chr1732111 1849 1802 ------
NM_002409chr2262941 2541 2188 1282 401 191 --13144 1528
NM_002445chr821157 1046 --127 --
NM_002451chr952904 2812 1400 478 269 --22560 1021 137
NM_002480chr12----21396 116 --
NM_002486chr952421 2079 1736 1001 97 --1684 12243
NM_002487chr151773 1310 ----
NM_002499chr1541632 930 899 583 ------
NM_002514chr82986 101 --21091 854 --
NM_002545chr11124931 4919 4653 4513 3908 3539 3370 1428 1056 595 557 431 21158 549 1319 14670
NM_002563chr32865 156 --1780 --
NM_002581chr9125547 5450 4779 2178 1967 1831 1215 1209 786 457 371 49 21222 862 ----
NM_002586chr641406 1160 515 228 1566 11447 --
NM_002588chr521158 320 ------
NM_002594chr2032336 455 214 --1271 --
NM_002595chr1221299 517 ------
NM_002599chr1151077 986 449 426 297 ------
NM_002600chr11297 11855 1561 131
NM_002620chr4168 ------
NM_002628chr321160 494 ----11059
NM_002629chr10195 --1106 --
NM_002636chr62424 220 ------
NM_002645chr1152962 2898 1103 911 165 ------
NM_002655chr875168 5162 1230 850 742 594 367 ------
NM_002657chr2083237 3001 2729 2501 1509 1021 975 849 ------
NM_002660chr2051199 968 370 282 248 ------
NM_002670chr321248 295 --1140 1646
NM_002674chr12123 ------
NM_002687chr1441148 262 251 30 --2430 155 1276
NM_002707chr2----1304 --
NM_002709chr252737 2709 2455 489 286 --33024 2883 252 --
NM_002710chr121281 --1971 --
NM_002715chr521309 103 --1834 --
NM_002717chr82441 253 ------
NM_002718chr382577 2450 2228 2197 2074 788 491 346 --1593 --
NM_002719chr1422269 306 --21990 1866 --
NM_002731chr172888 2724 2525 2344 267 162 78 --1674 --
NM_002734chr1732038 754 501 --1851 --
NM_002745chr2234439 4177 1666 13797 24215 1652 --
NM_002748chr1511223 1814 1272 --
NM_002758chr172547 91 ------
NM_002764chrX4885 771 205 117 --1695 --
NM_002776chr1971901 1652 1397 543 192 156 78 ------
NM_002813chr122180 34 ------
NM_002828chr183225 158 91 --1310 --
NM_002835chr7180 1609 ----
NM_002839chr972752 1299 1172 1032 905 805 47 23314 311 ----
NM_002857chr172533 2388 728 525 349 273 46 1811 1928 --
NM_002858chr121314 301 ----11398
NM_002869chr112661 509 ------
NM_002874chr942421 1918 544 88 --12000 --
NM_002886chr364849 4591 1825 1101 688 51 34906 3723 3401 12051 --
NM_002890chr52902 110 --1397 --
NM_002906chr1132370 677 86 --1408 --
NM_002912chr63830 271 207 ------
NM_002938chr451966 1509 1300 777 112 11819 11351 --
NM_002942chr321098 151 --11323 --
NM_002943chr15----1122 --
NM_002958chr3----2698 282 --
NM_002959chr174065 3955 3657 3487 3388 3127 253 --23809 1457 --
NM_002968chr162821 357 --1141 --
NM_002970chrX1267 133 ----
NM_002977chr261374 955 727 655 313 300 ------
NM_002994chr411900 --21441 674 --
NM_002998chr852245 2124 1849 192 109 ------
NM_003010chr1772430 2355 1907 1751 787 224 169 11832 --1303
NM_003026chr94912 551 516 85 --1183 --
NM_003028chr983848 3796 3091 2731 2689 2370 701 353 ------
NM_003030chr31150 ------
NM_003031chr162399 243 ------
NM_003034chr1286727 5663 5564 3102 3055 2788 2436 1387 --17202 25165 193
NM_003035chr1195 1650 1864 --
NM_003036chr111166 ----1275
NM_003037chr12257 157 ------
NM_003043chr374340 4274 3866 2964 2847 1302 1034 1495 12858 --
NM_003045chr1354182 3673 3338 1286 420 14314 14041 --
NM_003051chr121769 1422 11751 1614 --
NM_003068chr82678 309 ------
NM_003069chrX1200 ------
NM_003074chr32723 235 1438 21518 1476 --
NM_003076chr1231213 1156 165 --11177 --
NM_003091chr201182 ------
NM_003107chr622471 2195 --22326 2094 --
NM_003108chr2136695 6540 5740 5496 5025 4619 4495 4436 4414 2847 2150 1887 683 25474 5365 1998 --
NM_003112chr722621 111 1784 ----
NM_003128chr242715 2629 1934 398 1946 1387 --
NM_003133chr11351 ------
NM_003137chr651826 624 482 347 309 1195 1292 1392
NM_003144chr652188 1652 1422 858 575 ------
NM_003149chr351527 1038 600 399 188 21376 1246 ----
NM_003155chr881799 1134 1101 893 615 311 217 165 --2650 174 --
NM_003161chr1783558 3410 3244 2441 1035 572 360 62 13047 23006 247 --
NM_003165chr951896 1302 1279 766 238 1326 132 --
NM_003168chr173833 363 25 ------
NM_003189chr182871 2830 1308 1301 1162 922 485 371 --22976 1295 --
NM_003198chr11273 ------
NM_003199chr1875108 3823 3735 3488 3480 2126 1693 --24991 553 --
NM_003203chr251838 1685 682 562 480 ----12174
NM_003216chr2283333 2980 2507 2415 503 492 466 181 ------
NM_003217chr1221728 197 21942 1514 ----
NM_003221chr663841 3675 3241 2626 1210 983 11663 13683 13562
NM_003234chr31121 --11500 --
NM_003242chr342513 950 905 779 1184 12283 --
NM_003244chr181339 ------
NM_003246chr15--1784 2425 218 12022
NM_003255chr1772642 2381 2073 559 438 208 75 --1962 --
NM_003257chr15----11355 --
NM_003262chr381925 1767 1295 1011 910 870 129 96 ----23238 1182
NM_003275chr921509 456 ------
NM_003286chr202829 793 --21104 125 --
NM_003290chr1921103 93 ------
NM_003291chr132596 518 --1629 --
NM_003292chr131557 677 503 ----12152
NM_003298chr374680 4409 3832 2144 1655 900 887 --24066 458 --
NM_003304chr341500 1361 1081 121 11518 ----
NM_003305chr41347 --1279 --
NM_003314chr5--1101 ----
NM_003326chr162532 1874 1737 913 825 204 --22519 877 --
NM_003336chrX3823 393 126 ------
NM_003337chr511245 21125 1068 2527 224 --
NM_003338chr1041450 395 260 253 ------
NM_003339chr541580 1195 623 108 --1525 --
NM_003342chr1753132 2992 2748 2628 308 ------
NM_003345chr161130 ------
NM_003348chr1221702 275 --1120 --
NM_003349chr2041137 562 306 215 --11541 --
NM_003350chr821049 1001 1372 ----
NM_003363chr32630 535 --160 --
NM_003366chr16----1170 --
NM_003369chr1162691 1912 603 579 508 316 ------
NM_003379chr61436 --1143 --
NM_003383chr9------1191
NM_003387chr282937 2930 2502 2054 710 601 317 287 ------
NM_003390chr111966 1430 ----
NM_003392chr374121 4013 3395 3298 2831 624 326 14268 22775 856 --
NM_003399chrX2952 130 --21021 743 --
NM_003400chr23757 737 197 --1165 --
NM_003403chr142826 41 --1338 --
NM_003406chr851698 1606 1516 595 210 21629 32 ----
NM_003409chr1811318 ------
NM_003410chrX32073 740 435 --1648 12883
NM_003411chrY31231 397 78 --1611 --
NM_003413chrX2609 278 --1119 12018
NM_003439chr743372 2963 1191 718 --43207 2765 1241 426 13033
NM_003442chr11145 ------
NM_003453chr132567 208 ------
NM_003455chr112508 488 11686 11392 1344
NM_003463chr672742 2608 1363 1253 1040 520 511 --13124 12350
NM_003471chr32584 169 1199 ----
NM_003473chr1021086 89 --1820 --
NM_003474chr1011742 --32393 2158 319 --
NM_003478chr1153192 2564 2541 2354 2049 ------
NM_003482chr1232699 2580 832 ------
NM_003483chr122878 620 ------
NM_003489chr2132464 1356 1312 33053 2641 1063 ----
NM_003498chr1652749 2723 2559 773 755 12255 ----
NM_003503chr121316 953 1853 --1139
NM_003507chr231866 1673 1456 ------
NM_003566chr1232294 930 195 21359 1039 13175 --
NM_003567chr1154 --1441 --
NM_003574chr1865217 4214 3733 2320 918 549 24863 3973 35689 4141 3552 --
NM_003576chr134961 910 369 51 12339 12276 --
NM_003580chr81570 ------
NM_003583chr1273569 2975 2920 2521 2444 605 335 --1365 2614 516
NM_003590chr243087 2812 571 217 12842 21214 619 --
NM_003593chr175671 660 556 485 478 ------
NM_003603chr442081 1595 1421 368 ------
NM_003615chr343949 3403 2863 1328 --11185 --
NM_003617chr184814 4263 4044 3979 3806 3353 3104 28 24101 3875 11683 14415
NM_003626chr1151019 923 510 475 265 --1281 --
NM_003629chr162815 2308 2287 2231 848 75 12587 ----
NM_003630chr6--1163 ----
NM_003653chr172222 43 ------
NM_003659chr241207 222 163 139 --21155 826 --
NM_003663chr352738 2146 1161 1080 756 23234 2833 12122 --
NM_003679chr162603 2420 2268 2255 2237 1200 22728 234 ----
NM_003681chr2196212 5695 4743 4560 2405 1271 1143 715 482 15407 ----
NM_003702chr83812 318 89 1522 ----
NM_003705chr21764 --2320 304 --
NM_003711chr5178 ------
NM_003713chr131483 1366 1181 1450 11348 --
NM_003714chr572834 2567 1058 912 842 249 63 12743 12193 --
NM_003716chr34975 370 230 174 ------
NM_003718chr7----1213 --
NM_003735chr521158 320 ------
NM_003736chr521158 320 ------
NM_003743chr252300 2244 1783 1471 104 --22003 1506 --
NM_003759chr444088 3069 1569 1094 ------
NM_003762chr13959 561 433 11457 ----
NM_003763chr2062706 1975 1127 872 480 136 13016 13213 --
NM_003772chr1111051 1398 1879 --
NM_003778chr3----1675 --
NM_003787chr181606 --11630 --
NM_003794chr31959 --1864 --
NM_003797chr11----1157 --
NM_003831chr1811804 1204 ----
NM_003838chr141602 1545 318 44 ------
NM_003846chr12706 592 ------
NM_003861chr1442660 2330 1048 157 12354 ----
NM_003873chr1032542 2003 1706 11916 ----
NM_003877chr121845 2779 633 ----
NM_003884chr331619 1225 1166 --11652 --
NM_003887chr242056 1582 674 485 --11922 --
NM_003888chr1541331 1167 448 266 ------
NM_003895chr2121743 1348 --22190 2179 --
NM_003913chr634156 4029 553 23993 3485 23947 3517 --
NM_003934chr921318 1124 ------
NM_003938chr1951101 726 206 181 145 --1766 --
NM_003939chr1053698 3058 2622 1166 986 11099 12858 --
NM_003941chr722259 2029 1819 1411 --
NM_003945chr51497 ------
NM_003948chr43262 237 77 --21051 53 --
NM_003953chr172698 2428 2036 1746 715 303 181 11944 22888 22 --
NM_003980chr641054 279 214 85 --1553 --
NM_003983chr16104091 4023 4001 3331 1741 1613 1562 1515 1142 1008 --1890 --
NM_003993chr1129 ------
NM_003994chr1273220 3046 1339 1306 792 635 413 11439 23944 120 --
NM_004006chrX31058 539 523 12246 --22214 782
NM_004007chrX31058 539 523 12246 --22214 782
NM_004009chrX31058 539 523 12246 --22214 782
NM_004010chrX31058 539 523 12246 --22214 782
NM_004011chrX31058 539 523 12246 --22214 782
NM_004012chrX31058 539 523 12246 --22214 782
NM_004013chrX31058 539 523 12246 --22214 782
NM_004014chrX31058 539 523 12246 --22214 782
NM_004015chrX31058 539 523 12246 --22214 782
NM_004016chrX3972 453 437 12160 --22128 696
NM_004017chrX31058 539 523 12246 --22214 782
NM_004018chrX3972 453 437 12160 --22128 696
NM_004020chrX31058 539 523 12246 --22214 782
NM_004021chrX3972 453 437 12160 --22128 696
NM_004022chrX3972 453 437 12160 --22128 696
NM_004023chrX3972 453 437 12160 --22128 696
NM_004024chr14608 565 527 126 11529 ----
NM_004028chr1834119 3676 451 11383 ----
NM_004034chr103451 257 52 ------
NM_004035chr1774880 4730 4220 1793 1462 1317 796 23963 1126 14014 23811 1150
NM_004040chr231142 922 421 --11206 --
NM_004059chr93386 327 30 1170 ----
NM_004061chr5--1637 --1226
NM_004067chr711004 --1272 --
NM_004077chr1221229 874 --11093 --
NM_004081chrY21632 1616 ----11675
NM_004085chrX3803 540 101 --1122 --
NM_004089chrX11212 --1379 --
NM_004093chr1343240 3233 557 354 --12038 --
NM_004096chr1061755 1637 1602 1501 700 692 --11441 --
NM_004103chr81784 --1826 --
NM_004105chr25966 911 783 669 100 ------
NM_004109chr1142158 1992 872 157 ------
NM_004113chr311494 21778 720 21763 493 --
NM_004117chr611476 1325 12112 --
NM_004124chr1432777 2227 167 1643 --21108 1101
NM_004134chr52700 661 --1636 --
NM_004156chr82624 415 1577 ----
NM_004161chr221158 1067 --11390 --
NM_004162chr31494 --1396 --
NM_004170chr941908 1577 1408 1358 11277 11344 --
NM_004171chr11169338 8489 7459 7379 7308 7294 6530 6412 6260 3852 3185 3057 1932 1446 1208 643 55965 2944 2528 978 48 38973 5976 2248 --
NM_004180chr21175 --1504 --
NM_004183chr111685 ------
NM_004202chrY------136
NM_004205chr11----1516 --
NM_004219chr5150 ------
NM_004225chr831056 1011 60 11204 ----
NM_004229chrX61635 1610 846 703 597 175 --1666 1580
NM_004232chr1853592 3035 881 673 22 --13520 --
NM_004235chr92314 138 ------
NM_004261chr12211 26 --1684 1887
NM_004279chr721490 742 ------
NM_004286chr2252645 1959 1060 1027 257 ------
NM_004296chr14123706 3341 3145 2932 1601 1379 986 781 482 431 357 68 --22777 579 --
NM_004301chr3183 ------
NM_004302chr1262789 2502 2107 1851 1098 1029 ------
NM_004319chr183124 2878 2792 2649 2235 1179 883 801 ------
