TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1267
miRNA Sequence: CCUGUUGAAGUGUAAUCCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr274503 3983 3388 3334 1312 783 464 11028 2588 351 --
NM_000109chrX52672 2543 1908 383 250 ----11766
NM_000115chr1382558 2264 2126 1690 638 269 257 142 32247 686 580 ----
NM_000138chr1582563 2156 2129 2074 1866 1856 1066 862 --12395 11919
NM_000176chr563560 2629 2604 1414 1304 525 1175 1829 --
NM_000202chrX3498 161 137 11409 11187 --
NM_000210chr252382 1942 1784 1563 877 3797 681 552 --21489 650
NM_000217chr12104100 4039 3776 3378 3274 2087 1700 1364 1111 925 35002 3491 1223 13479 --
NM_000259chr1596224 5910 5877 5076 4643 4046 2456 2334 1908 --15660 15404
NM_000314chr1063242 3129 2602 978 839 86 1430 11163 --
NM_000332chr6117206 6053 5548 4415 2669 2328 1249 1172 524 223 145 34668 2799 953 --14602
NM_000337chr5145951 5436 5410 5359 4501 4323 2115 1946 1692 1427 1244 768 752 662 ------
NM_000346chr174782 646 534 278 --11733 --
NM_000368chr974719 3301 3258 1304 576 559 546 33467 1624 983 ----
NM_000393chr292123 1910 1614 1403 761 226 220 121 22 21814 1671 ----
NM_000397chrX42274 883 608 554 --12343 11945
NM_000408chr253218 2321 1377 1251 116 --1736 --
NM_000448chr1173282 3231 2288 1308 1147 711 212 11137 ----
NM_000461chr384669 3634 3607 3344 3227 1780 1318 321 1930 11827 21260 415
NM_000489chrX52922 2108 1369 1019 917 ----178
NM_000555chrX137776 7073 6273 5462 5258 2670 2655 2395 2388 1340 944 734 82 15400 37129 1192 867 25848 1165
NM_000610chr1142976 2721 2032 225 ----32277 489 75
NM_000618chr1284104 2449 1912 1544 971 544 383 236 ------
NM_000618chr1284104 2449 1912 1544 971 544 383 236 ------
NM_000663chr1673045 2709 2501 2199 2184 1131 43 21895 887 --22627 2601
NM_000719chr1256744 4910 4643 2281 1518 16186 12554 1935
NM_000724chr1051845 1472 351 151 56 ----1668
NM_000793chr1464560 4465 3594 1255 269 144 34493 4443 4363 13861 24327 83
NM_000806chr531387 527 62 ----21651 759
NM_000809chr4118738 8690 7596 7382 6099 3358 3084 1816 1449 976 216 28059 6547 1610 1524
NM_000813chr5105578 5140 4974 4372 3661 3613 3568 1641 1456 734 14179 22185 326 14101
NM_000814chr1543519 2981 153 37 1894 --12775
NM_000827chr552475 2123 2117 1604 942 --42423 2406 879 138 --
NM_000860chr461600 1564 1104 1094 428 268 ------
NM_000861chr332286 934 492 22664 171 1590 21877 188
NM_000866chr35747 707 628 349 287 21834 1197 ----
NM_000868chrX72031 1659 1636 880 857 642 408 12493 1439 --
NM_000875chr15166136 6080 5545 5357 5249 4844 4622 4263 2693 2682 2324 1788 1070 801 189 78 21894 274 35581 5331 2364 16028
NM_000876chr641451 1442 1365 457 ----1105
NM_000877chr222447 947 33009 2304 490 1169 13072
NM_000899chr1254225 3960 2691 1395 48 ------
NM_000901chr462281 1915 530 424 277 85 1509 1115 --
NM_000912chr863579 3110 2767 955 640 305 1445 11144 --
NM_000965chr331239 1024 149 ----11116
NM_001001323chr1222168 306 22977 219 --1399
NM_001001389chr1142976 2721 2032 225 ----32277 489 75
NM_001001390chr1142976 2721 2032 225 ----32277 489 75
NM_001001391chr1142976 2721 2032 225 ----32277 489 75
NM_001001392chr1143022 2767 2078 271 ----32323 535 121
NM_001001481chr883111 2995 2222 2155 1147 909 557 372 --23058 545 --
NM_001001664chr234113 3431 3217 ----13110
NM_001001890chr2153884 3495 2733 1457 1087 23005 1251 ----
NM_001001928chr22147543 6461 6089 5310 3227 3149 2946 2818 2664 2460 2285 1496 428 418 16438 22710 2658 33027 2996 662
NM_001001995chrX61854 1779 1769 1593 713 605 1700 ----
NM_001002814chr883517 2943 2519 944 888 329 231 94 13360 13531 --
NM_001002909chr1732055 1731 1676 12198 --1604
NM_001002926chr71499 151 12781 12813
NM_001003652chr18148079 7692 7174 5888 5685 5450 5259 3181 2281 1843 1745 1645 1636 291 36270 5504 1915 48660 5960 1076 892 11205
NM_001003674chr18116871 6847 5669 5499 5248 5207 4841 4516 1667 1202 982 15567 36799 4379 1153 35092 4873 2825
NM_001003675chr18116871 6847 5669 5499 5248 5207 4841 4516 1667 1202 982 15567 36799 4379 1153 35092 4873 2825
NM_001003679chr13611 135 51 --32119 1449 1361 --
NM_001003760chr683674 3659 3550 3052 2792 2680 516 95 --12275 --
NM_001003792chr31423 21100 396 --1367
NM_001003793chr31423 21100 396 --1367
NM_001003800chr962814 2688 843 417 355 59 21076 275 22278 151 12562
NM_001004317chr694176 4054 3249 3205 1761 1689 1185 899 221 --13884 --
NM_001004329chr1241074 561 538 242 1977 21442 552 --
NM_001004342chr175734 4226 3876 3692 2219 942 290 36123 4280 4104 24938 1687 15776
NM_001004419chr1274509 2808 1487 1202 840 190 168 13513 ----
NM_001005463chr1052203 1977 1950 663 173 12145 22273 112 --
NM_001005609chrX43743 2717 1234 342 21428 1290 22948 196 13303
NM_001007023chr1464560 4465 3594 1255 269 144 34493 4443 4363 13861 24327 83
NM_001007094chr1043476 2977 1002 301 23652 1649 13436 13610
NM_001007097chr995100 5052 3518 3468 3450 1115 778 625 503 --13191 --
NM_001008408chr785544 5367 5194 2363 1596 945 671 188 1594 25772 1773 --
NM_001008723chr102401 371 ----1192
NM_001009555chr441761 1667 1610 331 1183 --11745
NM_001009899chr3116228 5920 5703 5499 5353 4885 4095 2358 1838 831 441 22567 1089 26196 6027 --
NM_001009909chr1183964 3912 3035 2999 1281 875 859 372 13740 1228 --
NM_001009959chr242642 2289 1803 1668 21857 729 1878 12017
NM_001009993chr294570 4353 3611 3535 3291 2762 777 147 113 23790 1358 ----
NM_001010861chr151965 1740 792 482 248 --1418 11732
NM_001010891chr5116938 6872 6794 4669 4321 2252 2059 1960 1624 1537 1256 14218 --15709
NM_001010942chr1251239 1117 1056 527 326 --21314 59 --
NM_001010986chrX32530 2266 296 ----11789
NM_001011513chr454132 3821 3668 2894 81 1412 ----
NM_001011666chr7155965 5615 5303 5276 5018 4290 2396 2329 2323 2088 2078 1774 1657 1409 1270 25761 5005 ----
NM_001011708chr252675 1003 864 645 401 22411 1820 ----
NM_001011885chr15--11113 1503 1166
NM_001012267chr991943 1904 1741 1693 1475 795 516 237 64 ------
NM_001012393chr1175080 4095 3703 3689 1658 1106 576 11183 --11044
NM_001012420chr1522449 1797 11823 31976 1786 787 11878
NM_001012423chr1532449 1797 787 11823 21976 1786 22205 1878
NM_001012751chr1031785 1426 781 11202 11830 168
NM_001013620chr12138165 8116 7825 6759 5620 5602 5383 5375 5178 3326 2503 2282 508 --28247 1424 1848
NM_001013659chr19155330 4931 4906 4126 3984 3894 3616 2083 1903 1810 1763 1067 968 931 732 44498 3784 3409 861 13357 --
NM_001014380chr13115655 5635 5428 4949 4754 4472 1930 1116 943 402 368 13632 11242 --
NM_001014797chr10127924 6699 6583 6351 6150 6094 6043 5666 5561 2979 2830 1343 12048 35525 5152 2007 37466 5254 1989
NM_001015877chrX33112 1883 732 12944 32723 2297 266 --
NM_001017395chr343560 3409 1315 165 152 23643 2739 --
NM_001017440chr7107219 7093 5615 5587 5479 5348 5276 1710 1317 326 48257 4999 1242 82 27192 415 18041
NM_001017970chr1462665 2349 2332 2305 913 610 12490 ----
NM_001018064chr941639 744 366 121 ----22023 390
NM_001018065chr995419 4952 4807 4599 4277 4246 2295 1035 283 12224 24022 1082 --
NM_001018066chr995419 4952 4807 4599 4277 4246 2295 1035 283 12224 24022 1082 --
NM_001018074chr563560 2629 2604 1414 1304 525 1175 1829 --
NM_001018075chr563560 2629 2604 1414 1304 525 1175 1829 --
NM_001018076chr563560 2629 2604 1414 1304 525 1175 1829 --
NM_001018077chr563560 2629 2604 1414 1304 525 1175 1829 --
NM_001018091chr1552769 2647 2226 1796 641 ------
NM_001023567chr152790 469 22263 1844 21807 1636 12251
NM_001024094chr563560 2629 2604 1414 1304 525 1175 1829 --
NM_001024372chr832291 1856 1622 265 51 11914 --
NM_001024647chr12137542 7242 7175 7060 6274 5985 5793 5746 4863 3037 1870 1324 1104 ----46988 5478 5444 4766
NM_001024956chr11145729 4891 4709 4495 4044 4037 3669 3640 1102 1009 651 462 283 129 1259 --14369
NM_001025076chr10126244 6007 5710 5664 5040 4571 4309 4117 2265 1769 1036 412 1453 ----
NM_001025077chr10117602 7365 7068 7022 6398 5929 5667 5475 5034 2394 1770 11811 175 --
NM_001025079chr372979 1038 868 652 639 449 271 14024 ----
NM_001025108chr293995 3648 3264 2598 1649 1204 961 123 52 ----1782
NM_001025233chr1262222 2185 2000 1970 1865 1009 22110 536 1438 --
