TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1277-5p
miRNA Sequence: AAAUAUAUAUAUAUAUGUACGUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr561745 1635 1483 748 243 230 21371 37 2337 254 --
NM_000051chr1183435 3322 3309 2748 2366 1001 781 48 2721 662 12369 13535
NM_000052chrX183139 3100 3000 2832 2810 2769 2715 2699 2686 2676 2571 2495 2372 1346 1312 778 605 211 23236 113 ----
NM_000084chrX115141 4831 4804 4276 2596 2580 2150 2056 959 579 266 35656 586 61 55931 5913 4552 1171 55 --
NM_000091chr282893 2814 2725 2099 1145 999 801 726 11088 32800 2789 1094 --
NM_000097chr341177 1030 891 308 1974 2393 346 21062 1051
NM_000104chr243018 2818 967 450 32792 931 430 12551 32822 1210 905
NM_000109chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_000110chr15994 948 898 415 128 11194 1963 1902
NM_000112chr5105495 5343 4922 4826 1681 1426 1390 1371 1132 153 34594 1410 1039 35430 1393 260 11349
NM_000141chr1081089 454 421 413 390 375 146 102 --2431 401 1425
NM_000176chr5102945 2777 2715 1550 1529 786 539 475 268 242 23608 3577 11521 --
NM_000189chr252199 1760 896 795 777 --1874 1883
NM_000202chrX93806 3031 1330 1099 1043 617 461 405 156 21359 495 53226 3098 3084 903 480 1864
NM_000216chrX133940 3840 3669 3471 2691 1504 1302 1286 1272 1145 1049 784 270 12973 32648 1428 411 1771
NM_000248chr353029 905 811 554 178 23010 969 4962 557 471 143 --
NM_000252chrX71343 1268 1154 358 306 297 139 --2361 309 11536
NM_000259chr15126366 5919 5780 5634 5605 5158 4802 2126 1772 1410 522 480 35938 5356 2133 35812 5785 2169 1881
NM_000267chr17103271 3252 3105 3085 3041 1176 864 687 478 231 23124 1076 33118 1100 875 --
NM_000314chr1073053 2408 2389 2208 1985 715 217 11295 32870 891 492 22412 2393
NM_000332chr665281 2389 1813 1684 689 654 16029 32435 692 657 11105
NM_000337chr576149 2110 1005 833 197 183 173 --11100 --
NM_000408chr2123441 3057 3013 2998 2936 2826 2735 1241 919 215 187 154 13403 13169 11074
NM_000448chr11133292 3242 3127 2879 2810 2462 2291 1091 769 657 645 413 406 --42915 2489 923 772 1605
NM_000452chr135765 565 218 199 58 1386 52061 518 243 210 135 --
NM_000489chrX103432 3246 3056 2705 2657 2500 2438 2322 2166 731 --22325 376 11249
NM_000492chr791504 1218 1170 1156 1004 988 969 508 462 11268 ----
NM_000544chr6_cox_hap143423 3336 3175 825 13325 1264 23149 648
NM_000555chrX107211 6580 5881 5781 5558 2817 2320 1242 973 308 15566 66956 6596 6317 2822 2351 150 --
NM_000602chr731512 1489 1464 --31521 1492 1469 --
NM_000618chr12146591 6562 6441 6184 5608 4555 2399 2274 1940 1576 1303 866 514 267 15866 46286 6272 5271 724 --
NM_000618chr12146591 6562 6441 6184 5608 4555 2399 2274 1940 1576 1303 866 514 267 15866 46286 6272 5271 724 --
NM_000791chr582628 2470 1797 1042 1035 544 479 386 --157 12622
NM_000793chr14165132 5025 4019 3956 3550 3444 1904 1690 1681 1529 1501 1409 1204 997 986 585 24670 511 21215 875 --
NM_000806chr591959 1404 1364 766 517 490 377 344 55 11354 21493 347 --
NM_000809chr4219210 8203 8067 7902 7834 7823 7808 7677 6919 6883 6842 6617 6318 6176 3621 3598 3568 2938 1913 590 181 78885 7379 7340 6451 6092 6028 2970 79281 7371 7293 2870 2514 1924 937 27721 6530
NM_000813chr5165589 4455 4064 4005 3535 3465 3435 3423 2014 1831 1625 1500 1389 1285 1253 1203 --64912 3509 3480 1598 1529 1392 --
NM_000814chr1593563 1027 254 195 187 177 158 133 115 3995 971 411 42614 1500 1009 198 --
NM_000866chr351678 1387 1299 274 138 1701 11521 1655
NM_000868chrX82464 1953 1944 1693 1010 387 184 44 32591 2506 1980 --12456
NM_000880chr85860 835 803 347 220 1157 2806 785 1940
NM_000899chr1294382 4302 4218 4089 4073 2980 1577 1139 872 --12996 --
NM_000910chr481967 1906 1838 1680 1667 1461 1319 24 21864 1260 21512 1425 11624
NM_000945chr292010 642 474 360 344 336 322 314 90 ------
NM_000950chrX123627 3600 3106 3015 2502 1174 1063 805 314 287 267 201 1750 43530 3432 3193 3109 --