NM_004331chr822612 122 --21732 553 11669
NM_004337chr852219 1837 1698 764 160 1430 21557 256 11542
NM_004338chr18156854 6218 6046 5906 5289 4693 4520 2644 2041 2018 1602 1369 1215 975 706 --1684 15024
NM_004349chr82864 63 1117 ----
NM_004362chr42768 188 --193 --
NM_004365chr5--3126 103 45 ----
NM_004370chr621875 818 ------
NM_004379chr221220 635 --1482 --
NM_004380chr1662424 2407 2374 2216 1935 582 ------
NM_004384chr522316 499 --3941 555 159 --
NM_004389chr23653 580 200 --1240 --
NM_004392chr1342431 1703 524 56 ------
NM_004393chr342370 2300 1482 789 ------
NM_004397chr1183775 3324 3318 3220 2906 1668 491 93 --12806 --
NM_004405chr22847 47 1986 ----
NM_004426chr1261812 653 643 589 546 307 ------
NM_004428chr12556 546 --1649 --
NM_004432chr922335 921 2246 133 22058 1803 --
NM_004438chr242815 2544 2062 342 12249 22956 2387 --
NM_004441chr351203 1163 1038 999 305 --1403 --
NM_004457chr221142 1077 ------
NM_004458chrX22088 1686 1107 ----
NM_004464chr493851 3844 3578 3435 2963 2892 1405 918 31 13763 ----
NM_004480chr14----1699 --
NM_004492chr15132 ------
NM_004496chr141888 ----1332
NM_004498chr151269 --1332 --
NM_004499chr5--1119 ----
NM_004501chr164079 3432 1337 898 486 91 --23600 3151 --
NM_004504chr262984 2694 787 486 266 52 --1705 12125
NM_004505chr1731812 771 111 1747 1705 --
NM_004516chr1941236 1137 951 481 ------
NM_004520chr51533 1684 ----
NM_004525chr251015 552 280 138 82 ------
NM_004527chr173939 598 498 --1113 --
NM_004529chr931452 1411 1058 11065 ----
NM_004537chr1221360 1351 11523 ----
NM_004538chrX1555 1698 ----
NM_004578chr1185 --1915 --
NM_004580chr1531874 1681 144 1540 --1449
NM_004598chr523055 2536 13069 --12352
NM_004612chr954878 3932 3672 1776 327 --21451 413 --
NM_004615chrX1668 ------
NM_004637chr32313 113 11042 --11308
NM_004642chr123686 655 32 ------
NM_004654chrY1437 11350 ----
NM_004657chr251057 498 339 75 23 ------
NM_004660chrY42181 2069 1527 626 ----1556
NM_004661chr521030 921 21111 40 ----
NM_004663chr15------11592
NM_004673chr131416 1375 1112 11462 --1558
NM_004686chr841558 718 432 359 ----11207
NM_004687chr1741454 1429 808 118 --1461 --
NM_004703chr172340 50 --12322 --
NM_004709chrX11295 ------
NM_004711chr2293588 3504 3114 3009 2400 848 721 292 192 ------
NM_004713chr143665 531 240 ------
NM_004717chr741463 442 348 45 ------
NM_004719chr1242660 2457 251 184 ------
NM_004725chr1031228 1186 345 ------
NM_004726chrX75319 5110 4774 4026 3835 1365 823 11199 14216 --
NM_004733chr3------123
NM_004736chr121862 1702 --127 --
NM_004745chr8166737 6489 5997 5794 5520 5170 5080 4825 4720 4641 2824 2026 1685 955 702 409 --26951 107 12632
NM_004748chr1574081 3817 2815 1557 1427 1371 555 ------
NM_004760chr731721 499 472 --1260 --
NM_004768chr12789 761 --1319 1425
NM_004772chr521110 182 ------
NM_004774chr1772922 2884 2395 1936 1058 426 161 ------
NM_004788chr1162762 2690 2081 964 781 454 ------
NM_004796chr1412297 ------
NM_004801chr251191 1179 1078 576 228 ------
NM_004805chr241203 1001 317 37 ------
NM_004815chr1114913 4425 4365 4249 3383 3334 1374 1107 485 310 144 24088 3864 24547 3448 --
NM_004820chr8------152
NM_004827chr441733 1606 333 30 --21969 1645 1669
NM_004831chr192793 34 ------
NM_004840chrX52009 2000 828 555 43 --21932 394 --
NM_004841chr151129 865 856 850 200 ------
NM_004849chr631060 504 33 ------
NM_004859chr1752658 2200 2124 686 180 --12355 --
NM_004863chr1465220 5115 4031 813 783 738 34562 3227 275 ----
NM_004866chr5114964 4181 3400 3387 1877 1820 1476 1312 1243 538 257 ------
NM_004869chr182405 118 ------
NM_004898chr462621 2173 1973 1138 872 685 --11085 11067
NM_004902chr202172 56 ------
NM_004904chr7106523 6024 5113 4093 2399 1762 1433 1414 301 53 21735 1566 14294 1430
NM_004922chr1031031 758 162 1213 ----
NM_004929chr841161 1089 956 141 11347 21148 393 11197
NM_004930chr11516 ----1687
NM_004932chr551332 1324 1108 624 208 --11585 1688
NM_004947chr352347 2218 1830 946 727 1835 12120 --
NM_004956chr743071 1658 987 409 14477 ----
NM_004965chr211280 --1481 1310
NM_004966chr101929 1397 1823 --
NM_004969chr102511 71 ------
NM_004972chr92865 407 --1893 11190
NM_004976chr1165106 4824 1875 1744 887 633 14250 ----
NM_004985chr1231818 1777 1722 13505 ----
NM_004992chrX177907 7774 7750 7739 7685 6481 6265 6004 5386 5338 5186 3408 2705 1985 1280 1254 746 16181 22046 759 --
NM_004992chrX177907 7774 7750 7739 7685 6481 6265 6004 5386 5338 5186 3408 2705 1985 1280 1254 746 16181 22046 759 --
NM_004993chr1421358 47 --11058 --
NM_004996chr1671678 1628 1497 1413 1308 1222 588 --1461 --
NM_004999chr674323 4081 3777 3579 1425 297 273 --33522 920 405 --
NM_005010chr72897 873 148 ----
NM_005020chr72490 69 151 ----
NM_005026chr132044 546 434 ------
NM_005028chr1031861 1813 97 --1127 --
NM_005044chrX61512 1137 773 530 253 112 ----11822
NM_005045chr7277 56 --1363 --
NM_005056chr1264576 4286 2225 844 324 134 --1417 --
NM_005063chr1073592 3101 2503 1483 1031 973 208 --12947 --
NM_005068chr621400 1181 ----1517
NM_005079chr842365 2052 585 261 --32727 772 62 13103
NM_005096chrX31025 96 21 --11009 --
NM_005109chr371906 1783 1613 675 369 308 202 --1406 --
NM_005114chr42645 54 ------
NM_005116chr2094096 4089 3692 3584 3536 3079 1360 974 616 14206 21568 105 --
NM_005117chr113935 240 122 ------
NM_005121chr1742934 2722 2399 1165 --43510 3310 2614 818 --
NM_005135chr1581444 1279 1038 1023 678 619 593 473 1432 43637 3329 999 51 --
NM_005151chr1841567 874 424 409 12432 ----
NM_005156chr935402 4603 1374 ------
NM_005157chr941842 1801 1327 731 ------
NM_005159chr1542140 1943 653 84 21827 1447 11509 --
NM_005180chr10--1469 1361 --
NM_005182chr16139 ------
NM_005188chr11108122 5690 5477 3125 3108 2615 1768 1355 919 637 26843 875 16645 17849
NM_005197chr1476093 6073 5467 5159 4481 1212 374 ----22006 651
NM_005203chr10--1102 ----
NM_005206chr1731104 509 246 1999 ----
NM_005215chr182711 583 ------
NM_005220chr1741479 1110 313 241 165 ----
NM_005222chr71140 1830 ----
NM_005235chr297609 6914 6130 5624 2025 1600 1467 867 444 36920 6895 5927 37293 2194 1522 --
NM_005241chr32954 294 ------
NM_005244chr201509 --1623 --
NM_005254chr15--11435 --11410
NM_005259chr241501 1196 622 431 ------
NM_005271chr1041023 999 123 30 --11060 --
NM_005275chr6122 ------
NM_005276chr122598 116 --2703 261 --
NM_005276chr122598 116 --2703 261 --
NM_005277chr4----1478 --
NM_005312chr942656 2577 1065 983 ------
NM_005324chr1732052 571 122 32119 801 701 1812 --
NM_005336chr221963 1522 --21909 370 --
NM_005339chr453423 2820 1017 103 58 11210 ----
NM_005342chrX52720 2702 593 545 64 22159 605 ----
NM_005348chr141869 --2628 385 --
NM_005358chr1331447 501 245 ------
NM_005359chr1812585 33963 1749 352 34898 1948 238 15613
NM_005374chr1731810 1771 545 ------
NM_005398chr1051444 1401 1233 1145 528 1520 11005 --
NM_005399chr152808 2776 2763 1281 960 12951 33381 1105 574 --
NM_005400chr242828 2406 1954 881 1972 22169 2122 --
NM_005402chr721536 636 --11586 --
NM_005414chr3--1114 ----
NM_005417chr2041632 1483 764 482 ------
NM_005436chr1083749 3731 2622 2553 713 600 321 237 --14032 11205
NM_005437chr1031054 913 270 --11453 --
NM_005455chr1175 --1419 1126
NM_005458chr941880 1555 1538 256 --12185 --
NM_005465chr162039 1629 791 336 110 33 11753 11427 --
NM_005475chr1293179 3118 3072 2593 2284 2224 866 739 491 --13126 --
NM_005476chr931179 1100 368 --11005 --
NM_005479chr1021472 509 ------
NM_005493chr61197 ------
NM_005494chr71660 ------
NM_005497chr1753796 2460 2421 1008 278 ----12025
NM_005499chr191665 ------
NM_005501chr172981 410 ------
NM_005502chr942967 2565 763 467 --32375 628 415 --
NM_005504chr12136468 5838 5721 5199 4480 4269 4216 2519 2428 2051 1576 1234 966 25054 5025 36571 2437 344 12009
NM_005509chr531867 418 75 1761 21455 481 1625
NM_005527chr6160 125 2261 165 --
NM_005542chr751898 1882 1540 572 238 ------
NM_005552chr141525 ------
NM_005561chr132865 132 --1755 1648
NM_005563chr13833 245 46 ------
NM_005574chr114477 157 62 21 1706 ----
NM_005575chr53856 712 163 ------
NM_005584chr132660 516 ------
NM_005587chr152768 117 --1885 --
NM_005596chr966358 5882 5795 5563 4715 1798 140 14550 --
NM_005602chr341180 266 173 127 ------
NM_005607chr81946 ----1350
NM_005613chr141830 1604 773 358 12207 ----
NM_005625chr831045 399 198 ------
NM_005627chr61113 --1174 194
NM_005638chrX31574 600 401 1408 1542 --
NM_005647chrX63250 2667 2367 2224 1277 246 ------
NM_005651chr41299 ------
NM_005652chr1641160 1088 885 189 ------
NM_005655chr821068 469 ------
NM_005665chr154824 4766 3878 466 318 ------
NM_005667chr2--2333 275 ----
NM_005668chr554549 1744 761 397 95 11062 24097 2835 --
NM_005711chr5----1919 11063
NM_005715chr672626 2292 839 772 372 247 119 --22032 1001 --
NM_005717chr12277 221 --1997 --
NM_005721chr2------1778
NM_005737chr232892 2250 2178 --1785 --
NM_005738chr7----1347 --
NM_005746chr722658 2261 1630 11101 --
NM_005748chr1252318 1080 650 471 95 ------
NM_005749chr172465 107 1471 ----
NM_005765chrX1256 1786 ----
NM_005779chr533671 2726 152 23557 1012 ----
NM_005786chr181224 ----1332
NM_005795chr262630 2150 1157 656 470 163 ----1726
NM_005808chr313375 --2816 463 --
NM_005813chr252413 1906 983 830 385 11751 11641 --
NM_005819chr152602 1388 357 100 93 12292 ----
NM_005822chr672015 1974 1821 540 465 457 427 ------
NM_005826chr1193 --159 --
NM_005828chr1795023 4776 4728 4303 3549 3471 1110 1066 749 --1920 --
NM_005832chr341263 1224 1218 58 ------
NM_005836chr8------167
NM_005839chr11662 --1190 --
NM_005840chrX97677 7621 7601 7595 5697 2916 2604 539 69 15207 25224 155 --
NM_005842chr13--1677 ----
NM_005863chr1031282 583 569 ------
NM_005871chr102977 56 ------
NM_005880chr162599 108 --1189 --
NM_005885chr511022 --31220 449 272 --
NM_005898chr1133154 2394 223 13029 12717 --
NM_005900chr421058 814 ----1225
NM_005901chr18138329 7917 7635 6840 6217 5719 5498 3320 2376 1607 1445 935 645 35255 3249 1514 16888 --
NM_005906chr611499 11615 ----
NM_005907chr611646 --1185 --
NM_005909chr544250 3010 1018 540 24170 1696 --1679
NM_005910chr1793785 3681 3608 3346 1043 625 273 255 206 14050 ----
NM_005917chr2--1187 ----
NM_005933chr1152962 2232 1861 513 363 ------
NM_005935chr465265 4605 3349 3215 1633 1544 24022 3600 12087 --
NM_005941chr823568 704 12699 23008 1449 11143
NM_005955chr184937 4318 4082 3980 3841 1302 160 149 --25029 4928 --
NM_005962chr1041734 713 671 318 1764 1943 --
NM_005962chr1041734 713 671 318 1764 1943 --
NM_005964chr1751346 1255 1085 996 151 ------
NM_005966chr242023 939 625 234 ------
NM_005968chr191214 ------
NM_006007chr953731 3450 3313 2902 871 --23507 593 --
NM_006011chr1583923 3803 3362 2613 1589 1148 1024 275 --24076 3170 --
NM_006016chr631906 555 479 1627 ----
NM_006037chr264775 3557 3519 3181 1394 471 --14820 --
NM_006047chr20156 --12175 12228
NM_006054chr1151456 1378 1372 1365 146 11305 ----
NM_006055chr232722 2561 1159 22642 1170 --12060
NM_006060chr794193 4123 3748 3305 2949 1041 923 700 222 12986 ----
NM_006070chr3--1322 ----
NM_006073chr641571 1462 1389 686 --21530 883 --
NM_006080chr742140 2064 2027 1862 22787 2083 11917 --
NM_006090chr13264 185 154 ------
NM_006095chr463102 3052 2846 1311 452 137 13095 11602 --
NM_006113chr111491 --21968 122 --
NM_006134chr2121545 290 ------
NM_006135chr12483 390 1296 ----
NM_006136chr711007 ----1404
NM_006141chr1632360 620 257 ------
NM_006148chr1782824 2122 2062 413 358 74 49 34 --1327 --
NM_006154chr1512537 12591 --1761
NM_006158chr841823 1816 1322 148 ------
NM_006166chr1211793 --32489 1750 1638 12515
NM_006180chr912087 11878 21833 66 --
NM_006195chr91969 11151 ----
NM_006203chr595348 5340 5327 5260 4082 3546 1665 1581 1400 11770 34398 4196 208 --
