TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1272
miRNA Sequence: GAUGAUGAUGGCAGCAAAUUCUGAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000091chr252648 2485 2009 1004 963 ------
NM_000092chr284255 4035 3964 3464 3331 3290 1084 695 --34324 3707 1087 24583 4039
NM_000115chr1392670 2647 2596 2067 2009 609 490 479 53 ----11849
NM_000138chr152815 513 12122 1619 184
NM_000176chr563958 3654 3626 2650 2626 2419 23934 1556 33645 2467 192 --
NM_000259chr15136356 6138 5735 4284 2556 2164 1693 1572 898 456 159 129 59 11500 35682 1427 864 --
NM_000264chr953265 3223 2663 1311 327 12318 1959 --
NM_000314chr1021245 1063 32386 2244 862 ----
NM_000332chr666693 2678 2538 2317 1987 133 --37095 5640 41 12682
NM_000337chr5125656 5609 5483 4831 4635 4379 4090 2282 2177 1583 1304 424 12624 21322 1319 15378
NM_000351chrX54283 4185 2930 1059 130 --1573 1620
NM_000408chr253108 3016 2897 2609 2448 --22802 1108 --
NM_000489chrX23073 2361 --21106 1103 13077
NM_000531chrX1354 1250 --1262
NM_000618chr12106293 6267 6131 4744 2552 2477 2177 660 554 233 12133 16522 --
NM_000618chr12106293 6267 6131 4744 2552 2477 2177 660 554 233 12133 16522 --
NM_000633chr1885019 4814 3732 1718 1488 771 239 223 11727 13459 --
NM_000809chr4168987 8952 7736 7686 7468 7306 7233 6940 6392 2542 2420 2331 1436 1405 1141 1036 29266 8657 78909 8876 8677 7689 6447 2575 1267 11959
NM_000813chr595437 5347 5159 3524 2049 1143 810 669 420 12012 15162 --
NM_000814chr1561381 1069 707 583 390 345 --22951 975 1416
NM_000838chr662074 1739 1086 768 750 294 --12622 12135
NM_000857chr43470 455 376 ----1474
NM_000875chr15126471 6268 6128 5568 5440 5150 2506 1198 616 548 468 396 ------
NM_000899chr1283605 3067 2976 1463 1296 1144 1096 732 ------
NM_000902chr363197 3016 2411 2180 2045 1089 --13096 --
NM_000926chr11179243 8745 7859 7478 7042 6200 3609 3408 3229 3201 2771 2591 1414 1372 991 657 331 22761 120 29246 660 29250 2583
NM_000950chrX42970 1335 1181 1046 --21152 171 --
NM_001001419chr584801 4671 4596 4275 4124 3700 1926 1102 --23903 2049 --
NM_001001420chr584801 4671 4596 4275 4124 3700 1926 1102 --23903 2049 --
NM_001001481chr843188 2464 1081 387 --12983 --
NM_001002257chr262798 2734 2307 353 264 114 --33479 566 117 --
NM_001002860chr1453847 3539 3146 1594 84 --14188 --
NM_001003652chr1868610 1628 1131 788 321 130 ------
NM_001003674chr1887078 6832 6550 6106 4811 2429 956 404 36394 5832 4787 26426 772 --
NM_001003675chr1887078 6832 6550 6106 4811 2429 956 404 36394 5832 4787 26426 772 --
NM_001003679chr171980 1955 1837 1494 1386 355 334 --11800 --
NM_001004317chr613663 33076 1541 403 --13720
NM_001004360chr251989 603 538 372 345 ----11541
NM_001004419chr1244506 4173 1353 1197 13204 23418 3402 --
NM_001005473chr566453 6078 5875 4799 4519 177 --15837 12542
NM_001005474chr351456 1412 1332 1289 318 ------
NM_001005782chr22879 745 --2153 146 --
NM_001005845chr871735 1605 728 638 614 321 81 --21474 770 --
NM_001007553chr11384 --1454 1368
NM_001008539chr895292 4162 1922 1645 1146 1071 467 208 76 25042 4617 44524 508 346 28 --
NM_001008738chr532308 386 296 12605 12477 --
NM_001008783chr61890 ----1286
NM_001008801chr191827 ----2496 339
NM_001008925chr443329 2368 1372 771 --33054 265 255 21074 362
NM_001009909chr1143576 2754 1447 592 33545 2715 610 ----
NM_001009993chr263824 3312 3232 2801 809 43 1359 23944 715 --
NM_001010891chr575932 5476 5049 4402 1724 1266 974 25868 250 ----
NM_001011513chr493700 3506 3359 2748 2656 1027 883 486 404 ------
NM_001011666chr7136491 6452 5849 5821 5662 5601 4805 4555 4208 2269 2085 1113 306 --15352 --
NM_001011708chr272672 2284 2238 2228 1868 295 284 --12507 --
NM_001012420chr1582905 2414 2126 849 775 459 386 250 ------
NM_001012423chr1582905 2414 2126 849 775 459 386 250 ------
NM_001012755chrX74919 4454 4380 1689 1532 1415 575 24205 4041 25043 4421 24144 913
NM_001013659chr1934903 1044 935 1744 21047 374 --
NM_001014797chr1088060 5490 3076 3005 2891 1887 1533 1514 23090 3015 11735 --
NM_001015877chrX52980 2382 2355 2238 2172 --12241 --
NM_001017440chr788245 7972 7945 7772 5968 5522 5043 2894 ------
NM_001018067chr163673 3405 3398 1432 827 691 --24965 3311 --
NM_001018068chr163673 3405 3398 1432 827 691 --24965 3311 --
NM_001018069chr163673 3405 3398 1432 827 691 --24965 3311 --
NM_001018074chr563958 3654 3626 2650 2626 2419 23934 1556 33645 2467 192 --
NM_001018075chr563958 3654 3626 2650 2626 2419 23934 1556 33645 2467 192 --
NM_001018076chr563958 3654 3626 2650 2626 2419 23934 1556 33645 2467 192 --
NM_001018077chr563958 3654 3626 2650 2626 2419 23934 1556 33645 2467 192 --
NM_001020825chr551433 1129 1101 125 101 11409 11120 --
NM_001024094chr563958 3654 3626 2650 2626 2419 23934 1556 33645 2467 192 --
NM_001025076chr1086207 5841 4786 4368 2071 1934 585 124 1156 45349 817 116 71 23990 302
NM_001025077chr1077565 7199 6144 5726 1943 1482 1096 11514 46707 2175 1474 1429 25348 1660
NM_001025079chr343869 3625 2787 1099 13665 13577 --
NM_001025252chr863076 3031 2660 2483 823 661 1233 21044 664 --
NM_001025253chr863076 3031 2660 2483 823 661 1233 21044 664 --
NM_001025580chrX23694 141 --22875 157 1724
NM_001025616chr42176 126 --1389 11769
NM_001029863chr643043 2167 2061 249 ----12883
NM_001031700chr42803 235 ----12023
NM_001031804chr1674294 4110 3664 2954 1391 891 421 1964 34362 4359 3452 --
NM_001031812chr5--11860 21661 1536 11956
NM_001033045chr241734 1706 1027 53 33928 1759 953 24381 4091 --