NM_001025780chr93356 240 185 --11612 1139
NM_001029858chr653317 742 566 394 161 11163 --12430
NM_001029863chr632575 1037 281 ----1843
NM_001029955chr473462 2971 2708 2283 990 763 686 --1546 --
NM_001031684chr271507 1284 1165 266 260 178 144 ------
NM_001031695chr2243966 1340 870 469 24364 4099 --1395
NM_001031700chr452213 2042 1007 985 443 1267 ----
NM_001031804chr1653720 3571 3506 2864 2813 13280 --1378
NM_001031812chr542284 2269 2199 551 1433 11751 --
NM_001032392chr232655 2531 962 12497 --11757
NM_001032999chr2085368 4328 3657 1379 508 385 103 36 ----2468 336
NM_001033045chr284227 4162 4059 3857 2781 2692 1709 1223 34343 3319 611 --188
NM_001033087chr2042955 2388 1134 451 1641 12375 1727
NM_001033117chr384639 3792 3219 3133 1952 1805 325 239 ----1210
NM_001033564chr641818 1767 272 111 31898 1682 143 ----
NM_001033578chr852431 1656 592 550 531 --1347 12103
NM_001033925chr1072118 1970 1785 874 832 802 246 ----1475
NM_001034841chr1683676 3541 1472 1446 1211 850 610 235 15349 14721 --
NM_001034850chr531643 1109 392 123 --1462
NM_001037174chr261974 1963 1651 1612 1505 386 ----1754
NM_001037317chr151965 1740 792 482 248 --1418 11732
NM_001037334chr1862308 1930 1767 1644 856 588 --1343 --
NM_001037582chr441385 694 678 64 --11725 --
NM_001039538chr263499 2939 2314 2286 529 199 --12240 12502
NM_001039569chr243374 2678 1095 153 1266 ----
NM_001039590chrX62479 712 467 428 162 111 13986 ----
NM_001039591chrX62479 712 467 428 162 111 13986 ----
NM_001039618chr11105361 4839 4527 3606 2236 1515 1485 948 877 786 25354 4348 ----
NM_001039709chr2085368 4328 3657 1379 508 385 103 36 ----2468 336
NM_001039762chr1041785 694 484 60 22238 157 11570 1168
NM_001039937chr1394142 3933 3263 3003 2954 1157 850 511 228 13941 --13408
NM_001040152chr755138 3626 3184 1521 1342 24418 1360 ----
NM_001040159chr421442 22 1487 11360 11060
NM_001040284chr16115952 5754 5419 4556 4048 3878 1764 1754 695 643 257 ------
NM_001040402chr453054 2206 2020 1172 550 --12818 --
NM_001040429chr1343020 2769 2289 530 --12824 --
NM_001040441chr165453 4192 3437 1400 746 89 ------
NM_001040445chr235101 4941 756 --15273 24713 3468
NM_001040450chr1562389 691 651 465 405 81 12908 ----
NM_001040453chr1562389 691 651 465 405 81 12908 ----
NM_001040712chr963374 1416 1221 569 366 44 13288 1857 --
NM_001040875chr852472 2294 1969 927 161 22323 273 ----
NM_001042355chr1675219 4776 3619 1076 1020 737 564 13461 12102 --
NM_001042412chr1675219 4776 3619 1076 1020 737 564 13461 12102 --
NM_001042413chr942650 1520 829 600 23359 3060 --1575
NM_001042481chr1422676 2529 22335 715 --1460
NM_001042494chr1593798 3780 3620 3547 1326 796 358 276 213 13658 33354 2471 891 --
NM_001042495chr1593798 3780 3620 3547 1326 796 358 276 213 13658 33354 2471 891 --
NM_001042496chr1593798 3780 3620 3547 1326 796 358 276 213 13658 33354 2471 891 --
NM_001042497chr1593798 3780 3620 3547 1326 796 358 276 213 13658 33354 2471 891 --
NM_001042533chr383166 2748 2641 2313 1243 1179 1171 1112 13157 ----
NM_001042555chr12104037 3887 3459 3079 1796 1162 1026 379 288 215 11711 --13174
NM_001042599chr2117880 7451 7409 6263 3002 2232 1712 1252 882 634 544 12780 11825 --
NM_001042603chr1281770 1274 1254 957 510 322 217 182 11033 13251 --
NM_001044385chr273374 3234 2627 1340 1125 1028 134 --12730 --
NM_001044722chr542284 2269 2199 551 1433 11751 --
NM_001044723chr542284 2269 2199 551 1433 11751 --
NM_001046chr532544 2496 82 1884 12752 --
NM_001099678chr3116373 6360 6011 5421 4590 4250 2338 2294 841 199 162 --15707 2957 790
NM_001100108chr1138270 7779 7266 7013 6365 5805 3234 2609 1737 1650 1588 352 340 1433 27352 5343 --
NM_001106chr379742 9285 7901 6756 2436 1992 1294 48819 7107 6704 555 43665 2001 780 245 --
NM_001113490chrX52991 1219 1155 454 32 --32871 273 120 --
NM_001121chr1031780 665 356 --11239 1446
NM_001167chrX116770 6045 5124 4668 4645 4614 4439 4341 2641 2446 354 14675 12677 --
NM_001186chr2132880 2416 90 11029 22779 339 --
NM_001204chr287043 5663 4747 2778 2071 562 516 101 13088 16992 --
NM_001206chr951135 1058 393 199 134 21009 953 ----
NM_001233chr74966 599 340 276 11535 ----
NM_001259chr7156171 5863 5647 5502 5196 4828 4773 2405 1992 1774 1758 1281 609 537 69 34652 3984 1172 ----
NM_001304chr1753551 2959 541 414 402 1221 13094 --
NM_001346chr332866 2140 1890 1206 32385 524 187 11868
NM_001364chr1174595 4448 4234 3662 1576 1477 459 2306 30 --1820
NM_001399chrX43743 2717 1234 342 21428 1290 22948 196 13303
NM_001412chrX43783 3469 2713 960 23521 3429 1690 --
NM_001419chr1974290 4260 1924 1667 1528 855 446 ----11008
NM_001422chr1131420 935 287 165 --1882
NM_001432chr443799 2546 104 34 ----1805
NM_001438chr152883 2533 1195 1117 92 12598 --1110
NM_001609chr1064138 3548 1783 1273 1037 886 12858 ----
NM_001616chr243273 2992 583 178 ----23434 2435
NM_001627chr362404 2330 1755 1580 827 452 12036 1963 --
NM_001649chrX32436 2239 371 2819 522 21558 474 12459
NM_001656chr521553 796 ----1544
NM_001695chr884196 3839 3726 3491 1532 1513 500 154 153 --13336
NM_001754chr2153884 3495 2733 1457 1087 23005 1251 ----
NM_001777chr372979 1038 868 652 639 449 271 14024 ----
NM_001806chr1942961 2678 531 138 --1870 --
NM_001830chrX53450 3238 3222 865 850 21454 106 --12831
NM_001854chr121061 947 ----132
NM_001858chr6115164 4908 4666 4475 4406 3726 3669 1125 1040 356 178 13448 --13782
NM_001859chr942756 1443 984 487 --13972 2365 153
NM_001918chr1138926 8032 7700 7612 7570 3505 3440 3158 2971 2317 2287 2190 284 1557 --18336
NM_001969chr1433739 749 102 --2446 27 --
NM_002006chr4125314 5192 4540 4231 4162 3704 1377 1300 1232 960 860 572 12175 --14199
NM_002009chr1561725 711 589 572 276 34 11736 11049 --
NM_002025chrX108945 7916 7796 6658 6466 5758 3720 2345 1925 1685 17061 --13542
NM_002158chr243585 3163 2685 1306 13105 ----
NM_002214chr7125718 5660 5230 4431 4379 4276 4068 3864 2183 1967 1011 267 15649 1461 --
NM_002241chr183081 3025 2870 2370 1921 1081 1026 489 ----12445
NM_002242chr241684 540 382 319 11615 11438 --
NM_002264chr395017 4783 4486 3929 3690 1431 1164 673 358 --13458 --
NM_002270chr585291 4455 3609 3453 1904 1388 1005 210 15510 --14186
NM_002285chr293995 3648 3264 2598 1649 1204 961 123 52 ----1782
NM_002290chr611230 2989 565 --11223
NM_002310chr5106580 6228 5335 4102 2083 1256 866 423 68 37 ------
NM_002336chr1254104 1462 1453 1060 560 1198 11242 --
NM_002374chr263499 2939 2314 2286 529 199 --12240 12502
NM_002387chr574993 4138 3687 1555 282 227 49 11588 --24541 261
NM_002397chr552024 1894 1743 1653 322 2298 221 ----
NM_002481chr1117970 7024 6115 6108 5486 5466 5017 3087 2571 590 468 --27593 3113 12697
NM_002545chr1175080 4095 3703 3689 1658 1106 576 11183 --11044
NM_002577chr364042 3860 3612 3131 639 248 21286 1103 11253 --
NM_002581chr964880 4821 4234 1929 1396 1382 11765 13463 185
NM_002641chrX41782 688 284 136 --21613 519 --
NM_002645chr1172828 2519 2446 2144 1976 178 160 ------
NM_002655chr8104777 4761 4589 4424 1893 1598 1435 1186 750 346 1393 14094 --
NM_002665chr232655 2531 962 12497 --11757
NM_002736chr752081 1593 210 174 139 --1165 --
NM_002737chr17115982 5317 5041 4583 2648 2613 2531 1679 1182 605 351 15076 15230 --
NM_002740chr341937 838 686 537 --22580 986 --
NM_002742chr144737 709 206 65 1651 --1166
NM_002745chr22104548 4285 3725 3719 3404 3163 1360 1060 839 709 11494 ----
NM_002760chrY85487 4959 4621 4589 3717 1928 1493 91 24521 1193 ----
NM_002837chr1254447 3700 1285 1205 1065 34487 479 163 13794 --
NM_002839chr963374 1416 1221 569 366 44 13288 1857 --
NM_002869chr1162000 1661 1419 482 270 227 --1327 --
NM_002886chr374988 4675 4642 4588 3762 1173 706 --1449 --
NM_002906chr1142400 764 284 158 149 1683 --
NM_003034chr12107492 7158 6851 2168 1807 1751 1526 1115 708 383 --25849 1738 --
NM_003048chr242692 1769 307 76 21893 129 ----
NM_003099chr1565948 4366 2369 2186 1587 233 --22056 1433 --
NM_003108chr2106771 6757 5873 5728 4932 1608 1508 1210 694 585 1931 --15114
NM_003112chr762485 2159 1139 787 300 147 22095 1006 1538 --
NM_003130chr7132 11270 1113 11231
NM_003161chr1743365 3002 2818 2286 1975 21307 1163 --
