TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-127-3p
miRNA Sequence: UCGGAUCCGUCUGAGCUUGGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001005473chr546487 5095 2470 1267 --16509 15153
NM_001106chr3119675 9635 9577 8070 7396 6123 3371 3035 2196 2020 573 --1324 140
NM_002270chr555344 2265 1570 1296 39 13657 11122 --
NM_004798chr2042938 2882 2809 531 --2593 82 12593
NM_004852chr181113787 12710 12611 12425 10552 9364 8879 5150 2992 2881 86 --1729 110457
NM_007011chr1576690 6669 6518 6005 5141 1732 1698 --16343 21284 101
NM_007114chr312474 1616 --13325
NM_172071chr11299 --26980 4524 11727