NM_001033059chr64615 383 346 165 21327 1310 --11965
NM_001037334chr1832301 2113 256 --22070 2067 22074 1561
NM_001039585chr184023 3563 3430 2983 1581 1285 1157 162 13728 1368 --
NM_001039840chrX64221 1891 1399 514 357 274 14712 ----
NM_001040284chr1655107 4633 3833 3703 1742 --25194 1432 --
NM_001040441chr185478 4316 3708 3430 2066 527 260 98 13442 24874 606 11343
NM_001040446chr5--12735 1156 11048
NM_001040450chr1511918 12155 --1752
NM_001040453chr1511918 12155 --1752
NM_001040665chr7135038 4938 4820 4125 3858 3414 3254 3144 3050 1498 1169 435 50 13633 ----
NM_001040712chr942448 972 754 580 --32799 2342 2339 12803
NM_001042355chr1645405 5107 4160 1183 --21866 1348 23913 1236
NM_001042383chr373081 2742 2660 2563 2280 1217 556 --1668 1263
NM_001042406chr651254 933 430 183 69 1798 ----
NM_001042412chr1645405 5107 4160 1183 --21866 1348 23913 1236
NM_001042413chr954117 3860 1508 1494 180 23565 1426 32639 2636 698 --
NM_001042453chrX2575 386 --1164 11699
NM_001042481chr1462627 1978 1859 1780 835 353 ----12585
NM_001042510chr84752 479 394 364 --11362 11984
NM_001042511chr84752 479 394 364 --11362 11984
NM_001042533chr352729 2122 707 298 279 ----11342
NM_001042550chr961748 821 640 586 348 225 ------
NM_001042555chr1264325 3741 3588 3301 471 285 33788 2919 1402 11813 33592 1725 195
NM_001042599chr276195 5150 2628 2022 1630 1617 1287 --47378 4957 4939 1620 16001
NM_001042603chr1264217 1728 1671 1062 664 61 --14600 --
NM_001042604chr3104599 4271 3542 3470 1790 1544 1001 983 395 141 24409 3921 11470 11485
NM_001042669chr42176 126 --1389 11769
NM_001044385chr293785 3512 2492 2480 1571 1400 523 478 197 11150 1200 1615
NM_001044722chr5--11860 21661 1536 11956
NM_001044723chr5--11860 21661 1536 11956
NM_001046chr563040 2785 1000 984 778 123 32375 2136 1202 12693 --
NM_001099678chr375083 4225 4100 1392 918 363 111 11826 24529 627 1932
NM_001106chr3129306 8892 7219 6993 6494 3886 3762 3608 3296 1696 1655 932 19554 38319 7513 1770 --
NM_001146chr852337 2326 1563 1556 857 1571 ----
NM_001167chrX76548 6421 4957 2482 2278 1359 961 25494 252 ----
NM_001201chr473934 2405 1154 1148 1051 267 40 ----13966
NM_001204chr2156817 6483 6313 6145 5640 5600 5440 4713 2498 1770 1624 1475 1370 363 42 27456 2746 25279 693 --
NM_001241chr222072 1516 --21773 415 11892
NM_001241chr222072 1516 --21773 415 11892
NM_001259chr731857 1369 787 --24336 797 --
NM_001289chrX21157 641 11661 --11594
NM_001346chr311971 --11742 22657 1752
NM_001390chr1833646 1433 302 23143 819 --12487
NM_001391chr1841178 959 941 488 --11044 --
NM_001412chrX42304 1299 530 90 13714 12620 --
NM_001430chr2--11965 --1753
NM_001438chr132429 1141 200 13405 22508 791 --
NM_001527chr653480 1469 805 402 34 24658 3670 23955 862 --
NM_001621chr752996 677 445 294 261 --13040 --
NM_001621chr752996 677 445 294 261 --13040 --
NM_001634chr64615 383 346 165 21327 1310 --11965
NM_001650chr1863904 3380 3130 1665 543 267 --1759 1763
NM_001742chr761311 1176 225 103 40 23 ----11199
NM_001755chr1662203 2195 1710 1473 576 305 --11460 --
NM_001777chr343869 3625 2787 1099 13665 13577 --
NM_001858chr6105022 4785 3806 1231 941 925 617 447 430 353 --45135 4425 3280 79 11607
NM_001918chr169167 8956 6770 6379 1604 816 12292 27303 3465 --
NM_002006chr445676 4424 916 888 --13538 --
NM_002015chr1373001 2457 2247 2051 597 256 155 12212 ----
NM_002025chrX158464 8367 8245 7586 7458 7149 6470 5949 3360 2593 2190 1576 1454 1171 746 27357 544 27483 2096 18162
NM_002090chr44497 237 34 25 --1621 --
NM_002092chr4115077 4946 4505 4450 4223 3808 3386 3261 1841 1509 1093 --34347 3389 3318 --
NM_002158chr243597 2976 1271 75 13499 23813 1417 1966
NM_002203chr554121 3755 3523 2773 972 --24092 100 23527 1649
NM_002214chr785690 5441 5314 4428 4296 1604 822 770 --55267 4655 4480 921 155 --
NM_002223chr1263905 3340 3236 3020 1377 35 12841 --12891
NM_002247chr1041916 894 388 379 1873 ----
NM_002264chr374812 3802 3778 3389 3167 1815 987 13841 11716 23471 1607
NM_002310chr576412 5827 4708 4317 1078 751 615 25896 5465 31488 1068 722 16591
NM_002336chr1263905 3805 3330 1434 1019 961 --44841 3657 3305 3254 --
NM_002356chr662663 2546 2144 2032 1840 1077 ------
NM_002508chr131260 604 554 1579 21837 557 --
NM_002515chr142782 284 --32067 2044 665 12048
NM_002546chr84794 668 649 103 ------
NM_002594chr2072498 2184 2045 1801 1753 1648 157 ------
NM_002641chrX31601 435 130 1289 --1664
NM_002655chr8115130 4586 3813 1822 1755 1711 1121 376 271 127 23 14814 35016 4015 1993 14360
NM_002677chr872167 2009 1966 1914 1042 811 772 1729 2197 35 --
NM_002718chr352623 2414 2277 995 117 --12482 --
NM_002731chr163070 1924 1176 761 523 140 12769 --1923
NM_002736chr741860 716 697 445 1544 32109 1731 658 1324
NM_002737chr1776430 6222 5162 2181 1236 213 190 16446 ----
NM_002740chr322408 933 22487 349 --12779
NM_002745chr2254296 4282 3904 3430 613 ----13703
NM_002839chr942448 972 754 580 --32799 2342 2339 12803
NM_002886chr364754 4485 3823 3397 1539 834 13785 15115 --
NM_002941chr351650 1338 287 144 42 1239 11566 --
NM_002977chr262381 2111 1339 512 490 98 13332 ----
NM_003034chr1287686 7106 3158 2280 1849 1171 765 670 27431 5097 27321 2598 --
NM_003046chr895292 4162 1922 1645 1146 1071 467 208 76 25042 4617 44524 508 346 28 --
NM_003081chr2021121 993 ----11125
NM_003108chr257111 6545 5195 4642 1512 ----16412
NM_003112chr762929 2798 2509 2414 2290 291 1606 32821 2417 2293 1755
NM_003149chr361412 1392 1337 1256 1141 443 ------
