TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-127-5p
miRNA Sequence: CUGAAGCUCAGAGGGCUCUGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr821964 462 1228 ----
NM_000052chrX21383 799 33273 3109 2486 2820 188 22637 2557
NM_000076chr11------1235
NM_000084chrX156952 6589 6450 5895 5610 4937 4297 2681 2535 1993 949 943 824 718 202 14615 26532 878 16425
NM_000089chr71726 --1180 --
NM_000109chrX72657 1922 1864 1829 1064 418 225 --42364 2241 1994 1713 --
NM_000115chr13----11002 --
NM_000129chr6------1242
NM_000163chr511699 --12133 11924
NM_000165chr631483 1204 517 --11644 --
NM_000176chr563637 3377 2449 796 630 49 --23118 1543 12439
NM_000208chr1934608 3623 3082 1258 23242 373 1485
NM_000218chr112964 381 --1930 --
NM_000248chr362307 1100 881 515 266 123 --11989 --
NM_000255chr6123 --1121 --
NM_000259chr1544034 2175 1455 689 --22434 1801 15666
NM_000264chr953209 3066 881 573 241 --1324 --
NM_000266chrX2396 23 --1855 --
NM_000271chr181130 --1441 --
NM_000280chr113384 117 80 ------
NM_000289chr12----1298 --
NM_000314chr1052805 2566 1050 1031 383 22982 2321 --12812
NM_000321chr1341711 1696 1384 282 --11375 21480 1241
NM_000332chr697180 6941 6859 6150 5981 4579 4545 2142 272 36568 4992 2022 25219 541 11307
NM_000337chr5105799 5652 5097 5027 4524 4314 4133 2630 224 53 --22382 513 --
NM_000345chr42892 23 1243 ----
NM_000346chr1761909 1881 1324 1221 807 571 ------
NM_000366chr153216 62 53 ------
NM_000382chr173693 478 389 11890 ----
NM_000396chr11133 1153 --1360
NM_000408chr272741 2700 2336 2287 1096 663 206 12728 2727 165 --
NM_000411chr2152853 2825 2527 1272 875 12473 33086 2635 888 22293 1110
NM_000428chr1431867 739 224 1217 1167 --
NM_000439chr511559 --22402 1868 12136
NM_000477chr41306 ------
NM_000480chr1121628 1388 --11167 --
NM_000484chr212403 49 1382 1975 --
NM_000486chr1242581 2307 1189 236 13099 11059 --
NM_000489chrX112999 2711 2693 2668 2369 2352 1149 1125 1079 853 528 --13399 12106
NM_000503chr841596 1466 345 310 --1520 --
NM_000522chr72847 44 ------
NM_000530chr1----1322 --
NM_000533chrX41704 1625 1438 208 --11654 --
NM_000589chr5----132 --
NM_000612chr1133239 2680 119 33421 397 237 12426 --
NM_000615chr1142760 2614 846 627 --2408 53 --
NM_000618chr1265783 5697 4164 1984 1276 742 --1646 15028
NM_000670chr41522 ----1141
NM_000678chr20----1727 --
NM_000693chr1531730 1490 117 1648 --11213
NM_000706chr121305 --1287 --
NM_000719chr1265647 2172 747 688 306 62 21516 40 36618 1743 1595 --
NM_000793chr1443828 3159 1958 536 --1746 --
NM_000801chr2041116 981 163 96 --2933 288 1830
NM_000806chr571861 1569 1450 724 431 114 83 31520 695 409 --1525
NM_000813chr555326 4724 1946 1174 896 14237 15575 --
NM_000814chr1563224 2719 2666 1433 557 549 --1792 --
NM_000816chr5--2569 212 ----
NM_000828chrX21452 754 21968 61 ----
NM_000831chr186159 5707 5050 4076 2472 1200 313 187 --45736 1979 1920 1673 --
NM_000833chr161156 --1536 --
NM_000859chr541598 1297 1174 208 11400 11730 --
NM_000868chrX3902 708 129 ------
NM_000875chr15117022 5655 5114 4611 4471 2205 1115 843 347 202 149 15355 15816 12483
NM_000891chr17--2495 143 --12734
NM_000899chr1252966 1592 1541 1431 63 13693 31172 566 378 22813 81
NM_000901chr462270 2189 673 334 119 36 --1972 --
NM_000945chr251398 1367 774 674 352 21784 378 ----
NM_000950chrX53444 3063 2846 2252 1426 --11306 13503
NM_000959chr143590 1279 886 106 --12711 1806
NM_000966chr123854 144 40 ------
NM_001001323chr1253031 2535 1050 786 455 --1588 --
NM_001001394chr2------1126
NM_001001395chr1262633 2446 2242 1985 1857 982 --11763 1659
NM_001001396chr194447 4086 3536 2976 1705 1521 1188 997 144 --33555 2859 56 11505
NM_001001396chr194447 4086 3536 2976 1705 1521 1188 997 144 --33555 2859 56 11505
NM_001001419chr534116 4042 428 15122 11887 --
NM_001001433chr2023028 564 --1663 --
NM_001001484chr101461 --11734 --
NM_001001549chr742763 1865 999 622 1461 ----
NM_001001556chr151165 --2546 511 --
NM_001001664chr223085 1233 22696 539 --31350 350 179
NM_001001890chr2134266 3985 719 --13537 --
NM_001001994chrX----1117 1363
NM_001001995chrX51803 757 678 545 203 --11938 --
NM_001002027chr17----177 --
NM_001002032chr171131 1730 ----
NM_001002843chr1531227 1182 483 --121 --
NM_001002860chr1473756 3636 3036 1877 1269 612 108 24496 3182 24184 3220 --
NM_001002909chr1721536 1529 ------
NM_001002926chr772735 2609 2429 2345 524 393 139 11945 --12849
NM_001003681chr2211780 11307 ----
NM_001003686chr71378 --1107 --
NM_001003792chr32991 72 --1971 --
NM_001003800chr951507 989 773 169 41 --1497 --
NM_001003800chr951507 989 773 169 41 --1497 --
NM_001004065chr962715 2638 2500 1402 1172 436 --1717 --
NM_001004317chr664384 1686 1630 906 849 678 14147 ----
NM_001004342chr1105466 5230 2223 2126 1847 1311 1246 641 510 300 14523 25751 2015 14417
NM_001005158chr32471 65 ----1426
NM_001005339chr10------131
NM_001005353chr111072 --11182 --
NM_001005354chr121491 --159 --
NM_001005417chr12702 492 --1157 --
NM_001005609chrX11420 22945 1276 ----
NM_001006610chr16----147 --
NM_001006634chr16197 --1699 --
NM_001007094chr1044235 1533 1294 605 --1349 --
NM_001007097chr994650 3941 3929 3637 1930 1790 1240 1152 973 --24875 3775 11525
NM_001007099chr11318 --1265 --
NM_001007237chr132435 739 326 1649 12558 --
NM_001007250chr1----2387 100 --
NM_001007257chr12399 182 11154 ----
NM_001007278chr1333260 911 557 24098 3640 11122 --
NM_001007553chr12958 811 1461 1258 --
NM_001007559chr183320 177 137 21579 284 1810 --
NM_001008239chr1852812 2725 2660 2602 340 12556 31138 91 85 --
NM_001008495chr831389 746 503 ------
NM_001008541chr1042093 1971 1897 1816 --21525 397 --
NM_001008726chr1411679 1264 189 142
NM_001008783chr62688 254 --1838 1626
NM_001008925chr453113 3045 2573 633 492 22593 499 21338 96 --
NM_001008938chr111330 --134 --
NM_001009554chr483899 3454 3256 2949 1442 977 681 428 24755 3597 22884 252 --
NM_001009555chr411312 --11288 --
NM_001009899chr3135574 5189 4977 4771 4083 2434 2302 2168 1861 1522 843 576 455 11150 24399 2542 --
NM_001009955chr11406 --1173 --
NM_001009959chr232361 2054 1605 --1824 1197
NM_001009993chr273914 3821 2877 1461 1058 945 787 13445 ----
NM_001010853chr643240 2650 1126 1048 --1950 --
NM_001010854chr141212 ----1692
NM_001010891chr5146743 6470 6436 5704 5274 4420 4295 2693 2004 1304 1064 1019 989 497 --12524 --
NM_001010922chr163980 3099 2873 1599 579 468 --12815 11052
NM_001010971chr131019 653 314 --158 --
NM_001010980chr162734 2627 1098 614 416 94 --183 --
NM_001010989chr162509 199 ----1226
NM_001011513chr463927 3261 2508 1556 1024 167 --22791 238 1138
NM_001011537chr352384 2294 2179 1516 593 --21557 581 --
NM_001011538chr4----1409 1659
NM_001011666chr7106440 4689 4407 2355 1924 1820 947 768 353 297 14190 35722 4433 2045 35812 4536 2383
NM_001011713chr1441152 1111 1048 438 ------
NM_001012279chr63478 460 207 1234 ----
NM_001012333chr11------1117
NM_001012410chr31127 --185 --
NM_001012423chr1552634 2372 1123 687 622 12004 22804 1928 --
NM_001012446chr9275 63 ------
NM_001012968chrX52769 2624 2134 761 431 --2502 154 12469
NM_001013031chr1041001 957 694 495 --11048 1146
NM_001013406chr731739 1217 644 --1576 --
NM_001013415chr43541 256 234 ------
NM_001013437chr181332 ------
NM_001013438chr31151 --1807 --
NM_001014283chr1361952 1773 1625 1599 636 234 --1746 --
NM_001015045chr432426 1971 286 ------
NM_001017368chr1772824 2561 2212 1063 961 872 390 22600 461 1328 12846
NM_001017369chr42804 259 --1995 --
NM_001017395chr333287 2665 2220 --11394 --
NM_001017440chr7147640 7581 6873 6560 5383 5361 3298 1789 1624 1545 825 742 661 505 2272 218 25165 175 --
NM_001017523chr1241871 1531 403 61 ------
NM_001017923chr1421408 669 --1114 --
NM_001017926chr841780 1503 1182 617 --11370 --
NM_001017930chrX----11474 1485
NM_001017977chr1----180 --
NM_001017979chr42248 131 ------
NM_001017995chr594567 4043 3005 1873 1112 465 157 95 47 24857 4217 14863 --
NM_001018009chr3----1128 --
NM_001018067chr175056 4673 3450 1998 752 349 55 --11115 --
NM_001018089chr1563982 3601 3375 2835 1601 784 ------
NM_001023567chr1542460 2195 690 625 --11949 --
NM_001023587chr341097 819 121 91 11075 ----
NM_001024218chr142280 24 ------
NM_001024463chr1521091 446 ------