NM_003199chr18105319 5079 4702 3551 3493 1794 1690 1149 235 159 15393 155 --
NM_003236chr272668 2443 2162 1256 880 291 47 1386 1915 --
NM_003253chr213257 172 77 21470 342 11192 --
NM_003298chr365523 5004 4632 2256 1256 151 33792 221 32 25382 4004 --
NM_003340chr431411 1120 567 11389 --1533
NM_003341chr3--1115 --1429
NM_003387chr232499 2479 626 1528 12042 --
NM_003403chr144810 600 308 259 1837 ----
NM_003411chrY31273 620 156 11197 --1567
NM_003413chrX51665 1623 1520 807 303 11838 ----
NM_003421chr1043476 2977 1002 301 23652 1649 13436 13610
NM_003458chr3123773 3569 3498 3347 2911 2874 2795 2616 1076 1066 1037 198 13146 ----
NM_003468chr294159 3671 3427 3238 3121 2718 1707 977 710 ------
NM_003483chr1242918 2302 2093 263 1908 2728 32 --
NM_003489chr2193030 2338 2094 1309 1066 772 616 221 174 12822 --1829
NM_003498chr1652802 2732 2582 2092 811 --12429 11837
NM_003503chr131306 441 114 ----1335
NM_003574chr1844790 4486 1798 576 --13889 23526 602
NM_003583chr12103790 3066 2810 2740 2449 1487 1146 948 126 99 12752 ----
NM_003590chr244019 3174 3121 2501 --13760 --
NM_003607chr183756 3661 3610 850 597 450 182 117 13017 21268 869 13035
NM_003617chr1114938 4603 4582 4457 4153 3485 3467 3209 1909 737 91 24332 1346 13413 --
NM_003630chr62289 82 ----1190
NM_003663chr343199 2504 1015 656 12243 21236 410 --
NM_003679chr163075 2765 2600 363 350 338 11139 22502 1210 --
NM_003749chr1341710 374 251 68 --12198 1819
NM_003759chr484154 4114 4016 2817 2615 1614 924 307 ------
NM_003822chr173180 3149 2774 2418 2261 1996 480 --12332 --
NM_003831chr1871521 668 557 170 55 35 29 --1232 --
NM_003887chr251770 1686 865 627 236 --127 --
NM_003895chr2151740 1680 1345 600 371 --31884 1662 1588 --
NM_003913chr694099 4013 3834 1681 1035 550 422 133 61 ------
NM_003939chr1093888 3479 3322 2617 1586 1062 844 199 89 13450 11001 --
NM_003941chr752351 2174 1686 598 267 ----12016
NM_003948chr472670 2170 1916 1899 1637 570 275 12563 ----
NM_003980chr651455 1428 355 265 220 1157 1190 --
NM_003983chr1684199 3868 3699 3628 2814 1792 1666 569 13578 43879 2907 1585 1363 14075
NM_003994chr1254225 3960 2691 1395 48 ------
NM_004006chrX52672 2543 1908 383 250 ----11766
NM_004007chrX52672 2543 1908 383 250 ----11766
NM_004009chrX52672 2543 1908 383 250 ----11766
NM_004010chrX52672 2543 1908 383 250 ----11766
NM_004011chrX52672 2543 1908 383 250 ----11766
NM_004012chrX52672 2543 1908 383 250 ----11766
NM_004013chrX52672 2543 1908 383 250 ----11766
NM_004014chrX52672 2543 1908 383 250 ----11766
NM_004015chrX52672 2543 1908 383 250 ----11766
NM_004016chrX52586 2457 1822 297 164 ----11680
NM_004017chrX52672 2543 1908 383 250 ----11766
NM_004018chrX52586 2457 1822 297 164 ----11680
NM_004020chrX52672 2543 1908 383 250 ----11766
NM_004021chrX52586 2457 1822 297 164 ----11680
NM_004022chrX52586 2457 1822 297 164 ----11680
NM_004023chrX52586 2457 1822 297 164 ----11680
NM_004035chr1763898 3190 2067 963 865 191 11355 ----
NM_004080chr721241 554 --1123 11011
NM_004124chr1463595 3470 3357 2716 1079 343 --23450 1088 13059
NM_004136chr1593199 3185 2749 2495 1165 1128 938 216 143 187 22069 721 --
NM_004171chr1199671 7152 6600 6177 3381 3031 2956 2679 789 27757 6771 13867 12552
NM_004232chr1863406 2642 1353 925 586 161 23372 2503 --1387
NM_004274chr1432680 1121 243 12405 --13108
NM_004293chr933797 2902 925 13624 --12485
NM_004319chr143136 1244 1176 973 1513 --12088
NM_004331chr832303 302 148 2285 228 12039 1694
NM_004338chr18116871 6847 5669 5499 5248 5207 4841 4516 1667 1202 982 15567 36799 4379 1153 35092 4873 2825
NM_004379chr261420 1369 1077 700 601 217 11700 --11087
NM_004384chr542284 2269 2199 551 1433 11751 --
NM_004397chr1174321 3280 3139 1395 1320 516 373 13881 ----
NM_004412chr1065839 5793 5425 1569 1176 345 1527 --25434 913
NM_004438chr242952 2881 2370 1053 ----13106
NM_004440chr61114 11544 --1789
NM_004458chrX31960 945 427 --2830 501 --
NM_004459chr1762003 1719 703 607 195 138 21986 173 ----
NM_004464chr474140 4035 3395 3338 2989 293 222 --11082 --
NM_004501chr173750 3701 2876 1321 1279 371 210 1298 ----
NM_004586chrX64606 4398 3822 3638 993 62 --1590 14127
NM_004598chr543337 2952 830 566 ----22307 883
NM_004600chr121230 572 ----1258
NM_004685chr1342798 2066 2060 1160 --1113 --
NM_004703chr1752461 2041 422 240 61 ----12503
NM_004719chr1242657 1031 126 56 ------
NM_004726chrX135492 5333 5132 4922 4877 4498 4070 3942 3758 3690 2130 1759 1301 25035 4641 21826 1527 11456
NM_004736chr162198 2072 1737 1592 684 23 11600 ----
NM_004745chr856443 6127 6079 4371 2290 14754 14339 25685 5629
NM_004748chr1574173 3897 3694 3625 3275 1478 1297 23653 3545 --11495
NM_004756chr1971421 1380 1363 1349 181 115 104 21287 1237 ----
NM_004775chr1852423 2073 1657 522 121 11675 ----
NM_004798chr2053570 3188 2804 2775 390 32862 1081 667 1557 11115
NM_004808chr1043366 1074 612 504 23167 427 22719 2140 --
NM_004840chrX52451 2390 1985 746 371 21784 1640 1239 --
NM_004845chrX63849 3396 2557 1282 948 918 1453 1896 1114
NM_004850chr21193 --11451 1348
NM_004857chr1474538 4323 3482 3377 3194 512 210 34418 3955 896 --21038 555
NM_004859chr1771977 1141 1104 1089 661 501 280 ------
NM_004898chr472261 2120 1081 1003 846 194 95 11841 12830 --
NM_004904chr7155965 5615 5303 5276 5018 4290 2396 2329 2323 2088 2078 1774 1657 1409 1270 25761 5005 ----
NM_004929chr861458 1358 1223 1154 1028 983 --2555 523 --
NM_004949chr1841711 1481 589 491 12129 ----
NM_004985chr1283828 3437 3298 1686 1359 1344 1132 812 ------
NM_004992chrX107763 6835 6248 3367 2129 1727 1665 1141 766 270 23355 372 25217 3130 --
NM_004992chrX107763 6835 6248 3367 2129 1727 1665 1141 766 270 23355 372 25217 3130 --
NM_005036chr22147543 6461 6089 5310 3227 3149 2946 2818 2664 2460 2285 1496 428 418 16438 22710 2658 33027 2996 662
NM_005045chr72775 359 1805 --1288
NM_005056chr1282014 1518 1498 1201 754 566 461 426 11277 13495 --
NM_005069chr2171779 1686 1207 1130 662 572 317 ------
NM_005086chr122679 186 11811 --21672 241
NM_005093chr2085368 4328 3657 1379 508 385 103 36 ----2468 336
NM_005121chr1753597 2774 1512 364 127 --11050 --
NM_005135chr1593798 3780 3620 3547 1326 796 358 276 213 13658 33354 2471 891 --
NM_005151chr1862308 1930 1767 1644 856 588 --1343 --
NM_005156chr975150 5128 5030 4433 1205 1080 268 14989 23975 3606 --
NM_005160chr22156749 6461 5767 5434 4857 4761 4631 4258 1816 1561 1313 1122 1080 846 791 1349 ----
NM_005197chr14135330 5092 4772 4693 4061 2063 2031 1758 949 356 350 86 48 25852 1231 15166 --
NM_005235chr2117880 7451 7409 6263 3002 2232 1712 1252 882 634 544 12780 11825 --
NM_005239chr2152043 1950 1715 1581 189 --2600 499 1513
NM_005259chr261370 1274 1193 564 550 55 ------
NM_005277chr451883 1672 1636 1226 626 1463 11733 --
NM_005339chr443994 1522 1499 416 13948 11624 1581
NM_005359chr1845331 4948 1413 1308 12019 15107 --
NM_005399chr164298 3331 3157 1475 1299 774 --22987 445 --
NM_005436chr1073898 3777 3194 2643 1191 457 60 23886 3016 33549 1223 284 21543 547
NM_005455chr1----21276 1229 1544
NM_005475chr1283107 2958 2788 2660 2538 2342 1001 907 --127 --
NM_005486chr172187 157 ----2243 204
NM_005502chr943222 2592 2032 583 13162 1815 --
NM_005504chr12116629 5991 5890 5072 4760 4498 4462 2616 2161 1225 1011 36563 5061 4067 12420 14825
NM_005509chr541661 1513 533 164 153 ----
NM_005578chr374525 3708 3469 3385 1680 874 705 ------
NM_005591chr1152221 1094 883 202 145 ------
NM_005596chr9146162 5373 4755 4719 4567 4526 4051 2446 2429 2252 2088 1352 824 135 --14856 1870
NM_005602chr341199 1023 981 823 11331 ----
NM_005665chr194666 4569 3632 1906 1418 1216 1134 1126 253 13081 13982 --
NM_005668chr5104557 3866 3135 2879 1677 1533 1194 293 272 92 11665 22940 1517 1407
NM_005725chr131931 744 80 12117 ----
NM_005746chr762736 2280 1080 529 509 232 1274 22094 419 --
NM_005748chr1232211 450 195 12881 ----
NM_005759chr264231 3202 1775 1691 565 263 23922 2943 ----
NM_005813chr262048 1718 702 517 506 283 --2861 442 --
NM_005822chr682312 2251 1987 896 623 591 537 254 ----1690
NM_005840chrX76265 5088 4934 1662 926 807 49 16351 21368 1266 15927