NM_003155chr832719 2580 41 12570 12660 --
NM_003161chr1742653 367 260 112 13370 2868 561 --
NM_003199chr1895208 1916 1616 1569 1111 960 241 172 30 11427 34109 1919 1416 --
NM_003234chr361973 1765 1759 1594 892 118 ----22258 1977
NM_003262chr384314 3923 1922 1720 1652 1034 385 260 --14982 1464
NM_003274chr2132014 892 136 1732 12824 22137 773
NM_003292chr151478 907 190 167 39 --1391 1763
NM_003298chr376202 5115 3899 1924 649 578 435 35269 1980 1106 ----
NM_003338chr1031765 1572 474 --21616 199 --
NM_003352chr22879 745 --2153 146 --
NM_003410chrX22971 881 --12030 1479
NM_003463chr632151 929 319 12266 21283 1280 --
NM_003566chr1232988 401 201 22928 904 33262 319 192 --
NM_003574chr1864740 4642 4407 2276 495 218 1125 34831 4828 1085 --
NM_003590chr253497 2838 2505 315 73 --22465 1163 23274 3191
NM_003607chr164053 3557 3435 2687 1684 1229 ----1368
NM_003672chr111340 1329 --11611
NM_003679chr193413 3365 3275 3072 2353 2335 604 585 415 1965 1555 --
NM_003759chr453332 2989 2652 719 664 ----11502
NM_003774chr1243002 2503 2242 93 --122 13106
NM_003816chr851349 1219 342 252 228 --31088 473 384 1495
NM_003831chr1851632 1525 1494 1394 587 1639 ----
NM_003870chr1522022 1948 --1640 11381
NM_003909chr852327 2226 2163 818 753 --12143 22675 2360
NM_003913chr633603 3439 703 --44149 4026 3767 1011 12660
NM_003930chr772336 2216 1579 438 288 148 62 --12397 --
NM_003958chr653020 2666 2610 790 185 11425 22827 2534 13229
NM_003994chr1283605 3067 2976 1463 1296 1144 1096 732 ------
NM_004028chr1863904 3380 3130 1665 543 267 --1759 1763
NM_004087chr391777 1641 1634 1597 1308 715 479 169 120 ----1500
NM_004093chr1352737 2502 1243 1141 918 12305 21249 1246 --
NM_004094chr1452435 2054 1009 955 710 --22848 1131 --
NM_004136chr1593308 2655 2621 2538 2526 1022 890 838 273 ------
NM_004171chr1169668 9123 8568 7927 3737 3216 --68614 6257 2138 974 966 704 --
NM_004232chr1853325 2788 268 237 132 11238 12586 --
NM_004274chr14----43143 3028 2132 1267 13147
NM_004338chr1887078 6832 6550 6106 4811 2429 956 404 36394 5832 4787 26426 772 --
NM_004384chr5--11860 21661 1536 11956
NM_004397chr1183614 3449 3255 3187 817 788 488 53 --12916 --
NM_004447chr1251085 990 170 110 41 ------
NM_004586chrX85191 4738 3423 1461 1369 1129 916 319 --34459 1815 1307 1770
NM_004598chr532373 2094 540 11270 --1544
NM_004612chr974085 4031 3751 3622 3332 1906 1617 11654 ----
NM_004666chr641333 1280 1108 548 21161 307 ----
NM_004686chr84553 429 282 196 --2643 370 11451
NM_004726chrX95603 4411 4196 4153 1822 1523 322 220 199 13826 ----
NM_004734chr1393210 3066 3056 2874 2862 2835 1074 693 388 --23149 2838 12818
NM_004736chr132108 1817 1732 --21508 627 --
NM_004738chr2021694 50 ----2568 69
NM_004744chr431458 1066 81 --3866 698 549 2887 870
NM_004748chr1542989 1592 1585 690 --33689 2821 1408 2260 157
NM_004815chr174868 4710 4470 3764 3309 3216 2998 --33525 1131 1030 --
NM_004857chr1464701 1871 1780 1463 1217 1162 11376 23386 100 --
NM_004859chr1762610 2385 1086 615 188 48 21060 508 ----
NM_004866chr564449 4404 3882 2002 1785 766 ------
NM_004869chr1851761 1344 1299 410 402 ------
NM_004904chr7136491 6452 5849 5821 5662 5601 4805 4555 4208 2269 2085 1113 306 --15352 --
NM_004932chr531553 587 407 --11527 1411
NM_004956chr753898 1426 907 322 147 --13718 --
NM_004992chrX67933 3397 3315 2831 2108 1652 26330 2271 --12034
NM_004992chrX67933 3397 3315 2831 2108 1652 26330 2271 --12034
NM_004993chr1451490 1295 1159 396 44 --1587 --
NM_005056chr1274461 1972 1915 1306 908 305 84 --14844 --
NM_005079chr863076 3031 2660 2483 823 661 1233 21044 664 --
NM_005126chr321903 321 --11776 1881
NM_005151chr1832301 2113 256 --22070 2067 22074 1561
NM_005188chr1178085 7447 7279 6175 3260 3161 1444 15397 ----
NM_005197chr1445941 5033 2131 1846 13777 46134 5051 410 263 --
NM_005233chr35599 505 496 178 58 1311 ----
NM_005235chr276195 5150 2628 2022 1630 1617 1287 --47378 4957 4939 1620 16001
NM_005277chr451489 556 453 351 103 --11294 --
NM_005385chr312591 1799 --22277 580
NM_005433chr1872828 2347 2199 1998 1975 420 198 --22187 1978 --
NM_005436chr1073711 3208 2814 1380 1117 969 961 ----1424
NM_005475chr1243186 2921 2683 401 ----13190
NM_005502chr963187 2749 2380 2090 1277 363 11228 23063 2702 12214
NM_005504chr12136626 6595 5887 5828 5543 5465 4223 2286 2242 2231 884 625 180 22499 1344 24697 4441 --
NM_005578chr385056 4890 3782 3466 3382 1188 776 418 --21628 1132 --
NM_005596chr975839 5570 2543 2228 1702 1652 636 25865 1190 11584 --
NM_005665chr131495 1082 416 14433 --150
NM_005668chr543861 1464 1086 311 13547 44607 3371 3368 284 --
NM_005715chr61280 --21869 325 12369
NM_005746chr762541 2419 2373 1847 1766 1050 ------
NM_005759chr2104285 3868 3275 2987 1827 1726 1688 1337 933 195 ----14524
NM_005779chr552522 1461 1370 1348 303 1197 165 --
NM_005822chr642270 1496 204 127 1182 2503 43 --
NM_005840chrX46947 5352 4830 362 27613 5053 23002 509 --
NM_005845chr1321359 456 ----21686 620
NM_005868chr732001 1942 1634 1293 22415 731 --
NM_005898chr1142842 2366 826 220 12925 12335 12913
NM_005901chr1868610 1628 1131 788 321 130 ------
NM_005902chr1563739 3238 3205 3004 960 777 13902 --1976
NM_005903chr584801 4671 4596 4275 4124 3700 1926 1102 --23903 2049 --
NM_005907chr62617 519 11677 1522 2181 151
NM_005935chr474954 4055 1209 1035 697 381 84 24773 4284 ----
NM_005941chr894207 3914 3610 3503 3208 3081 2999 845 754 12586 13084 13019
NM_005964chr1741220 1169 358 259 --1233 11506
NM_006007chr943464 3303 3008 1088 ----11032