NM_001024596chr19133632 3318 3196 3092 2900 2458 2222 1462 1321 946 763 667 429 22870 288 ----
NM_001024647chr12126870 6839 6832 6674 6498 5755 5601 5094 967 911 447 369 1477 11604 27559 5500
NM_001024649chr552509 2103 909 726 702 --1994 11937
NM_001024666chrX2674 460 ------
NM_001024847chr352125 1623 1609 1555 986 ----11769
NM_001024947chr5------1209
NM_001025076chr1066227 4655 4024 2235 813 38 1746 21120 112 14562
NM_001025252chr833152 2880 312 --1114 --
NM_001025266chr3124724 4617 4014 3965 3907 3701 1605 1095 878 861 154 44 14713 13000 33391 3384 1422
NM_001025356chr1262434 1170 844 466 387 41 --32542 571 147 --
NM_001025580chrX64191 3902 3539 3072 2626 113 33466 2684 1097 --1135
NM_001029875chr532656 1102 725 ----22067 578
NM_001029998chr421204 560 ------
NM_001030006chr1782344 2153 1764 710 525 259 203 176 ------
NM_001030007chr1693705 3556 3411 2832 2743 2446 1352 1226 697 33587 2506 1600 --1977
NM_001030055chr1484721 4553 3690 3141 3100 2970 90 63 13703 --34702 3666 1758
NM_001031684chr211195 ----11471
NM_001031716chr21958 --21032 301 --
NM_001031812chr511755 ----1206
NM_001032280chr631372 1310 431 ------
NM_001032293chr174235 221 90 75 ------
NM_001032296chr1321995 836 1376 --1818
NM_001032380chr1031487 1281 317 ----1713
NM_001032393chrX2570 145 ------
NM_001033049chr2142391 2299 738 323 ------
NM_001033057chr32796 78 --21965 1759 --
NM_001033117chr384659 3555 3426 3390 3241 1316 288 70 ------
NM_001033557chr231355 1118 1081 152 ----
NM_001033925chr10--2830 43 --11695
NM_001034025chr12----1805 --
NM_001034841chr1675538 4592 3976 1858 1751 661 163 --23648 135 12113
NM_001034850chr521651 424 ----1103
NM_001035260chr101644 --11535 --
NM_001037132chr731779 1513 640 --11455 --
NM_001037164chr731678 521 117 ------
NM_001037172chr3------11166
NM_001037174chr221755 1585 --1315 --
NM_001037334chr1831737 769 106 --175 --
NM_001037339chr151772 1681 1298 484 309 --11662 --
NM_001037954chr1183444 2416 2355 866 455 123 96 54 ------
NM_001038493chr231564 1067 484 11183 11204 --
NM_001039199chr20104859 4743 4649 4592 3416 3388 3315 3273 3114 1653 14885 ----
NM_001039490chr11------1139
NM_001039538chr242724 2712 2624 215 --1736 12882
NM_001039577chr164424 3487 3241 1682 1089 395 11051 ----
NM_001039590chrX33667 749 662 --1472 --
NM_001039618chr11125766 5109 4303 3963 3898 3889 2291 1926 1464 1413 1089 213 11117 ----
NM_001039690chr1682132 1870 1845 1463 883 868 328 286 1240 1221 --
NM_001039802chr121279 1067 1252 ----
NM_001039840chrX65018 4958 2306 511 424 414 11905 25826 1352 --
NM_001040057chr741085 972 581 484 ------
NM_001040101chr411469 --11219 --
NM_001040108chr1452536 2349 2042 528 499 11997 53045 2998 2490 2074 366 --
NM_001040110chr711241 --11562 --
NM_001040152chr763888 3794 1968 1694 1204 802 ------
NM_001040284chr16105843 5463 4704 4672 2330 1929 1631 1400 1060 314 11368 --11157
NM_001040402chr453250 3079 2779 1031 947 13195 12058 12848
NM_001040429chr1332841 1384 475 1115 ----
NM_001040441chr123713 1994 34286 4190 399 23631 2041 --
NM_001040446chr572221 1798 894 866 586 400 315 --1440 12618
NM_001040450chr1522611 409 --2552 199 --
NM_001040613chr83593 277 169 --1144 --
NM_001040665chr774736 4281 3604 3563 3063 748 355 13454 1697 --
NM_001040709chr152453 1919 178 122 60 1387 --1692
NM_001040712chr973090 2783 2775 2523 1206 540 390 13202 ----
NM_001042355chr1634547 3833 3519 --54946 3638 1376 1025 980 1263
NM_001042413chr944134 3692 998 167 ----13974
NM_001042440chr542019 1616 1259 297 --1266 --
NM_001042472chr20----1604 --
NM_001042473chr101810 --1691 --
NM_001042481chr1462165 2081 965 862 820 259 --12538 --
NM_001042486chr20----1179 --
NM_001042494chr1533628 3035 2531 12341 1427 --
NM_001042510chr831455 674 155 --21529 1441 --
NM_001042555chr1244730 4029 1927 66 ------
NM_001042603chr1295068 4784 4523 1781 1058 961 923 802 142 11317 24940 3833 11272
NM_001042632chr2032414 2234 837 ------
NM_001042681chr172239 2090 1809 1785 811 291 266 --12472 --
NM_001042683chr621456 1149 11770 ----
NM_001042749chrX21763 623 ------
NM_001043351chr131965 1649 1587 --11421 1605
NM_001046chr542462 2030 1861 997 --12588 --
NM_001049chr1422031 206 22210 731 11771 --
NM_001071775chr13----1147 1290
NM_001096chr17191 --1190 --
NM_001099678chr395425 4674 4567 2244 2204 2183 1166 991 147 --31657 1274 221 --
NM_001100108chr1137339 7310 7192 7139 6627 6547 6402 5287 5215 3266 3054 1531 747 --35098 1550 157 --
NM_001106chr3138746 8145 7498 7254 6945 6219 2947 2516 2272 1388 1376 851 476 26648 1292 26055 1858 12475
NM_001121chr102431 365 1455 ----
NM_001146chr822253 1914 2284 249 --11718
NM_001167chrX96049 5672 4579 2620 2047 1970 1632 1336 365 11119 21378 971 --
NM_001174chrX32188 2047 50 --21556 203 --
NM_001174chrX32188 2047 50 --21556 203 --
NM_001201chr453991 3918 3631 3621 2595 1110 22831 2621 --
NM_001204chr276654 6439 5310 4737 539 351 87 22363 136 ----
NM_001206chr931982 1097 517 12840 12260 --
NM_001222chr1031963 1299 440 --11763 --
NM_001241chr21233 2521 213 11746 --
NM_001259chr7105912 5409 5010 4748 3915 2291 1948 1595 825 793 23955 236 22328 200 14031
NM_001304chr17103681 3584 3032 2780 1196 1183 1128 564 342 109 ----1425
NM_001316chr202202 56 1144 --1471
NM_001326chr11------1463
NM_001332chr541527 431 387 274 1597 11316 --
NM_001351chr331511 727 423 --1514 --
NM_001356chrX21954 579 12336 12399 187
NM_001358chr41115 ----142
NM_001364chr1144225 3772 3448 1783 1354 1640 --
NM_001387chr522911 2373 --1168 --
NM_001390chr1821451 1013 21388 262 12727 11086
NM_001391chr183425 280 70 --1953 2885 265
NM_001394chr8----2363 267 --
NM_001400chr131035 365 254 185 11347 1396
NM_001408chr13511 410 80 ------
NM_001419chr1974718 4520 4345 3096 771 337 207 2444 309 1688 --
NM_001430chr221676 1596 --41891 383 377 53 --
NM_001438chr163679 3466 2958 2788 181 150 23162 2368 31066 908 409 13010
NM_001440chr822715 735 --1359 --
NM_001453chr621668 324 ------
NM_001455chr644518 3520 1721 540 14608 13197 --
NM_001482chr15--3228 103 77 ----
NM_001498chr631405 1229 1082 1499 11064 --
NM_001508chr23814 278 119 ------
NM_001518chr72377 47 --11030 --
NM_001527chr6104726 4166 3951 3680 3092 1298 1207 385 213 85 ------
NM_001546chr6--1581 21146 396 --
NM_001554chr13548 248 220 ------
NM_001558chr1131694 659 426 --21539 461 --
NM_001584chr111282 1323 11127 --
NM_001616chr263350 3135 2832 2703 2656 556 11272 13114 --
NM_001663chr1431789 476 413 22075 1003 11966 --
NM_001668chr141961 1653 1518 454 --11863 --
NM_001690chr331650 812 108 --22447 2314 --
NM_001699chr1931549 1173 605 21309 312 ----
NM_001704chr61551 1460 ----
NM_001730chr131225 11446 1572 --
NM_001737chr52248 105 ------
NM_001753chr741398 1227 715 264 ------
NM_001755chr161872 --1476 --
NM_001759chr1274958 4801 4268 2071 1756 1603 685 15009 --14330
NM_001789chr341419 1367 503 35 ------
NM_001792chr1821107 1077 3373 292 83 ----
NM_001797chr161612 1769 --1781
NM_001804chr5------1794
NM_001830chrX73770 3595 3176 2503 818 618 118 23735 2545 --2215 198
NM_001838chr17----1159 1936
NM_001845chr1341390 1311 202 158 1424 ----
NM_001854chr11176 1945 --11393
NM_001858chr674819 4749 4708 4153 4059 1924 220 --2887 393 --
NM_001884chr51440 --1478 --
NM_001894chr2211131 --11235 --
NM_001903chr5------1680
NM_001938chr111204 --1144 11229
NM_001939chrX33131 1310 89 --11328 13065
NM_001942chr181432 ----11461
NM_001964chr511165 --2915 761 --
NM_001977chr4--21660 1236 1338 11346
NM_001981chr13738 309 262 11818 1339 12216
NM_001991chr1742188 2069 1547 377 --22039 1391 --
NM_002006chr465424 4957 4788 1031 697 269 --23534 1527 24363 3666
NM_002024chrX------22213 1769
NM_002025chrX129071 9062 8848 8532 8450 8347 7024 3433 3314 2260 1316 264 --32551 2314 1908 --
NM_002026chr22178 154 2908 228 2893 137 --
NM_002048chr911003 ------
NM_002054chr22482 441 ------
NM_002069chr741596 1500 1407 1352 --1433 --
NM_002073chr22------1628
NM_002076chr1242792 2248 2221 107 1121 ----
NM_002077chr931899 1791 497 --11847 11945
NM_002080chr162951 795 --164 1328
NM_002089chr4------1549
NM_002114chr62514 384 --1208 --
NM_002137chr741755 265 257 26 --42336 923 346 76 --
NM_002147chr171919 ------
NM_002154chr51515 2409 384 --145