NM_006212chr154017 2003 1266 1006 703 --25311 204 --
NM_006216chr2171 ------
NM_006226chr231357 1065 57 133 ----
NM_006237chr1352060 2027 1672 153 105 --2725 396 11855
NM_006243chr1----1969 1409
NM_006246chr1411144 --4850 516 499 466 --
NM_006251chr533192 795 490 ------
NM_006252chr177181 6688 6680 3007 1766 719 83 --37166 5848 2573 25989 170
NM_006255chr142752 715 ------
NM_006256chr132586 2512 869 22281 155 12466 --
NM_006265chr841354 1063 1028 170 ------
NM_006281chr811130 ------
NM_006281chr811130 ------
NM_006283chr854747 4096 4057 3680 313 --13524 --
NM_006298chr672574 1359 1280 1182 1141 966 238 32739 2676 888 1686 --
NM_006304chr7------153
NM_006306chrX84628 3708 3685 2303 1720 1462 1266 1255 22021 1434 24435 4396 --
NM_006310chr17------11101
NM_006313chr1231571 1159 495 ------
NM_006315chr463353 2921 2846 1812 918 221 ------
NM_006317chr52790 601 1646 1637 --
NM_006320chr441037 850 228 107 ------
NM_006334chr9--1292 ----
NM_006352chr131973 268 169 --11943 --
NM_006357chr22126 43 ------
NM_006359chrX32219 2049 708 12257 1147 --
NM_006363chr20173 2505 242 ----
NM_006371chr395033 4909 4817 3934 3248 1038 706 545 538 11576 14956 11150
NM_006380chr1744288 2740 508 358 ----13863
NM_006386chr2232454 2342 706 11696 11635 --
NM_006393chr1044270 3392 3228 113 --21650 1231 1962
NM_006408chr73959 900 680 ------
NM_006411chr63389 312 39 ------
NM_006419chr44767 640 209 33 --2681 486 --
NM_006420chr2083451 2669 2138 1334 1271 894 104 69 12624 ----
NM_006422chr122147 79 ------
NM_006425chr51361 --146 11108
NM_006439chr4----1191 --
NM_006457chr411223 33522 854 277 ----
NM_006469chr111151 11254 ----
NM_006475chr131245 ------
NM_006476chr113696 505 471 --2725 567 --
NM_006482chr1273569 2975 2920 2521 2444 605 335 --1365 2614 516
NM_006496chr131606 619 476 1297 ----
NM_006504chr1062917 2692 2529 902 819 207 ------
NM_006516chr131470 1091 293 --11077 --
NM_006517chrX52094 1859 1548 929 770 ------
NM_006536chr12960 953 ------
NM_006541chr10----1202 --
NM_006544chr1455519 2253 2065 381 236 32192 1224 289 16044 --
NM_006547chr711587 ------
NM_006561chr1095667 4724 4316 4006 2449 2411 1542 1246 390 --151 --
NM_006565chr16--161 ----
NM_006595chr1132019 1610 73 1364 1333 --
NM_006599chr16127985 7386 6981 6058 5501 3221 2519 2510 1612 1518 1297 936 27456 5882 33186 771 196 1544
NM_006601chr121301 --1857 --
NM_006602chr20--1230 1331 --
NM_006603chrX2645 408 1483 11981 11823
NM_006606chr2062113 1158 594 134 86 28 ------
NM_006609chr242309 999 963 916 --1442 1171
NM_006618chr1----11428 11492
NM_006620chr643196 3146 1196 841 1782 11918 --
NM_006624chr1022081 738 ------
NM_006626chr922433 136 --11679 --
NM_006628chr1594185 3366 3214 2858 1856 1815 959 950 573 1330 23954 1242 14156
NM_006629chr1812137 11874 --21862 892
NM_006646chr1343057 2945 2460 135 ------
NM_006654chr1274652 3960 3530 2906 1658 1323 137 24640 1817 11088 --
NM_006675chr12103373 3099 2949 2732 2699 2078 1283 1083 663 405 ------
NM_006682chr752864 2640 2360 737 686 ------
NM_006699chr12888 24 11684 ----
NM_006704chr13170 ------
NM_006710chr23838 759 29 ------
NM_006717chr953385 3238 2634 2293 629 ------
NM_006722chr332330 2025 1043 1991 ----
NM_006727chr5----1389 --
NM_006729chrX85157 4502 4348 4194 3830 3638 1603 465 --13590 --
NM_006736chr241730 1308 540 80 ------
NM_006749chr8----190 11053
NM_006751chr21320 ----1251
NM_006754chr71997 --11200 --
NM_006759chr2--1218 ----
NM_006766chr832483 2342 421 --21912 1793 --
NM_006769chr1----1262 --
NM_006774chr76665 493 477 176 121 115 1185 1147 --
NM_006775chr672820 2538 2126 2077 1894 297 288 ------
NM_006777chrX22286 2085 ----1344
NM_006788chr181780 154 21697 96 --
NM_006790chr52320 148 ----1167
NM_006811chr202865 375 ------
NM_006814chr2092636 2471 2361 1734 906 667 504 40 22 --21778 308 --
NM_006818chr11990 --1918 --
NM_006823chr811217 ------
NM_006827chr1442787 2434 1183 777 2378 80 23020 2471 --
NM_006832chr141213 ----1420
NM_006838chr1241465 649 450 355 11284 ----
NM_006851chr1222303 176 1873 ----
NM_006854chr751955 1785 1649 1598 183 21852 1614 11493 11913
NM_006856chr1221008 247 169 ----
NM_006870chr204654 554 116 47 --1318 --
NM_006873chr232428 2301 1402 --23378 2474 --
NM_006874chr411207 --1314 --
NM_006884chr31150 ------
NM_006885chr1663560 3517 3506 2933 2813 1325 11118 1189 --
NM_006888chr1442643 830 711 107 22309 1072 --13116
NM_006908chr72921 292 ----1224
NM_006914chr91246 ------
NM_006918chr1195601 4913 4877 3714 3635 1229 1018 612 84 21399 1078 22273 1275 --
NM_006920chr221677 413 ------
NM_006922chr252333 1044 933 863 326 2792 332 12392 --
NM_006924chr174158 152 135 125 --13260 13904
NM_006930chr551925 1890 1509 1403 648 ----11656
NM_006931chr1221600 483 --1202 --
NM_006937chr17----295 59 --
NM_006939chr143461 433 184 ------
NM_006940chr1241399 1393 270 59 --1707 --
NM_006947chr431771 260 243 --1148 --
NM_006950chrX2685 270 ------
NM_006955chr1072706 2695 2609 1195 932 862 847 11051 23097 87 --
NM_006956chr762271 1547 813 730 612 114 ----11746
NM_006965chr183915 435 376 ------
NM_006981chr941207 829 789 714 22679 1916 ----
NM_006982chr12----148 --
NM_007005chr9159 --1554 --
NM_007007chr1254457 4339 3225 1556 1088 24012 3345 24145 3954 --
NM_007008chr22317 33 1193 ----
NM_007010chr1731294 741 358 ------
NM_007011chr1596558 6290 5734 2644 2445 2031 1462 1083 295 --26502 780 --
NM_007013chr83218 163 89 ------
NM_007023chr221092 261 --2420 122 --
NM_007035chr121646 --1305 --
NM_007036chr54920 842 820 173 ------
NM_007038chr21105486 5058 4745 4512 4473 1825 993 443 422 230 14622 24920 398 16035
NM_007040chr191689 ------
NM_007064chr331709 488 209 ------
NM_007067chr1731151 518 107 ------
NM_007076chr12----1106 --
NM_007078chr1072195 1898 1132 731 724 601 376 ------
NM_007106chr1342408 2041 900 145 ------
NM_007111chr132872 338 ------
NM_007114chr342667 2591 2257 279 --12344 --
NM_007123chr12147 56 ------
NM_007124chr632014 1617 405 --11263 --
NM_007139chr71814 --11116 --
NM_007144chr1731288 490 360 ------
NM_007146chr1732723 2395 1799 1615 ----
NM_007150chrX31709 288 161 ------
NM_007158chr11429 ------
NM_007166chr1121264 529 --11185 --
NM_007172chr2283000 2596 2553 2503 2401 2045 1155 1111 1627 11323 195
NM_007174chr1252194 1703 608 592 31 ------
NM_007175chr863617 2703 1100 700 514 275 23428 2471 22358 1284 --
NM_007187chr131333 ----1715
NM_007192chr145999 448 406 270 30 ----1321
NM_007195chr1853502 3251 3242 2755 1039 13091 ----
NM_007203chr953926 3322 2897 2585 1583 ------
NM_007214chr621350 548 ------
NM_007216chr112898 386 1118 ----
NM_007217chr32396 277 1144 ----
NM_007218chr82709 671 --2787 71 --
NM_007236chr1562086 678 407 281 260 251 12050 ----
NM_007238chr2094774 4441 4310 3982 3623 3611 1637 1017 335 --13926 --
NM_007249chr13228601 8578 8286 7990 7726 6394 6199 6147 5913 5878 5733 3267 3250 3001 2603 2118 1882 1591 1479 727 606 465 29451 5781 38683 7877 1838 16997
NM_007269chr1------1618
NM_007282chr3--1782 ----
NM_007286chr522122 1301 ----1778
NM_007292chr1774880 4730 4220 1793 1462 1317 796 23963 1126 14014 23811 1150
NM_007313chr941842 1801 1327 731 ------
NM_007332chr861579 1483 1353 1272 159 152 ------
NM_007345chr1842166 1923 1834 1448 ------
NM_007349chr71164 ------
NM_007350chr1264543 4444 3725 3461 1698 773 ------
NM_007351chr441126 1057 995 74 ------
NM_007358chr121782 675 --11498 --
NM_007363chrX3814 671 334 ------
NM_007373chr1031215 581 400 11427 11762 --
NM_007375chr132319 997 991 12792 1369 --
NM_012069chrX4927 813 127 109 --1688 --
NM_012081chr533296 1472 1149 --22867 2381 --
NM_012092chr21286 --31829 690 114 --
NM_012095chr1042247 1318 876 591 --13478 --
NM_012096chr373021 2659 2496 2408 1044 365 217 12766 1695 --
NM_012104chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_012104chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_012120chr632789 1824 526 11872 ----
NM_012134chr161884 1464 1345 1330 1226 356 ------
NM_012137chr152218 1949 1179 834 604 11006 1719 --
NM_012141chr1354147 3332 2714 1140 1097 34046 3132 3036 --1581
NM_012156chr20113233 2997 2911 2832 2579 2547 1043 254 199 99 72 ----11008
NM_012158chr1321600 310 --1711 --
NM_012161chr4--11065 ----
NM_012164chr9137471 6715 6688 6463 6258 6154 5521 5019 2966 1995 1820 1218 280 1594 46985 6705 5728 1306 --
NM_012177chr62488 117 ------
NM_012183chr1--1533 ----
NM_012193chr1144896 3698 1114 702 14837 23449 521 --
NM_012199chr1104163 3359 2876 1784 1517 1435 1327 686 241 232 11560 ----
NM_012214chr246130 5627 2356 1343 14662 23950 298 --
NM_012223chr23947 479 450 --1924 --
NM_012234chr383118 2686 2543 1427 1234 1170 403 78 --22994 416 --
NM_012249chr222405 438 11332 23435 2342 --
NM_012250chr1121073 47 --173 --
NM_012252chr765169 3405 3387 851 671 394 --12117 --
NM_012262chr164835 4374 3981 3796 3584 1291 11926 34410 1531 1421 --
NM_012281chr71832 --11887 --
NM_012286chrX2446 230 1481 ----
NM_012287chr383988 3497 3279 3267 3152 1192 1039 353 --24013 1070 --
NM_012288chr675458 5182 5082 4174 1742 589 195 25137 2252 ----
NM_012294chr773266 1503 901 570 441 239 124 --11539 --
NM_012297chr472511 2473 2436 544 510 129 57 11685 ----
NM_012300chr52476 402 11952 ----
NM_012301chr762234 1869 1570 1409 581 534 1743 11856 --
NM_012306chr1241108 544 420 25 --2825 233 --
NM_012307chr18------1925
NM_012316chr1105587 5349 4608 4069 3730 3721 1960 1939 1895 398 --45223 4920 3933 1474 --
NM_012327chr1851032 622 557 378 238 ------
NM_012328chr751385 1228 1219 415 169 ------
NM_012329chr1741564 1054 581 451 --11154 --
NM_012334chr574320 3695 3521 3514 1021 571 402 --12880 13828
NM_012347chr633032 2146 924 1381 12601 --
NM_012382chr524165 479 12902 44039 3661 1559 560 --
NM_012413chr21103 2121 109 ----
NM_012416chr911160 --1396 --
NM_012419chr6--1238 --1508
NM_012421chr1--1431 ----
NM_012433chr21250 ------
NM_012434chr641484 1441 1105 569 188 ----
NM_012448chr1731981 1704 35 1668 --12499
NM_012463chr1261616 1605 1256 1198 459 98 ------
NM_012471chrX71979 1727 1645 1224 465 374 136 21319 228 1151 --
NM_012479chr732693 912 518 --1675 --
NM_013230chrY41716 1619 258 41 ------
NM_013231chr1453479 1640 1257 835 752 --54325 3859 3458 3299 3234 --
NM_013233chr23926 440 310 11404 ----
NM_013238chr1331718 1314 235 1718 11331 11304
NM_013255chr7147621 6535 6127 3542 3095 3030 2882 2661 2611 2334 2116 1580 1246 506 38497 803 189 ----
NM_013261chr473305 3161 1392 1360 874 225 60 --42771 2517 1062 740 11408
NM_013262chr64426 367 236 174 ----11450
NM_013263chr16147 ------
NM_013269chr1244412 3590 3500 433 24398 1397 ----
NM_013277chr126949 825 816 747 104 56 --1240 --
NM_013293chr71545 --1221 --
NM_013348chr191530 1867 ----
NM_013354chr82898 384 --11365 --
NM_013357chr8169 --1278 1287
NM_013372chr1543176 2115 461 292 --12616 --
NM_013377chr123688 537 501 --1467 --
NM_013410chr11108 11238 ----
NM_013434chr271980 1489 1474 1259 693 403 59 ------
NM_013434chr271980 1489 1474 1259 693 403 59 ------
NM_013437chr82261 46 1328 1401 --
NM_013438chr931349 638 626 ------
NM_013444chrX2834 766 ------
NM_013449chr1262895 2714 2267 707 365 167 --1152 --
NM_013450chr231221 842 451 ------
NM_013958chr81332 1316 1354 --
NM_013959chr81332 1316 1354 --
NM_013961chr81332 1316 1354 --
NM_013962chr81332 1316 1354 --
NM_013989chr1454932 4385 3839 306 281 --11788 --
NM_013999chr172976 535 --1150 --
NM_014011chr221016 619 11901 --11642
NM_014016chr3----2445 123 --
NM_014021chr153152 2400 2117 655 51 ------
NM_014034chr61454 11338 1117 --
NM_014043chr31507 --1632 31354 1270 567
NM_014048chr1674836 4427 4191 4022 2025 1099 1050 14002 13638 --
NM_014089chr132437 89 148 2896 168 --