NM_006016chr652293 2267 1425 332 149 1783 ----
NM_006080chr782783 2570 2476 2362 941 840 563 98 --12915 --
NM_006095chr453439 3060 2985 1139 1118 --44159 1241 844 841 --
NM_006154chr1522727 783 22638 2213 22282 960 --
NM_006203chr573912 2155 1909 1657 1426 1030 303 14705 ----
NM_006241chr372155 1610 873 635 602 348 228 ------
NM_006246chr1451285 1134 1086 329 309 --1119 --
NM_006287chr252574 934 607 137 107 12674 22116 859 1272
NM_006306chrX73712 2027 1310 852 562 276 249 ----11749
NM_006457chr493700 3506 3359 2748 2656 1027 883 486 404 ------
NM_006489chr142782 284 --32067 2044 665 12048
NM_006538chr273977 3257 2676 1533 734 174 89 --13193 --
NM_006544chr1486006 5968 5376 5313 4740 3702 1541 1389 14596 34439 4436 810 --
NM_006561chr1086207 5841 4786 4368 2071 1934 585 124 1156 45349 817 116 71 23990 302
NM_006572chr1772383 2158 1333 1079 1015 946 187 --23134 759 13343
NM_006599chr1697954 7085 6731 6091 6029 5684 2922 1262 361 17046 36829 5046 383 --
NM_006614chr333496 2581 2243 11132 11020 13656
NM_006624chr1031592 1447 484 --31978 1595 595 --
NM_006628chr1554060 3403 3266 3007 320 --140 1842
NM_006654chr1264325 3741 3588 3301 471 285 33788 2919 1402 11813 33592 1725 195
NM_006682chr762859 2767 2209 2169 2066 760 --1848 12238
NM_006729chrX94845 4580 3889 3480 2007 1973 1901 245 201 --34359 1173 618 11177
NM_006731chr975796 4764 4404 4005 1758 1003 580 ----11762
NM_006775chr6113059 2364 2049 1984 1918 1050 832 763 487 460 101 --12535 --
NM_006832chr142404 177 --4881 362 109 101 --
NM_006873chr253394 2452 976 932 904 ------
NM_006924chr1744355 4175 3307 1177 14093 11332 --
NM_006947chr441614 1503 1151 464 11470 11564 --
NM_006948chr2151714 738 716 405 58 1317 ----
NM_006996chr141155 685 575 311 11513 --1611
NM_007007chr1264444 3210 1747 1677 1082 284 ------
NM_007011chr1576861 5894 5207 2068 1877 1134 726 --45990 5841 1880 1137 --
NM_007106chr1341860 790 391 380 12245 42760 882 801 323 --
NM_007157chrX42907 2528 2344 619 1413 125 --
NM_007158chr11384 --1454 1368
NM_007173chr1132330 2142 208 22103 197 1935 --
NM_007191chr122503 88 ----1129
NM_007238chr2044365 3521 3019 878 ----33548 1960 1138
NM_007249chr13138575 8508 8266 7746 3710 3154 2937 2666 2143 2068 842 400 177 28314 8294 25777 3593 38632 6833 6726
NM_007271chr691376 1341 1308 357 333 323 297 244 51 ------
NM_007287chr363197 3016 2411 2180 2045 1089 --13096 --
NM_007288chr363197 3016 2411 2180 2045 1089 --13096 --
NM_007289chr363197 3016 2411 2180 2045 1089 --13096 --
NM_007331chr462657 2264 1893 1021 660 631 --21755 1752 12661
NM_012137chr182546 2536 2328 2032 1796 1042 893 249 ------
NM_012164chr9107557 7043 6171 5820 2795 2711 1987 1375 1206 111 15208 26901 2798 --
NM_012214chr286357 5847 3997 2395 1776 1256 929 397 --24935 2534 --
NM_012223chr241268 537 356 305 11301 1259 --
NM_012247chr102940 56 ----1381
NM_012249chr242469 2375 2282 281 --1656 12235
NM_012281chr742413 2164 952 667 1474 1705 --
NM_012287chr384504 4485 3961 3732 3422 3002 844 387 24198 3930 22782 2779 12915
NM_012297chr471002 914 498 467 160 138 39 22538 2286 146 --
NM_012309chr1164510 3645 3580 3287 3156 552 --11931 14962
NM_012388chr1553030 507 424 165 95 12145 --1934
NM_012420chr1052141 1885 1856 392 160 ----12307
NM_012464chr442743 2075 869 175 1240 22176 569 --
NM_013231chr1474063 1766 1676 1435 1090 406 23 13397 12824 --
NM_013250chr1171280 1264 1155 579 431 159 57 --2263 260 --
NM_013255chr788144 6745 6143 2872 2669 1996 1132 1086 --27742 6124 12976
NM_013269chr1244433 4100 1280 1124 13131 23345 3329 --
NM_013309chr151285 --2844 647 12584
NM_013341chr272672 2284 2238 2228 1868 295 284 --12507 --
NM_013374chr363027 2357 1177 613 517 419 ----1651
NM_013381chr1231830 825 441 ----11689
NM_014021chr153251 2352 1219 39 27 11296 ----
NM_014048chr1675146 4946 4420 4410 4225 3923 1830 --25226 1142 --
NM_014112chr874684 3701 3339 2048 1585 1445 1110 21355 888 ----
NM_014294chr811392 11439 --11183
NM_014423chr565588 4819 3614 1408 1172 682 13979 14485 13835
NM_014572chr1321780 1569 ----11481
NM_014612chr941348 1258 1082 511 2620 402 ----
NM_014616chr353504 1337 914 587 536 2683 307 1819 --
NM_014702chr642792 2490 790 208 23376 804 ----
NM_014705chr751489 471 458 212 143 11962 12043 --
NM_014711chr1642049 1605 734 209 --11728 11345
NM_014721chr6137496 7428 5973 5923 5823 5552 4816 4721 2978 2118 600 576 263 --36706 6351 426 --
NM_014739chr654073 3816 3204 2857 1007 1467 ----
NM_014742chr2021709 1301 --41741 1738 1735 187 --
NM_014757chr522278 347 --12374 12378
NM_014787chr162840 1963 1953 1930 1913 915 12036 --22624 2157
NM_014819chr532467 1568 260 31747 1560 472 ----
NM_014826chr164053 3557 3435 2687 1684 1229 ----1368
NM_014828chr1461845 693 612 576 441 99 --1696 11849
NM_014829chr522208 2099 1411 21891 527 1531
NM_014873chr184551 3945 3915 3646 3379 1353 1110 65 1703 ----
NM_014877chr1765075 4887 4777 1104 515 178 26736 1010 14912 --
NM_014904chr1053881 3124 1162 812 105 ------
NM_014918chr1531503 1115 201 --21605 491 11407
NM_014920chr643541 3374 3131 238 22321 747 ----
NM_014923chr1322189 122 --12231 1599
NM_014946chr242369 2262 1233 71 ----11198
NM_014982chr1421969 634 11687 54631 3959 3956 1972 795 11539
NM_015000chr1272581 2267 1069 999 933 826 365 --1589 --
NM_015026chr1243859 3184 2921 1584 13135 13470 1840
NM_015040chr253200 3154 2886 804 460 22405 793 23028 91 --
NM_015051chr922486 2345 11234 --1935