NM_005845chr1321103 504 11374 1198 11364
NM_005868chr762394 2016 1811 1737 1581 71 1361 --11540
NM_005901chr18148079 7692 7174 5888 5685 5450 5259 3181 2281 1843 1745 1645 1636 291 36270 5504 1915 48660 5960 1076 892 11205
NM_005909chr5103441 3033 2985 2848 1411 1334 1270 1099 206 192 ------
NM_005920chr163760 2696 2655 1323 1070 866 1437 13236 --
NM_005935chr4105059 4959 4579 4545 3400 2083 848 431 318 152 --14315 --
NM_005941chr874147 4096 3445 1661 1636 1589 688 ------
NM_005955chr143846 1544 1397 615 15311 25019 1385 12219
NM_005966chr24905 276 212 172 2919 691 1594 11803
NM_006007chr974217 4109 4099 3467 1444 802 647 14372 23975 1690 --
NM_006011chr15114318 4308 3746 3552 3393 3055 2923 2757 1545 1100 557 2544 87 ----
NM_006016chr651915 1485 1456 507 274 22041 599 1188 --
NM_006047chr2033550 3015 2337 --12411 13508
NM_006055chr273217 2814 2634 2476 1179 740 358 ------
NM_006080chr742865 2779 2526 353 32562 2241 207 ----
NM_006089chrX31312 142 50 --1238 1329
NM_006095chr453962 3090 3048 1337 1297 --34021 3590 2888 --
NM_006106chr1123143 3056 --1402 12304
NM_006141chr1662805 2604 2565 2432 1992 313 22465 1797 1809 --
NM_006180chr941639 744 366 121 ----22023 390
NM_006194chr1481305 1141 863 508 414 276 49 22 1895 ----
NM_006195chr951094 885 281 236 58 1876 ----
NM_006203chr5104944 4654 4536 3578 3518 1841 1508 1497 1397 228 ------
NM_006206chr462951 2635 2407 2333 1074 346 2337 316 ----
NM_006226chr231392 1294 216 21208 895 ----
NM_006251chr53467 458 370 22807 2590 22693 1255 12276
NM_006256chr13714 634 87 21826 654 1283 --
NM_006265chr821358 1160 --1253 11088
NM_006275chr2032523 852 681 --32164 996 324 11868
NM_006282chr2043772 3763 837 323 23728 1320 14616 --
NM_006283chr883985 3518 1724 1634 1528 1151 922 165 44703 4006 3783 1748 --126
NM_006298chr643165 2247 1084 36 12531 33370 1007 615 --
NM_006306chrX65591 5573 5422 4512 4404 192 25797 5482 ----
NM_006310chr175961 953 303 198 190 1855 11092 11214
NM_006313chr1211726 11398 --1185
NM_006315chr473758 3594 3411 2819 594 545 154 13206 1736 --
NM_006371chr384463 3837 3504 1725 1683 1115 948 69 25114 1953 ----
NM_006380chr17124098 3248 2817 2704 1522 1005 701 482 423 382 252 194 --13653 --
NM_006393chr1074560 4461 3352 1641 1513 1118 177 22858 1069 ----
NM_006457chr454132 3821 3668 2894 81 1412 ----
NM_006469chr151641 1608 412 105 28 ----1554
NM_006482chr12103790 3066 2810 2740 2449 1487 1146 948 126 99 12752 ----
NM_006538chr242912 1041 947 325 41426 1078 963 186 13261 --
NM_006544chr14135964 4806 4736 4664 4396 3778 2340 2002 1989 523 456 354 145 13968 24180 64 16086
NM_006546chr17115871 5864 4573 4259 1660 1572 1560 1294 1252 608 40 15590 25324 844 16165
NM_006561chr10126244 6007 5710 5664 5040 4571 4309 4117 2265 1769 1036 412 1453 ----
NM_006599chr16106886 5687 3111 2722 2139 588 468 440 220 192 16782 ----
NM_006609chr272911 2567 2421 2151 1922 1849 1821 ----1844
NM_006614chr362577 2291 2261 1445 633 125 12440 32514 1112 971 --
NM_006624chr1052137 607 542 344 256 1308 ----
NM_006626chr962537 979 923 814 294 153 ----1867
NM_006628chr1564202 4163 4110 2964 2888 1135 14517 43049 605 540 179 --
NM_006629chr1832852 2795 2400 3628 507 196 ----
NM_006646chr1342757 2200 501 315 1971 2710 702 --
NM_006654chr12104037 3887 3459 3079 1796 1162 1026 379 288 215 11711 --13174
NM_006667chrX41022 939 131 54 ------
NM_006682chr752648 2336 1052 1016 60 1775 ----
NM_006729chrX105660 4499 3806 3745 2171 1779 1673 1536 1198 640 34717 1653 1004 13484 --
NM_006750chr16148018 7019 6913 6892 6776 6611 6259 2739 2321 1702 1162 1120 449 98 15997 36288 3093 2415 15596
NM_006805chr561455 1424 1326 1271 1210 52 ------
NM_006861chr1251644 1482 1357 750 500 3767 676 368 --1834
NM_006873chr263295 3068 2470 2195 1136 764 --22392 1096 --
NM_006895chr272077 2025 1889 1492 1479 379 230 ------
NM_006902chr183351 2283 504 341 148 86 76 56 12543 ----
NM_006918chr11145729 4891 4709 4495 4044 4037 3669 3640 1102 1009 651 462 283 129 1259 --14369
NM_006920chr251460 1279 498 320 165 --21297 72 --
NM_006922chr292342 2284 1670 1608 1033 875 706 190 111 ------
NM_006930chr551887 1748 1535 1477 801 11792 2470 220 --
NM_006948chr212661 312 12421 --12370
NM_006955chr10103303 2776 2632 2508 2439 2214 918 725 139 99 11172 12575 --
NM_006981chr952985 2926 1204 530 311 22895 2124 11005 --
NM_007006chr1623560 2651 1583 22743 2562 --
NM_007007chr12124421 4141 3896 3485 3038 1743 1085 1012 813 555 495 72 23860 401 ----
NM_007030chr575192 4929 4279 3948 1079 418 341 13455 14598 23570 1617
NM_007038chr21125955 5314 5206 5188 5079 4589 4465 3885 3852 1879 997 46 25699 5369 1118 12441
NM_007050chr2097320 6178 5851 5393 4981 2929 2059 1176 674 25953 5199 36954 5616 5483 12751
NM_007195chr1893644 2711 2425 2312 1021 581 259 238 101 1179 ----
NM_007246chr47835 671 661 269 207 50 21 ----2954 117
NM_007249chr13118976 8091 6845 6772 6398 3437 2977 2657 1991 1389 89 26451 2947 37594 7156 62 --
NM_007292chr1763898 3190 2067 963 865 191 11355 ----
NM_007358chr161877 1852 819 718 428 146 ------
NM_012089chr131390 633 517 ----1969
NM_012095chr1063316 3281 2764 2585 953 286 23259 350 11265 --
NM_012096chr363690 2440 1289 786 480 214 1499 ----
NM_012097chr261974 1963 1651 1612 1505 386 ----1754
NM_012141chr1394142 3933 3263 3003 2954 1157 850 511 228 13941 --13408
NM_012214chr276025 5431 4203 2480 1760 1563 1210 --25938 4820 --
NM_012218chr1962301 2165 2039 1915 572 78 22535 1054 22856 1933 --
NM_012249chr223571 3105 33468 1034 988 13090 12633
NM_012250chr1141343 1122 898 27 11113 11276 --
NM_012252chr775042 4771 4755 3397 2124 1688 436 21506 144 ----
NM_012262chr175120 4406 3346 1560 1455 1426 670 --14236 15023
NM_012281chr741939 1927 1913 58 ----11542
NM_012288chr695563 5313 2207 2088 930 870 805 601 200 33887 2095 2056 ----
NM_012297chr472338 797 630 527 517 501 179 1447 ----
NM_012309chr1174426 4187 4100 3829 3216 1976 1221 11892 11213 --
NM_012334chr574201 3839 3571 1206 1092 750 619 --2908 201 1382
NM_012382chr574427 4369 3924 3783 3622 2864 1599 --13683 --
NM_012425chr1052487 2184 988 361 219 12449 11021 --
NM_012465chr1042615 2208 67 60 22503 710 12138 12427
NM_013231chr1434043 974 956 1720 13878 1841
NM_013255chr7147884 6340 6269 6072 5980 5953 5374 3328 1657 817 776 731 511 379 --21736 1595 23130 372
NM_013257chr852431 1656 592 550 531 --1347 12103
NM_013269chr1264436 1414 1129 767 117 95 13440 ----
NM_013309chr1572115 2013 1046 719 636 420 330 1472 11773 --
NM_013341chr252675 1003 864 645 401 22411 1820 ----
NM_013372chr1542974 2284 2205 429 --12309 1783
NM_013377chr124553 534 517 498 ------
NM_013381chr1262298 2219 1731 1557 821 577 --12243 --
NM_013402chr1172452 1939 1907 1877 1845 647 350 2497 306 ----
NM_013989chr1464560 4465 3594 1255 269 144 34493 4443 4363 13861 24327 83
NM_014011chr22244 184 11718 1358 --
NM_014021chr142518 977 710 403 23278 208 13212 --
NM_014048chr16105287 5030 4617 4476 4096 3825 3351 1692 664 201 24898 493 14113 14442
NM_014141chr7105245 4768 4510 1516 1309 765 665 616 333 109 11799 --14370
NM_014155chr11117191 6556 6033 5550 4777 2922 2898 2298 1088 917 46 32469 2370 576 ----
NM_014157chr1653899 3697 3334 2676 406 --12813 13973
NM_014290chr92237 152 ----1169
NM_014309chr2243956 1330 860 459 24354 4089 --1385
NM_014331chr497206 6882 6634 6381 6353 5393 5303 1122 894 ------
NM_014421chr44584 443 411 398 1506 ----
NM_014504chr772150 2055 2049 2043 1884 784 108 ------
NM_014571chr193051 2810 2693 2164 1216 942 737 683 313 52515 1908 1196 658 628 ----
NM_014607chr262082 2004 1498 1455 1442 859 --11679 --
NM_014674chr333278 1379 186 1273 12472 1774
NM_014682chr852184 1964 714 404 37 125 11645 --
NM_014721chr687265 7120 6813 6620 6113 2950 2652 696 ----11139
NM_014751chr882042 1701 1574 1515 1402 1357 626 137 11819 ----
NM_014767chr1063154 2556 1179 1119 752 56 33318 2914 1204 2858 38 --
NM_014810chr183548 3294 2255 1222 1216 1141 585 480 --12675 --
NM_014826chr183756 3661 3610 850 597 450 182 117 13017 21268 869 13035
NM_014830chr1283901 3619 1429 1098 896 362 187 40 13058 2518 487 1376