NM_000959chr163474 3303 2960 2909 2556 936 --32565 1557 1296 13631
NM_001001395chr1292826 2202 2043 1839 1007 429 413 373 293 --21842 301 --
NM_001001396chr174272 4020 4005 3990 1609 1153 728 --34320 2829 708 13348
NM_001001419chr5175169 5090 5069 4914 4290 3909 3799 3721 3225 3191 1913 787 710 650 173 145 27 24324 952 --15155
NM_001001420chr5175169 5090 5069 4914 4290 3909 3799 3721 3225 3191 1913 787 710 650 173 145 27 24324 952 --15155
NM_001001481chr883181 3171 2973 2590 2186 949 715 511 1680 21392 306 12454
NM_001001484chr1072219 2199 2159 2142 2070 904 837 22092 1704 42166 2022 2005 589 1729
NM_001001664chr2114080 4019 3831 3811 3635 2975 2914 2764 1557 1505 447 23002 628 32529 883 714 --
NM_001001668chr19104038 3691 3551 3106 3057 2955 2818 1499 1492 1105 1195 13215 33110 2878 233
NM_001001974chr1082362 2316 2284 2220 1565 818 787 273 1106 22038 1885 11706
NM_001002860chr14114526 4131 3592 2836 1715 1614 1560 1335 373 322 137 23069 342 23595 443 --
NM_001003652chr18148595 7895 7716 7649 7435 6944 2773 1697 1686 1233 491 484 318 164 36206 5880 5751 38598 6104 6047 --
NM_001003674chr18176784 6710 6633 6173 5896 5411 5266 5070 4996 4973 4790 4766 2577 2128 1123 1108 641 14567 21033 322 25011 413
NM_001003675chr18176784 6710 6633 6173 5896 5411 5266 5070 4996 4973 4790 4766 2577 2128 1123 1108 641 14567 21033 322 25011 413
NM_001003679chr1142113 2052 1936 1930 1843 1688 1633 1595 1509 1482 1366 472 362 151 11781 11545 11752
NM_001003712chr12173456 3396 3246 3136 2913 2649 1622 1614 1312 1252 883 689 673 395 336 324 277 --23569 1298 13869
NM_001003760chr6153625 3110 3068 2895 2683 2547 2437 1466 1182 1172 535 510 312 126 115 --23306 1280 --
NM_001004065chr973564 3546 3526 1306 847 804 783 33904 1337 995 23718 3677 --
NM_001004317chr6104451 4342 4220 3976 3728 3575 1553 1136 300 224 32750 460 189 54496 3384 2858 1004 324 --
NM_001004329chr1261202 1051 598 303 275 118 --1601 21071 329
NM_001004346chr451158 1077 840 330 72 --2418 297 1440
NM_001005404chr1754438 4331 3259 3107 1469 13858 24222 3174 11521
NM_001005473chr586630 4507 4455 2572 2400 2361 1801 734 2444 51 35378 5306 2278 14764
NM_001007023chr14165132 5025 4019 3956 3550 3444 1904 1690 1681 1529 1501 1409 1204 997 986 585 24670 511 21215 875 --
NM_001007466chr664554 4195 3706 3555 1923 473 35049 4682 597 13934 13466
NM_001008539chr8135416 5394 5138 4884 4535 4157 3334 3311 2162 1610 271 259 247 14436 1898 --
NM_001008564chr1372114 1693 1511 1404 813 459 447 --32154 2137 816 --
NM_001008707chr1471868 1499 1445 1381 345 280 204 --11397 11355
NM_001008738chr582864 2680 2633 1068 899 639 573 147 22915 552 1644 --
NM_001008756chr382570 2310 2262 931 888 867 856 623 --1872 1849
NM_001008925chr483508 3169 3090 3065 1405 748 706 372 33474 593 475 43511 2257 1292 993 1103
NM_001009554chr4104739 4555 4481 4257 4087 3478 3250 3014 1172 530 --1922 13132
NM_001009554chr4104739 4555 4481 4257 4087 3478 3250 3014 1172 530 --1922 13132
NM_001009894chr1271373 583 447 435 403 379 31 --31701 1198 102 --
NM_001009899chr3156325 6052 6042 5808 5065 4613 4532 2499 2147 1776 1159 1065 1045 803 363 16409 46061 3967 1728 49 --
NM_001009960chr7132803 2788 2723 2711 2645 2574 2508 2377 2235 1023 782 432 82 12064 32519 785 251 --
NM_001010853chr693183 3174 2521 2338 2331 680 490 401 368 1468 22919 2341 1331
NM_001010861chr172784 2659 2435 2427 679 544 407 32623 576 328 22137 966 --
NM_001010888chrX144617 4321 4200 3383 3174 3037 3001 1566 984 976 968 942 760 584 2901 741 2989 801 --
NM_001010891chr5166645 6462 6158 6119 5757 5416 5253 4309 4253 2410 2137 1845 1694 1384 417 168 31860 1849 774 76822 6044 5595 4905 4256 2382 1016 31814 1644 1290
NM_001010984chr1102450 2301 2292 2222 2120 1898 953 816 580 432 22248 1790 1474 --
NM_001011513chr474037 3986 3703 3042 915 423 215 43405 2980 1036 828 13965 --
NM_001011666chr7116303 5633 4705 4668 4564 4170 3977 2252 2159 1540 284 24996 2540 26421 5463 --