NM_002161chr9----1433 --
NM_002196chr201328 21104 985 --11090
NM_002203chr532673 2556 1606 13110 24088 3770 --
NM_002211chr1021071 350 --2385 72 --
NM_002214chr785340 5237 4425 3751 1764 1740 1152 513 --21188 841 13583
NM_002228chr11995 ------
NM_002232chr13888 414 156 ------
NM_002252chr2----160 --
NM_002267chr1332058 1548 962 --11884 --
NM_002268chr3----11186 --
NM_002270chr564284 4145 3490 1594 1406 450 12072 15323 15390
NM_002271chr133580 572 171 --11503 1335
NM_002298chr1331057 364 175 --1355 --
NM_002336chr1264090 4042 3607 1927 1811 361 14986 --24831 4079
NM_002384chr181950 ----1172
NM_002395chr621369 186 11237 ----
NM_002399chr1551365 1210 1071 1015 932 ----1907
NM_002406chr51295 --11031 --
NM_002408chr141187 199 ----
NM_002430chr2211706 ----12227
NM_002480chr1271358 1096 1016 544 438 230 150 ------
NM_002499chr1552311 1698 647 551 213 --1779 --
NM_002500chr2----1512 1121
NM_002518chr21123 ----137
NM_002544chr171230 1265 ----
NM_002568chr8137 1425 ----
NM_002570chr152291 86 --1115 --
NM_002588chr521235 55 --186 --
NM_002610chr242453 2392 812 793 ----22170 1224
NM_002615chr17--190 1112 --
NM_002635chr12----1146 --
NM_002645chr1122040 21 ----12826
NM_002655chr8125334 5249 4718 4675 3489 3380 1973 738 502 453 167 154 21891 481 14369 --
NM_002657chr2073789 1537 1516 1336 835 356 92 --12725 --
NM_002660chr201980 ----1441
NM_002669chr41144 1130 ----
NM_002687chr1421122 449 --11175 --
NM_002698chr1922524 794 11059 1944 12138
NM_002699chr121363 1076 ------
NM_002709chr263571 3562 1428 1222 834 688 12599 1480 --
NM_002710chr12--11103 --1910
NM_002711chr72826 286 --1346 --
NM_002715chr531078 958 242 --1355 --
NM_002729chr10------1340
NM_002731chr122022 335 --12353 --
NM_002734chr173112 67 49 12121 22047 1870 --
NM_002748chr1511179 ------
NM_002843chr1123262 1379 ----12696
NM_002848chr12----11098 --
NM_002858chr121177 28 1279 21192 426 --
NM_002868chr1282212 2168 2132 2102 872 742 562 162 ------
NM_002869chr112793 757 --21463 163 --
NM_002874chr95410 369 342 293 241 3992 506 182 ----
NM_002886chr394889 4788 4208 4157 3297 1513 1267 1137 977 --23378 330 --
NM_002890chr5----1627 --
NM_002902chr15----157 --
NM_002906chr1121890 323 ------
NM_002924chr11403 --1441 --
NM_002959chr143297 2885 2761 1430 --24283 1691 --
NM_002970chrX1316 --1116 --
NM_002971chr31838 --1896 --
NM_002973chr121231 --1425 --
NM_002977chr273301 2959 2482 2354 1329 1093 705 12841 13078 --
NM_002999chr201187 ------
NM_003017chr61574 ----1554
NM_003022chrX21263 74 21292 81 11140 --
NM_003043chr354172 3903 3210 1288 259 --183 --
NM_003048chr292747 2597 2177 1941 1858 948 804 489 429 22522 352 12609 --
NM_003069chrX1497 --1319 --
NM_003070chr93695 571 250 --1129 --
NM_003071chr33821 308 257 ------
NM_003072chr19----194 --
NM_003074chr33854 819 287 --21554 1491 --
NM_003076chr122388 200 --11089 --
NM_003079chr172980 389 ----1362
NM_003081chr201148 --1252 --
NM_003088chr7------11140
NM_003107chr641986 1889 382 138 12036 --12077
NM_003108chr267199 7021 6707 6478 2658 1417 17186 15227 15307
NM_003112chr742078 2068 2015 118 12179 32529 907 761 --
NM_003118chr55807 741 655 418 252 ----1326
NM_003128chr221889 873 ----12356
NM_003140chrY------190
NM_003151chr2193 --1202 --
NM_003155chr81151 --22468 846 1678
NM_003161chr1722588 2428 --195 --
NM_003162chr21977 1230 ----
NM_003182chr71434 --131 1473
NM_003202chr521196 522 ----11317
NM_003214chr621221 554 1180 11170 --
NM_003216chr2262725 2520 2313 1294 1106 254 1914 1149 --
NM_003221chr6103457 3041 2643 1556 1465 1190 1046 1025 1003 588 --21607 1391 176
NM_003222chr202487 254 ------
NM_003234chr32852 153 --1762 --
NM_003253chr2121721 1280 21562 537 21631 1418 --
NM_003262chr394602 4095 3540 1967 1842 1532 1338 966 414 15145 1893 --
NM_003269chr61496 ------
NM_003286chr201313 --1889 --
NM_003288chr20----1631 1560
NM_003298chr3116007 5358 5220 5194 5087 3826 2260 2109 1520 1194 703 16191 26166 5998 12057
NM_003337chr531283 1234 685 11726 1503 1616
NM_003340chr43914 479 184 ----11060
NM_003342chr1753157 2700 2072 502 471 ------
NM_003344chr721431 1257 ------
NM_003372chrX1779 ----1158
NM_003374chr51630 ----1145
NM_003380chr10177 1303 ----
NM_003392chr323304 431 ----23638 2651
NM_003404chr2011339 21321 749 12018 --
NM_003405chr221524 --2497 155 --
NM_003406chr81627 1292 ----
NM_003410chrX42811 2198 735 540 ------
NM_003411chrY51751 1605 505 383 182 --21589 273 --
NM_003418chr31770 --1116 --
NM_003471chr332150 905 647 ----1840
NM_003473chr10--11125 ----
NM_003478chr1143273 3174 3119 2851 1754 ----
NM_003488chr173963 823 786 ----1282
NM_003574chr1874672 4573 4424 4177 3677 1668 1647 15611 ----
NM_003590chr263253 1287 1261 1167 189 159 11010 23491 182 13939
NM_003597chr232233 836 612 --1199 --
NM_003601chr41222 --1153 --
NM_003603chr452019 1880 1847 1384 237 --11832 --
NM_003629chr193153 3076 2922 2737 1323 1264 870 606 253 ----12600
NM_003632chr174780 726 604 595 ------
NM_003659chr21913 ----21044 967
NM_003705chr21823 1194 1200 --
NM_003714chr552924 2650 1094 552 393 1707 ----
NM_003716chr331029 381 308 ------
NM_003718chr7----1110 --
NM_003722chr332601 2059 1670 1190 12650 --
NM_003743chr231935 515 304 1544 ----
NM_003750chr102658 110 177 ----
NM_003760chr11563 --161 --
NM_003766chr17----1449 --
NM_003783chr11375 --1942 --
NM_003787chr1821280 44 1168 ----
NM_003800chr632303 1896 821 --1330 --
NM_003825chr1521535 539 --11300 --
NM_003850chr131491 1638 ----
NM_003873chr1042335 1774 220 204 12427 --1138
NM_003895chr21--31738 1704 445 ----
NM_003902chr13690 340 30 ------
NM_003913chr683962 3752 2688 1497 1128 972 611 339 --22850 1670 --
NM_003916chrX41170 946 259 129 ------
NM_003921chr121844 1613 11681 --11548
NM_003939chr10114000 3988 3892 3608 3524 1648 960 701 402 214 115 ----1458
NM_003966chr5137607 7511 7043 6551 3092 3066 2907 2128 1993 1145 640 82 22 25223 5176 27065 6723 --
NM_003971chr17----199 --
NM_003972chr1021324 144 --11106 --
NM_003993chr12339 217 ------
NM_004036chr2--1700 1751 --
NM_004056chr82311 146 --1772 --
NM_004077chr1221133 70 --1366 --
NM_004085chrX----1750 --
NM_004093chr1353183 2743 2666 2402 396 13247 23189 621 --
NM_004094chr141431 12789 1994 --
NM_004100chr632369 1975 867 11773 1289 --
NM_004109chr1111921 --22222 114 11545
NM_004112chr1731762 1424 1402 ------
NM_004124chr1433509 681 625 13120 --1814
NM_004161chr21506 ------
NM_004162chr331028 238 124 1199 ----
NM_004169chr17------1811
NM_004181chr4185 1262 ----
NM_004227chr752826 2142 1029 536 350 --12227 --
NM_004229chrX11404 11800 22258 2097 11436
NM_004236chr15--1571 --1189
NM_004261chr11907 ----1746
NM_004293chr933849 977 852 1685 --23326 3048
NM_004295chr1731291 1130 170 ------
NM_004301chr3147 --155 1145
NM_004311chr1043008 895 501 384 --11000 --
NM_004329chr1011010 --1215 --
NM_004331chr862382 1014 954 585 477 261 --22345 435 --
NM_004368chr191155 --1387 --
NM_004393chr331966 261 231 21536 587 ----
NM_004395chr51176 ------
NM_004423chr372130 2105 968 913 895 651 501 ------
NM_004426chr1221515 184 --21507 727 --
NM_004429chrX2162 120 --1916 --
NM_004430chr821034 769 11017 12802 --
NM_004432chr952251 886 764 422 286 --11478 --
NM_004438chr21332 1933 12691 --
NM_004440chr61474 --11273 --
NM_004498chr15------141
NM_004504chr243029 2873 2522 82 --13003 22471 98
NM_004529chr9----21025 157 --
NM_004540chr21------1790
NM_004578chr11230 --1355 --
NM_004586chrX95150 4868 4222 3701 3325 2165 2047 1329 684 43873 3499 2191 167 1203 35478 4895 1866
NM_004593chr32779 269 1809 ----
NM_004612chr964840 4082 3515 1339 923 440 23854 3837 ----
NM_004642chr121106 1513 ----
NM_004654chrY2978 460 ------
NM_004660chrY42079 1883 821 245 ----186
NM_004663chr1551277 1202 1017 204 186 --1150 --
NM_004710chr173864 336 194 --1628 --
NM_004718chr2------1673
NM_004719chr1262420 2196 2008 1832 1773 297 12444 12779 --
NM_004725chr1031257 441 431 ------
NM_004730chr541898 1601 1564 815 --11498 1627
NM_004734chr13----1190 --
NM_004736chr151878 1853 1837 844 372 --1814 --
NM_004745chr8116655 6134 5801 5180 4622 4560 4456 1528 1347 586 504 --21407 869 25612 1741
NM_004748chr1583971 2681 1357 1350 896 849 76 42 2988 763 23478 602 --
NM_004762chr1741613 1521 516 280 --1133 --