NM_015143chr451403 1324 1195 1094 289 11254 ----
NM_015156chr1442580 1455 1325 879 23918 534 1545 --
NM_015170chr832189 1951 645 11575 --22140 1568
NM_015192chr2093014 2734 2395 2369 1939 559 467 403 47 --12241 1550
NM_015205chr1355085 4837 3335 657 451 13593 24989 4923 14993
NM_015206chr15103867 3295 3122 3094 2867 2503 1347 557 519 255 ------
NM_015208chr1832945 2514 738 154 23496 3493 11473
NM_015215chr133074 2544 360 ----12822
NM_015225chr953044 2961 655 512 269 2858 626 ----
NM_015247chr1645405 5107 4160 1183 --21866 1348 23913 1236
NM_015271chr443905 3495 2774 498 --24117 1085 14332
NM_015310chr8107963 7327 7132 6636 5805 5227 3095 3006 2007 859 16493 ----
NM_015314chr772299 1693 992 975 588 573 552 ------
NM_015317chr262403 2148 1973 619 558 68 ------
NM_015355chr1731506 275 207 --1169 11817
NM_015365chrX23694 141 --22875 157 1724
NM_015423chr1121303 617 11454 --11758
NM_015431chr11745 11252 23598 3298 1301
NM_015435chr831268 1095 207 --1110 1114
NM_015436chr443148 2187 1191 590 --32873 84 74 2893 181
NM_015455chr553534 3067 2866 1232 1212 33691 3473 1431 12834 --
NM_015564chr562346 2232 999 691 597 584 ------
NM_015576chr342982 505 383 148 --21187 348 --
NM_015578chr1951909 845 506 330 306 1619 11514 --
NM_015640chr163673 3405 3398 1432 827 691 --24965 3311 --
NM_015678chr1331526 1388 214 --11391 11239
NM_015888chr143354 2361 1283 692 32549 1138 906 22925 2917 12269
NM_015975chrX31660 225 127 21560 1366 --11580
NM_016009chr174929 4688 3337 714 306 169 31 34875 4344 864 ----
NM_016018chr842281 1806 677 171 1835 1616 --
NM_016021chr62650 43 --11081 11085
NM_016025chr1671370 1297 1263 590 516 216 118 ------
NM_016073chr157966 879 865 345 301 258 138 --1320 --
NM_016083chr6123811 3719 3660 3232 2886 2704 2675 2626 2553 923 767 142 --13929 --
NM_016096chr84752 479 394 364 --11362 11984
NM_016131chr232299 582 286 --21839 1538 1175
NM_016132chr1542812 2310 2104 2097 --12677 --
NM_016156chr1142209 745 595 25 12322 1598 --
NM_016206chr398993 7902 7803 7768 7425 6783 5551 1825 266 11669 48740 6354 3280 1421 28833 3573
NM_016221chr552247 1580 571 467 80 --11882 --
NM_016255chr643375 2416 1142 1095 22834 2715 --13253
NM_016260chr297301 5990 4743 2902 2336 1762 952 283 224 ----14871
NM_016275chr331748 480 70 2999 797 12635 --
NM_016287chr152006 1521 576 99 25 --11792 --
NM_016315chr241800 1680 1251 471 11258 11327 --
NM_016472chr1441274 469 217 111 --21277 1253 --
NM_016513chr643541 3374 3131 238 22321 747 ----
NM_016530chr1594045 3022 1627 1541 1184 793 562 529 520 --13332 --
NM_016531chr483100 1595 1442 1082 930 524 137 70 22869 2841 ----
NM_016542chrX2575 386 --1164 11699
NM_016591chr541169 747 263 255 --1877 2925 321
NM_016607chrX2329 124 1115 21140 282 --
NM_017420chr1453644 1451 1187 1144 184 --11370 --
NM_017447chr2161015 1008 698 498 240 105 --43188 2682 807 501 1163
NM_017628chr495233 5180 4723 4654 3250 1959 1834 1151 1030 --11720 13339
NM_017633chr62889 263 ----11002
NM_017637chr979478 7429 7208 3571 2171 1966 814 12691 ----
NM_017644chr375192 4232 4138 1374 1072 766 407 31930 1550 565 14235 14675
NM_017650chr7125576 5040 4168 4034 3695 1935 1853 1831 1818 1751 988 217 15263 ----
NM_017651chr621052 1039 1267 11089 --
NM_017752chrX31432 792 144 22014 23 --12104
NM_017768chr14800 777 599 83 ----1824
NM_017769chr1453131 2887 2182 993 984 22894 1035 22926 80 12861
NM_017779chr15554 253 147 121 93 12487 12076 --
NM_017812chr72674 209 ----1568
NM_017848chrX43365 3256 2907 323 --1389 13657
NM_017919chr994406 2282 2056 1695 1647 1609 1507 1487 439 ----23640 2139
NM_017935chr44633 554 496 226 ----2693 168
NM_017944chr112814 604 12902 --22169 769
NM_017987chr1042156 728 625 228 11435 1443 --
NM_018084chr242218 1299 1191 969 --21206 366 --
NM_018126chr451346 1335 1218 282 41 1542 1376 --
NM_018155chr363169 2749 2541 827 802 439 12195 22671 2507 --
NM_018184chr312066 --1738 1388
NM_018225chr975305 5261 4961 4491 1159 819 236 1360 ----
NM_018254chr152375 2164 2089 1980 43 --32391 2167 733 147
NM_018293chr372623 2258 1992 1929 1086 354 70 ------
NM_018299chr843188 2464 1081 387 --12983 --
NM_018351chr1284370 3856 2968 817 785 624 125 50 13561 ----
NM_018361chr874081 3593 3429 3381 3334 2524 1616 13402 --1711
NM_018362chr1154025 3489 511 490 154 12545 32960 1528 111 --
NM_018364chr143334 2799 2523 698 23352 1188 23435 685 --
NM_018374chr7115070 4389 3898 2101 1800 1254 1075 1007 998 796 710 --33238 1686 713 12048
NM_018409chr462599 2493 2453 2133 381 29 23202 2630 12496 12233
NM_018429chr542936 2855 2783 908 3576 567 370 ----
NM_018440chr8108685 6787 5721 5649 3359 2898 2773 2336 2061 298 --12004 --
NM_018566chr175076 3910 3225 2031 2011 703 567 1626 14381 --
NM_018638chr1235184 5054 3938 ----1914
NM_018841chr193938 3892 3730 3219 2691 2440 1483 1407 488 --13812 12701
NM_018999chr1074798 4687 3402 3383 3034 1628 109 --1196 --
NM_019001chr3104599 4271 3542 3470 1790 1544 1001 983 395 141 24409 3921 11470 11485
NM_019008chr2221514 119 --42924 2489 862 803 12671
NM_019036chr651254 933 430 183 69 1798 ----
NM_019063chr232270 1877 236 --21517 1514 1893
NM_019072chr584218 4029 3929 3732 2801 2729 827 184 23756 289 14139 --
NM_019117chrX63452 2898 2750 2570 475 127 --13114 1755
NM_019556chrX31318 447 178 ----1451
NM_020122chr265332 5239 4140 1965 934 484 ------
NM_020159chr421260 69 ----11264
NM_020177chr563133 2884 971 847 808 108 22088 135 23197 3194 --
NM_020228chr1122016 174 --42317 2283 902 696 --