NM_014838chr2232357 2123 806 31977 564 420 1905 12412
NM_014839chr142105 1992 675 446 41726 1610 1571 393 ----
NM_014850chr384639 3792 3219 3133 1952 1805 325 239 ----1210
NM_014862chr1594150 3898 3412 3178 2692 1181 767 712 366 12922 ----
NM_014877chr1766331 6299 5556 2560 1914 386 ----14817
NM_014879chr34770 411 130 71 163 1788 --
NM_014897chr172888 632 13274 --22974 141
NM_014903chr1242043 925 739 711 1142 21927 854 --
NM_014906chr1763815 3231 3187 2745 1201 236 11516 11380 --
NM_014912chr1043486 1040 684 497 11076 13125 12292
NM_014920chr671173 837 825 404 253 146 109 32916 2739 902 11321 --
NM_014923chr1362322 2305 1726 1547 336 257 ------
NM_014936chr632803 2105 1746 22590 410 ----
NM_014950chr1421547 1152 --2707 555 148
NM_014953chr1374392 4217 3422 3063 1397 1381 1100 --23553 1065 12860
NM_014988chr472815 2648 1080 899 887 97 69 ------
NM_014991chr453263 2959 2928 2556 1071 23052 2324 12041 12453
NM_014999chr1241679 1256 541 58 --1116 --
NM_015008chr343560 3409 1315 165 152 23643 2739 --
NM_015025chr242698 2183 1822 868 ----1953
NM_015026chr1294147 3741 3262 1708 751 477 242 198 176 --13099 --
NM_015032chr1382667 2400 2178 1909 1851 985 834 461 --11973 --
NM_015035chr2086471 6173 4441 2505 2455 1785 364 318 25528 4728 25849 5816 14680
NM_015040chr263421 2533 2270 2249 952 378 11333 ----
NM_015045chr1062285 2195 729 684 448 236 --11867 --
NM_015046chr962402 1972 1718 963 138 26 12150 1491 22100 402
NM_015064chr1283375 3220 2712 2556 2522 1062 810 345 11293 2755 637 1303
NM_015068chr743990 2478 373 194 33270 1393 212 ----
NM_015071chr566223 5085 4920 4724 448 128 25092 1460 44953 2413 920 308 1220
NM_015090chr165494 4855 4272 2054 1478 854 23812 879 16115 15544
NM_015092chr1674651 4028 3882 1476 1111 768 494 41776 920 587 285 ----
NM_015093chr631150 294 286 11851 ----
NM_015115chr453054 2206 2020 1172 550 --12818 --
NM_015132chr771924 1848 1645 1366 803 458 294 --1390 11561
NM_015137chr842355 2283 1826 90 --11043 --
NM_015144chr16113584 3530 3523 3084 2849 2748 2437 1057 1030 888 604 2638 612 --1934
NM_015155chr1093197 2810 2778 2758 2514 2488 2179 1233 922 --12419 --
NM_015156chr1493886 3206 3100 3058 2843 2484 1480 1413 736 --1332 13586
NM_015205chr13115042 4963 4576 4350 4155 2042 1071 994 605 364 254 13447 21641 69 --
NM_015206chr15123743 3578 3427 2358 1531 1350 1039 1029 560 474 267 72 1567 11117 --
NM_015208chr1843211 2939 380 293 34067 3122 3037 ----
NM_015247chr1675219 4776 3619 1076 1020 737 564 13461 12102 --
NM_015252chr25962 792 625 220 94 ------
NM_015265chr262704 2575 2556 2426 825 709 ------
NM_015271chr451431 1257 907 684 501 ----13268
NM_015272chr1631472 297 249 ----11389
NM_015275chr1271954 1882 1704 1569 659 460 419 ------
NM_015285chr1862280 2213 2054 1933 362 328 1312 1594 --
NM_015313chr1134464 1702 750 ----13689
NM_015314chr762369 2215 1883 1848 1655 569 ----1231
NM_015336chr1262425 2276 1830 1039 159 147 --12036 --
NM_015375chr194893 4591 4081 3677 3289 3151 1323 723 361 54378 3659 1996 1470 953 1194 --
NM_015429chr341097 1078 452 331 ----1216
NM_015436chr493169 2644 2612 2458 1350 1103 872 835 706 12065 --12654
NM_015455chr543141 2856 2578 1029 3598 275 169 13341 13839
NM_015458chr894363 3612 3603 1871 1542 1260 624 478 145 12053 14847 --
NM_015460chr392044 1979 1825 818 369 259 182 68 52 11574 11316 --
NM_015526chr1961481 1460 1354 559 473 379 2445 332 --2277 158
NM_015535chr242714 1687 788 425 13318 --13604
NM_015541chr321200 569 ----1287
NM_015550chr773239 2601 1185 971 918 740 295 ------
NM_015564chr593470 3229 2731 1278 1189 1109 1101 910 372 23544 2329 13499 --
NM_015568chr2053884 3190 1385 338 65 11061 34092 2782 1054 --
NM_015571chr642246 1855 518 504 ------
NM_015575chr233580 2716 506 12691 --1455
NM_015646chr1251239 1117 1056 527 326 --21314 59 --
NM_015879chr1898328 8207 8009 7980 7760 7584 6475 5679 5595 36636 2833 2484 18542 16062
NM_015886chr885761 4486 4117 3881 1569 992 871 502 --24183 1191 14677
NM_015888chr143359 2634 2093 135 --21225 346 --
NM_015906chr1104570 3958 3452 3430 3051 3019 1765 1681 1010 593 --13200 11578
NM_015912chr842127 2012 591 440 --1104 1475
NM_016009chr154805 4453 4275 4035 1087 34184 827 533 1310 --
NM_016021chr653033 1131 1030 948 372 ----12933
NM_016040chr152380 1838 916 880 201 --32359 851 346 --
NM_016072chr1262432 1941 762 209 147 70 22297 1924 21648 677 --
NM_016076chr153025 2934 2750 2394 2010 12662 --12161
NM_016083chr653357 3317 1009 677 490 --11499 --
NM_016131chr252365 1653 375 356 289 12083 ----
NM_016132chr1593407 3184 2893 2403 2221 1174 1147 1106 1067 --1135 --
NM_016152chr331239 1024 149 ----11116
NM_016206chr3178457 8362 8230 7314 7102 6906 6786 6640 6408 6371 5973 2488 1463 1201 1189 269 84 48518 6037 3261 2752 12108 18926
NM_016248chr1354020 3865 3821 3456 96 --13906 13176
NM_016260chr286923 6089 2789 2294 1003 955 827 753 11329 --1982
NM_016289chr262266 1511 939 750 58 37 1824 11620 --
NM_016322chr953002 2331 989 916 144 ----1642
NM_016353chr821947 1719 11528 1255 1901
NM_016376chr1764044 3774 1503 1395 623 49 1116 1585 --
NM_016396chr1562227 2114 1082 1066 977 298 1338 1429 --
NM_016422chr1143206 2446 443 286 12839 12467 --
NM_016475chr1431153 505 339 --41087 363 260 68 --
NM_016485chr652229 2137 1940 1655 48 --21864 163 --
NM_016513chr671173 837 825 404 253 146 109 32916 2739 902 11321 --
NM_016531chr453985 3248 2883 1554 786 ------
NM_016577chr3104513 4283 4251 3553 3279 3195 3067 2858 895 670 23407 1634 ----
NM_016617chr1331603 1533 86 ----11526
NM_016824chr1031780 665 356 --11239 1446
NM_016929chr6144479 4371 4145 3980 3629 3508 3267 2959 1630 1589 1507 1120 257 170 13382 ----
NM_016950chr421442 22 1487 11360 11060
NM_017415chr554506 4003 3537 3298 64 24243 1405 14543 --
NM_017420chr1453592 1069 859 549 506 13660 --11037
NM_017423chr431718 532 364 ----11628
NM_017447chr2143822 3565 570 135 32774 1199 313 ----
NM_017548chr332198 2189 59 12020 1226 11469
NM_017563chr3106036 5974 5285 2074 1600 1262 949 712 424 241 --16268 --
NM_017592chr1972261 2087 2015 1818 147 127 85 22003 138 ----
NM_017610chr1551723 1592 1466 837 651 --11714 --
NM_017628chr453296 2010 1670 890 685 1978 31930 1531 1076 13899
NM_017633chr61979 --11161 2740 617
NM_017634chr841897 1624 1363 787 11253 11476 1198
NM_017637chr9107270 6480 6096 2906 2817 2765 2059 1133 1040 982 37247 6003 2219 28647 1449 --
NM_017643chr1763054 2900 2665 2257 868 280 ------
NM_017644chr343480 1306 989 481 23530 1329 1904 14069
NM_017650chr7105850 5572 4750 2425 1614 1092 1038 830 822 220 34453 1570 163 14707 --
NM_017658chr1494383 4099 3918 3353 3177 1079 791 543 195 --14398 --
NM_017666chrX41917 765 207 197 ------
NM_017680chr931027 410 306 ----1161
NM_017684chr1541452 786 769 25 --1306 --
NM_017694chr241930 1560 218 139 21965 655 ----
NM_017742chr1851375 1308 489 476 201 21469 1429 11980 --
NM_017754chr684907 4880 4430 4089 1474 692 301 52 24526 510 ----
NM_017801chr362360 1708 672 522 471 147 --22393 283 --
NM_017919chr985733 5070 4742 4724 1854 1700 1247 908 14752 14380 --
NM_017987chr1042112 2053 1921 1861 ----2433 200
NM_018018chr1221189 104 1481 1569 1630
NM_018036chr14113879 3694 3200 3112 2822 1550 1476 932 450 140 65 22758 1197 1955 --
NM_018084chr263009 2479 2447 1218 1212 775 --21277 146 --
NM_018155chr363065 2938 2848 2336 635 419 12792 12210 --
NM_018157chr1263282 3255 2694 388 40 26 --1871 12619
NM_018293chr392990 2938 2835 2291 747 739 724 574 261 ------
NM_018299chr883111 2995 2222 2155 1147 909 557 372 --23058 545 --
NM_018351chr1274673 3761 3024 1304 1140 1086 483 --21676 1448 --
NM_018362chr1163634 2535 1514 507 468 150 ----14010
NM_018364chr154014 1569 1344 1174 562 1301 ----
NM_018367chr1122424 2021 1111 32282 302 294 --
NM_018373chr14126246 5612 5189 5133 5045 4819 4146 2529 1310 914 459 21 --12263 --
NM_018374chr765260 4845 4567 4456 3839 1610 14901 ----
NM_018375chr141428 --21851 1686 11437
NM_018403chr374000 3683 3551 3009 1189 857 633 2372 197 --13694
NM_018429chr592707 2380 2057 2047 702 662 377 201 65 ------