NM_004768chr131152 254 168 --11093 11087
NM_004774chr1722288 2142 12405 --12970
NM_004775chr1842204 1870 649 607 1619 1571 12142
NM_004776chr2061179 1147 1038 848 503 25 12272 ----
NM_004788chr1131904 1815 1672 --12474 --
NM_004807chr262538 2032 1966 1022 640 443 --12523 --
NM_004817chr91267 --1500 --
NM_004834chr273026 2804 2715 2700 2492 2067 1344 ------
NM_004836chr21639 --1257 --
NM_004849chr6--173 11713 --
NM_004850chr22701 357 ----1344
NM_004852chr182112396 12373 11609 10658 9448 8950 8844 8757 4649 4496 2820 2716 2577 2559 2516 2243 2189 2067 1922 444 376 1877 712884 11574 11191 10490 10048 9911 9735 513800 12144 9566 3896 665
NM_004857chr1463981 3840 3303 3087 1673 329 24770 3177 14688 --
NM_004859chr1722965 2683 --12957 1222
NM_004863chr1435017 4531 3663 --11319 13958
NM_004869chr1851404 1312 1167 601 490 --11322 --
NM_004887chr541124 749 430 213 --1352 --
NM_004906chr6--1186 1516 --
NM_004925chr91548 --1711 --
NM_004926chr1431580 1488 210 ------
NM_004929chr81511 --11173 11066
NM_004938chr92987 836 ------
NM_004956chr763047 2887 2813 1551 1269 588 --11301 24167 1487
NM_004969chr103458 389 89 ------
NM_004979chrX41169 415 340 233 --1138 --
NM_004992chrX106351 6000 3371 2787 2233 612 241 152 144 90 28488 6829 12553 --
NM_004999chr653666 1656 994 986 887 1770 22789 1519 11103
NM_005012chr1----1134 --
NM_005028chr1042360 2204 164 53 --11598 --
NM_005065chr1465161 4537 4145 1756 1232 210 11866 21277 683 --
NM_005066chr11730 1314 ----
NM_005067chr33852 661 289 2620 151 1918 --
NM_005096chrX21056 268 11273 ----
NM_005109chr321699 361 1277 1122 --
NM_005112chr41743 1999 1183 --
NM_005116chr20104485 4122 3278 3161 3032 2870 1595 1552 1306 310 23195 1786 ----
NM_005156chr955275 5138 4317 3640 1566 --24823 1370 --
NM_005188chr11138353 8308 7702 7487 5968 5318 5273 5042 3009 2137 2057 1639 1068 --37819 7276 1080 18184
NM_005225chr2021193 137 ------
NM_005238chr1122840 2631 ----13123
NM_005239chr21--21571 1509 11932 --
NM_005254chr1521257 1234 ----1477
NM_005276chr1231433 584 464 ----21696 526
NM_005327chr41723 --1242 --
NM_005329chr1621789 569 --12183 --
NM_005338chr71850 --2662 452 --
NM_005339chr484065 3989 3663 3118 1118 996 713 322 ------
NM_005342chrX52837 2539 2132 1877 955 --22172 556 --
NM_005349chr41505 --1404 --
NM_005381chr22412 403 ------
NM_005384chr9------1276
NM_005399chr133809 771 119 23296 2815 1173 --
NM_005402chr731542 712 184 1535 ----
NM_005406chr184638 617 112 58 11398 ----
NM_005415chr21540 1288 ----
NM_005436chr1063009 2650 1154 860 124 71 1787 22660 317 --
NM_005445chr10------1308
NM_005455chr131532 1507 342 --21186 669 --
NM_005458chr942326 1831 1786 404 12372 --11647
NM_005475chr1252962 2857 2047 1176 184 1645 2912 516 --
NM_005499chr19----1588 --
NM_005502chr911238 1739 23155 2520 --
NM_005503chr15----11087 --
NM_005509chr51131 ----11734
NM_005520chr52602 204 --1567 --
NM_005522chr7----11133 --
NM_005523chr741233 1015 524 33 ------
NM_005561chr132688 112 ----1700
NM_005570chr18181 ------
NM_005578chr385037 4042 3891 3739 1917 1907 1361 494 --11128 1703
NM_005587chr151757 --1948 --
NM_005596chr915299 25732 1829 24513 4416 --
NM_005600chr1----1200 --
NM_005603chr1821600 1345 --11850 --
NM_005604chr692171 2006 1896 1864 1004 854 799 636 408 ----12411
NM_005629chrX31253 1083 55 ----21194 892
NM_005639chr1231492 720 528 ------
NM_005647chrX62608 2522 1075 924 880 761 13435 ----
NM_005665chr154861 4541 3374 689 82 --11194 --
NM_005668chr563198 2895 2809 1424 472 89 34417 4296 4189 ----
NM_005688chr32499 146 --1287 --
NM_005725chr172063 1916 798 387 335 240 36 --11815 --
NM_005746chr732692 345 212 1985 22099 407 --
NM_005748chr1253091 2554 2433 2154 997 --1710 1859
NM_005814chr111452 ------
NM_005819chr163329 2509 1406 808 559 449 21165 684 ----
NM_005822chr631621 846 339 1910 21493 795 --
NM_005839chr11884 --183 --
NM_005871chr103249 127 38 ------
NM_005880chr1631060 379 324 --1183 1271
NM_005898chr1182883 2743 1072 969 784 566 478 160 --22099 1096 12470
NM_005935chr493571 3528 2056 1897 1763 1578 1031 827 81 ----1357
NM_005941chr883600 2571 1505 1036 751 532 337 186 1455 12680 --
NM_005964chr1731214 229 157 ----11341
NM_005966chr232042 1707 816 1754 11858 --
NM_005994chr17------1625
NM_006016chr651956 1689 1520 1468 1444 11683 ----
NM_006040chr1641098 450 362 75 --185 --
NM_006041chr171379 --1160 --
NM_006047chr2042988 2611 562 450 1104 12461 --
NM_006079chr61771 ------
NM_006080chr732078 881 616 21982 1835 --12447
NM_006106chr1152842 1343 1236 418 375 --42887 2458 2313 1318 --
NM_006122chr1522442 797 ----11073
NM_006139chr222419 2316 --12737 --
NM_006141chr1641724 1086 860 264 12803 1373 11048
NM_006143chr12------147
NM_006152chr121209 --143 --
NM_006161chr53673 587 469 ----1115
NM_006162chr1821188 1162 ------
NM_006164chr2----1187 --
NM_006194chr14--1861 127 1483
NM_006195chr91300 --1102 11422
NM_006196chr22357 110 ------
NM_006206chr422337 1133 1292 1825 --
NM_006218chr3----1217 --
NM_006243chr12893 869 --1233 --
NM_006246chr141115 ------
NM_006252chr1117578 6540 6436 5341 2980 2486 1537 1476 1142 1049 403 17312 16775 25388 701
NM_006253chr1221071 810 ----11275
NM_006256chr142772 646 334 91 11854 22150 220 --
NM_006264chr4------1402
NM_006265chr831448 1309 1034 --11349 --
NM_006277chr2----2710 100 --
NM_006282chr2084636 3228 2932 2899 660 627 602 327 --11400 14521
NM_006313chr1211540 --1107 --
NM_006315chr494268 3172 2764 2744 1151 946 480 377 246 ------
NM_006325chr122151 118 --1240 --
NM_006352chr121979 1793 --21937 651 1814
NM_006377chr911081 ------
NM_006391chr111323 ----1274
NM_006393chr10104503 4391 3897 3108 2929 2883 1784 1388 1020 790 14403 127 --
NM_006393chr10104503 4391 3897 3108 2929 2883 1784 1388 1020 790 14403 127 --
NM_006393chr10104503 4391 3897 3108 2929 2883 1784 1388 1020 790 14403 127 --
NM_006415chr911188 11242 1338 --
NM_006460chr1711120 --1391 --
NM_006471chr18188 --181 --
NM_006504chr1032676 1848 503 ----12807
NM_006534chr2033227 1168 113 ----13302
NM_006544chr1445389 2396 1243 1011 11824 25051 1551 --
NM_006546chr17136636 6273 5875 5786 5178 4662 4638 2413 2181 1835 1228 801 764 16666 15810 --
NM_006547chr721847 1695 --12104 1208
NM_006559chr14834 395 174 81 ----1345
NM_006575chr14--198 ----
NM_006599chr16156997 6752 6020 5112 2653 2353 2292 1945 1833 1529 1489 1248 1198 918 247 --27905 5097 --
NM_006621chr131559 1545 174 --11373 11389
NM_006624chr102636 393 ------
NM_006628chr1563627 931 847 530 341 111 11133 --24344 537
NM_006644chr131234 ----1661
NM_006651chr4----11154 --
NM_006698chr2031435 1224 1138 --21485 969 182
NM_006717chr952743 2372 2171 996 549 12961 1797 --
NM_006734chr62499 450 ------
NM_006738chr1574584 4224 4180 2973 2879 727 201 23937 3589 14621 --
NM_006750chr1698124 7066 5410 3097 2486 1903 1648 1207 622 25424 3090 67959 7510 7434 5441 1813 882 --
NM_006756chr811471 1213 21076 168 161
NM_006762chr121359 193 ----11340
NM_006775chr622150 187 --22693 2324 --
NM_006777chrX72933 2279 1967 822 351 270 53 --11896 12460
NM_006803chr822086 1521 21873 321 12116 --
NM_006805chr521721 1237 11740 ----
NM_006807chr1721001 127 4222 167 156 45 11053 --
NM_006826chr21144 --1226 --
NM_006851chr1242826 2759 909 246 1360 1966 --
NM_006852chr1762757 2122 1106 687 587 354 12034 ----
NM_006885chr1684056 3837 1301 1036 944 686 657 95 23080 1542 23322 2732 11385
NM_006887chr22686 540 --1233 --
NM_006908chr71405 --11147 --
NM_006910chr16----1159 --
NM_006920chr231859 1301 465 ----1285
NM_006939chr1421034 138 --1999 --
NM_006948chr211658 ------
NM_006951chr102829 627 ------
NM_006981chr932910 2577 917 11202 12336 --
NM_006993chr10------163
NM_006999chr5------11573
NM_007005chr911451 11216 ----
NM_007008chr2----1107 --
NM_007011chr15126354 6056 5961 5887 5878 4692 4577 1622 509 489 301 68 24290 1424 35837 2492 264 --
NM_007026chr172386 242 --1439 --
NM_007033chr121653 506 ----1128
NM_007038chr21105887 5255 5005 4381 4050 921 832 373 177 102 14683 --14135
NM_007054chr543024 2838 696 627 ----13889
NM_007067chr171602 1525 11446 --
NM_007084chr1321410 1329 11164 21399 377 --
NM_007106chr1342723 2600 1734 78 --1779 --
NM_007111chr132862 27 ------