NM_014109chr851215 429 417 354 96 --11171 1906
NM_014112chr875491 5211 4579 4455 3359 1995 256 --21898 1681 --
NM_014117chr1642606 1084 266 91 ------
NM_014141chr785378 4190 3232 1891 1750 1639 1503 1377 13484 2426 96 --
NM_014155chr1155902 2673 1543 1351 866 --11237 --
NM_014157chr1663330 2856 1043 636 410 148 23814 3797 23701 622 --
NM_014176chr1--123 ----
NM_014181chr221116 278 ------
NM_014191chr123951 425 159 ------
NM_014212chr1211000 --1655 --
NM_014231chr1282034 1792 1620 1610 1579 760 96 43 1695 ----
NM_014243chr421981 167 --11497 1600
NM_014252chr13------1143
NM_014278chr43383 66 58 ------
NM_014280chr12613 68 ----1908
NM_014284chr1162 ------
NM_014289chrX--11190 --1419
NM_014294chr831145 1015 571 --11223 --
NM_014302chr7--130 ----
NM_014309chr2255158 5081 3367 1798 1208 1632 11857 --
NM_014319chr1231768 1693 116 ------
NM_014325chr1252186 804 565 152 116 ------
NM_014331chr4147373 7367 6343 5609 4994 4857 2645 2172 2030 1853 1812 1365 637 297 17644 --27211 773
NM_014333chr1142725 2258 2033 575 ------
NM_014344chr111342 --1223 --
NM_014345chr61931 1124 ----
NM_014351chr2231471 1102 478 ------
NM_014372chr131938 1752 1595 ------
NM_014376chr572563 2100 2094 1689 516 360 179 1572 11945 --
NM_014379chr821021 691 1112 1685 1843
NM_014382chr311757 1432 ----
NM_014388chr1135996 5876 5833 4791 4708 4499 4472 1570 1529 1408 1208 684 205 21026 445 44661 2225 793 142 --
NM_014392chr421159 629 ------
NM_014393chr831988 1518 77 1444 --1488
NM_014408chr13556 190 133 --2616 581 --
NM_014423chr565420 4565 4081 3990 3879 2168 34460 1703 640 ----
NM_014447chr441632 1365 1083 282 --1422 --
NM_014452chr63470 432 21 ------
NM_014454chr61670 ------
NM_014456chr102577 512 ------
NM_014458chr12538 250 11080 ----
NM_014470chr122582 541 ------
NM_014494chr1621907 1867 ------
NM_014522chrX2596 590 --1692 --
NM_014554chr1262246 2003 1426 277 228 155 22199 636 11783 --
NM_014563chrX22103 2059 --1160 --
NM_014574chr14----1998 1152
NM_014575chr3----1515 --
NM_014585chr241207 1181 483 23 1421 ----
NM_014586chr2174707 4511 1616 1576 889 103 63 11715 11600 --
NM_014607chr221764 565 ------
NM_014615chr1633637 2734 2340 --12979 12939
NM_014630chr1563498 3394 2924 2815 1556 1214 12445 ----
NM_014636chr973101 2780 1698 1528 674 470 214 13581 24362 1255 --
NM_014637chr811238 11117 ----
NM_014647chr1612161 2380 124 180 --
NM_014655chr172153 1714 1688 1582 838 680 577 11812 11516 --
NM_014667chr342435 2382 242 226 ------
NM_014670chr231389 1213 637 --182 1604
NM_014677chr8----11006 --
NM_014682chr81438 ------
NM_014690chr782924 2881 2862 2849 2114 879 745 548 12451 ----
NM_014701chr1522913 1072 1619 13235 --
NM_014702chr662930 2918 1143 566 203 62 1337 13289 --
NM_014705chr731799 604 31 ----1406
NM_014707chr731921 1624 395 11488 1919 --
NM_014709chr21182 ------
NM_014711chr1641731 1539 741 571 12130 21934 1469 --
NM_014713chr22517 157 ------
NM_014718chr12------1828
NM_014720chr103219 61 50 1251 1694 --
NM_014721chr6126651 5688 5283 5149 5115 2543 2047 1213 1185 770 660 40 15721 14558 --
NM_014726chr175553 499 408 151 36 ------
NM_014727chr19156 ------
NM_014730chr1275055 4892 4677 4600 4545 660 208 1382 24752 454 11994
NM_014730chr1275055 4892 4677 4600 4545 660 208 1382 24752 454 11994
NM_014735chrX--1486 11552 --
NM_014739chr663849 3449 3312 2977 889 441 11393 1679 22565 833
NM_014742chr2051552 1337 633 483 34 1191 11468 --
NM_014743chr483122 2930 2861 2477 1143 1061 437 175 1299 ----
NM_014746chr253087 1687 746 222 26 1545 190 11420
NM_014755chr273870 3112 2901 1329 1249 1164 1146 12776 ----
NM_014765chr132545 2530 805 22115 211 ----
NM_014766chr773779 3705 3572 3497 2976 1472 1222 --1602 --
NM_014779chr3147 1141 1979 --
NM_014781chr8190 --1430 126
NM_014795chr211282 ------
NM_014800chr751153 937 175 123 93 1300 21137 456 --
NM_014810chr193556 3437 3269 2623 1092 1070 884 827 771 --23153 502 --
NM_014812chr131932 1786 1612 1433 11846 --
NM_014820chr352099 1917 1821 1423 136 11965 1623 --
NM_014824chr112592 402 1815 1703 --
NM_014827chr121441 223 ------
NM_014830chr1263874 3093 2472 1144 782 246 --12871 --
NM_014832chr1341911 1551 1395 403 --12064 --
NM_014836chr1051910 1690 1416 1236 491 11696 ----
NM_014840chr1242780 1167 668 629 12242 12512 --
NM_014844chr1494155 2980 1439 1229 1034 773 684 515 283 ----11019
NM_014847chr1131 ------
NM_014848chr1562770 2498 2075 994 569 59 ------
NM_014850chr374898 4339 4328 4075 3277 541 171 24829 1924 2891 329 --
NM_014869chr331237 1039 222 11504 11120 --
NM_014873chr154152 3692 3551 1896 865 1288 1559 --
NM_014877chr1777532 6597 4759 2577 1997 632 498 37165 1207 554 32947 2361 1918 --
NM_014885chr4146 ------
NM_014887chr132636 611 ------
NM_014888chr721466 103 ------
NM_014890chr3177 --1248 --
NM_014893chrY32199 915 142 ----22385 2305
NM_014897chr1772967 2885 2751 878 757 327 38 --12213 --
NM_014900chr2----2756 312 --
NM_014903chr1242172 1895 1665 410 ------
NM_014906chr1744025 3295 2884 265 --13462 --
NM_014912chr102907 309 11384 ----
NM_014917chr12693 174 ----1954
NM_014918chr1551132 1108 1073 384 317 --1186 --
NM_014923chr1332383 2192 2022 ------
NM_014925chr124769 753 671 244 ------
NM_014926chr34941 914 105 68 ----1824
NM_014932chr321261 239 --21690 1449 --
NM_014935chr1113838 3753 3741 2813 2416 1257 1067 491 356 284 70 12365 23208 59 --
NM_014936chr642523 2034 861 58 11802 2336 226 --
NM_014939chr18--1272 1181 11335
NM_014946chr21998 13113 ----
NM_014950chr14199 21666 1252 ----
NM_014953chr1343868 469 227 129 11544 23853 3675 --
NM_014961chr441804 867 746 642 --11884 --
NM_014962chr2032581 1805 43 22088 1158 12625 --
NM_014970chr1----1215 --
NM_014978chr1031573 231 164 ------
NM_014982chr1463748 3612 1437 1409 1104 867 13403 34662 4179 272 --
NM_014988chr432162 2062 1141 11029 ----
NM_014989chr61494 1790 11305 --
NM_014991chr482587 2565 2546 2143 2009 532 341 100 ------
NM_014992chr141350 --1608 --
NM_014997chr7112902 2715 2238 1870 1019 965 802 658 569 414 170 --22335 1880 --
NM_015000chr1273115 2216 2128 501 458 301 259 --13086 --
NM_015002chr122693 322 1527 1280 --
NM_015008chr362831 2760 2649 2623 1378 457 --13446 --
NM_015025chr221918 1735 ----12705
NM_015026chr1254574 4527 4497 723 447 --13109 --
NM_015027chr1621796 423 ------
NM_015032chr131804 12372 ----
NM_015033chr932980 2905 337 --22295 890 --
NM_015039chr161060 942 357 318 180 41 14008 ----
NM_015045chr102103 46 ----1440
NM_015049chr253183 3056 2309 1149 572 --12480 --
NM_015051chr9----21261 435 13041
NM_015055chr1122845 2592 1464 22521 2484 --
NM_015063chr1961318 1296 1057 324 267 247 11289 ----
NM_015064chr1243261 2716 523 295 1532 --1329
NM_015068chr763624 3357 3233 3146 1094 681 --21192 120 1172
NM_015073chr1931828 1721 1690 ------
NM_015074chr164676 4553 3143 1901 1632 516 ------
NM_015075chrX52065 1663 654 583 95 --11897 --
NM_015086chr1261310 1054 613 125 63 36 ------
NM_015090chr1105938 5866 5595 5462 5205 4753 3895 1555 1150 382 --11486 --
NM_015091chr143825 148 97 ------
NM_015092chr1674606 4040 3722 1597 707 73 45 --11270 --
NM_015094chr2294037 3832 3772 1783 1645 1516 1502 1333 558 11819 ----
NM_015097chr32667 166 --21517 88 --
NM_015100chr131683 1327 810 ------
NM_015110chr912459 11621 --1805
NM_015115chr463219 3104 2913 2690 1266 801 --2756 238 --
NM_015124chr2242273 2122 1791 856 --2817 96 --
NM_015130chr421262 968 ------
NM_015132chr761275 737 505 298 158 133 11260 ----
NM_015135chr71160 --1129 --
NM_015138chr1542200 817 487 422 ------
NM_015143chr421220 22 11492 11272 --
NM_015150chr31189 154 ----
NM_015153chr62676 96 ------
NM_015155chr1052569 2230 901 581 422 1281 23013 882 --
NM_015156chr1463891 2854 768 556 258 93 23228 1368 ----
NM_015161chr1631149 504 348 ------
NM_015170chr841649 876 395 71 --11896 --
NM_015172chr141047 635 241 107 ------
NM_015173chr41475 11758 ----
NM_015176chr141741 1586 1333 445 --1151 --
NM_015184chr3------1248
NM_015192chr2062362 1862 649 501 104 90 21995 669 11891 --
NM_015199chr352823 2765 2441 2368 606 --12276 --
NM_015205chr13113870 3538 3501 1247 1211 1189 1160 1139 717 595 122 14602 31272 971 379 --
NM_015206chr1593184 2996 2975 2701 2459 2383 1544 721 541 --22941 604 2948 163
NM_015215chr11774 --22408 241 --
NM_015225chr952569 2492 2335 2110 1947 1120 22865 2609 --
NM_015231chr114835 288 131 118 ------
NM_015234chr621251 1155 ------
NM_015239chr9------1527
NM_015247chr1695122 5103 4771 2017 1830 1407 1159 1029 84 34638 3579 57 15273 15255
NM_015252chr21731 ------
NM_015254chr862904 2468 1942 929 681 352 ------
NM_015267chr123844 675 563 1760 11860 12101
NM_015271chr464036 4030 3454 2819 1262 239 21290 932 --12706
NM_015272chr1651966 1709 1509 1327 534 1674 ----
NM_015275chr1241903 800 160 104 ------
NM_015277chr18----21144 303 --
NM_015282chr242935 997 828 589 11007 12115 --
NM_015289chr1581922 1833 1656 1252 785 761 469 281 ------
NM_015291chr173262 3072 2590 2372 1174 1084 711 --13237 --
NM_015296chr1341235 1037 838 130 --21224 52 --
NM_015299chr1473464 3397 2525 1427 1357 818 787 --13981 --
NM_015310chr855338 5283 2818 2462 1963 25360 3320 26531 877 --
NM_015313chr1144636 4092 3112 210 --44073 1568 1260 68 --
NM_015315chr582345 2331 1218 1117 1065 751 580 193 22675 1239 22512 1148 1230
NM_015326chr132617 2023 395 11056 12807 --
NM_015328chr732347 1930 1129 23014 2709 12065 --
NM_015329chr1962439 2071 1873 772 620 246 ------
NM_015336chr1222213 2090 --187 --
NM_015338chr2041258 1245 412 341 --1765 --
NM_015347chr1262663 2304 1031 902 569 229 ------
NM_015349chr652555 2264 559 439 70 12305 ----
NM_015355chr17159 1620 1216 --
NM_015358chr2111112 ----1896
NM_015361chr23748 653 52 1676 ----
NM_015367chr2261260 606 553 415 295 178 11522 ----
NM_015387chr221960 1423 11383 --1415
NM_015393chr473541 3506 2715 1303 1257 932 192 ----22816 1380
NM_015397chr931654 1434 43 --1290 --
NM_015419chrX2457 339 ------
NM_015439chr6185 ------
NM_015455chr563565 2956 1526 999 384 372 --1837 --
NM_015457chr111433 ------
NM_015472chr31397 ------
NM_015472chr31397 ------
NM_015483chr71808 ----1846
NM_015484chr11781 1661 1162 1251
NM_015497chr151726 --1107 1172
NM_015509chr124586 334 315 144 ------
NM_015514chr143495 419 70 ------
NM_015520chr352528 1940 715 643 28 --12765 --
NM_015530chr26983 888 808 288 159 110 ----1905
NM_015535chr293758 3623 3609 3540 3022 1485 981 428 120 21308 710 13245 --
NM_015541chr3--11098 ----
NM_015542chr1031078 429 92 --11103 --
NM_015550chr752981 2271 2193 1166 745 ------
NM_015553chr6115004 4729 4438 4387 1922 1626 1413 1333 839 706 194 11324 1374 --
NM_015555chr621417 1323 11726 ----
NM_015560chr342216 1064 701 37 11944 --1207
NM_015564chr523319 2865 --1546 --
NM_015565chr2131898 807 424 --11644 --
NM_015569chr154110 1855 1000 750 147 21006 967 1408 14070
NM_015570chr721742 1483 ------
NM_015571chr632052 750 486 --12515 --
NM_015575chr242728 2618 1095 189 12357 ----
NM_015576chr352306 883 784 461 332 ------
NM_015578chr1911382 1198 11939 --
NM_015589chr142160 68 ------
NM_015622chr71224 ------
NM_015635chr941376 776 550 326 ------
NM_015640chr155370 4622 3505 998 261 --11491 1781
NM_015646chr121250 --1274 2167 98
NM_015678chr1351608 1585 1114 372 112 1447 11093 --
NM_015691chrX3683 545 212 ------
NM_015853chr114187 168 75 46 ------
NM_015872chr111242 11622 ----
NM_015879chr18117272 6764 6255 5262 2792 1955 1539 1343 869 777 455 35535 2318 728 27764 6136 --
NM_015886chr885422 4454 3787 1834 1287 1158 279 260 12085 23930 1176 24935 1553
NM_015888chr163085 2975 2584 2562 2504 2143 --12883 --
NM_015906chr143371 3364 3207 1112 14025 2181 101 --
NM_015912chr852488 2268 2168 2093 968 --21705 776 12423