NM_018440chr8107488 7144 7028 6587 3487 3207 2234 989 598 515 26402 2083 33474 3125 697 --
NM_018557chr25688 518 347 93 68 21403 559 ----
NM_018638chr1265249 4525 4478 1951 1661 598 24658 4107 --11748
NM_018700chr5----41653 1328 674 469 --
NM_018945chr663301 1239 1223 1198 195 83 13034 23140 2745 --
NM_018947chr785027 4896 4393 3414 1152 980 959 597 14087 ----
NM_018970chr773160 2754 2575 2356 2261 2063 145 --1105 --
NM_018972chr852472 2294 1969 927 161 22323 273 ----
NM_019000chr531643 1109 392 123 --1462
NM_019022chr1852973 2696 2659 1202 716 ------
NM_019035chr472106 2031 1394 841 526 447 231 --11840 --
NM_019050chr462205 2065 1684 1404 677 267 --11908 --
NM_019084chr1062293 2032 1982 1579 942 684 1283 1188 --
NM_019891chr111162 11136 --21245 863
NM_019903chr1031780 665 356 --11239 1446
NM_020122chr2105771 4064 2269 2230 2117 2054 1816 1626 1466 1243 25638 4344 13996 1869
NM_020177chr553124 2679 1149 582 46 33022 2239 2130 ----
NM_020194chr24563 455 449 441 1671 136 --
NM_020205chr163503 2638 2530 2443 1131 393 ------
NM_020228chr1132547 483 283 12300 --21595 747
NM_020342chr242433 2123 1967 1731 --22586 900 --
NM_020390chr374859 4425 3872 3805 3406 753 178 11809 34936 3791 3771 1276
NM_020403chr132554 485 21206 295 --179
NM_020432chr762084 1818 1789 561 554 331 11580 12043 --
NM_020443chr1137017 6210 5667 5536 5303 5175 5110 4866 1652 806 789 690 356 135 24875 2661 --
NM_020466chr6124880 4840 4520 4406 4294 4284 3681 3567 1410 1126 156 63 14077 43815 3271 3224 205 11644
NM_020473chrX41782 688 284 136 --21613 519 --
NM_020474chr1851834 1659 819 301 54 --11916 --
NM_020638chr1272103 1700 1374 1356 242 229 40 --1515 --
NM_020647chr832161 901 589 11990 1408 --
NM_020673chr20117104 7045 6904 6730 6564 5560 4864 1360 1303 592 440 24857 606 156 12354
NM_020686chr1673045 2709 2501 2199 2184 1131 43 21895 887 --22627 2601
NM_020699chr164049 1990 1725 1131 1087 152 25274 4661 25338 251 11611
NM_020711chr242642 2289 1803 1668 21857 729 1878 12017
NM_020715chr1452275 2107 2082 1844 94 12219 ----
NM_020717chrX95044 3832 3353 3123 1772 1651 1148 621 82 14944 1363 --
NM_020734chr122891 852 12624 --12137
NM_020739chr1574173 3897 3694 3625 3275 1478 1297 23653 3545 --11495
NM_020760chr221297 563 1472 1233 11573
NM_020766chrX84218 4169 3163 1451 1421 1241 1234 179 --1172 --
NM_020768chr562514 2439 745 625 165 121 12031 13046 --
NM_020771chr631247 575 74 ----11264
NM_020772chr17127994 6732 5835 5499 3440 3077 1677 1023 761 473 331 91 198 ----
NM_020774chr18125766 5674 5597 5356 4500 4081 2504 1622 1169 766 535 399 --14704 --
NM_020776chr1842743 2349 2290 258 ----12194
NM_020778chr1585004 4943 4662 4125 3634 3268 3124 1189 2374 37 1904 24706 1927
NM_020781chr793200 2724 2383 1177 1045 961 830 333 43 12662 ----
NM_020783chr1821933 226 ----12333
NM_020804chr692584 2328 1819 1654 903 822 789 780 227 ----1805
NM_020821chr1541452 786 769 25 --1306 --
NM_020830chr282943 2404 1320 1236 757 237 120 38 ------
NM_020844chr857376 7299 5982 5384 5016 25734 245 26089 4882 27578 5779
NM_020859chr473925 3135 2737 2638 1081 838 45 --23894 298 --
NM_020917chr1983575 3388 2962 2489 1133 654 643 167 13951 --13002
NM_020918chr1072301 1324 1147 683 267 189 183 --1491 --
NM_020921chr1483381 3335 3135 3050 2486 2305 1338 1274 ------
NM_021033chr1343529 3254 511 496 --23501 3167 --
NM_021116chr7149091 8883 7988 7054 6685 6332 5920 5877 3320 2954 1674 1422 924 191 36505 6167 99 37735 7144 1457 --
NM_021145chr731094 418 406 ----11163
NM_021176chr271754 1673 1509 1238 370 361 316 ------
NM_021183chrX21670 651 12514 12150 12268
NM_021204chr41889 ----1691
NM_021255chr1453690 3538 3202 2844 197 2477 164 134 --
NM_021814chr621616 108 --21638 80 1659
NM_021815chr263115 2964 2936 2184 1220 715 12332 12293 --
NM_021911chr5105578 5140 4974 4372 3661 3613 3568 1641 1456 734 14179 22185 326 14101
NM_021912chr1543519 2981 153 37 1894 --12775
NM_021954chr1353654 3137 3089 336 272 22365 82 ----
NM_021961chr1165487 1803 1762 1241 749 677 11643 16660 --
NM_021964chr3126284 5796 5281 4361 4274 2324 2201 1769 1669 916 381 173 --46099 5518 2512 401 --
NM_021998chrX41249 1096 988 975 11037 --11018
NM_022048chr1586267 5636 5520 2435 2042 1448 1380 1152 15577 25776 1013 --
NM_022049chr161849 1596 1376 1370 1275 1257 ------
NM_022166chr1655133 4203 4020 1002 29 35570 2208 340 75759 2471 2234 1178 691 152 40 24060 2144
NM_022373chr72818 61 1213 --1905
NM_022456chr12137542 7242 7175 7060 6274 5985 5793 5746 4863 3037 1870 1324 1104 ----46988 5478 5444 4766
NM_022459chr1396370 5851 4663 4546 2357 1863 1590 1366 327 --21584 643 12277
NM_022474chr14122661 2470 2288 2223 2107 1049 794 672 400 155 106 55 ----1254
NM_022739chr1721008 806 11125 1394 166
NM_022763chr341016 740 623 473 11054 ----
NM_022824chr551769 1622 1265 763 665 1412 --21467 40
NM_022828chr551365 1186 437 247 109 ------
NM_022977chrX31960 945 427 --2830 501 --
NM_024007chr552105 1109 922 596 584 22669 2090 ----
NM_024345chr996139 5447 5030 5014 4582 3928 2394 1208 721 22168 1802 43798 1520 940 765 --
NM_024415chr5190 ----174
NM_024513chr363609 2913 2736 1093 998 161 21241 1033 1612 --
NM_024524chr3113175 2918 2013 1954 1260 998 663 331 226 192 181 12602 ----
NM_024551chr1252251 2151 2118 1975 1926 12059 12328 11695
NM_024551chr1252251 2151 2118 1975 1926 12059 12328 11695
NM_024569chr162702 917 811 425 104 36 --22282 1837 --
NM_024665chr352939 1777 1566 822 454 --13856 1369
NM_024721chr8102389 2223 2199 2189 2121 2108 2075 1921 1026 970 ------
NM_024744chr252635 2507 729 558 355 2866 721 12129 --
NM_024749chr15865 456 403 383 327 1411 1896 11411
NM_024761chr9105026 4567 4399 4345 3570 3468 1684 1154 992 527 1113 11983 15011
NM_024770chr2106676 6467 6152 6084 6000 5588 5013 4505 4439 172 --12671 --
NM_024808chr134883 254 217 70 1165 ----
NM_024947chr377970 7600 7122 6390 3281 3033 30 12166 16471 18150
NM_024989chr287836 7529 6464 6127 6059 5781 5276 2907 12497 22635 1083 --
NM_024993chr241154 1003 503 261 --11368 --
NM_025054chr854219 3521 3268 3230 1643 21305 1101 13293 --
NM_025073chr174660 4328 3788 2983 1781 1222 148 --13434 1472
NM_025074chr463095 1168 846 493 229 165 31076 919 444 --11038
NM_025134chr1672088 1908 1731 910 404 283 90 ----11005
NM_025160chr174273 3832 3822 3214 2985 1418 597 --31121 660 389 --
NM_025191chr163379 3153 2907 2285 970 606 ----11151
NM_025235chr103206 143 53 ----2325 216
NM_030579chr1643623 3280 2877 733 22924 1191 1364 --
NM_030621chr1473971 3790 2776 1519 383 166 138 1151 --12948
NM_030625chr1062517 2429 2295 1938 1622 909 --22284 344 --
NM_030627chr532991 1593 551 21011 327 1533 --
NM_030647chr7166035 5685 5582 4800 4599 4094 3991 3851 2049 1615 1042 1010 850 504 329 171 11509 1363 24051 343
NM_030648chr475384 5292 5059 4701 4260 3510 2237 34471 1015 503 21193 629 --
NM_030650chr253733 3714 2860 1371 542 13442 11477 11015
NM_030670chr124625 557 451 98 22302 461 11752 --
NM_030671chr124625 557 451 98 22302 461 11752 --
NM_030674chr12105871 5347 4674 3813 3729 2242 1960 947 501 61 ----15236
NM_030751chr1041796 1548 1220 53 1277 11535 --
NM_030751chr1041796 1548 1220 53 1277 11535 --
NM_030791chr142460 386 ----1449
NM_030806chr1149257 8929 8678 7269 5980 3345 3120 2820 2417 2295 1748 1493 1409 1275 37375 5862 2262 48004 6433 2885 2161 11209
NM_030816chr153140 1246 846 537 121 11034 12344 --
NM_030885chr352374 1939 711 401 82 --22303 731 --
NM_030918chr175080 4245 3728 2141 1116 1022 899 34237 1012 799 24829 1574 --
NM_030938chr171435 1258 1243 11035
NM_031271chr861459 1442 1236 299 252 74 ------
NM_031427chr1465846 5268 4064 2314 1131 495 21785 53 --13819
NM_031435chr1263339 2944 2257 2160 891 398 ------
NM_031442chrX72724 2508 2356 2255 2085 496 151 --12671 11045
NM_031468chr7107219 7093 5615 5587 5479 5348 5276 1710 1317 326 48257 4999 1242 82 27192 415 18041
NM_031469chr673743 3653 3460 2971 2704 1284 56 1880 12857 --
NM_031483chr204698 279 230 217 --11321 --
NM_031844chr173750 3701 2876 1321 1279 371 210 1298 ----
NM_031845chr263499 2939 2314 2286 529 199 --12240 12502
NM_031847chr263499 2939 2314 2286 529 199 --12240 12502