NM_007125chrY51220 463 419 163 78 ------
NM_007191chr122714 210 --1124 --
NM_007212chr141809 906 313 237 12018 ----
NM_007214chr62885 849 1950 1373 --
NM_007249chr13109099 8980 8763 7532 7009 6343 6155 2022 1648 1351 --18125 --
NM_007345chr181246 ----189
NM_007373chr1011338 11177 ----
NM_007375chr122359 2347 ----11984
NM_012062chr122947 207 --2955 251 --
NM_012073chr521577 1555 --1149 11350
NM_012081chr533175 2303 2285 --43142 2589 963 110 --
NM_012082chr81329 ----1377
NM_012095chr1053551 3391 3327 755 505 ----1172
NM_012096chr373710 3595 3430 3111 1322 918 45 1546 1106 --
NM_012115chr6------155
NM_012180chr41533 --1118 --
NM_012189chr18----1182 --
NM_012197chr91538 1475 11545 --
NM_012215chr102448 224 ------
NM_012224chr4----2331 72 2966 804
NM_012234chr373481 3343 3096 3067 2885 2516 1253 13717 12356 13035
NM_012238chr1021362 1253 ----1338
NM_012249chr252477 1362 1095 712 254 22700 2629 12336 --
NM_012259chr61260 --1912 --
NM_012262chr184438 4419 4128 3999 3918 1782 1123 912 23881 1558 31601 1436 186 --
NM_012281chr751871 1779 1636 513 137 ------
NM_012290chr211646 ------
NM_012297chr472591 2567 2480 2466 1917 1616 1606 --12248 --
NM_012300chr552512 2397 1935 210 24 2275 221 --11961
NM_012301chr731977 1404 646 --1292 --
NM_012311chr10----1417 --
NM_012319chr182946 274 --146 --
NM_012327chr1841090 1073 444 169 171 --1494
NM_012334chr594610 1807 1782 1669 1012 636 567 214 122 24511 1140 24071 224 --
NM_012414chr1----1280 --
NM_012416chr921114 782 1216 ----
NM_012421chr1------1453
NM_012434chr61531 11230 --11643
NM_012464chr432933 267 158 --22831 565 --
NM_012465chr10113462 3262 3242 3190 2841 2556 2403 1041 852 574 454 22540 829 13086 33409 2206 1282
NM_012482chr11624 ----1718
NM_013231chr1423568 3527 --23375 455 --
NM_013233chr21203 1146 ----
NM_013255chr7108757 8583 8566 6402 5917 5642 2482 2327 971 962 28619 2284 56607 6252 6136 1741 1366 12598
NM_013261chr483398 3190 2960 2429 861 843 674 259 13796 --11380
NM_013267chr122420 99 ------
NM_013279chr1121937 1694 --1844 22107 586
NM_013281chr2021347 1196 ----1170
NM_013322chr72566 182 11309 21114 67 --
NM_013354chr821458 365 11476 ----
NM_013357chr82832 791 1229 1755 --
NM_013372chr15--23324 251 13330 --
NM_013381chr1232336 256 178 1805 ----
NM_013433chr1942056 723 565 342 --11860 --
NM_013448chr141728 --1707 --
NM_013995chrX32255 775 643 ----12191
NM_014016chr311072 --1390 --
NM_014021chr133229 278 185 1527 2542 46 11230
NM_014048chr1674344 3648 3454 3413 1221 972 537 14636 14448 14474
NM_014112chr855099 4679 4401 1924 546 --14619 --
NM_014117chr1662446 2143 1780 948 842 445 1398 1634 --
NM_014141chr744025 3445 1686 78 1991 ----
NM_014155chr11117576 6961 6926 6198 5219 4878 2081 1931 811 754 289 47189 6693 5637 4653 1975 11329
NM_014157chr1663405 2888 2561 1285 1217 970 21361 1006 ----
NM_014181chr252505 2385 2294 855 520 1674 31821 1141 122 --
NM_014240chr363013 1267 951 481 358 328 --33454 1186 500 --
NM_014253chrX52336 1717 1583 950 788 12305 2847 356 --
NM_014285chr9--1757 1238 --
NM_014294chr841004 986 539 129 --11401 --
NM_014325chr1261500 907 812 437 231 216 ------
NM_014331chr477242 6792 5239 2280 1849 825 609 37776 6292 541 15294 --
NM_014337chr2252239 781 714 680 648 --12072 --
NM_014379chr82967 139 1805 ----
NM_014386chr5------133
NM_014390chr73502 119 113 ------
NM_014409chr1------11178
NM_014415chr331263 577 519 11409 1328 --
NM_014423chr534653 1871 810 --34026 1071 437 11768
NM_014426chr201622 ----194
NM_014432chr611057 11136 11402 --
NM_014445chr33726 562 131 11721 ----
NM_014456chr1011257 --1373 --
NM_014470chr12--1782 ----
NM_014487chr4----1660 1200
NM_014491chr71784 --1399 --
NM_014494chr1622252 386 ----11712
NM_014502chr11----1416 --
NM_014515chr1231044 992 323 ------
NM_014583chr3------1206
NM_014584chr14----11322 --
NM_014615chr1693178 2837 2318 2273 1374 774 646 515 467 --22524 696 --
NM_014632chr11----1194 --
NM_014647chr1671631 905 710 682 631 565 167 169 ----
NM_014660chr71821 ----1992
NM_014701chr1582648 955 408 359 219 163 135 66 ------
NM_014705chr751901 1763 1719 779 698 11847 ----
NM_014706chr1251050 964 956 843 133 --1749 --
NM_014707chr71167 1245 12045 --
NM_014709chr22509 89 ------
NM_014711chr1631954 1724 611 --11870 --
NM_014717chr191747 1847 ----
NM_014730chr12125048 5036 4628 3876 3398 2021 2008 1914 1667 1472 610 197 --44620 4135 3357 1588 --
NM_014746chr273921 3365 3305 3137 2812 344 282 --23764 119 --
NM_014751chr892171 2059 1879 1658 1456 858 405 241 39 21622 1513 1686 --
NM_014774chr123234 1137 --1987 12019
NM_014782chrX--1399 ----
NM_014803chr1032888 2413 437 --22872 2497 1706
NM_014810chr163386 3055 3025 2732 2480 1100 ------
NM_014827chr121610 1503 1665 157 1529
NM_014832chr1372119 2048 1631 1529 1520 837 467 ------
NM_014835chr2021620 302 1240 2513 209 --
NM_014840chr1273401 3274 2727 2651 2596 2232 235 12854 ----
NM_014841chr6--1364 --183
NM_014860chr221686 1042 ----11927
NM_014873chr164419 4179 1531 1454 1394 916 --11892 --
NM_014893chrY1669 1245 12341 --
NM_014897chr1762655 1170 940 779 483 447 --1119 1262
NM_014899chr522904 270 --13146 1999
NM_014903chr1232070 766 461 31682 1608 51 ----
NM_014906chr172325 95 1834 41605 1164 702 194 22898 1258
NM_014910chr19----158 --
NM_014912chr101688 --43455 2355 1351 838 --
NM_014932chr31707 ----1785
NM_014938chr1232003 708 542 ------
NM_014939chr181453 --1404 --
NM_014947chr121105 389 --12038 --
NM_014969chr11986 ------
NM_014989chr641274 673 665 166 ------
NM_015017chr12414 97 ------
NM_015023chr131421 1324 1284 11396 ----
NM_015026chr1251482 1212 1055 871 785 1211 1683 --
NM_015027chr1651822 706 364 113 41 11391 ----
NM_015033chr953285 3057 2564 1149 357 ------
NM_015042chr1523212 2706 --53826 3711 1415 1373 35 --
NM_015045chr102518 304 --12223 --
NM_015046chr962632 2357 1902 1775 707 187 ------
NM_015071chr5115720 5513 5370 5201 5158 4662 4504 2249 2185 1848 1572 24094 305 22391 31 --
NM_015076chr6104349 3383 3312 3103 2929 1786 955 810 651 198 21372 803 23301 566 --
NM_015092chr1654582 3699 1306 1013 878 --24314 4084 --
NM_015093chr631197 629 390 1662 21730 76 --
NM_015094chr2254319 4114 1789 871 813 ----1154
NM_015097chr311507 11958 --1367
NM_015100chr131726 1712 1666 1683 ----
NM_015129chrX51438 670 503 226 73 --1706 11816
NM_015132chr721343 1217 21800 684 11585 11492
NM_015144chr1673745 3189 2667 2584 951 804 116 --1684 --
NM_015147chr293072 2739 2208 1217 1093 941 680 633 247 ----22389 135
NM_015149chr11767 11731 22067 687 --
NM_015155chr1053304 3255 2894 2640 666 13051 --1681
NM_015156chr1473514 3406 3151 2561 2538 454 392 11503 1337 --
NM_015173chr411429 --1248 --
NM_015176chr151751 1615 1424 1142 100 11275 --21195 1158
NM_015191chr1172555 1849 1732 1095 951 836 590 11064 22707 970 --
NM_015199chr322856 2795 ----139
NM_015205chr1355276 5094 3463 829 756 --24822 4030 --
NM_015206chr1563434 2574 537 431 337 191 11004 ----
NM_015213chr11----1618 --
NM_015265chr22664 116 21653 1043 --12092
NM_015271chr464234 4051 3881 3397 3093 356 --21239 888 --
NM_015272chr1631816 1805 586 11470 1439 --
NM_015278chr683323 2931 2710 2200 1281 715 608 586 ------
NM_015285chr1822390 1692 ------
NM_015288chr543817 2998 963 938 13491 11195 --
NM_015291chr142534 2471 1207 478 ----11365
NM_015299chr1453552 2712 1123 580 529 13063 ----
NM_015317chr242690 2299 2189 1770 11070 1877 --
NM_015328chr792877 2772 2760 2559 2499 2121 1254 800 459 --12176 --
NM_015330chr2262557 2386 2036 767 144 94 1875 12510 --
NM_015331chr11265 --1658 --
NM_015335chr1222470 488 --1591 --
NM_015347chr1242838 1051 701 101 --22361 399 11191
NM_015359chr832705 2344 691 22406 1984 --12484
NM_015429chr3128 11086 ----
NM_015435chr83977 369 106 1196 181 --
NM_015443chr171609 --152 --
NM_015446chr11167 --1543 --
NM_015455chr553199 2539 898 558 194 33769 1582 701 23166 2815 22854 1479
NM_015458chr8124685 3636 3421 2128 1808 1381 1141 970 308 287 186 108 23392 788 ----
NM_015465chr51296 1723 1631 --
NM_015472chr3--1478 --2501 442
NM_015475chr2--1854 153 --
NM_015477chr152887 862 --1736 --
NM_015483chr731082 381 322 ----1725
NM_015488chr231344 1160 346 --11456 --
NM_015497chr153891 309 213 ------
NM_015527chr16----1332 --