NM_015920chr15----1635 1610
NM_015933chr3----180 --
NM_015948chr61446 ----1323
NM_015975chrX11125 11413 ----
NM_015986chr171437 1357 ----
NM_015995chr1585376 4660 4321 3673 3546 1743 1049 921 25010 1137 14157 --
NM_015999chr12471 184 ------
NM_016009chr154847 4569 4532 4199 3992 11216 11359 --
NM_016021chr63505 271 157 --4590 533 182 51 --
NM_016025chr1631744 1310 1225 1110 11391 --
NM_016040chr131951 1809 630 12764 --11106
NM_016041chr17168 --1248 --
NM_016057chr1251241 1167 185 131 29 1808 ----
NM_016061chr231540 550 23 --1248 --
NM_016071chr7193 ----1183
NM_016072chr1251865 774 632 364 308 --11707 12166
NM_016073chr151854 --1997 --
NM_016075chr1342640 2632 2336 1960 13175 ----
NM_016076chr1102817 2778 2617 2341 1976 900 660 618 77 22 1720 13037 1864
NM_016079chr241448 848 545 128 --22302 866 --
NM_016083chr653923 3015 1362 847 185 13509 --13389
NM_016089chr351691 1360 641 137 53 ------
NM_016096chr852108 1933 1865 424 223 ------
NM_016097chr1821089 974 ------
NM_016107chr52546 444 11166 --11231
NM_016120chrX----1469 --
NM_016124chr131234 478 389 --1243 --
NM_016129chr4----133 --
NM_016131chr212324 21580 113 ----
NM_016132chr1532680 32 24 ----13472
NM_016162chr124839 668 314 39 --1857 --
NM_016169chr1073034 1187 1156 1123 1075 877 613 --13292 --
NM_016205chr451090 932 141 121 85 ----21224 498
NM_016206chr378580 8133 7216 7098 2970 2152 359 28161 6485 17700 26513 1778
NM_016217chr632927 2509 599 23024 1103 176 --
NM_016248chr1353653 3576 3321 668 631 --22949 306 --
NM_016252chr22615 381 1766 1905 --
NM_016255chr633189 2556 413 23314 1146 ----
NM_016257chr193515 3087 2753 2593 2566 2398 2241 2174 676 23112 2163 21366 566 --
NM_016258chr1------148
NM_016260chr255608 5534 2478 1109 655 12983 15958 --
NM_016264chr19143 --1545 --
NM_016270chr191493 ------
NM_016271chr18101968 1921 1898 1873 1850 1825 1802 168 45 24 ----11620
NM_016272chr2242439 1938 1867 491 --1294 --
NM_016275chr371911 1872 1857 1751 891 487 203 ------
NM_016277chr631569 1144 373 ----1600
NM_016281chr123958 434 79 ------
NM_016302chr32251 224 --1304 --
NM_016308chr15704 322 268 103 21 ------
NM_016312chr122383 221 ----1132
NM_016316chr2--1473 ----
NM_016322chr972993 1226 1046 938 627 567 388 --1690 192
NM_016352chr751292 1200 1177 368 339 11124 ----
NM_016353chr822473 1879 --2798 267 --
NM_016357chr121825 --11212 1184
NM_016376chr1794251 3633 2735 1522 946 864 726 708 285 --34268 1568 31 --
NM_016395chr15101867 1705 1627 1534 1349 685 589 564 216 144 --1572 --
NM_016396chr1562525 2258 2156 2122 1952 262 --12784 --
NM_016403chr113618 192 50 ------
NM_016424chr1741231 738 396 306 1539 ----
NM_016441chr212228 ------
NM_016442chr521717 919 ------
NM_016451chr11----168 --
NM_016489chr7164 --192 1556
NM_016499chr111176 ------
NM_016507chr1753063 719 644 609 45 --12506 12313
NM_016522chr1121336 1282 --1366 --
NM_016530chr1543436 3417 3072 555 13936 13264 --
NM_016531chr434058 3300 527 12811 1407 12888
NM_016536chr19199 --173 1236
NM_016542chrX31711 1668 360 --21366 656 --
NM_016544chr273040 2799 2733 2516 1544 1202 694 --11425 --
NM_016591chr52314 243 1881 ----
NM_016603chr521806 302 --31436 567 275 --
NM_016604chr53894 240 233 1846 1296 --
NM_016607chrX41662 1333 1260 678 ------
NM_016621chr1154080 3847 3391 3345 2886 --22957 2845 --
NM_016626chr181222 ------
NM_016649chr20----135 --
NM_016653chr21273 --11044 --
NM_016654chr15--11435 --11410
NM_016823chr174974 507 379 116 1869 ----
NM_016834chr1793785 3681 3608 3346 1043 625 273 255 206 14050 ----
NM_016835chr1793785 3681 3608 3346 1043 625 273 255 206 14050 ----
NM_016841chr1793785 3681 3608 3346 1043 625 273 255 206 14050 ----
NM_016929chr653725 1361 428 422 122 13442 23988 601 --
NM_016941chr192101 71 161 --1402
NM_016950chr41458 ------
NM_017415chr574568 4214 3582 2879 1694 1419 235 ------
NM_017420chr1413309 --1925 --
NM_017423chr41722 --42045 1621 451 232 --
NM_017426chr4140 ------
NM_017483chr241288 1170 1062 118 11013 ----
NM_017488chr241623 1505 1397 453 11348 ----
NM_017545chr202551 217 --1533 --
NM_017549chr731445 1141 1018 ------
NM_017551chr1042388 1661 596 288 ------
NM_017553chr153359 98 92 --11283 --
NM_017563chr396210 5207 4797 4392 3895 2239 1704 1209 1117 22525 1696 22435 1337 26153 5550
NM_017577chr321185 190 --11221 --
NM_017580chr1032036 1723 332 1437 ----
NM_017582chr141499 496 477 256 ------
NM_017588chr92713 443 --21944 1601 --
NM_017593chr4198 ----1197
NM_017594chr943002 1218 973 234 22870 131 23152 415 12658
NM_017596chr164000 3966 2875 442 186 35 23226 3200 13265 --
NM_017602chrX3821 596 353 ------
NM_017610chr1551399 638 545 481 43 11835 11581 --
NM_017628chr494726 4030 3442 3280 2119 1227 1189 1089 517 --24984 1120 13606
NM_017632chr4------1132
NM_017633chr643918 1557 1210 238 ------
NM_017634chr831236 623 338 1769 ----
NM_017637chr9178323 7988 7211 6706 6667 6490 6450 6210 3775 3412 2808 2676 1987 1328 1141 872 611 13489 --17438
NM_017640chr61263 --174 --
NM_017641chr121173 ----1214
NM_017643chr1752420 1157 987 597 452 1692 ----
NM_017644chr374400 4245 3629 1922 1860 1257 491 24103 443 11742 --
NM_017650chr775928 5002 4205 4139 1599 727 603 --2945 278 --
NM_017658chr1464158 3921 1473 1082 839 56 --24207 868 --
NM_017666chrX72013 1559 1405 768 464 314 291 --1559 --
NM_017686chr12767 185 ------
NM_017709chr121000 655 11653 23616 251 --
NM_017714chr201312 ------
NM_017719chr321781 224 --1996 --
NM_017730chr31171 1464 ----
NM_017736chr1622378 2277 1342 ----
NM_017737chr142079 696 629 564 1587 2749 447 --
NM_017744chr152143 1673 900 879 452 ----1472
NM_017745chrX1521 ----1559
NM_017753chr9140 ------
NM_017754chr644276 3115 1897 912 --24180 1643 --
NM_017786chr81715 1273 ----
NM_017789chr21213 ------
NM_017798chr203464 264 113 11088 ----
NM_017799chr1432009 1732 1539 ------
NM_017811chr942905 2463 941 223 --12396 --
NM_017812chr7----1726 --
NM_017822chr12----1265 --
NM_017824chr103660 519 36 ------
NM_017831chr1864682 3141 1376 1043 415 210 --23399 192 --
NM_017845chr43845 745 159 ------
NM_017848chrX73944 3763 3350 3265 2995 1340 141 23780 3747 11631 --
NM_017880chr23406 291 44 ------
NM_017893chr1041091 549 476 316 ------
NM_017915chr122780 405 11107 --1235
NM_017919chr9125577 5390 5084 4965 4949 4727 4402 3664 2097 1257 1113 41 --11082 11181
NM_017933chr221615 461 11087 ----
NM_017938chrX32210 650 314 11792 1215 --
NM_017943chr1431031 318 283 11078 21016 791 --
NM_017944chr1163148 2830 2559 2302 971 821 ------
NM_017974chr22917 386 --11243 --
NM_017988chr121130 1628 165 --
NM_017994chr733022 2359 663 ------
NM_017999chr14--179 ----
NM_018014chr221103 71 ----1363
NM_018027chr102418 143 11137 2754 276 --
NM_018045chr132665 1965 739 11050 ----
NM_018060chr13397 351 261 ------
NM_018061chr111169 1662 1512 --
NM_018084chr223304 3216 ----12045
NM_018086chr251659 1511 1297 320 137 ------
NM_018087chr1172 ------
NM_018103chr1----1106 --
NM_018107chr143726 102 56 ------
NM_018121chr1031030 708 605 --13161 --
NM_018128chr1721469 517 ----11088
NM_018131chr101777 --1689 --
NM_018137chr141153 948 359 157 --11179 --
NM_018155chr333068 2692 324 ------
NM_018157chr1273242 3129 2586 1188 753 506 44 12142 1790 --
NM_018167chr141353 --1143 --
NM_018181chr18----21528 157 --
NM_018182chr1772204 792 678 620 295 172 109 22180 2145 1522 --
NM_018184chr352197 1868 712 323 155 1295 1653 1554
NM_018195chr1131905 1321 568 --11824 --
NM_018200chr1562045 1891 1879 1675 479 332 ------
NM_018202chr13763 253 151 --1845 --
NM_018211chr11575 1218 21612 91 --
NM_018214chr651318 1027 957 321 114 ------
NM_018241chr43816 740 401 ------
NM_018246chr812725 2618 117 22803 588 --
NM_018247chr652066 885 868 815 513 1241 11054 --
NM_018254chr131487 884 546 11697 --12466
NM_018263chr242379 1923 1676 71 22626 1726 1929 --
NM_018266chr34958 721 419 286 ------
NM_018287chr102442 228 ----1854
NM_018293chr322231 1177 22381 1819 12999 --
NM_018299chr832737 1084 153 ----22348 2312
NM_018307chr17--1796 152 --
NM_018310chr8251 28 ----1582
NM_018315chr421355 1059 11408 1633 --
NM_018327chr2011304 --11885 --
NM_018351chr1274021 3796 3787 3609 3595 3553 2893 14374 24005 1030 --
NM_018362chr1142963 1404 807 748 --2978 325 --
NM_018364chr153596 3495 1416 791 129 11061 ----
NM_018374chr754756 3922 2072 1803 1649 24871 3381 22052 659 --
NM_018381chr193939 582 372 --1709 --
NM_018387chr9177 --1126 --
NM_018400chr1173870 3448 2994 392 153 121 53 14107 34117 1734 1485 --
NM_018403chr333460 3453 900 14087 1156 1746
NM_018409chr43964 293 107 1271 1621 12660
NM_018416chr1242576 1938 1023 187 --1111 --
NM_018424chr941857 1520 556 196 21650 1450 11234 1688
NM_018429chr552768 2383 2352 2300 188 12497 ----
NM_018433chr23516 201 92 ------
NM_018440chr8108561 7966 7885 6864 2936 2852 1792 926 644 239 37507 3223 2247 35838 3211 2282 --
NM_018441chr2----146 --
NM_018445chr151514 ----1203
NM_018448chr1231307 958 484 --11217 --
NM_018471chr22180 144 --1157 --
NM_018482chr851010 1001 980 252 231 --2157 33 --
NM_018490chr1141707 540 436 72 ------
NM_018509chr1741503 1417 1237 1191 ----11483
NM_018534chr23244 160 111 ------
NM_018553chr1711674 --2448 43 1151
NM_018566chr13689 114 43 14528 23651 3358 --
NM_018593chr6------1105
NM_018638chr1243817 2217 1475 560 --1585 24530 421
NM_018639chr123416 82 45 ----11122
NM_018640chr1232769 2263 575 1684 2766 43 --
NM_018644chr1142009 1561 1368 53 --11948 --
NM_018650chr122266 914 --1372 --
NM_018704chr141996 830 739 32 11771 31982 1657 194 --
NM_018710chr831123 236 99 185 2537 69 --
NM_018712chr113572 448 365 11572 1231 --
NM_018717chr482687 2366 1168 1152 820 805 368 79 ------
NM_018841chr132678 1172 513 33942 3787 632 ----
NM_018847chr92316 166 11822 ----
NM_018890chr72921 292 ----1224
NM_018912chr521158 320 ------
NM_018913chr521158 320 ------
NM_018914chr521158 320 ------
NM_018915chr521158 320 ------
NM_018916chr521158 320 ------
NM_018917chr521158 320 ------
NM_018918chr521158 320 ------
NM_018919chr521158 320 ------
NM_018920chr521158 320 ------
NM_018921chr521158 320 ------
NM_018922chr521158 320 ------
NM_018923chr521158 320 ------
NM_018924chr521158 320 ------
NM_018925chr521158 320 ------
NM_018926chr521158 320 ------
NM_018927chr521158 320 ------
NM_018928chr521158 320 ------
NM_018929chr521158 320 ------
NM_018945chr652859 2551 986 661 132 --1979 --
NM_018947chr764717 3772 1745 1685 1505 67 1300 34688 3739 3247 1611
NM_018948chr121095 566 --11178 --
NM_018963chr2131149 542 105 --168 --
NM_018970chr752789 2700 2001 1175 841 1849 32537 1112 129 1358
NM_018979chr1212327 --12271 --
NM_018999chr1074599 3657 3054 667 608 475 39 24425 3482 21400 892 --
NM_019001chr374849 2960 1868 1832 1662 1020 341 1683 ----
NM_019003chrX----1117 --
NM_019004chr742329 2105 2014 532 3937 660 414 11672 --
NM_019010chr171257 ------
NM_019016chr172152 88 ------
NM_019022chr1841993 1137 1055 971 12397 ----
NM_019027chr461914 1900 1804 765 724 246 --12586 --
NM_019035chr431942 1681 786 --12003 --
NM_019041chr6102610 2532 2379 2044 1783 1697 621 505 384 54 22246 615 11891 --
NM_019042chr72487 353 --1323 --
NM_019045chrX2877 669 ------
NM_019053chr1031087 864 698 ------
NM_019067chrX44812 1440 1147 777 11759 14844 11811
NM_019072chr523418 3398 13544 ----
NM_019080chr1351456 1277 1253 178 22 --21126 469 --
NM_019084chr1032096 1932 1926 --31663 946 145 --
NM_019087chr531751 1648 633 --1568 --
NM_019091chr22267 228 ------
NM_019094chr1233832 1017 76 ----1739
NM_019098chr831857 1794 1670 ------
NM_019102chr71130 ------
NM_019102chr71130 ------
NM_019114chr92876 485 --1951 --
NM_019116chr1673763 3501 3198 1453 1142 552 72 --1403 --
NM_019555chr31537 139 ----