NM_031911chr452431 943 813 524 264 12478 1859 --
NM_032012chr944681 3726 3617 733 24965 4008 --1874
NM_032116chr13115655 5635 5428 4949 4754 4472 1930 1116 943 402 368 13632 11242 --
NM_032144chr251517 1276 331 120 77 --1177 --
NM_032145chr641924 1914 1774 616 11598 ----
NM_032160chr1843380 3161 943 856 24105 4089 ----
NM_032175chr551772 1650 1632 1614 296 ------
NM_032189chr13124844 4765 4378 4152 3957 1941 1844 873 796 407 166 56 13249 11443 --
NM_032199chr1033830 2484 849 32610 1084 42 --1473
NM_032208chr263497 2625 2363 1272 1143 533 1709 32466 766 284 1812
NM_032217chr441052 1024 948 434 1405 21163 1046 --
NM_032228chr1162442 1335 1323 1307 690 350 --22274 1386 --
NM_032321chr232831 2062 645 21178 768 2458 179 --
NM_032373chr1075376 5214 4583 4203 3984 2203 111 15436 14814 160
NM_032410chr82973 114 ----11150
NM_032445chr15102283 2041 1888 1706 917 681 547 441 345 271 ------
NM_032446chr533373 3211 685 12341 1812 13094
NM_032452chr1431564 1515 1008 11112 ----
NM_032458chrX63442 2213 1062 265 244 218 23274 2128 33053 2627 596 --
NM_032521chr2063026 2914 2610 2551 2451 2183 12843 ----
NM_032632chr1431692 211 147 ----11401
NM_032682chr373630 2688 2658 2344 1415 980 280 2373 324 ----
NM_032731chr1721299 53 1127 --11284
NM_032778chr383166 2748 2641 2313 1243 1179 1171 1112 13157 ----
NM_032800chr172643 2479 1947 1059 728 453 143 1210 11024 --
NM_032833chr152605 1959 1079 980 717 --1803 1948
NM_032837chr1751850 829 544 394 136 --31816 787 144 --
NM_032842chr741733 1376 1189 417 ----1135
NM_032859chr1363764 3705 3687 1506 1430 785 ------
NM_032900chr1043798 3129 706 580 ----12441
NM_032968chrX73452 3196 1561 1248 878 640 219 13898 2999 155 --
NM_032969chrX73452 3196 1561 1248 878 640 219 13898 2999 155 --
NM_032973chrY63448 3191 1560 878 640 219 13890 2999 155 --
NM_033020chr1104570 3958 3452 3430 3051 3019 1765 1681 1010 593 --13200 11578
NM_033133chr17103682 3326 3195 3049 2432 1210 1161 1132 985 747 ------
NM_033143chr484471 4366 3726 3669 3320 624 553 55 --11413 --
NM_033181chr653357 3317 1009 677 490 --11499 --
NM_033224chr7117711 6161 5991 5922 2718 2162 2090 1414 1074 475 380 48032 5885 5336 3016 16247 36031 5595 5481
NM_033285chr894416 4187 3761 3110 1669 1173 297 242 192 --1485 --
NM_033360chr1283949 3558 3419 1807 1480 1465 1253 933 ------
NM_033429chr1552926 2529 2366 2042 958 --32843 2614 837 1597
NM_033631chr183746 3012 2864 2615 2543 2527 938 315 12970 12431 --
NM_033637chr1093888 3479 3322 2617 1586 1062 844 199 89 13450 11001 --
NM_052832chr873002 2493 1025 909 729 715 481 --11217 --
NM_052834chr1862280 2213 2054 1933 362 328 1312 1594 --
NM_052879chr1244107 4080 672 208 12533 ----
NM_052885chr1264734 4355 3540 3346 1888 520 2773 342 ----
NM_052904chr671278 554 475 440 297 199 192 ------
NM_052905chr261653 1196 743 728 221 175 ------
NM_052907chr1264310 4267 2841 233 92 74 33822 3318 1046 23841 2704 --
NM_052910chr1372179 1933 1851 1685 1620 1466 787 ------
NM_052927chr551776 1669 697 484 129 1536 --11438
NM_053016chr977973 7322 5575 5447 4995 1413 1345 27108 6852 11725 --
NM_053023chr1162482 1075 1054 960 708 245 --1861 1296
NM_053043chr785544 5367 5194 2363 1596 945 671 188 1594 25772 1773 --
NM_057175chr462650 2520 1768 744 689 604 1532 1940 11859
NM_080629chr121061 947 ----132
NM_080630chr121061 947 ----132
NM_080676chr2042955 2388 1134 451 1641 12375 1727
NM_080832chrX71492 1395 1150 668 437 410 347 ------
NM_130391chr963374 1416 1221 569 366 44 13288 1857 --
NM_130392chr963374 1416 1221 569 366 44 13288 1857 --
NM_130393chr963374 1416 1221 569 366 44 13288 1857 --
NM_130434chr1521089 1019 ----169
NM_130438chr2183389 2229 2163 874 679 286 271 99 1557 33421 2300 1352 22520 71
NM_133170chr2097320 6178 5851 5393 4981 2929 2059 1176 674 25953 5199 36954 5616 5483 12751
NM_133265chrX52991 1219 1155 454 32 --32871 273 120 --
NM_133334chr4166278 5831 5347 5187 4887 4659 4442 4434 4418 4226 2559 2435 1748 1393 411 300 12285 ----
NM_133478chr262563 2280 1779 1700 510 434 1989 12498 11985
NM_133493chr643301 1255 411 142 ----14641
NM_133646chr275341 1880 1818 1677 1509 931 223 24879 885 ----
NM_133647chr1593798 3780 3620 3547 1326 796 358 276 213 13658 33354 2471 891 --
NM_134442chr261420 1369 1077 700 601 217 11700 --11087
NM_138270chrX52922 2108 1369 1019 917 ----178
NM_138288chr1492257 2152 1758 807 569 509 284 226 101 ------
NM_138444chr1364198 3716 3182 1805 1513 801 34888 1630 1169 24166 1942 --
NM_138459chr663685 2893 2761 1352 838 125 ------
NM_138468chr2105830 5388 5285 4940 4714 4379 1824 1049 890 318 22447 1619 ----
NM_138621chr242912 1041 947 325 41426 1078 963 186 13261 --
NM_138694chr683635 3489 3320 2701 2672 481 320 284 13175 --13242
NM_138713chr16106886 5687 3111 2722 2139 588 468 440 220 192 16782 ----
NM_138714chr16106886 5687 3111 2722 2139 588 468 440 220 192 16782 ----
NM_138731chr14104204 3820 2946 1624 1475 904 660 445 273 63 ------
NM_138959chr176103 5415 4975 4691 2117 876 824 16683 --26218 4410
NM_139168chr54500 418 116 65 1197 11921 --
NM_139279chr272605 2574 2463 891 796 687 659 13302 43260 3075 2985 1366 --
NM_144571chr496584 5783 5496 2754 1984 1521 1341 306 222 16743 1260 35877 4976 498
NM_144578chr1475495 5105 4463 2023 1889 1184 454 --1560 14529
NM_144590chr1062893 2146 2083 2056 1927 670 ------
NM_144599chr15114276 3833 2203 2073 1308 1190 758 304 204 155 120 --54648 3977 1742 1385 642 --
NM_144664chr1151829 1613 564 341 245 --12112 11630
NM_144778chr1352710 2584 2509 860 678 12303 --191
NM_144949chr22244 184 11718 1358 --
NM_144973chr1265276 4519 4253 3626 3475 1571 21881 1065 15028 11387
NM_145113chr1451008 997 511 437 151 11179 --11397
NM_145251chr1431020 511 461 1180 ----
NM_145259chr296927 6613 5560 5011 1554 1526 1355 1155 616 --12679 --
NM_145307chr10124585 4476 4449 4330 4066 3188 1688 1189 969 787 209 28 ------
NM_145320chr773239 2601 1185 971 918 740 295 ------
NM_145321chr773239 2601 1185 971 918 740 295 ------
NM_145322chr773239 2601 1185 971 918 740 295 ------
NM_148955chr1565948 4366 2369 2186 1587 233 --22056 1433 --
NM_152277chr531928 717 276 ----1744
NM_152330chr1422676 2529 22335 715 --1460
NM_152388chr273374 3234 2627 1340 1125 1028 134 --12730 --
NM_152407chr572144 2128 2000 1012 768 394 336 ------
NM_152409chr533186 2929 2626 13225 32642 2275 968 --
NM_152447chr141350 ----1315
NM_152455chr1542162 1885 64 35 ----12775
NM_152529chr284227 4162 4059 3857 2781 2692 1709 1223 34343 3319 611 --188
NM_152622chr512356 ----22528 203
NM_152629chr942650 1520 829 600 23359 3060 --1575
NM_152688chr62906 702 ----1350
NM_152699chr373456 3299 3050 2808 2454 1488 804 23616 3337 13533 13076
NM_152724chr1052487 2184 988 361 219 12449 11021 --
NM_152758chr863065 2020 1155 1124 341 125 22040 624 12530 --
NM_152774chr722106 1919 1848 --11798
NM_152787chrX61229 1094 1070 1056 715 481 --13528 --
NM_152793chr774458 4295 3896 3429 1964 1468 309 11400 11102 --
NM_152826chr1565948 4366 2369 2186 1587 233 --22056 1433 --
NM_152835chr162957 2822 2420 2247 1913 775 --150 21931 1850
NM_152838chr2033550 3015 2337 --12411 13508
NM_152903chr1342460 2230 1806 186 11825 12604 --
NM_152996chr171907 1577 821 800 713 587 221 --2418 339 --
NM_153020chr641426 1313 672 82 1277 194 --
NM_153022chr1251663 1632 410 398 390 --1617 --
NM_153182chr383166 2748 2641 2313 1243 1179 1171 1112 13157 ----
NM_153184chr341983 410 269 241 ------
NM_153188chr585291 4455 3609 3453 1904 1388 1005 210 15510 --14186
NM_153235chr651892 393 207 56 50 12062 ----
NM_153262chr143202 1962 1178 241 12132 --11163
NM_153332chr863147 2441 927 860 372 230 ------
NM_153346chrX21599 1538 ----1329
NM_153365chr452660 2603 2224 1989 258 --11004 12531
NM_153371chr1362062 1848 1466 850 401 385 ------
NM_153619chr1543637 3572 2414 2270 1207 --12391
NM_153620chr761667 632 583 415 191 137 1715 ----
NM_153634chr1261676 1562 1456 619 475 408 1196 1117 1270
NM_153689chr261795 1640 1602 584 548 157 --1378 --
NM_170665chr1283823 3268 3109 2820 2809 1620 1253 329 4901 770 346 318 11271 --
NM_170679chr551192 1053 840 392 106 11097 ----