NM_020390chr384909 3979 3061 1702 1578 888 501 175 24453 1757 23982 3313 11621
NM_020466chr674666 4048 1639 1278 1218 808 265 ------
NM_020473chrX31601 435 130 1289 --1664
NM_020654chr331115 154 131 31224 1079 420 11570 --
NM_020673chr20126349 5722 5571 4819 2947 2413 2265 2025 1748 1401 434 230 26868 4936 ----
NM_020718chr1675100 4505 4068 2494 2475 1496 939 --24373 2541 --
NM_020739chr1542989 1592 1585 690 --33689 2821 1408 2260 157
NM_020772chr17138621 8180 8020 7428 7317 7219 7009 6898 5624 3251 969 361 49 23090 2729 28554 1274 --
NM_020774chr1865972 4831 2373 1821 1659 1062 25506 104 22278 373 34835 2120 1045
NM_020782chr12104765 4532 4285 3910 3446 1864 1635 419 383 275 14365 ----
NM_020792chr332063 699 322 ----1797
NM_020801chr512304 --1996 12203
NM_020830chr232620 2189 661 12627 --22927 2539
NM_020844chr877540 7051 6328 2954 1858 1594 1105 ------
NM_020861chr631324 1192 549 1173 --1230
NM_020868chr251989 603 538 372 345 ----11541
NM_020871chrX52243 2215 2052 1634 947 22514 342 ----
NM_020872chr31390 1380 --21462 122
NM_020917chr1952791 1412 993 672 651 --1228 --
NM_020921chr1433700 3453 1383 --23456 3308 2451 129
NM_020935chr294477 3326 1694 1653 1611 1432 1390 804 455 13999 3813 810 807 21436 798
NM_020940chr1022558 465 12280 --1201
NM_020948chr153098 2801 2519 2387 1087 11123 ----
NM_021033chr1343163 2186 964 872 --33333 3330 1315 --
NM_021038chr373197 2744 1168 1114 627 96 75 1484 ----
NM_021083chrX93416 3020 2880 2826 1217 1155 541 466 312 --23333 925 --
NM_021204chr41315 --1720 1724
NM_021252chr1051824 515 413 354 151 1118 1268 --
NM_021629chr345012 3131 686 571 24654 304 14079 1690
NM_021814chr641708 1537 136 34 ----11221
NM_021815chr262669 2434 2034 1951 1051 759 13120 --1407
NM_021911chr595437 5347 5159 3524 2049 1143 810 669 420 12012 15162 --
NM_021912chr1561381 1069 707 583 390 345 --22951 975 1416
NM_021956chr661549 1310 1213 1080 600 186 ------
NM_021960chr142356 2205 602 375 ----11025
NM_021961chr1187348 6556 6541 5282 1079 1055 191 76 --16384 --
NM_021964chr396317 6125 5441 5258 4998 2438 1963 1539 1204 22491 563 --16223
NM_022037chr23959 214 81 --2887 156 --
NM_022173chr23959 214 81 --2887 156 --
NM_022351chr863585 3549 3185 2917 2875 159 1685 ----
NM_022444chr721918 212 --11706 1268
NM_022459chr1376298 5498 2212 1538 1031 539 363 14941 15169 --
NM_022474chr1442220 791 494 397 ----1846
NM_022763chr352854 2572 2509 2439 1936 --1954 12524
NM_022841chr1562099 1838 931 872 384 316 --12079 12467
NM_022843chr1351529 1324 1207 1196 56 ------
NM_022845chr1662157 2149 1664 1427 530 259 --11414 --
NM_022893chr243060 883 706 507 --21997 901 --
NM_022901chr921537 37 2154 132 --11694
NM_022918chr1141953 1519 1388 638 22165 243 11498 --
NM_024423chr1844172 3946 3482 549 1946 13465 --
NM_024557chr1151456 1422 1311 140 131 ------
NM_024583chr221049 250 2857 830 --21105 1053
NM_024613chr81382 ----21328 498
NM_024646chr143629 3503 2966 1464 --1215 --
NM_024665chr364402 4225 3087 1604 1416 1076 1297 13616 12907
NM_024770chr2116293 6081 5826 5184 4886 4730 4373 2635 2564 2303 606 ------
NM_024947chr398445 7166 6924 6191 6104 3583 3350 3255 2980 17043 48036 2053 312 171 --
NM_024989chr2118093 7274 6730 6124 3250 2547 2041 376 339 292 254 12659 12849 --
NM_025054chr893208 2943 1586 1580 1359 1040 705 392 85 ----13511
NM_025073chr154451 4429 4412 4325 1110 14621 ----
NM_025146chr322569 2101 12391 --12105
NM_025180chr373081 2742 2660 2563 2280 1217 556 --1668 1263
NM_030621chr1443885 3576 1694 1243 --11266 1889
NM_030627chr573832 3733 1532 1515 1353 1036 964 1614 1655 --
NM_030647chr794624 4284 4182 4162 4127 2118 1687 727 326 11141 ----
NM_030650chr243891 762 682 113 11075 32905 1394 421 --
NM_030660chr1451490 1295 1159 396 44 --1587 --
NM_030674chr1275517 4612 4498 3747 3733 1846 1149 1937 12190 11850
NM_030755chr1463028 2764 2147 848 323 123 ------
NM_030816chr133204 1260 504 --13411 1798
NM_031305chr42176 126 --1389 11769
NM_031362chr252574 2411 1935 930 889 ------
NM_031365chr252710 2547 2071 1066 1025 ------
NM_031366chr252710 2547 2071 1066 1025 ------
NM_031419chr351456 1412 1332 1289 318 ------
NM_031427chr1465794 5188 3952 3909 2308 1433 15630 45584 3895 1158 1042 --
NM_031435chr1223199 2515 --42130 1330 542 85 --
NM_031442chrX73125 2512 2409 2234 2215 1286 1161 1156 1638 --
NM_031468chr788245 7972 7945 7772 5968 5522 5043 2894 ------
NM_031483chr2053392 3065 2814 1369 543 --11218 11000
NM_032042chr562818 1812 1021 829 154 92 ------
NM_032121chrX12745 --12035 12039
NM_032128chr42725 284 ----1698
NM_032160chr1864330 4042 2792 1732 274 197 21475 1199 --11143
NM_032182chr1051515 601 380 280 206 21354 679 ----
NM_032189chr1354887 4639 3137 459 253 13395 24791 4725 14795
NM_032208chr243593 3148 1309 952 ----13445
NM_032221chr2051939 1491 1449 671 182 --1504 --
NM_032228chr1183114 2668 1359 964 782 595 516 461 12726 ----
NM_032321chr272985 2972 2828 2800 2644 2085 1260 --12356 --
NM_032373chr1085444 4580 1801 1181 880 847 823 55 15482 --14449
NM_032440chr1052909 940 425 68 54 ------
NM_032446chr553529 3355 3117 1121 754 2776 377 23832 1504 --
NM_032457chr483624 3285 3226 1408 1387 1105 834 490 13116 43775 3772 1204 371 --
NM_032458chrX63310 2712 2685 2568 2502 215 2300 273 22571 319 --
NM_032466chr831282 1128 547 --31577 659 499 --
NM_032468chr831282 1128 547 --31577 659 499 --
NM_032622chr451389 501 423 357 220 ------
NM_032778chr352729 2122 707 298 279 ----11342