NM_019556chrX11133 1546 ----
NM_019606chr71220 ------
NM_019610chr131453 384 353 ----21927 1901
NM_019854chr12----1690 --
NM_019862chr1671678 1628 1497 1413 1308 1222 588 --1461 --
NM_019895chr32204 141 ------
NM_019898chr1671678 1628 1497 1413 1308 1222 588 --1461 --
NM_019899chr1671678 1628 1497 1413 1308 1222 588 --1461 --
NM_019900chr1671678 1628 1497 1413 1308 1222 588 --1461 --
NM_020039chr1231319 181 80 --31266 641 339 --
NM_020066chr12898 90 ------
NM_020116chr441579 1190 1168 559 --11770 198
NM_020122chr285485 4319 2216 1792 1429 648 271 127 --1915 --
NM_020123chr1041431 1232 554 153 1619 11061 --
NM_020133chr6186140 5654 5618 5187 4814 4761 4577 4562 4533 4149 4124 2219 2153 1686 1019 835 507 351 25235 1224 34554 4373 60 15610
NM_020143chr22842 124 ------
NM_020144chr73757 521 122 --11793 11422
NM_020150chr1042166 1603 887 224 12245 ----
NM_020177chr553365 2222 736 264 226 1838 ----
NM_020178chr173882 177 118 ------
NM_020182chr2073516 3356 3260 2928 2702 2303 2293 --23612 2475 --
NM_020200chr102760 94 ------
NM_020225chr4----176 --
NM_020228chr1162508 2476 2386 2081 784 169 --11010 11670
NM_020239chr1102005 1867 1538 1438 817 795 698 692 43 29 12182 11821 --
NM_020240chr562687 2389 2290 852 810 682 1817 ----
NM_020245chr664921 4856 3618 1867 1395 374 11047 13466 --
NM_020310chr1752639 2219 1973 1794 83 ----12325
NM_020317chr11338 ------
NM_020336chr2023765 1195 11242 13547 --
NM_020337chr442553 2186 1182 761 ------
NM_020341chr201159 2656 99 --1302
NM_020346chr1141752 1608 319 212 1326 ----
NM_020348chr103988 710 386 ------
NM_020357chr311107 --11227 --
NM_020360chr172626 612 ------
NM_020403chr1321750 352 --21402 1213 --
NM_020420chrY21632 1616 ----11675
NM_020424chr163658 174 154 --1224 --
NM_020432chr731640 794 252 --12339 --
NM_020466chr644138 1614 1413 612 --14453 11031
NM_020474chr181638 --21642 73 --
NM_020475chr852449 2009 724 570 71 ------
NM_020476chr852449 2009 724 570 71 ------
NM_020477chr852449 2009 724 570 71 ------
NM_020478chr852512 2072 787 633 134 ------
NM_020480chr852449 2009 724 570 71 ------
NM_020532chr22317 33 1193 ----
NM_020546chr542886 2604 2267 745 --21969 291 --
NM_020640chr331478 325 170 32205 267 249 1148 --
NM_020644chr1121027 749 1676 ----
NM_020647chr83789 592 516 ------
NM_020651chr21298 11458 ----
NM_020654chr331480 551 525 --11512 --
NM_020673chr2096845 5574 5502 1934 1915 1560 1271 967 621 27240 2187 25299 2459 --
NM_020676chr33754 343 24 ------
NM_020686chr1632172 723 257 --22821 2138 --
NM_020689chr205627 558 239 232 167 --21526 1160 --
NM_020699chr195222 4861 4238 4207 3434 1450 924 483 29 13422 24694 2136 --
NM_020704chr732302 801 615 ------
NM_020714chr19124585 4578 3380 3204 3142 2956 2796 1687 1602 1323 344 334 11853 34340 3038 1591 --
NM_020717chrX154934 4767 4162 4143 4133 3914 3794 3632 3616 3502 2001 1875 714 304 27 13961 ----
NM_020726chr5----2418 118 --
NM_020727chr2141576 1336 1184 513 ------
NM_020728chr782716 2542 2264 2045 2036 1208 469 23 --12976 --
NM_020734chr1242592 847 423 367 ------
NM_020739chr1574081 3817 2815 1557 1427 1371 555 ------
NM_020742chrX32268 1861 979 ----12459
NM_020748chr1732171 1945 1574 --2739 191 --
NM_020750chr611500 2997 246 11428 --
NM_020760chr21448 --11539 --
NM_020765chr1----1287 --
NM_020766chrX73417 3313 3145 1454 1302 930 149 ------
NM_020772chr1787853 7273 5581 3080 2528 2052 1445 1288 16557 12491 --
NM_020774chr1886100 5689 5210 2049 1781 1428 1154 361 15276 45777 5664 4199 278 --
NM_020776chr1863018 1138 761 462 453 123 1153 ----
NM_020779chr232069 2050 700 --12646 12020
NM_020796chr552937 2927 2673 2667 219 1756 12412 --
NM_020801chr521730 984 --1176 --
NM_020803chr42933 703 11481 ----
NM_020805chr1821579 1263 187 --137
NM_020806chr143549 327 56 --1123 --
NM_020809chr1142312 1758 411 287 --1791 --
NM_020810chr1483251 3215 2623 1316 728 711 554 176 --23072 430 --
NM_020818chr14----1108 --
NM_020826chr11112515 2506 2334 2318 1449 1057 878 539 386 81 46 13023 --12632
NM_020834chr1431285 760 412 1429 --11591
NM_020839chr31422 --11333 --
NM_020841chr1233784 1559 1114 1182 ----
NM_020845chr1232112 1738 425 --22058 170 --
NM_020850chr1652843 2613 2035 982 710 --13163 13275
NM_020854chr1831430 1379 1347 1123 ----
NM_020858chr1562202 1499 900 647 538 35 --11481 --
NM_020860chr43837 388 144 --1418 --
NM_020861chr641318 516 489 139 21328 937 11375 --
NM_020868chr21348 ------
NM_020871chrX31999 852 360 11008 ----
NM_020886chr112319 26 ------
NM_020896chr111280 ------
NM_020899chr1761605 1023 555 531 453 447 --12018 --
NM_020919chr221296 293 ------
NM_020921chr1422492 2251 43590 3581 3140 2702 ----
NM_020922chrX41747 1205 237 169 ------
NM_020925chr131276 1001 937 --1571 --
NM_020935chr274592 3850 3084 1803 855 211 196 --23791 1714 --
NM_020940chr1022414 1900 --2374 158 --
NM_020948chr153487 3455 2733 2237 1459 --22950 649 --
NM_020951chr1942318 2305 246 130 ------
NM_020962chr1552416 916 827 796 454 ------
NM_020964chr1864301 3906 1582 1476 1123 640 23758 1187 14096 11704
NM_020977chr452121 1657 367 327 206 --11881 --
NM_020981chr21215 ----1584
NM_020993chr1272581 2175 2080 1983 1873 472 456 ------
NM_021007chr222346 981 ----1940
NM_021013chr173331 112 28 ------
NM_021019chr121148 ------
NM_021032chr311494 21778 720 21763 493 --
NM_021033chr1342736 2436 2415 900 1850 ----
NM_021061chr843780 3757 342 27 1554 1207 11172
NM_021064chr641750 1258 631 156 --1604 --
NM_021069chr442081 1595 1421 368 ------
NM_021079chr1763342 3286 2497 1308 782 689 1964 1235 --
NM_021083chrX32784 1093 636 1791 23371 1178 12337
NM_021097chr262578 2569 2499 1964 992 218 12560 ----
NM_021102chr191385 ------
NM_021111chr9161 --1508 --
NM_021120chrX82981 2700 2353 2233 2168 752 677 21 --12806 --
NM_021133chr131294 1231 485 --2225 69 --
NM_021140chrX21111 1025 ----1265
NM_021159chr441687 1461 1092 79 ------
NM_021174chr8125 --1229 --
NM_021183chrX82587 2523 1650 921 894 589 236 146 1472 ----
NM_021190chr11862 --11326 --
NM_021200chr1171115 951 944 745 219 107 70 ------
NM_021215chr202279 165 --12146 --
NM_021222chr121008 375 --11317 --
NM_021242chrX--1243 --1823
NM_021252chr101244 --31387 811 49 21467 1411
NM_021255chr1453694 3449 1449 1124 744 --13774 --
NM_021572chr61976 ------
NM_021622chr1052227 2093 910 887 38 --1412 --
NM_021629chr384863 4814 4808 4252 3563 1867 912 841 14745 1888 --
NM_021637chrX41378 1015 437 152 --1226 --
NM_021638chr474405 3984 1860 1832 823 653 55 --24529 288 --
NM_021643chr21730 --31752 609 360 --
NM_021647chr494734 4030 3394 3169 3158 2960 2907 1532 885 --11371 --
NM_021648chr63951 520 182 12255 ----
NM_021728chr142240 56 1268 ----
NM_021809chr2031678 1580 405 ----11689
NM_021813chr6104945 4853 3566 1612 1489 1419 1180 558 475 154 21035 514 34030 1530 1309 --
NM_021815chr242232 2090 1241 655 ------
NM_021907chr22108 97 ------
NM_021911chr552052 1938 1788 367 132 --15049 --
NM_021912chr1583325 3246 1532 1229 1186 978 888 862 --33105 521 454 --
NM_021914chr1442179 2006 1876 1674 1582 12192 1534
NM_021935chr3----11058 141
NM_021947chr171906 1853 ----
NM_021951chr91870 --2790 709 --
NM_021954chr1372970 2957 2764 1287 1184 929 343 --12442 13344
NM_021960chr122142 1812 --22656 654 --
NM_021961chr11146612 5201 2829 2692 2662 2421 2139 2117 1807 1728 1346 1118 744 666 --45896 5825 1332 1141 16837
NM_021964chr342506 1325 830 177 --31773 1557 326 --
NM_021988chr2041137 562 306 215 --11541 --
NM_021999chr13------1530
NM_022037chr21683 ------
NM_022048chr1576331 4690 1528 1041 1005 954 110 11367 21217 896 --
NM_022073chr1431525 131 122 11675 --1244
NM_022114chr1114630 3851 3843 3495 3454 3182 1892 1862 1023 967 113 14017 21490 1050 --
NM_022116chr72335 140 1787 ----
NM_022130chr551378 371 363 244 23 --11037 --
NM_022154chr4154 1299 1346 11150
NM_022166chr16105530 5162 4512 4382 2228 1950 1828 1773 1764 1701 12178 12326 --
NM_022170chr731709 1417 77 --31607 1152 175 --
NM_022173chr21683 ------
NM_022366chr11302 --182 --
NM_022373chr71787 ------
NM_022442chr2041137 562 306 215 --11541 --
NM_022458chr751974 995 418 252 60 --12648 --
NM_022459chr1395856 5584 5337 5210 5073 5009 4267 1615 1491 15733 35609 4156 1728 --
NM_022474chr1442746 2206 615 184 1959 11728 --
NM_022475chr43106 80 52 1602 ----
NM_022477chr205488 425 213 148 38 --2248 222 --
NM_022488chr3--125 ----
NM_022494chr102174 24 ------
NM_022495chr141493 2157 54 1186 --
NM_022496chr121393 ----1408
NM_022497chr322809 197 ----13611
NM_022648chr264562 4450 4183 1760 1555 1268 --1600 13303
NM_022650chr52902 110 --1397 --
NM_022716chr1112729 2589 2380 1934 1281 907 684 614 555 387 59 22196 771 --12400
NM_022719chr2243518 3173 2834 283 1726 32468 2454 464 --
NM_022726chr641292 1079 331 282 --11718 --
NM_022730chr21960 ------
NM_022737chr1951294 1269 490 465 62 ------
NM_022748chr772821 2105 2050 1135 1110 211 108 ------
NM_022763chr343018 2960 391 294 ------
NM_022766chr2232635 2334 2230 --1956 --
NM_022771chr122320 213 1388 ----
NM_022776chr3--2550 230 ----
NM_022781chr932753 2659 257 22695 2132 ----
NM_022802chr1051405 1210 1017 561 395 ------
NM_022818chr1621593 189 1271 ----
NM_022824chr541820 725 580 471 --11271 --
NM_022828chr53549 377 141 ------
NM_022831chr151814 1446 1368 380 336 ------
NM_022832chr442454 2403 815 556 --1957 --
NM_022841chr1522019 859 11820 ----
NM_022845chr1642160 613 447 33 11970 11579 --
NM_022893chr212670 12680 22561 493 --
NM_022894chr231616 1283 182 ------
NM_022898chr14103800 3556 3549 3459 3096 3085 1849 1832 889 858 --23161 1704 --
NM_022900chr72178 136 --11199 --
NM_022912chr262882 2820 1132 800 671 41 --13075 --
NM_022918chr113730 555 41 ------
NM_022977chrX22088 1686 1107 ----
NM_023010chrX1660 ------
NM_023039chr51319 ------
NM_023068chr2051166 382 359 352 124 11582 21035 308 --
NM_023112chr144537 327 63 50 --12983 --
NM_023929chr821083 321 --12097 --
NM_023943chr3----1147 --
NM_024007chr51780 1977 12794 12177
NM_024019chr42911 181 --11082 --
NM_024052chr1752622 2506 2414 2270 969 ------
NM_024054chr71336 ------
NM_024085chr21705 ------
NM_024090chr441950 1357 630 585 ------
NM_024094chr8--1129 ----
NM_024117chr931301 1272 441 11215 ----
NM_024122chrX1241 2176 24 ----
NM_024312chr123635 254 119 --11568 --
NM_024315chr7--1313 --1164
NM_024325chr2031284 1066 311 ------
NM_024345chr9106097 5915 5706 4497 2011 1315 738 724 489 208 ----13925
NM_024408chr193712 3630 3287 2864 1154 897 548 386 360 23183 1086 42610 2324 452 314 --
NM_024415chr5--1231 194 --
NM_024430chr1831297 310 218 --11677 11762
NM_024524chr353171 3157 3094 1201 824 1177 11958 --
NM_024539chrX21192 249 ------
NM_024545chr23748 519 148 --1690 --
NM_024557chr1131381 1369 147 --1590 --
NM_024563chr541945 634 604 598 ----11393
NM_024569chr182775 2505 2113 1823 792 380 258 66 12021 22965 99 --
NM_024581chr6--1169 ----
NM_024612chr1711082 ------
NM_024624chr22127 99 ----1411
NM_024645chr821223 605 --1420 --
NM_024646chr133043 814 500 14012 1242 --
NM_024665chr334624 1079 589 --14185 --
NM_024669chr51418 2453 110 ----
NM_024699chr82694 321 ------
NM_024704chr201743 --21035 714 --
NM_024713chr1531262 195 43 --1663 --
NM_024740chr1143865 1659 270 34 --1976 --
NM_024744chr252197 1673 1046 566 309 --12184 --
NM_024749chr141996 1915 1677 65 32238 1951 1856 ----
NM_024761chr9144897 4697 4570 4297 4224 4050 3364 2033 1757 1578 1230 1186 1057 147 --24088 1242 --
NM_024769chr111726 1214 1871 --
NM_024770chr2156638 6009 5709 5653 5592 5269 4578 4286 4220 4167 2438 1519 1396 1004 237 25479 5464 11071 --
NM_024779chr1251493 1327 1315 1159 144 --11557 --
NM_024785chr23486 188 79 ------
NM_024812chr841505 1443 741 549 12147 ----