NM_015542chr1021144 918 --21232 408 1391
NM_015550chr712712 12958 --21117 293
NM_015554chr1582927 2551 2500 1043 774 629 273 242 12399 --1913
NM_015567chr1321323 26 2256 93 1135 --
NM_015569chr174347 3355 1425 677 642 616 213 --1719 --
NM_015570chr721693 411 --21589 456 --
NM_015626chr172325 150 --164 --
NM_015635chr911696 ------
NM_015642chr31102 1259 ----
NM_015680chr22225 41 1671 2683 486 --
NM_015686chrX22305 2277 ------
NM_015723chr7--1140 1228 --
NM_015850chr861784 1695 898 451 347 338 12062 ----
NM_015872chr111182 --11284 --
NM_015879chr18106776 6726 6469 5587 5545 3303 2515 1476 633 329 28539 2561 ----
NM_015885chr111349 --1186 --
NM_015886chr865728 4048 3951 3741 1717 931 --24644 1144 --
NM_015906chr144652 1865 1469 140 1817 --1221
NM_015912chr821937 1566 --2381 53 1101
NM_015995chr1565372 5239 4728 1710 1036 267 ----14585
NM_015999chr1--1563 1138 1654
NM_016018chr842466 2439 2230 1082 --32496 1870 1024 --
NM_016021chr652501 1214 461 267 40 --1853 --
NM_016022chr1----1171 --
NM_016041chr17----1351 --
NM_016061chr221060 384 --1437 --
NM_016076chr172826 2786 2558 2487 2311 800 460 12509 ----
NM_016083chr633487 2918 1200 13618 13804 --
NM_016087chr71137 ------
NM_016100chr20141 ----1386
NM_016107chr531389 355 273 ------
NM_016129chr41315 --159 --
NM_016131chr272351 2001 1920 1657 1527 783 677 ------
NM_016133chr23557 539 186 1607 ----
NM_016205chr411183 1107 1277 --
NM_016206chr3119049 7970 7949 7206 6835 6201 3135 3021 2007 1235 290 --21796 1569 38618 8228 1187
NM_016216chr32801 223 --156 --
NM_016221chr522169 77 --21779 1659 --
NM_016248chr1353902 3042 622 542 132 1816 23400 507 12656
NM_016269chr431183 762 316 ------
NM_016271chr1862346 2044 1782 852 227 150 ----1206
NM_016272chr2252768 1905 1790 308 184 12146 ----
NM_016275chr331070 231 172 ----22035 766
NM_016287chr151649 1315 828 544 305 --1166 --
NM_016289chr231948 1616 616 1759 1462 --
NM_016306chr3------1258
NM_016308chr11557 --1664 --
NM_016322chr911105 --32784 2269 603 --
NM_016339chr1731611 403 298 ----11775
NM_016353chr822361 67 11592 11574 --
NM_016357chr12------11186
NM_016358chr53502 129 72 ------
NM_016376chr1773979 3707 3173 1302 1002 893 437 11345 24091 636 --
NM_016396chr1532973 2486 544 --1673 --
NM_016441chr22775 567 127 ----
NM_016451chr111227 --128 --
NM_016472chr144509 478 179 172 --11409 --
NM_016485chr63692 651 312 2767 266 ----
NM_016531chr442784 1100 1036 843 21196 784 1821 12965
NM_016559chr31558 --11099 --
NM_016588chr61640 --2680 240 --
NM_016605chr552227 2003 1972 1856 1673 1341 ----
NM_016612chr81268 --1661 --
NM_016940chr211412 ----1191
NM_016946chr163299 2822 2413 2285 1337 1095 --182 --
NM_017420chr1433283 3103 3049 11097 11118 --
NM_017519chr631072 1016 861 ------
NM_017544chrX1754 ----1663
NM_017548chr311444 ----1223
NM_017577chr331601 1260 167 ------
NM_017581chr4------1134
NM_017590chr2242258 2104 1994 537 --1289 2472 303
NM_017599chr1221867 1386 --11838 2538 61
NM_017612chr12--1410 1452 --
NM_017633chr643446 3339 373 343 12446 ----
NM_017634chr831842 1564 1467 --1487 --
NM_017635chr1111638 --1498 --
NM_017637chr9149208 8733 7940 7714 7573 7503 6022 3537 3468 3014 2466 1469 1009 760 --36890 5904 2255 --
NM_017650chr765802 5720 4462 4246 4083 1254 --22104 1423 15919
NM_017658chr1441836 768 462 397 --12905 --
NM_017666chrX41851 1502 698 148 1763 --1455
NM_017694chr221509 1438 --1575 --
NM_017714chr203681 594 52 1331 --1709
NM_017728chr1742139 2037 1151 303 ------
NM_017742chr1871523 1358 1320 784 733 547 410 ----11629
NM_017744chr142111 1700 662 140 ------
NM_017753chr921025 705 --1871 1197
NM_017754chr684248 3645 3248 1549 640 470 434 330 --14796 14813
NM_017769chr1432636 105 28 23007 853 12999 --
NM_017789chr2------1281
NM_017798chr2011147 ----1818
NM_017799chr143454 235 39 11360 11473 --
NM_017848chrX104002 3021 2972 1810 1613 1552 1504 1242 547 355 11168 14578 --
NM_017859chr20----1137 --
NM_017902chr1095640 4471 3639 1205 1076 821 756 277 57 --35732 5580 4273 --
NM_017944chr1172587 2461 2344 2283 2192 721 577 21934 950 ----
NM_017945chr32879 290 11205 21309 1255 --
NM_017988chr12--1940 --140
NM_017994chr743007 2849 1913 385 21882 847 1715 --
NM_018013chr652733 2608 1072 790 537 ------
NM_018014chr21890 --1417 --
NM_018027chr1042829 1159 363 205 12113 ----
NM_018078chr41420 --11041 --
NM_018086chr261744 1670 1530 1398 368 184 1710 --1424
NM_018092chr16----11596 --
NM_018105chr81934 1254 172 --
NM_018117chr10------1264
NM_018120chr811218 --1302 --
NM_018121chr101858 1550 12702 --
NM_018128chr1731056 983 369 --1513 --
NM_018159chrX1482 11577 ----
NM_018168chr1421321 1073 ----11429
NM_018171chr121326 ------
NM_018178chr121850 150 --31790 1394 276 --
NM_018184chr332097 437 219 --12007 1257
NM_018193chr153576 43 36 ------
NM_018214chr6--11149 --11014
NM_018254chr11407 --12086 --
NM_018290chr421243 143 --11116 --
NM_018293chr332566 2310 274 12021 --12398
NM_018330chr1051753 1212 1150 1063 632 11231 ----
NM_018362chr1143363 2944 2764 2502 ----1965
NM_018364chr121381 527 13620 11069 --
NM_018371chr831133 1126 423 ----11483
NM_018374chr764866 4000 1913 807 518 497 --21491 763 --
NM_018383chr231778 1316 717 21947 1439 11415 11537
NM_018403chr341090 481 176 55 --13222 11408
NM_018444chr81264 11566 32380 1842 747 --
NM_018448chr1211173 ----1100
NM_018464chr101129 ----1371
NM_018566chr154802 1266 975 789 545 15148 44879 2023 1356 1221 3801 424 317
NM_018590chr10--1173 --11668
NM_018638chr12165596 5381 4887 4467 4353 3702 3656 3461 3438 1796 1392 1318 996 847 336 117 23612 1541 55137 5092 3813 1016 989 --
NM_018657chr32202 178 ----1736
NM_018698chrX31489 1428 667 11288 11733 2741 181
NM_018700chr511426 11673 --11650
NM_018710chr8--1121 1372 --
NM_018718chr752267 1798 1555 880 438 --1827 11661
NM_018719chr72907 362 11282 ----
NM_018834chr5------1335
NM_018841chr193592 3546 3399 2590 2447 1274 990 535 234 32611 1465 785 23889 1181 --
NM_018898chr551604 895 633 283 253 --32052 1518 182 --
NM_018948chr121131 256 ------
NM_018951chr711299 ------
NM_018955chr17----193 --
NM_018959chr192707 530 ----1256
NM_018970chr722606 241 11934 ----
NM_018976chr1232468 2293 1871 12867 192 --
NM_018977chrX------1414
NM_018979chr1252596 2073 1742 594 218 22087 573 1238 --
NM_018999chr1051235 862 589 390 347 --33652 784 53 --
NM_019005chr7141 ------
NM_019012chr12------1182
NM_019016chr17--2224 207 ----
NM_019050chr431815 559 519 11799 ----
NM_019063chr222242 720 ----12081
NM_019114chr962462 2416 2362 2254 899 382 --12141 1797
NM_019116chr1643070 2881 2742 349 --1220 1381
NM_019617chr2------1133
NM_019843chr222378 64 ------
NM_019886chrX1221 ------
NM_020117chr52363 270 ------
NM_020122chr2115784 5226 2320 1686 1630 1331 1216 1160 986 511 472 14219 --11755
NM_020140chr12------1245
NM_020143chr21862 --1918 1874
NM_020156chr7------1158
NM_020198chr1731530 1227 997 1198 ----
NM_020205chr162957 2817 2803 2734 2484 1141 1925 ----
NM_020235chr32248 32 --1361 --
NM_020309chr1941107 806 281 29 1260 --2440 202
NM_020338chr1032442 1470 320 --23279 2847 --
NM_020341chr2031678 1400 716 1223 1634 --
NM_020342chr231941 951 49 --2668 120 12170
NM_020346chr1121675 656 ------
NM_020357chr33492 230 55 1521 21310 217 --
NM_020363chrY41537 1392 521 57 134 2612 111 --
NM_020390chr321113 830 --1271 --
NM_020403chr13----2324 66 --
NM_020432chr721691 89 ----11675
NM_020440chr162788 2738 2155 417 325 248 --13091 --
NM_020474chr1841681 1633 358 157 ------
NM_020640chr352152 1960 1909 1626 737 --1298 --
NM_020673chr20117478 6996 6450 6159 5472 5289 5229 2602 1879 1292 1251 14717 26294 957 --
NM_020679chr17----1441 --
NM_020718chr16105855 5604 5051 4995 4710 4702 4641 2445 1374 1330 ------
NM_020726chr5----1255 --
NM_020748chr1751485 806 585 307 236 21652 645 ----
NM_020752chr1052622 2174 1953 696 521 --22387 880 --
NM_020760chr21689 ----184
NM_020769chrX2805 682 ------
NM_020772chr17158700 7987 7601 7404 7092 7055 5965 5449 5434 5375 3405 2943 2021 1155 739 --57790 7434 7266 6777 1872 28383 2063
NM_020805chr1831840 1696 1428 --1256 --
NM_020824chr102690 118 --1144 --
NM_020856chr19--1276 11340 --
NM_020860chr4------1333
NM_020871chrX62164 2035 1886 1569 764 507 --22106 34 1304