NM_032838chr1921176 848 11287 51179 1057 1054 1039 857 --
NM_032873chr1144175 1293 1286 846 ----11221
NM_032961chr431268 1083 876 1361 2139 81 --
NM_032968chrX73846 3321 3308 2720 1407 840 85 14101 3305 302 252 --
NM_032969chrX73846 3321 3308 2720 1407 840 85 14101 3305 302 252 --
NM_032973chrY73838 3316 3303 2715 1407 840 85 14093 3305 302 252 --
NM_032975chr1833646 1433 302 23143 819 --12487
NM_032978chr1841178 959 941 488 --11044 --
NM_032979chr1841178 959 941 488 --11044 --
NM_032980chr1833646 1433 302 23143 819 --12487
NM_032981chr1841178 959 941 488 --11044 --
NM_033181chr6123811 3719 3660 3232 2886 2704 2675 2626 2553 923 767 142 --13929 --
NM_033222chr941436 548 506 160 1199 11353 --
NM_033224chr767063 6470 5623 2705 1220 936 12730 11995 --
NM_033389chr1784164 3760 3684 3570 3211 1835 1112 271 14791 1214 1625
NM_033430chr444003 3450 3436 589 --23199 1637 1426
NM_033437chr444003 3450 3436 589 --23199 1637 1426
NM_033505chr256561 6141 6119 2636 1682 15011 15522 --
NM_033656chr21115658 5376 4353 4246 3642 2219 2077 1972 1688 1200 299 1549 ----
NM_052818chr1352181 2136 1574 609 437 --1673 1139
NM_052885chr1284997 4438 4118 3537 1698 1420 651 517 ------
NM_052898chr851541 1276 323 131 122 21832 1589 1134 --
NM_052900chr831655 1427 697 21273 615 11309 11143
NM_052907chr1244302 4099 2764 1410 --43607 1513 673 472 --
NM_052917chr262975 1248 1055 1024 387 52 33237 2183 1295 22861 375 --
NM_053016chr987304 7166 6895 6095 5630 2665 2079 1965 --22559 1000 --
NM_058241chr211972 --21673 315 11792
NM_058241chr211972 --21673 315 11792
NM_078487chr953146 3082 3037 2655 2636 12828 ----
NM_080867chr1474961 4087 3884 3479 3432 1980 677 11771 33435 1523 1015 --
NM_130391chr942448 972 754 580 --32799 2342 2339 12803
NM_130392chr942448 972 754 580 --32799 2342 2339 12803
NM_130393chr942448 972 754 580 --32799 2342 2339 12803
NM_130811chr2021121 993 ----11125
NM_133334chr475620 5340 1702 1107 1042 436 43 --11945 147
NM_133372chr532308 386 296 12605 12477 --
NM_133473chr1921792 701 1756 21321 704 11903
NM_133631chr351650 1338 287 144 42 1239 11566 --
NM_133638chr5290 45 ----21282 274
NM_133646chr295320 4130 3736 3522 3399 1534 1490 1321 150 --11426 24863 1494
NM_138270chrX23073 2361 --21106 1103 13077
NM_138286chr1951522 1503 1093 921 328 2725 249 ----
NM_138426chr731747 646 111 2554 119 11891 --
NM_138459chr621349 122 ----13475
NM_138468chr226027 656 ----15457
NM_138621chr273977 3257 2676 1533 734 174 89 --13193 --
NM_138713chr1697954 7085 6731 6091 6029 5684 2922 1262 361 17046 36829 5046 383 --
NM_138714chr1697954 7085 6731 6091 6029 5684 2922 1262 361 17046 36829 5046 383 --
NM_138731chr1454070 3218 2785 1647 613 ----1310
NM_139283chr1262154 1643 1624 435 429 176 --21880 34 --
NM_144571chr476796 6185 5151 5134 4512 1495 166 31774 1129 904 36213 2512 120 --
NM_144578chr1445305 4755 3886 1886 2430 173 35272 4297 3354 --
NM_144599chr1583963 2034 1711 1305 1081 871 669 308 --22130 1572 14113
NM_144664chr111559 --21948 588 11651
NM_144721chr462254 1874 1862 633 123 89 1131 --1766
NM_145005chr92942 278 ----1163
NM_145206chr1083329 3222 2997 2973 2942 2085 509 269 --23305 2887 --
NM_145207chr464384 4245 4222 4032 3600 1677 14334 1530 --
NM_145259chr276794 5325 4929 4869 2173 927 308 --25956 2431 --
NM_145284chrX52015 796 693 596 521 32372 1858 975 ----
NM_145307chr1064070 3815 3400 1604 1335 948 166 23701 1397 --
NM_148957chr1342700 2573 2160 2077 --32654 2611 520 --
NM_152330chr1462627 1978 1859 1780 835 353 ----12585
NM_152388chr293785 3512 2492 2480 1571 1400 523 478 197 11150 1200 1615
NM_152389chr241219 1167 642 22 --11606 21171 1087
NM_152409chr532705 2638 280 2610 338 13103 --
NM_152424chrX94523 3514 1541 1367 1244 1119 997 736 636 ----1640
NM_152529chr241734 1706 1027 53 33928 1759 953 24381 4091 --
NM_152608chr12454 311 --31993 1990 399 12447
NM_152624chr557418 6542 4853 1296 452 11658 12499 --
NM_152629chr954117 3860 1508 1494 180 23565 1426 32639 2636 698 --
NM_152641chr1232894 1124 695 12153 --1586
NM_152678chr332724 2332 41 12449 2656 531 --
NM_152745chr761018 724 355 296 271 207 ----1791
NM_152754chr773287 3253 2928 2599 553 484 413 --23219 3046 33504 3223 1134
NM_152756chr594343 3586 3532 3182 2955 1266 826 810 224 11656 ----
NM_152758chr892830 2412 2378 2287 1141 870 313 213 158 11954 --12253
NM_152835chr182819 2751 2146 1963 1895 645 328 64 --22645 2055 1978
NM_152924chr1576861 5894 5207 2068 1877 1134 726 --45990 5841 1880 1137 --
NM_152999chr7135038 4938 4820 4125 3858 3414 3254 3144 3050 1498 1169 435 50 13633 ----
NM_153182chr352729 2122 707 298 279 ----11342
NM_153183chrX1446 --21048 1045 11227
NM_153184chr371814 1763 1563 378 167 88 62 ----1297
NM_153456chr13116250 6085 6066 5881 5869 4851 4175 4140 4075 1726 1127 ----14043
NM_153607chr543050 2930 888 94 --12218 12808
NM_153646chr1442241 2232 231 142 1701 1728 1713
NM_153647chr1442241 2232 231 142 1701 1728 1713
NM_153648chr1442241 2232 231 142 1701 1728 1713
NM_153687chr1241217 285 100 33 --1288 137
NM_153810chr1074965 4724 4631 4187 3205 2026 448 21181 1071 11755 --
NM_172071chr152950 2166 1091 1006 438 21505 923 46441 6215 4953 4914 --
NM_172127chr462034 1509 1353 682 331 187 ----1196
NM_172128chr461990 1465 1309 638 287 143 ----1152
NM_172240chr1231059 902 221 11275 2905 115 --
NM_173214chr1697954 7085 6731 6091 6029 5684 2922 1262 361 17046 36829 5046 383 --
NM_173536chr464190 3648 3496 1952 1360 1113 11107 --11315
NM_173552chr341560 627 361 232 11756 1999 11988