NM_024817chr1574159 2354 1878 1837 617 504 466 15418 ----
NM_024854chr1241550 1436 1412 349 --21284 1041 --
NM_024896chr9--1724 ----
NM_024913chr741327 678 453 422 11460 ----
NM_024930chr522382 1065 --12765 --
NM_024939chr1641216 1159 260 154 --137 --
NM_024946chr1651786 1692 1541 1228 105 ----1412
NM_024947chr3178751 8377 7917 7799 7734 7017 6642 6533 3740 3490 3258 2649 2359 1533 1287 1113 701 26045 2597 37990 3592 2721 22266 806
NM_024949chr414308 21854 1735 --13770
NM_024953chr1241826 643 74 54 1651 1295 --
NM_024969chr21821 ------
NM_024989chr287169 6417 5404 5093 1876 1395 560 363 ------
NM_025054chr864023 3687 1449 1162 1115 529 33493 3370 1618 ----
NM_025057chr1451266 1098 494 329 213 --11174 1252
NM_025073chr143715 3565 3148 298 23596 823 11472 1839
NM_025134chr1622328 618 --12166 22093 665
NM_025146chr352740 2385 1096 765 532 ------
NM_025151chr831859 378 193 ------
NM_025160chr174027 3423 3404 3315 3077 332 262 11265 23498 3151 --
NM_025164chr1182052 1673 1631 892 885 824 523 245 ------
NM_025176chr202463 104 --140 --
NM_025179chr1134562 4414 4408 4184 3891 3218 3031 1984 1243 795 465 213 124 --24518 3501 --
NM_025182chr9145 156 ----
NM_025184chrX1775 1212 ----
NM_025187chr1661338 1298 1263 1109 471 193 --151 --
NM_025191chr142533 2358 456 439 --23267 846 170
NM_025194chr1921292 1178 ------
NM_025195chr841465 439 427 267 ----1295
NM_025201chr1552054 1925 1662 377 161 ------
NM_025219chr2062019 1758 882 863 546 273 ------
NM_025222chr351221 1105 362 306 148 --1113 --
NM_025235chr1072237 2208 1718 1472 1385 718 95 1524 1147 --
NM_025238chr1531598 1093 259 --121 --
NM_030579chr1653606 3467 3460 107 31 13513 1358 --
NM_030621chr1431275 1227 729 ------
NM_030625chr1072534 2090 2073 807 740 719 417 --2913 473 --
NM_030627chr541602 1147 488 59 --11491 1946
NM_030634chr172367 1788 979 947 616 525 332 12466 1469 --
NM_030637chr142672 450 ------
NM_030647chr7106346 6316 6048 5520 4501 2521 1690 701 662 24 21943 1312 34743 4594 4044 --
NM_030648chr475338 5228 4863 3855 2154 1964 288 --34777 445 110 22189 209
NM_030650chr273685 3284 3108 2916 1489 325 146 1268 23221 2864 --
NM_030660chr1421358 47 --11058 --
NM_030674chr1264576 1935 1881 637 357 25 --25107 658 --
NM_030755chr1482774 2190 1924 1149 1016 915 851 142 1998 22294 2021 --
NM_030780chr841453 1390 1322 597 ------
NM_030786chr141668 454 332 127 --21751 1451 --
NM_030803chr22917 386 --11243 --
NM_030806chr1159207 9168 8945 8737 6339 6260 3451 3435 3406 3318 3264 2353 2333 1820 1595 21390 1013 26307 2308 1947
NM_030809chr1241663 713 425 33 ------
NM_030816chr173398 3216 2563 2411 2338 1307 434 --11472 --
NM_030821chr41761 ------
NM_030881chr2232454 2342 706 11696 11635 --
NM_030884chr331620 486 480 --1883 --
NM_030885chr32919 338 --11728 12366
NM_030918chr164986 4572 4442 4294 855 594 14745 34545 1682 37 --
NM_030920chr11756 11864 159 --
NM_030978chr9183 --1392 --
NM_031157chr12------1595
NM_031203chr191214 ------
NM_031217chr11--1106 ----
NM_031262chr9271 33 ------
NM_031263chr92128 90 ------
NM_031266chr5--1119 ----
NM_031267chr7----1213 --
NM_031362chr262269 1752 1133 804 393 196 --12750 --
NM_031365chr252405 1888 940 529 332 1100 22886 1848 --
NM_031366chr252405 1888 940 529 332 1100 22886 1848 --
NM_031372chr431182 468 48 ------
NM_031407chrX2178 146 ------
NM_031419chr31232 ----11322
NM_031426chr942634 2100 564 341 --11021 --
NM_031427chr14115849 5830 5515 3898 3766 2340 1973 1381 680 137 131 ----1202
NM_031431chr1351508 1421 687 568 101 --1539 --
NM_031435chr1263413 3392 3202 394 39 32 1361 23061 3016 --
NM_031442chrX73083 2610 2246 2222 539 172 63 1427 12097 --
NM_031445chr243221 2526 2398 661 --22945 995 --
NM_031453chr1042291 2013 684 623 1948 2874 706 --
NM_031461chr852310 1863 761 666 580 --11938 --
NM_031468chr7167978 7956 7916 7412 6548 6389 5640 5351 3106 3022 2462 2183 2063 845 395 307 25711 1054 --11499
NM_031479chr1211143 ------
NM_031483chr2032441 1254 1166 13136 33250 342 75 --
NM_031844chr164079 3432 1337 898 486 91 --23600 3151 --
NM_031845chr243144 2957 645 86 --32329 2290 328 --
NM_031847chr243144 2957 645 86 --32329 2290 328 --
NM_031866chr1021065 831 ------
NM_031889chr461940 1851 1535 594 568 22 1378 21509 1269 150
NM_031953chr4----1364 --
NM_031992chr731709 1417 77 --31607 1152 175 --
NM_032012chr964846 4707 4405 1809 1439 1373 --13730 --
NM_032013chr205488 425 213 148 38 --2248 222 --
NM_032017chr121954 843 1535 ----
NM_032025chr31569 1194 32048 370 50 --
NM_032042chr541895 1088 406 135 1487 ----
NM_032047chr332322 622 574 ----11680
NM_032052chr223544 335 194 ------
NM_032088chr521158 320 ------
NM_032092chr521158 320 ------
NM_032102chr1132548 801 80 1175 --11947
NM_032109chr551376 1236 1083 484 132 ------
NM_032116chr1395529 5449 5309 4742 3922 2350 2204 1288 429 1741 25237 1397 11044
NM_032121chrX72610 977 546 486 457 442 210 --12585 --
NM_032139chr195700 378 329 245 75 --1788 --
NM_032144chr22513 358 ------
NM_032153chr332144 849 119 ------
NM_032154chr103700 387 294 ------
NM_032182chr1031602 1119 465 ------
NM_032195chr211101 ------
NM_032199chr101290 11410 11359 1753
NM_032221chr2042041 1253 684 228 --11725 --
NM_032228chr1143498 3475 519 28 1107 ----
NM_032233chr143718 349 192 ------
NM_032246chr15------1297
NM_032293chr92283 26 ------
NM_032325chr113774 649 66 --31902 795 87 --
NM_032328chr1------172
NM_032352chr1411008 --11251 --
NM_032373chr1055232 4297 1884 531 192 35136 4361 3800 --25565 607
NM_032403chr521158 320 ------
NM_032408chr721127 995 --2462 441 --
NM_032433chr1951545 1140 1020 240 70 ------
NM_032438chr661636 1541 1474 666 212 32 ------
NM_032439chr1011332 11209 ----
NM_032440chr1021869 156 1448 ----
NM_032458chrX53330 2645 2574 374 322 ------
NM_032471chr61360 --1930 --
NM_032486chr1642166 1636 491 102 11919 ----
NM_032505chr352554 1848 464 162 40 ------
NM_032521chr2042746 1988 976 642 --22455 278 --
NM_032523chr21131 --136 --
NM_032532chr63610 257 142 ----1503
NM_032547chr441371 1146 930 396 ------
NM_032557chr41355 ------
NM_032559chr17------1116
NM_032560chr14----1454 --
NM_032569chr16186 ----11271
NM_032578chr1031223 1184 1117 --1567 --
NM_032590chr122408 257 ----1457
NM_032595chr1721056 502 ------
NM_032603chr21627 --1724 --
NM_032632chr1431504 530 288 11449 11628 --
NM_032682chr363453 3250 3017 2653 825 783 13474 22288 902 11083
NM_032689chr1941155 1131 474 326 --1349 --
NM_032701chr192560 543 ------
NM_032741chr63389 312 39 ------
NM_032765chr51802 --1181 --
NM_032778chr353273 3148 2706 2457 466 ----1672
NM_032784chr62299 124 --2315 248 --
NM_032786chr121204 ------
NM_032804chr1042100 806 651 582 2318 279 11822 --
NM_032813chr1341119 904 792 769 --1753 --
NM_032828chr1954508 4490 1594 435 37 ------
NM_032833chr172506 2026 910 720 700 166 151 --12127 --
NM_032837chr1722087 275 ------
NM_032838chr191829 --2433 376 --
NM_032846chr1421368 216 1534 --1352
NM_032866chr1583025 2525 2393 2034 2015 633 546 146 12667 13148 --
NM_032870chr61497 ------
NM_032892chr151257 ------
NM_032895chr173801 607 270 ------
NM_032900chr1053946 3843 3306 3084 855 ------
NM_032918chr1241323 805 291 86 ------
NM_032947chr541173 855 796 89 1234 159 --
NM_032961chr411190 --1529 --
NM_032978chr181925 --1200 --
NM_032979chr181925 --1200 --
NM_032981chr181925 --1200 --
NM_033020chr143371 3364 3207 1112 14025 2181 101 --
NM_033025chr192983 245 ------
NM_033027chr31771 ------
NM_033055chr121043 73 --1261 --
NM_033056chr10----1596 --
NM_033081chr2031279 503 343 --1162 --
NM_033083chr383302 2678 2595 2558 2275 2226 1260 205 --11060 --
NM_033089chr202382 124 ------
NM_033105chr81107 ------
NM_033117chr91356 ----1286
NM_033132chr1321606 1456 1705 --21426 59
NM_033133chr1763186 2755 2683 1190 942 795 ------
NM_033141chr1411924 --12067 --
NM_033143chr494182 4175 3909 3766 3294 3223 1736 1249 362 14094 ----
NM_033147chr22108 97 ------
NM_033148chr22108 97 ------
NM_033181chr653923 3015 1362 847 185 13509 --13389
NM_033211chr51291 1197 ----
NM_033224chr776268 6081 5849 3195 2115 1402 337 --31751 1380 1112 --
NM_033225chr842298 2284 971 770 --22712 2012 --
NM_033285chr833767 3569 338 --11643 --
NM_033290chrX52417 1057 854 412 398 --23020 1185 13339
NM_033326chr1141626 1578 914 884 1647 1373 --
NM_033389chr1774392 4310 3997 3687 3621 1079 798 13215 ----
NM_033401chr162474 122 1192 ----
NM_033426chr1451848 1055 922 708 480 11037 12102 --
NM_033429chr1562929 2609 2580 2524 1190 460 ------
NM_033430chr453205 1640 1496 1172 230 --23518 432 --
NM_033437chr453205 1640 1496 1172 230 --23518 432 --
NM_033450chr6--1299 2305 86 --
NM_033480chr633032 2146 924 1381 12601 --
NM_033481chr633032 2146 924 1381 12601 --
NM_033495chrX2412 199 1317 ----
NM_033502chr6148 ------
NM_033535chr4--11065 ----
NM_033551chr582345 2331 1218 1117 1065 751 580 193 22675 1239 22512 1148 1230
NM_033624chr122693 322 1527 1280 --
NM_033631chr193862 3274 2509 2442 1261 872 420 273 59 ------
NM_033632chr421355 1059 11408 1633 --
NM_033637chr1053698 3058 2622 1166 986 11099 12858 --
NM_033644chr52476 402 11952 ----
NM_033645chr52476 402 11952 ----
NM_033656chr2155867 4309 2020 1088 1038 24829 3865 35856 2037 291 14886
NM_033666chr102957 142 1133 1640 --
NM_052821chr92713 443 --21944 1601 --
NM_052840chr151480 --11183 --
NM_052851chr1332209 372 203 1964 11754 --
NM_052875chr1142103 602 323 234 --21952 415 11846
NM_052877chr13431 82 28 ------
NM_052879chr1263866 3200 3136 2883 767 118 --24057 357 11621
NM_052885chr1254509 3977 1729 1582 303 14815 13871 --
NM_052886chr841975 1461 210 97 ----32010 1809 1707
NM_052898chr831284 501 31 180 1697 --
NM_052905chr241656 1589 731 422 --11165 1574
NM_052907chr1264333 4042 3803 3596 3528 446 14188 ----
NM_052910chr1351996 1773 1688 369 363 11796 146 --
NM_052911chr183926 733 34 ------
NM_052927chr5--22195 1581 2726 548 --
NM_052928chr1741681 1378 453 181 ------
NM_052965chr12139 71 ------
NM_052978chr1451597 603 297 76 44 ------
NM_053002chr31134 179 ----
NM_053016chr9117484 7169 6532 5281 2822 2373 1829 1569 1063 918 196 --27643 5584 27593 2421
NM_053023chr1152928 2790 2718 2231 552 ------
NM_053024chr321482 1046 ----11381
NM_053035chr7193 ----1183
NM_053042chr431243 520 416 --12883 --
NM_053043chr756195 5539 5052 3974 1136 --34451 885 220 --
NM_053056chr1172887 2807 1218 1105 949 403 120 ------
NM_053064chr1441221 795 616 116 --1185 11116
NM_054025chr1142009 1561 1368 53 --11948 --
NM_054033chr21101 ------
NM_057159chr931329 204 32 ------
NM_057175chr421757 147 32362 902 253 --11854
NM_057178chr1742535 2003 804 421 ------
NM_058170chr111615 ----1187
NM_058240chr143442 328 279 ------
NM_080552chr203709 587 116 ------
NM_080599chr1031078 429 92 --11103 --
NM_080626chr12----1335 --
NM_080632chrX1660 ------
NM_080645chr621875 818 ------
NM_080669chr1744731 4301 3013 1569 ----1925
NM_080676chr2062758 2080 702 325 249 235 11222 1931 --
NM_080737chrX21207 969 ------
NM_080738chr161634 1329 393 309 248 194 ------
NM_080743chr642502 2205 623 540 --1554 --
NM_080759chr1342431 1703 524 56 ------
NM_080760chr1342431 1703 524 56 ------
NM_080764chr2252635 2114 1013 945 192 1951 12718 --
NM_080798chr10--1102 ----
NM_080799chr10--1102 ----
NM_080800chr10--1102 ----
NM_080801chr10--1102 ----
NM_080802chr10--1102 ----
NM_080803chr10--1102 ----
NM_080804chr10--1102 ----
NM_080805chr10--1102 ----
NM_080806chr10--1102 ----
NM_080807chr10--1102 ----
NM_080808chr10--1102 ----
NM_080809chr10--1102 ----
NM_080810chr10--1102 ----
NM_080811chr10--1102 ----
NM_080812chr10--1102 ----
NM_080813chr10--1102 ----
NM_080814chr10--1102 ----
NM_080815chr10--1102 ----
NM_080832chrX21826 440 1707 1218 --