NM_020899chr1752193 591 527 412 253 11801 12290 --
NM_020905chr2----1354 --
NM_020914chr1721839 164 11678 ----
NM_020918chr1052311 2252 1123 536 63 12595 --1782
NM_020935chr234340 3726 471 13257 1492 --
NM_020940chr1072538 2329 2073 861 848 575 196 ----11958
NM_020956chr1994219 2893 1913 1835 1757 1679 1562 893 301 ------
NM_020988chr1621110 37 ------
NM_021020chr842841 1364 970 918 --13461 --
NM_021033chr132673 461 23293 619 11062 13195
NM_021038chr342890 1111 1092 320 1635 ----
NM_021047chr191131 --1261 --
NM_021079chr1753095 2732 2258 1258 130 12577 13244 --
NM_021097chr232983 2786 338 ----1122
NM_021140chrX----11020 --
NM_021148chr7--11641 1859 --
NM_021183chrX52259 1952 467 334 262 ------
NM_021188chr141171 --1413 --
NM_021189chr12412 233 --11085 --
NM_021190chr1------11253
NM_021202chr2042813 2345 1019 347 ------
NM_021224chr91424 ------
NM_021238chr1241389 802 751 269 ------
NM_021255chr1463857 3423 2867 2667 925 898 --11630 13276
NM_021643chr241648 1599 1557 119 --11354 --
NM_021645chr1331765 666 343 --11701 1501
NM_021648chr662344 1714 404 250 34 22 1228 ----
NM_021785chrX------1246
NM_021813chr685137 4782 4168 4081 1749 681 625 391 --15207 --
NM_021818chr14------139
NM_021914chr1431853 1791 38 12118 --12322
NM_021938chr191245 ----1100
NM_021960chr152646 1893 817 502 482 --22021 223 --
NM_021961chr11127455 7288 6913 6345 5358 2819 2724 2610 2552 2409 1594 1560 17181 26564 6223 --
NM_021963chrX--1112 ----
NM_021964chr375881 5717 4448 2601 2019 1897 735 26503 1667 26145 5784 14391
NM_021998chrX11226 21299 88 ----
NM_022049chr12351 39 --11854 --
NM_022062chr1141716 1511 460 118 --21416 446 1183
NM_022121chr621083 962 --1173 --
NM_022130chr551262 974 342 319 109 ------
NM_022133chr821167 706 ------
NM_022140chr531958 1520 1495 11924 --1816
NM_022143chr731351 1073 405 ----11477
NM_022343chr91494 ----1471
NM_022346chr411214 153 --11105
NM_022459chr1374399 1922 1696 960 607 527 179 16076 15147 --
NM_022474chr144870 778 247 207 12105 ----
NM_022730chr21258 --11010 1363
NM_022733chr121084 186 ------
NM_022735chr111563 ------
NM_022744chr161966 11283 186 --
NM_022753chr112698 --22317 981 12736
NM_022756chr131487 1406 24 --1323 11151
NM_022771chr122728 346 1100 1146 1960
NM_022781chr983258 3064 2687 2296 1278 964 721 86 ------
NM_022832chr452264 837 426 360 62 --1747 1501
NM_022841chr1582641 2634 2599 2214 2075 1845 807 534 --2869 308 --
NM_022893chr222838 2781 22439 1112 ----
NM_022894chr21254 --11156 --
NM_022896chr201683 --11099 11118
NM_022898chr14114539 3942 3929 3834 3469 3248 2966 1416 1390 1048 670 14825 --13668
NM_023015chr11139 --1681 --
NM_023016chr242551 2355 2259 1141 22406 320 ----
NM_023034chr8----1505 --
NM_023076chr1632333 2048 923 1221 1471 --
NM_024015chr172361 338 --1171 --
NM_024046chr331124 270 65 --1262 --
NM_024052chr1732697 2616 685 ------
NM_024090chr411624 11364 11374 11834
NM_024094chr8139 2887 787 1671 1180
NM_024295chr841421 814 589 137 21404 603 1177 --
NM_024321chr19------1111
NM_024326chr101135 ----1123
NM_024336chr16----1252 --
NM_024345chr965841 5831 5067 1212 797 610 157 ----
NM_024524chr342649 673 137 65 --12833 12740
NM_024528chrX----1100 --
NM_024529chr1--1124 21169 44 --
NM_024539chrX2215 65 1502 11037 --
NM_024551chr1232580 1962 297 --12405 --
NM_024598chr1651240 1113 1101 1043 844 ----11333
NM_024612chr17--1928 ----
NM_024617chr9--1102 1299 --
NM_024629chr41746 11140 1737 --
NM_024646chr12605 393 13301 43952 3753 2559 358 --
NM_024665chr374140 4060 3711 1763 1060 826 529 21244 473 ----
NM_024670chr1021267 1168 1126 1588 --
NM_024692chr231334 444 372 --21198 229 --
NM_024713chr1521420 174 ----1212
NM_024721chr822034 86 31761 366 272 --1411
NM_024745chr16------11099
NM_024749chr1------1163
NM_024761chr945018 4260 3492 2108 14600 34213 4131 331 --
NM_024771chr1131746 785 479 --11688 --
NM_024798chr1542356 1909 712 652 --1486 --
NM_024813chr1------1132
NM_024828chr9--21424 1186 ----
NM_024834chr1031496 388 197 --1308 1367
NM_024887chr12683 404 --11645 --
NM_024920chr431329 975 65 ------
NM_024939chr1631597 1237 93 21522 1183 ----
NM_024947chr3119521 8358 8244 8048 7492 7252 6475 6122 3021 583 517 38925 8473 2899 57960 2681 2611 1637 1478 26134 2669
NM_024948chr102705 233 --1174 --
NM_024949chr454909 4660 3837 3376 825 --14510 --
NM_025054chr873717 2756 2746 1075 1059 969 166 14209 ----
NM_025057chr14----1969 --
NM_025076chr2--1141 1499 --
NM_025083chr1551817 1416 1305 1298 308 --176 --
NM_025133chr22993 356 --1986 --
NM_025134chr1632396 554 184 22178 469 --11870
NM_025137chr151270 ----1329
NM_025146chr332522 2116 98 --11803 --
NM_025147chr21111 11121 --1932
NM_025160chr144284 3434 755 168 14328 12949 --
NM_025191chr163238 3053 2934 2912 1385 558 1103 ----
NM_025235chr1052044 1789 788 763 415 ----1165
NM_030625chr1051926 1692 1038 399 249 21936 293 1969 --
NM_030627chr563609 2617 1423 1391 1369 1305 ------
NM_030647chr765682 5456 1426 1298 367 67 15737 35587 5036 647 1920
NM_030648chr485196 4308 3719 1755 1708 1597 1529 1360 31978 1137 765 ----
NM_030650chr243664 2995 2752 245 13093 1853 --
NM_030751chr102680 464 ------
NM_030820chr6----1695 --
NM_030918chr1115229 4902 4596 4317 4164 4148 3646 1516 698 544 315 --34884 4568 4227 --
NM_030935chr7------181
NM_030979chr13137 1450 ----
NM_031426chr942615 2397 724 296 22056 1992 11015 --
NM_031435chr1221404 1361 11396 12286 --
NM_031442chrX53008 2710 1027 1003 165 --33153 2527 802 --
NM_031445chr263059 2875 2644 931 520 125 ------
NM_031483chr2052811 2573 1099 987 658 ----11431
NM_031492chr112109 102 ------
NM_031935chr1----1751 --
NM_031936chr11122 ------
NM_032048chr181101 ----158
NM_032102chr1152994 1919 1207 1173 150 1403 ----
NM_032124chr182948 39 --11198 --
NM_032144chr23645 609 224 --11320 --
NM_032153chr321712 462 1631 ----
NM_032199chr1083834 3689 3036 2882 2496 2441 1265 767 --148 --
NM_032221chr203799 305 41 --21386 727 --
NM_032228chr11----11195 --
NM_032229chr131844 --11049 --
NM_032236chr1----1361 --
NM_032246chr152912 336 ------
NM_032291chr131745 1241 646 ------
NM_032303chr941794 1757 1309 542 11665 1191 11576
NM_032329chr2104249 4200 3979 2947 2849 2809 1719 1343 584 360 --13384 14273
NM_032373chr1035542 812 508 --25146 4476 --
NM_032431chr11----11020 --
NM_032434chr211197 ----11375
NM_032439chr1021049 314 1532 --11560
NM_032440chr1052793 2727 2488 1960 702 --1422 --
NM_032445chr1512000 --1722 --
NM_032457chr433041 317 118 --23265 1092 23187 593
NM_032458chrX63404 3372 2935 872 550 212 ------
NM_032501chr2011437 --11516 --
NM_032509chr842300 626 452 437 --11687 11824
NM_032510chr1811970 1127 --1331
NM_032521chr2031238 848 736 12449 13206 --
NM_032547chr421172 95 --1376 --
NM_032558chr911474 --11094 --
NM_032574chr2------166
NM_032632chr1441820 1635 1572 798 --11732 --
NM_032673chr2----171 --
NM_032682chr353182 3153 2911 1265 764 13258 22532 2428 --
NM_032727chr103253 231 116 11557 ----
NM_032765chr5------1684
NM_032804chr1011019 ------
NM_032812chr10----1356 --
NM_032818chr92497 462 ------
NM_032846chr1441542 1416 545 492 --143 --
NM_032924chr7------1455
NM_032936chr7------177
NM_033030chr221386 376 11253 --176
NM_033055chr1----1920 1341
NM_033082chr121174 ----1181
NM_033121chr12--11596 2689 296 --
NM_033215chrX----1361 --
NM_033224chr787353 6847 6787 6614 2676 2402 2033 267 37883 7511 6948 57914 6506 5948 5912 5476 32291 1098 775
NM_033225chr872672 2499 2056 556 527 478 101 1874 ----
NM_033260chr63519 299 232 --1621 --
NM_033285chr893975 3614 3531 3365 2979 2748 2740 2728 916 --23667 619 --
NM_033296chr41178 --1696 --
NM_033394chr2----21499 1056 --
NM_033495chrX1784 1389 11017 --
NM_033549chr51944 ------
NM_033656chr2162275 2216 2073 1506 376 213 ------
NM_052840chr1521620 284 --11095 --
NM_052886chr83482 399 264 --136 --
NM_052910chr13------11864
NM_052927chr532113 2107 2086 --11862 --
NM_052937chr822492 2289 --11769 1551
NM_052978chr1441593 1235 505 184 1424 ----
NM_053025chr341589 1199 654 25 ----11469
NM_053056chr1132579 2227 2210 --1116 --
NM_053064chr1442504 2343 693 308 13001 ----
NM_054027chr531905 1858 438 ------
NM_057175chr431071 445 200 ----12621
NM_078476chr621616 487 11602 2368 42 --
NM_080552chr201131 1457 --1110