NM_173582chr1146312 4993 931 692 --15992 14248
NM_173642chr179115 8349 8266 6871 5595 3226 553 29156 7709 1896 --
NM_173797chr5167 183 --158
NM_173808chr144419 3704 3343 1420 11788 21067 146 13207
NM_173822chr241401 1331 565 105 22186 289 1730 11453
NM_173829chr585282 3970 3916 2067 1794 1146 252 142 --14046 15765
NM_173851chr863775 3081 2652 2536 1249 1168 174 21610 1603 --
NM_174937chr102718 276 --1489 2659 497
NM_175061chr71213 --21608 442 1200
NM_175861chr1235804 4212 904 --35114 4119 1485 --
NM_175884chr741233 1061 983 375 ----11319
NM_176823chr193878 3864 3691 2822 2683 1540 1346 1309 1097 13160 ----
NM_177438chr1443885 3576 1694 1243 --11266 1889
NM_177947chrX2329 124 1115 21140 282 --
NM_177948chrX2329 124 1115 21140 282 --
NM_178011chr1042680 2203 1247 1171 --2957 802 --
NM_178123chr2----21090 767 11015
NM_178498chr1164017 3766 3449 889 592 277 --24072 3201 --
NM_178539chr1231949 1860 1449 ----1745
NM_181077chr1572290 1923 1685 1428 852 778 250 ------
NM_181354chr821531 1159 --1673 11548
NM_181358chr113626 23861 3850 1226 12699
NM_181481chr1887078 6832 6550 6106 4811 2429 956 404 36394 5832 4787 26426 772 --
NM_181482chr1887078 6832 6550 6106 4811 2429 956 404 36394 5832 4787 26426 772 --
NM_181483chr1887078 6832 6550 6106 4811 2429 956 404 36394 5832 4787 26426 772 --
NM_181670chr1241414 1378 1250 482 ----21323 1254
NM_181704chr2141294 1055 253 73 1395 4937 928 910 76 --
NM_181705chr595607 4659 4586 4460 4381 1267 1131 582 159 14756 21357 770 15727
NM_181706chr1162288 2223 2108 1701 338 129 11885 1951 32227 1814 342
NM_181723chr842320 1988 1872 337 11982 22005 795 --
NM_181782chr661826 900 803 378 363 128 --1791 --
NM_181897chr352623 2414 2277 995 117 --12482 --
NM_182484chr2141294 1055 253 73 1395 4937 928 910 76 --
NM_182503chr655588 4427 2066 1584 76 --23846 133 --
NM_182508chr1361979 1053 836 573 437 364 --21074 930 1789
NM_182551chr262798 2734 2307 353 264 114 --33479 566 117 --
NM_182763chr142345 2194 591 364 ----11014
NM_182898chr7136491 6452 5849 5821 5662 5601 4805 4555 4208 2269 2085 1113 306 --15352 --
NM_182899chr7136491 6452 5849 5821 5662 5601 4805 4555 4208 2269 2085 1113 306 --15352 --
NM_182920chr351424 1176 1014 422 29 --1334 --
NM_182948chr163070 1924 1176 761 523 140 12769 --1923
NM_183078chr652926 2572 2516 696 91 11331 22733 2440 13135
NM_183419chr831268 1095 207 --1110 1114
NM_194291chr82227 195 ----11060
NM_194314chr134367 4124 310 --33726 567 564 11903
NM_194434chr1864740 4642 4407 2276 495 218 1125 34831 4828 1085 --
NM_198066chr1442843 2799 1211 385 --22759 950 12856
NM_198123chr831655 1427 697 21273 615 11309 11143
NM_198124chr831655 1427 697 21273 615 11309 11143
NM_198181chr1562709 2670 1870 862 547 472 ------
NM_198268chr113626 23861 3850 1226 12699
NM_198269chr113626 23861 3850 1226 12699
NM_198273chr562833 2334 1060 939 809 269 ------
NM_198400chr1522727 783 22638 2213 22282 960 --
NM_198468chr651558 1314 975 700 35 --21623 1368 14142
NM_198485chr372433 1973 717 549 274 255 29 ------
NM_198503chr122053 1643 --11978 1446
NM_198581chr236223 6163 5810 36769 1921 619 25663 832 --
NM_198715chr1125918 5163 5129 4884 4807 4457 3868 3844 2056 521 511 359 16272 36359 4670 4354 --
NM_198793chr343865 3621 2783 1095 13661 13573 --
NM_199072chr743093 2689 2316 2038 --22915 121 --
NM_199132chr191827 ----2496 339
NM_199168chr1041551 1069 326 288 11465 2339 336 --
NM_199324chr41773 23742 303 --13607
NM_199421chr1474961 4087 3884 3479 3432 1980 677 11771 33435 1523 1015 --
NM_199436chr242369 2262 1233 71 ----11198
NM_199437chr1122016 174 --42317 2283 902 696 --
NM_199438chr1122016 174 --42317 2283 902 696 --
NM_199439chr1122016 174 --42317 2283 902 696 --
NM_201278chr1142209 745 595 25 12322 1598 --
NM_201281chr1142209 745 595 25 12322 1598 --
NM_201591chr451489 556 453 351 103 --11294 --
NM_201592chr451489 556 453 351 103 --11294 --
NM_203349chr1531908 1683 131 ----1765
NM_203406chr552377 2337 2230 2054 1927 ----12115
NM_203459chr142239 1899 1023 248 1938 22271 316 --
NM_203463chr223156 120 --24948 3662 13160
NM_203504chr471002 914 498 467 160 138 39 22538 2286 146 --
NM_203505chr471002 914 498 467 160 138 39 22538 2286 146 --
NM_206594chr132429 1141 200 13405 22508 791 --
NM_206595chr132429 1141 200 13405 22508 791 --
NM_206853chr664100 3357 3168 2566 1132 34 ------
NM_206854chr665361 4618 4429 3827 3313 1295 ------
NM_206855chr676326 5583 5394 4792 4278 2260 55 2620 551 1536 --
NM_206909chr8107963 7327 7132 6636 5805 5227 3095 3006 2007 859 16493 ----
NM_206933chr162839 2780 1982 1059 1008 67 180 12068 --
NM_207292chr373197 2744 1168 1114 627 96 75 1484 ----
NM_207293chr373197 2744 1168 1114 627 96 75 1484 ----
NM_207294chr373197 2744 1168 1114 627 96 75 1484 ----
NM_207295chr373197 2744 1168 1114 627 96 75 1484 ----
NM_207296chr373197 2744 1168 1114 627 96 75 1484 ----
NM_207297chr383222 2769 1193 1139 652 121 100 36 1509 ----
NM_207306chr1261360 1324 1288 1252 1216 1180 1144 1108 1072 1036 1000 964 928 892 860 824 788 752 716 680 644 608 572 536 500 464 ------
NM_207361chr1385182 4843 2434 2107 1793 1152 631 392 34953 4245 4057 --16147
NM_207422chrX51439 1392 1251 1213 199 --1216 1138
NM_212558chr9124014 3577 3457 3379 3337 2820 1685 834 794 760 599 472 --23627 1011 14102
NM_213589chr2115585 5225 3795 2105 1466 1196 1150 1050 852 660 338 25052 1769 25329 4676 25574 5202
NM_213606chr1052696 2639 2137 1868 506 --22212 1040 --