NM_170686chr793200 2724 2383 1177 1045 961 830 333 43 12662 ----
NM_170709chr852431 1656 592 550 531 --1347 12103
NM_172070chr242231 2080 89 58 ------
NM_172071chr177478 7399 6594 6505 5587 5374 2150 17173 ----
NM_172127chr42556 276 --154 1362
NM_172128chr42512 232 ----1318
NM_173054chr72775 359 1805 --1288
NM_173198chr952985 2926 1204 530 311 22895 2124 11005 --
NM_173200chr952985 2926 1204 530 311 22895 2124 11005 --
NM_173214chr16106886 5687 3111 2722 2139 588 468 440 220 192 16782 ----
NM_173468chr485585 5210 4199 2009 1754 1742 1292 640 12405 --15421
NM_173496chr1052405 1146 1031 651 252 1945 2683 400 --
NM_173519chr842067 1998 1787 466 11466 ----
NM_173576chr1052147 2057 1956 1626 418 ------
NM_173591chr1251037 905 796 757 100 --1169 --
NM_173602chr1273744 3504 3261 881 659 435 197 ----22977 1395
NM_173642chr1108129 7520 7307 7256 7112 6060 3271 2737 2671 126 17539 ----
NM_173694chrX32596 2332 362 ----11855
NM_173808chr174147 3681 3448 1275 844 604 409 24029 4017 24129 103 13540
NM_173812chr1231449 1012 484 21313 101 ----
NM_173826chr33593 472 82 31145 693 304 ----
NM_173829chr575791 5442 5113 5024 1909 1551 334 13843 14424 --
NM_174890chr101205 ----1578
NM_175061chr76727 536 398 259 88 40 12116 11877 --
NM_175607chr351607 1227 1155 1067 317 ------
NM_175612chr351607 1227 1155 1067 317 ------
NM_175623chr12137542 7242 7175 7060 6274 5985 5793 5746 4863 3037 1870 1324 1104 ----46988 5478 5444 4766
NM_175736chr12107778 7351 7311 6484 5374 4888 2383 2159 1315 866 26140 5061 16013 25554 2609
NM_175854chr1362784 2686 2577 1795 1722 49 --11007 --
NM_175861chr1285090 4898 4175 3954 3761 3736 1784 1058 24986 2133 21354 82 --
NM_176081chr1065839 5793 5425 1569 1176 345 1527 --25434 913
NM_176083chr1065839 5793 5425 1569 1176 345 1527 --25434 913
NM_177424chr151777 1466 719 658 457 ------
NM_177438chr1473971 3790 2776 1519 383 166 138 1151 --12948
NM_177452chr1432184 2095 134 21754 350 128 --
NM_177538chr265719 5703 2609 2364 2110 751 11466 16481 --
NM_177985chr261974 1963 1651 1612 1505 386 ----1754
NM_178011chr1073305 2896 2889 2266 1216 777 424 1891 1696 --
NM_178037chr1283375 3220 2712 2556 2522 1062 810 345 11293 2755 637 1303
NM_178038chr1283375 3220 2712 2556 2522 1062 810 345 11293 2755 637 1303
NM_178151chrX137776 7073 6273 5462 5258 2670 2655 2395 2388 1340 944 734 82 15400 37129 1192 867 25848 1165
NM_178152chrX137776 7073 6273 5462 5258 2670 2655 2395 2388 1340 944 734 82 15400 37129 1192 867 25848 1165
NM_178153chrX137776 7073 6273 5462 5258 2670 2655 2395 2388 1340 944 734 82 15400 37129 1192 867 25848 1165
NM_178539chr1221986 548 --2847 119 1210
NM_178585chr453263 2959 2928 2556 1071 23052 2324 12041 12453
NM_178812chr831545 1264 277 1299 21424 1360 1190
NM_178815chr1052071 1015 233 185 82 ----22728 884
NM_180989chr1311800 1804 --1869
NM_181077chr153790 469 215 11842 31991 1805 1634 12244
NM_181481chr18116871 6847 5669 5499 5248 5207 4841 4516 1667 1202 982 15567 36799 4379 1153 35092 4873 2825
NM_181482chr18116871 6847 5669 5499 5248 5207 4841 4516 1667 1202 982 15567 36799 4379 1153 35092 4873 2825
NM_181483chr18116871 6847 5669 5499 5248 5207 4841 4516 1667 1202 982 15567 36799 4379 1153 35092 4873 2825
NM_181504chr543696 3463 1134 758 42803 2596 1073 656 ----
NM_181521chr1677240 7105 6871 5957 4725 4499 1711 --12561 14395
NM_181523chr543696 3463 1134 758 42803 2596 1073 656 ----
NM_181524chr543696 3463 1134 758 42803 2596 1073 656 ----
NM_181723chr83773 604 315 ----1665
NM_181836chr552191 1759 896 692 231 --12657 --
NM_181886chr431411 1120 567 11389 --1533
NM_181887chr431411 1120 567 11389 --1533
NM_181888chr431411 1120 567 11389 --1533
NM_181889chr431411 1120 567 11389 --1533
NM_181890chr431411 1120 567 11389 --1533
NM_181891chr431411 1120 567 11389 --1533
NM_181893chr431411 1120 567 11389 --1533
NM_182501chr262563 2044 1289 871 292 284 1549 ----
NM_182607chrX51695 689 280 176 165 ------
NM_182641chr1762003 1719 703 607 195 138 21986 173 ----
NM_182666chr3--1115 --1429
NM_182757chr682481 2421 2398 1286 1266 1008 591 149 33098 2907 877 2510 209 --
NM_182758chr1543654 606 548 284 11230 13737 --
NM_182762chr7106228 5907 5722 5176 4430 4260 2474 1474 870 434 1692 25285 1323 --
NM_182896chr351773 1310 173 67 35 11160 1197 --
NM_182898chr7155965 5615 5303 5276 5018 4290 2396 2329 2323 2088 2078 1774 1657 1409 1270 25761 5005 ----
NM_182899chr7155965 5615 5303 5276 5018 4290 2396 2329 2323 2088 2078 1774 1657 1409 1270 25761 5005 ----
NM_182972chr132520 2325 1081 ----12539
NM_183004chr1433739 749 102 --2446 27 --
NM_194071chr795286 5269 4540 4533 1667 1174 550 488 295 11082 15218 --
NM_194247chr2104557 4004 3837 3652 3486 3249 1362 471 434 388 33070 1754 1241 ----
NM_194283chr554219 3086 936 921 313 23870 1323 ----
NM_194285chr1142685 2356 2110 671 11264 ----
NM_194291chr84829 329 240 91 12836 1231 --
NM_194298chr1031636 1419 266 ----162
NM_194434chr1844790 4486 1798 576 --13889 23526 602
NM_197941chr562567 2425 1882 489 301 155 ------
NM_198212chr74928 561 302 238 11497 ----
NM_198270chrX33348 894 876 ----11205
NM_198273chr522330 123 32449 1101 559 ----
NM_198281chr463059 3027 2627 2557 1078 245 --12152 22766 2577
NM_198381chr1131420 935 287 165 --1882
NM_198581chr295212 4750 2708 2621 1740 990 852 423 273 22449 1034 35814 974 778 --
NM_198715chr195642 5598 5482 5212 5085 4572 2176 538 204 36107 4107 2381 11057 --
NM_198793chr372975 1034 864 648 635 445 267 14020 ----
NM_198859chr365050 4817 4437 3424 1711 935 --24685 161 14332
NM_198889chr441052 1024 948 434 1405 21163 1046 --
NM_198896chr1162000 1661 1419 482 270 227 --1327 --
NM_198900chr12107778 7351 7311 6484 5374 4888 2383 2159 1315 866 26140 5061 16013 25554 2609
NM_198901chr7132 11270 1113 11231
NM_198904chr541893 1376 812 553 1417 ----
NM_198935chr2062877 2843 2538 2001 1198 925 12478 12834 1381
NM_199000chr771976 325 156 79 63 43 23 --1452 2407 181
NM_199188chr1244107 4080 672 208 12533 ----
NM_199190chr1244107 4080 672 208 12533 ----
NM_199437chr1132547 483 283 12300 --21595 747
NM_199438chr1132547 483 283 12300 --21595 747
NM_199439chr1132547 483 283 12300 --21595 747
NM_199461chr1053526 3444 950 827 111 22500 1363 13347 --
NM_199462chr194893 4591 4081 3677 3289 3151 1323 723 361 54378 3659 1996 1470 953 1194 --
NM_201263chr151576 637 617 461 386 31761 805 91 ----
NM_201570chr1051845 1472 351 151 56 ----1668
NM_201571chr1051845 1472 351 151 56 ----1668
NM_201572chr1051845 1472 351 151 56 ----1668
NM_201590chr1051845 1472 351 151 56 ----1668
NM_201591chr451883 1672 1636 1226 626 1463 11733 --
NM_201592chr451883 1672 1636 1226 626 1463 11733 --
NM_201593chr1051845 1472 351 151 56 ----1668
NM_201596chr1051845 1472 351 151 56 ----1668
NM_201597chr1051845 1472 351 151 56 ----1668
NM_201613chr124659 575 106 73 ------
NM_201628chr183380 2428 2400 2273 2262 2063 1183 778 ------
NM_203350chr1----21171 1124 1439
NM_203406chr532504 2427 936 --22068 830 11920
NM_203446chr2152550 2490 2155 2097 1181 1824 32694 2472 2398 --
NM_203487chr132554 485 21206 295 --179
NM_203504chr472338 797 630 527 517 501 179 1447 ----
NM_203505chr472338 797 630 527 517 501 179 1447 ----
NM_205860chr173180 3149 2774 2418 2261 1996 480 --12332 --
NM_206594chr152883 2533 1195 1117 92 12598 --1110
NM_206595chr152883 2533 1195 1117 92 12598 --1110
NM_206853chr653481 2515 1359 532 49 12548 167 --
NM_206854chr674742 3776 3607 3320 1793 1310 30 13809 11328 --
NM_206855chr685707 4741 4572 4285 2275 995 491 230 14774 12293 --
NM_206866chr2132880 2416 90 11029 22779 339 --
NM_206907chr53467 458 370 22807 2590 22693 1255 12276
NM_207012chr1063316 3281 2764 2585 953 286 23259 350 11265 --
NM_207015chr352060 1580 1552 539 448 12407 1922 --
NM_207304chr1352597 2471 2396 747 565 12190 ----
NM_207361chr13136340 6249 5009 4830 4819 4643 4546 4149 3843 1697 1292 1269 785 2417 324 25153 2091 14105
NM_207406chr4106433 5404 5154 4836 4739 4482 2430 2212 1426 1102 24599 186 ----
NM_207445chr1581695 1603 1503 748 645 612 355 193 --1760 --
NM_212558chr974022 3204 2823 2633 874 665 255 23731 1234 ----