NM_080617chr202931 187 ------
NM_080738chr111305 2636 424 ----
NM_080862chr311174 11001 1943 --
NM_080867chr1474816 4694 3754 3534 3484 3185 808 11154 --11603
NM_080927chr373389 2711 2556 2272 1284 903 626 1168 --2826 619
NM_133265chrX32904 2490 578 --1499 12975
NM_133367chr633359 1235 1088 ----13294
NM_133478chr222492 213 --170 --
NM_133638chr52969 196 --11291 --
NM_138285chr21524 ------
NM_138300chr121164 629 1649 1500 --
NM_138335chr4----2792 713 --
NM_138423chr1541946 1852 925 627 --11970 --
NM_138426chr722453 1576 1802 1505 --
NM_138468chr246024 4778 1688 507 1553 --16151
NM_138473chr12125041 4569 4199 4039 3859 1660 1288 1190 692 593 570 262 ----15154
NM_138492chr5198 1197 --1137
NM_138731chr1443915 3301 632 56 ----1400
NM_138927chr212132 29 ------
NM_138962chr17170 ----1372
NM_139015chr1231139 435 400 --1455 --
NM_139072chr22328 144 --1809 --
NM_139167chr83507 96 56 ------
NM_144567chr122448 2351 --1772 --
NM_144571chr486660 6459 6353 5913 5390 5220 1149 351 25559 2486 1963 14880
NM_144579chr222960 932 --22280 385 --
NM_144582chr252460 2098 1715 1703 898 21797 184 1469 --
NM_144599chr1595432 5374 4313 4211 3847 3774 1897 1452 270 23742 748 14830 --
NM_144632chr251686 1670 1489 947 71 --11900 12365
NM_144635chr311142 ------
NM_144643chr41373 ------
NM_144657chrX140 --1253 --
NM_144664chr1152164 2129 1917 1014 325 11626 ----
NM_144721chr461102 1033 750 517 479 382 22512 354 11023 1678
NM_144775chr17104253 4035 3948 3519 3301 3181 1685 1544 1347 102 ------
NM_144778chr1332075 504 301 --31842 1069 720 --
NM_144963chr862030 905 819 714 433 276 12572 2649 61 --
NM_144974chr131611 1814 ----
NM_144976chr193578 549 72 ------
NM_145165chr1422459 1149 11159 12768 --
NM_145206chr1042552 2058 1339 365 ----12811
NM_145284chrX32471 2385 1766 --12185 2512 436
NM_145313chr1011176 11688 ----
NM_145349chr1721945 1520 --1429 --
NM_145891chr1631679 685 47 11633 11742 --
NM_147190chr12--1743 1260 --
NM_148894chr44970 838 132 78 --2919 158 --
NM_152261chr1231939 1664 824 --2894 425 --
NM_152272chr82928 358 --1324 --
NM_152277chr51595 ----21638 740
NM_152284chr8196 --2844 635 1673
NM_152305chr311812 --11631 11625
NM_152335chr15--1624 1169 --
NM_152400chr421384 228 1103 2694 413 --
NM_152414chr821403 1045 ----11033
NM_152417chr811313 1968 ----
NM_152423chrX----11176 --
NM_152437chr1232489 2304 805 1914 12208 12414
NM_152463chr17------1499
NM_152493chr131461 1324 285 --1618 --
NM_152556chr721768 775 12421 1190 1942
NM_152622chr522864 1060 1697 13383 23154 241
NM_152624chr5177314 7045 6697 6192 5932 5477 5342 4971 2955 2495 2314 2089 1678 1474 1211 1117 564 26549 606 15666 16331
NM_152641chr1252468 2369 1940 1881 262 12666 42497 2412 459 144 --
NM_152653chr3------1538
NM_152660chr12709 91 ------
NM_152665chr121014 129 11215 1347 --
NM_152688chr62769 650 ----1757
NM_152745chr7----1181 11192
NM_152753chr641807 579 399 166 ------
NM_152756chr524053 3005 1832 1244 --
NM_152758chr831913 967 236 33063 1965 388 ----
NM_152780chrX5512 336 223 213 92 --1250 1892
NM_152793chr774417 3522 1691 1584 543 208 174 35093 4109 666 24727 1870 --
NM_152835chr142130 2002 864 629 1185 --12955
NM_152857chr63956 215 184 ------
NM_152996chr132110 1607 374 ------
NM_153020chr621698 1455 --11365 1100
NM_153035chr12546 185 --32670 2128 2047 --
NM_153183chrX2843 363 21124 467 ----
NM_153184chr31398 --1710 --
NM_153207chr1243363 3170 2810 287 21639 316 ----
NM_153343chr472455 2100 1634 855 732 715 220 --194 --
NM_153346chrX2190 58 --1538 --
NM_153362chr61930 1621 1237 --
NM_153456chr1344746 2332 1962 1700 14800 21547 1426 --
NM_153607chr532593 2577 2228 12324 22838 2535 --
NM_153619chr1563465 3195 2893 1420 1269 358 ----2578 420
NM_153685chr12------11217
NM_153686chr441947 1911 901 499 22150 587 21625 804 12463
NM_171998chrX42505 1753 529 519 21554 767 22346 406 --
NM_172070chr21577 ----169
NM_172236chr201698 --131 --
NM_172240chr1221290 996 11403 ----
NM_173075chr431477 1281 574 --1362 --
NM_173354chr2131406 760 492 21634 467 1605 --
NM_173355chr2----1270 --
NM_173469chr1531184 326 73 140 ----
NM_173478chr173855 437 236 ------
NM_173491chr521439 960 ------
NM_173495chrX41588 820 653 442 ----12125
NM_173510chr2242510 2071 1834 805 ----12586
NM_173511chr283485 2882 1593 1396 1228 547 133 107 1818 42779 2569 2518 1427 12996
NM_173559chr6------1383
NM_173560chr6------1230
NM_173595chr1295228 4379 1941 1903 1650 1580 1156 950 566 ------
NM_173683chr82705 187 11774 1489 --
NM_173794chrX----2507 427 --
NM_173808chr143409 3202 1529 542 1407 --13874
NM_173812chr1221087 346 ----194
NM_173829chr585758 5517 5379 4338 2444 1828 1490 322 14436 34928 997 450 --
NM_173854chr121665 328 --22243 251 --
NM_175061chr711456 22059 124 11831 --
NM_175709chr2232804 2069 551 1404 --12878
NM_175854chr1342310 2188 1028 170 --1942 --
NM_175856chr51204 --1739 --
NM_175907chr1812129 --12472 --
NM_176814chr721473 287 --1596 --
NM_177531chr81454 ----1144
NM_177966chr341903 1678 1531 444 11711 1352 --
NM_177968chr241660 1504 1395 836 1596 ----
NM_177999chr933536 2872 1089 ----1109
NM_178011chr1032090 737 406 --12867 1330
NM_178123chr221007 301 2251 187 1258 --
NM_178126chr1762141 2036 1550 630 458 239 ------
NM_178423chr721283 414 --1151 --
NM_178439chr21493 ----189
NM_178496chr351067 524 430 317 129 --1972 --
NM_178517chr17----1115 --
NM_178539chr1221565 801 21422 448 ----
NM_178565chr821692 1224 21287 1078 1524 --
NM_178571chr171192 --2743 217 --
NM_178812chr831554 1507 1131 ------
NM_178835chr4----127 --
NM_181354chr8--1108 11177 --
NM_181504chr561686 1127 989 869 770 137 14171 1360 11117
NM_181552chr7------1938
NM_181571chr1041102 772 140 83 11017 11128 --
NM_181643chr111550 11459 11619 --
NM_181701chr981977 1809 1726 1697 1672 1642 711 116 1142 11930 173
NM_181705chr544787 1276 797 531 11090 1130 --
NM_182488chr13------1957
NM_182503chr675438 4488 2195 1534 1304 1025 200 --14608 --
NM_182691chr721088 103 --11058 --
NM_182700chr72756 548 --1719 --
NM_182757chr663384 2982 1374 786 596 232 11320 --2818 619
NM_182758chr1523643 2905 3494 421 324 12761 --
NM_182767chr1231741 313 80 1776 ----
NM_182830chr1411559 1375 22230 2182 --
NM_182920chr3----1549 --
NM_183416chr151536 1419 579 480 198 11695 --1159
NM_194247chr264401 3720 3024 1271 446 288 --11492 --
NM_194285chr111724 ------
NM_194286chr1295806 4954 4678 4575 1951 1508 1326 1200 157 --13956 11439
NM_194317chr242160 955 766 166 --1441 --
NM_197941chr532122 951 168 ----12441
NM_198270chrX32675 1162 188 32497 2452 943 13438 --
NM_198273chr563176 2683 2378 2250 898 134 23016 213 1919 181
NM_198281chr442561 1099 684 387 --23134 223 --
NM_198401chr861466 1417 1320 1108 67 47 --11619 --
NM_198402chr3185 ------
NM_198404chr132596 260 --149 --
NM_198465chrX32953 2763 939 --1167 12095
NM_198527chr152200 120 ------
NM_198560chr373600 3475 3100 3009 1484 1292 269 --13803 --
NM_198581chr247511 6603 5254 5031 12758 25659 230 22146 358
NM_198834chr171138 --12273 --
NM_198859chr354702 4517 3428 1954 1526 14155 14234 --
NM_198904chr522003 1451 2569 212 --11936
NM_199000chr7167 31788 1644 615 --1395
NM_199072chr752921 2830 2026 1252 1075 ----12635
NM_199247chr17----182 --
NM_199320chr442362 2186 965 859 12313 32485 2376 528 --
NM_201280chr62625 141 192 11618 1196
NM_203290chr6132 ------
NM_203301chr1431397 1229 1076 11210 1115 --
NM_203390chr811533 --1601 --
NM_203394chr1262342 2144 1094 832 438 398 11817 12734 --
NM_203406chr542608 641 605 523 ----1619
NM_203446chr212782 452 42548 2514 1929 473 12117 --
NM_203458chr123424 980 141 --11278
NM_203459chr142472 2371 2168 22 1695 11017 --
NM_205848chr132596 2270 477 --1971 177
NM_207336chr7139 --1332 --
NM_207366chr711967 --11951 --
NM_207371chr1041586 1410 1061 489 --11592 --
NM_207381chr1521166 181 134 ----
NM_207391chr1921111 492 --1237 11091
NM_207404chr322112 472 --22225 1575 --
NM_207442chr142950 210 ------
NM_207506chr831068 440 267 ------
NM_207517chr1541977 1845 1524 747 --11573 --
NM_207647chr922216 347 21879 1023 --1431
NM_212464chr1551677 1485 1457 394 77 --21617 1445 --
NM_212467chr1542254 2062 2034 827 --42194 2022 973 159 --
NM_213589chr255284 5134 4938 974 862 14924 31231 849 613 --