NM_080867chr1454584 1923 1854 770 680 11314 11272 --
NM_080927chr372441 2166 1032 692 650 525 161 1539 ----
NM_130391chr972752 1299 1172 1032 905 805 47 23314 311 ----
NM_130392chr972752 1299 1172 1032 905 805 47 23314 311 ----
NM_130393chr972752 1299 1172 1032 905 805 47 23314 311 ----
NM_130435chr1062917 2692 2529 902 819 207 ------
NM_130436chr2152226 564 260 227 204 11961 --12338
NM_130438chr21112803 2092 2072 1141 837 804 781 495 438 256 34 12538 1290 22915 2103
NM_130439chr1041734 713 671 318 1764 1943 --
NM_130439chr1041734 713 671 318 1764 1943 --
NM_130442chr751153 937 175 123 93 1300 21137 456 --
NM_130768chr71259 --197 137
NM_130830chr351432 1303 1060 1052 61 13624 ----
NM_130831chr342216 1064 701 37 11944 --1207
NM_130832chr342216 1064 701 37 11944 --1207
NM_130833chr342216 1064 701 37 11944 --1207
NM_130834chr342216 1064 701 37 11944 --1207
NM_130835chr342216 1064 701 37 11944 --1207
NM_130836chr342216 1064 701 37 11944 --1207
NM_130837chr342216 1064 701 37 11944 --1207
NM_130838chr15--11795 11389 --
NM_130839chr15--11795 11389 --
NM_133265chrX83593 3286 2528 2362 1196 1161 673 445 --12337 --
NM_133329chr241568 445 128 108 2731 342 ----
NM_133334chr475623 4452 2461 2259 2105 527 203 21822 1046 14410 12010
NM_133370chr423427 3184 1302 23249 3207 --
NM_133433chr51837 --172 --
NM_133445chr963779 2444 1456 1094 888 618 --22521 472 --
NM_133476chr124932 353 338 154 ------
NM_133486chrX----1384 --
NM_133493chr663934 3148 1549 1051 945 360 34246 2905 1796 1746 --
NM_133496chr1104476 4165 3850 3608 3292 3256 3140 1415 1261 351 --11025 --
NM_133499chrX2755 340 ------
NM_133503chr122525 204 --1623 --
NM_133504chr122525 204 --1623 --
NM_133505chr122525 204 --1623 --
NM_133506chr122525 204 --1623 --
NM_133647chr1581444 1279 1038 1023 678 619 593 473 1432 43637 3329 999 51 --
NM_134260chr15----1122 --
NM_134261chr15----1122 --
NM_134262chr15----1122 --
NM_134268chr1771154 1132 1126 1120 1114 1108 393 ------
NM_134325chr141798 1595 671 554 1370 11113 --
NM_134442chr221220 635 --1482 --
NM_138270chrX43415 857 821 382 --13132 --
NM_138285chr22504 446 ------
NM_138288chr1431912 405 153 ------
NM_138289chrX----126 --
NM_138316chr10----11043 --
NM_138326chr21169 ----1128
NM_138328chr1743085 1231 1003 889 11248 13364 --
NM_138333chr942474 2343 1886 1696 --22250 241 --
NM_138338chr2232097 693 576 ----12592
NM_138341chr12121 ----180
NM_138357chr1061661 1350 1225 655 522 317 --11263 --
NM_138423chr1511522 154 --11651
NM_138426chr741817 905 651 61 12341 1659 --
NM_138444chr1344986 4535 1809 109 13415 --11698
NM_138459chr643643 1312 574 475 ------
NM_138468chr276068 4717 4484 4453 1442 953 706 --1175 --
NM_138473chr1284976 4778 4720 1495 1300 1233 732 490 ----13365
NM_138479chr13796 220 113 1554 12016 --
NM_138559chr221093 61 ----1353
NM_138576chr14103800 3556 3549 3459 3096 3085 1849 1832 889 858 --23161 1704 --
NM_138638chr1442179 2006 1876 1674 1582 12192 1534
NM_138694chr643029 2288 452 340 12334 12447 --
NM_138701chr71246 --145 --
NM_138713chr16127985 7386 6981 6058 5501 3221 2519 2510 1612 1518 1297 936 27456 5882 33186 771 196 1544
NM_138714chr16127985 7386 6981 6058 5501 3221 2519 2510 1612 1518 1297 936 27456 5882 33186 771 196 1544
NM_138727chr152143 1673 900 879 452 ----1472
NM_138728chr152143 1673 900 879 452 ----1472
NM_138731chr1473211 1294 1271 1219 609 129 38 13393 11531 --
NM_138735chr251191 1179 1078 576 228 ------
NM_138771chr731015 566 400 ----149
NM_138782chr522336 49 --11672 --
NM_138799chr21548 ----11707
NM_138811chr721032 260 ------
NM_138931chr32961 389 ------
NM_138959chr1186634 5964 5942 5189 5174 4989 4917 4339 2411 2206 1507 1352 1239 713 509 424 207 136 22579 2028 44519 4319 1680 390 --
NM_138970chr1412297 ------
NM_138971chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_138971chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_138972chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_138972chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_138973chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_138973chr1173462 3426 2396 1434 1421 1117 700 13439 --1931
NM_138994chr162474 122 1192 ----
NM_138995chr24849 518 444 43 ----1159
NM_139035chrX1200 ------
NM_139048chr32204 176 ----1107
NM_139057chr1562242 2129 1059 944 890 378 --12515 --
NM_139071chr1231213 1156 165 --11177 --
NM_139072chr2----1567 --
NM_139168chr531325 216 151 ------
NM_139207chr1232034 2025 697 12197 ----
NM_139244chr62959 735 --166 --
NM_139279chr252827 2466 1109 947 186 1598 22912 1301 --
NM_139281chr573619 3549 3410 3220 2209 1338 634 12331 ----
NM_139316chr72991 375 ------
NM_139321chr2063836 3621 2645 2594 1219 383 --23430 867 13893
NM_144571chr486236 5917 5848 5545 4609 2515 2025 90 --36634 4549 1625 --
NM_144574chr141231 --1636 --
NM_144578chr14105559 5498 4167 3934 3434 3418 1662 1235 969 584 14362 ----
NM_144595chr13----2363 199 --
NM_144599chr15104959 4437 4322 4216 4002 3441 1632 1292 472 197 11546 21299 830 --
NM_144632chr231957 467 455 ------
NM_144633chr321339 389 --21475 598 --
NM_144664chr1152544 2481 2014 222 173 ------
NM_144709chr22156 53 --1314 --
NM_144723chr54696 358 346 309 ------
NM_144732chr191689 ------
NM_144775chr1711778 --24896 3777 --
NM_144778chr1352484 2197 1918 1846 74 ------
NM_144949chr221016 619 11901 --11642
NM_144963chr842210 635 474 86 --12310 1178
NM_144982chr12--1505 1143 --
NM_145025chr63972 292 171 ------
NM_145044chr321513 1425 ----11140
NM_145052chrX2978 423 ------
NM_145055chr1863694 3076 3003 2954 965 51 1431 ----
NM_145117chr1193157 2369 1164 1042 707 377 166 139 56 --12356 --
NM_145203chr13165 ----1705
NM_145206chr1052986 2350 883 804 79 --13088 --
NM_145234chrX2951 183 ------
NM_145235chr10----1145 --
NM_198503chr121833 883 ------
NM_198507chr51159 ------
NM_198513chr821609 243 11552 2746 628 --
NM_198521chr12139 ------
NM_198549chr11320 12786 ----
NM_198562chr31613 --1239 12077
NM_198581chr297078 6946 5836 4869 4815 2829 1782 1136 1026 --22254 1455 --
NM_198595chr474405 3984 1860 1832 823 653 55 --24529 288 --
NM_198597chr1031031 758 162 1213 ----
NM_198679chr942656 2577 1065 983 ------
NM_198793chr382938 2701 1303 1172 1091 624 601 551 13683 12536 13550
NM_198829chr72921 292 ----1224
NM_198859chr384906 4646 4569 3214 1559 712 514 321 23939 700 ----
NM_198880chr31171 1464 ----
NM_198896chr112661 509 ------
NM_198900chr1276004 5585 5492 4901 2455 2364 2206 25651 565 14981 26805 5520
NM_198904chr562152 1596 1423 526 324 249 1625 ----
NM_198989chr132232 218 --1407 --
NM_199000chr762215 1810 1767 1617 1581 145 1494 1729 --
NM_199040chr1233832 1017 76 ----1739
NM_199051chr1----1299 1232
NM_199072chr712780 ------
NM_199144chr2041137 562 306 215 --11541 --
NM_199168chr1031072 348 342 ----11511
NM_199169chr2073516 3356 3260 2928 2702 2303 2293 --23612 2475 --
NM_199170chr2073516 3356 3260 2928 2702 2303 2293 --23612 2475 --
NM_199171chr2073516 3356 3260 2928 2702 2303 2293 --23612 2475 --
NM_199188chr1263866 3200 3136 2883 767 118 --24057 357 11621
NM_199190chr1263866 3200 3136 2883 767 118 --24057 357 11621
NM_199203chr2041137 562 306 215 --11541 --
NM_199205chr8125 --1229 --
NM_199324chr412995 13005 11150 11144
NM_199414chr152919 35 --1442 --
NM_199421chr1454584 1923 1854 770 680 11314 11272 --
NM_199436chr21998 13113 ----
NM_199437chr1162508 2476 2386 2081 784 169 --11010 11670
NM_199438chr1162508 2476 2386 2081 784 169 --11010 11670
NM_199439chr1162508 2476 2386 2081 784 169 --11010 11670
NM_199454chr1114630 3851 3843 3495 3454 3182 1892 1862 1023 967 113 14017 21490 1050 --
NM_199478chrX2746 467 176 ----
NM_199482chr221960 1423 11383 --1415
NM_201267chr23244 160 111 ------
NM_201413chr21----11110 --
NM_201414chr21----11110 --
NM_201428chr1151456 1378 1372 1365 146 11305 ----
NM_201429chr1151456 1378 1372 1365 146 11305 ----
NM_201430chr1151382 1304 1298 1291 72 11231 ----
NM_201559chr674747 4714 4624 3923 626 466 335 --11114 --
NM_201568chr142082 2016 1916 1586 --1461 --
NM_201569chr142082 2016 1916 1586 --1461 --
NM_201570chr103745 708 61 21590 752 ----
NM_201571chr103745 708 61 21590 752 ----
NM_201572chr103745 708 61 21590 752 ----
NM_201590chr103745 708 61 21590 752 ----
NM_201591chr4----1478 --
NM_201592chr4----1478 --
NM_201593chr103745 708 61 21590 752 ----
NM_201596chr103745 708 61 21590 752 ----
NM_201597chr103745 708 61 21590 752 ----
NM_201599chrX31025 96 21 --11009 --
NM_201999chr411207 --1314 --
NM_203282chr1941692 1480 1225 133 ----1357
NM_203288chr7----126 --
NM_203301chr1461166 695 475 427 418 382 11487 ----
NM_203327chr2094096 4089 3692 3584 3536 3079 1360 974 616 14206 21568 105 --
NM_203341chr12284 99 --1757 1960
NM_203346chr221963 1522 --21909 370 --
NM_203351chr1732111 1849 1802 ------
NM_203364chr1121091 79 ------
NM_203372chr221142 1077 ------
NM_203390chr81185 --11862 1739
NM_203391chrX2691 222 --2498 281 --
NM_203394chr1252407 2081 1099 348 83 ------
NM_203399chr13833 245 46 ------
NM_203401chr13833 245 46 ------
NM_203403chr96950 866 412 389 195 49 2956 890 --1506
NM_203406chr552830 1021 491 228 50 ----1815
NM_203413chr172963 24 --1833 --
NM_203446chr2152553 2158 2131 1914 457 --23000 2989 --
NM_203454chr161036 968 936 899 865 316 ------
NM_203458chr153852 3806 3729 3380 1091 23059 1015 1599 --
NM_203459chr1253 30 --2644 177 --
NM_203463chr264620 4550 1908 1756 1550 182 23344 3136 ----
NM_203464chr11108 11238 ----
NM_203486chr19------1158
NM_203487chr1321750 352 --21402 1213 --
NM_203504chr472511 2473 2436 544 510 129 57 11685 ----
NM_203505chr472511 2473 2436 544 510 129 57 11685 ----
NM_203506chr1732051 1593 273 12095 ----
NM_205768chr131973 268 169 --11943 --
NM_205841chr5----1178 --
NM_205852chr1241707 1649 1429 234 1877 ----
NM_206594chr173472 2579 512 378 305 203 28 12976 ----
NM_206595chr173472 2579 512 378 305 203 28 12976 ----
NM_206853chr623454 796 --11444 --
NM_206854chr644715 3702 2057 1098 ------
NM_206855chr645680 4667 2063 265 --14100 --
NM_206876chr252737 2709 2455 489 286 --33024 2883 252 --
NM_206907chr533192 795 490 ------
NM_206909chr855338 5283 2818 2462 1963 25360 3320 26531 877 --
NM_206914chr1231382 335 38 11942 ----
NM_206996chr11352 ------
NM_207012chr1042247 1318 876 591 --13478 --
NM_207032chr2031464 467 113 --1518 --
NM_207033chr2031372 375 21 --1426 --
NM_207034chr2031372 375 21 --1426 --
NM_207043chr142209 1896 1497 370 --12240 --
NM_207044chr142209 1896 1497 370 --12240 --
NM_207047chr142209 1896 1497 370 --12240 --
NM_207113chr731412 470 257 ------
NM_207170chr11781 1661 1162 1251
NM_207171chr131683 1327 810 ------
NM_207299chr9140 ------
NM_207303chr1083265 2922 2916 1096 984 664 615 326 11646 23539 1443 11243
NM_207304chr1342371 2084 1805 1733 ------
NM_207321chr1031001 430 316 --1765 1964
NM_207337chr121737 182 1191 --
NM_207372chr1062439 618 527 368 153 41 1709 ----
NM_207404chr342278 1884 1849 1777 21445 575 22202 1495 --
NM_207406chr4146429 5935 5228 5099 4126 4101 3993 2096 2084 1391 693 561 226 97 11929 55522 1882 1279 415 116 --
NM_207413chr8135 ----1322
NM_207418chr1_random31029 698 345 ------
NM_207422chrX31010 493 202 1959 11184 --
NM_207481chr22489 274 --21166 161 --
NM_207517chr1552029 1920 1684 586 304 --11411 1359
NM_207520chr22317 33 1193 ----
NM_207521chr22317 33 1193 ----
NM_207645chr113324 43 28 ------
NM_212460chr7----1347 --
NM_212471chr1732038 754 501 --1851 --
NM_212472chr1732038 754 501 --1851 --
NM_212543chr3----1675 --
NM_212551chr12283 121 1759 1265 --
NM_212558chr9103460 3259 3222 3123 3090 2784 1345 1320 862 723 13423 --11196
NM_213606chr1011856 11090 --22572 2425
NM_213609chr3169 ----1162