NM_001011720chr851409 1166 1107 974 33 21040 376 2408 23 --
NM_001012420chr1582503 2239 1902 901 588 470 414 378 12200 1993 11912
NM_001012423chr1572503 1902 901 588 470 414 378 12200 22240 993 11912
NM_001012756chr19102957 2641 2507 1086 850 836 476 374 317 64 ----22826 1281
NM_001012761chr562648 2256 316 107 90 58 1682 52329 662 177 74 61 1286
NM_001012968chrX92783 2678 2485 2412 2296 1811 981 866 420 --21096 758 --
NM_001013620chr12338319 8050 7535 7208 7048 6732 6467 6263 6134 6115 5951 5882 5871 5857 5843 5833 5819 5696 5607 2696 2294 2187 1766 1464 1293 1275 1146 1113 671 586 298 154 139 1746 78053 7137 6070 5826 5511 5134 142 28347 3273
NM_001014380chr13175879 5796 5611 5523 5335 4697 4464 4405 4268 2172 1963 1544 1385 1286 960 456 388 12097 25412 4731 --
NM_001014797chr10128229 7094 6476 3064 2155 2015 1933 1747 993 683 604 360 --68255 6316 5231 613 409 306 --
NM_001017434chr18662 618 549 481 286 218 212 202 ------
NM_001017440chr798212 8126 7830 7822 7107 6537 5863 1152 813 26791 5240 37845 7110 818 28141 8130
NM_001017923chr1491353 428 417 276 262 245 231 196 124 --11191 --
NM_001018065chr9125947 5914 5313 5017 4853 4586 4231 4137 2415 924 902 695 15673 22243 1417 34857 4210 4044
NM_001018066chr9125947 5914 5313 5017 4853 4586 4231 4137 2415 924 902 695 15673 22243 1417 34857 4210 4044
NM_001018067chr1114917 4903 4797 1989 1727 1457 729 598 524 280 206 25163 1558 34419 527 218 15116
NM_001018068chr1114917 4903 4797 1989 1727 1457 729 598 524 280 206 25163 1558 34419 527 218 15116
NM_001018069chr1114917 4903 4797 1989 1727 1457 729 598 524 280 206 25163 1558 34419 527 218 15116
NM_001018074chr5102945 2777 2715 1550 1529 786 539 475 268 242 23608 3577 11521 --
NM_001018075chr5102945 2777 2715 1550 1529 786 539 475 268 242 23608 3577 11521 --
NM_001018076chr5102945 2777 2715 1550 1529 786 539 475 268 242 23608 3577 11521 --
NM_001018077chr5102945 2777 2715 1550 1529 786 539 475 268 242 23608 3577 11521 --
NM_001018090chr1591975 1916 1832 1782 996 966 516 260 240 12363 42352 2083 1082 233 11786
NM_001018091chr15102085 2026 1942 1892 1191 1106 1076 626 370 350 12473 32462 2193 343 11896
NM_001018102chr1591975 1916 1832 1782 996 966 516 260 240 12363 42352 2083 1082 233 11786
NM_001024094chr5102945 2777 2715 1550 1529 786 539 475 268 242 23608 3577 11521 --
NM_001024647chr12217671 7510 7360 7345 7330 7310 7205 4740 3056 2692 2419 1899 1589 1545 1316 1250 778 685 670 656 468 22052 1463 31257 1053 631 1338
NM_001024649chr582914 2336 2128 1904 1821 1013 750 625 1612 --1347
NM_001024847chr362241 355 337 317 309 290 1923 --22375 1571
NM_001024956chr1165699 5247 4592 3725 1284 771 23622 2233 45825 3728 1049 786 1821
NM_001025076chr10106058 5063 4501 4048 3974 1081 783 732 593 420 23893 2407 36061 3994 1383 13771
NM_001025077chr10127416 6421 5859 5406 5332 5062 2439 2141 2090 1951 1778 242 15251 37419 5352 2741 15129
NM_001025079chr3104082 3966 3852 3270 3189 2776 1410 1080 894 213 --34065 897 693 13856
NM_001025108chr2104216 3907 3720 3619 3359 3174 2924 1543 1245 173 13640 23910 1394 1543
NM_001025366chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025366chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025367chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025367chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025368chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025368chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025369chr6111890 1672 1624 1602 1591 1572 1404 1359 438 427 381 11918 41617 1577 495 443 1391
NM_001025369chr6111890 1672 1624 1602 1591 1572 1404 1359 438 427 381 11918 41617 1577 495 443 1391
NM_001025370chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025370chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_001025580chrX114184 3864 3732 2771 2718 1595 1531 1441 963 605 237 21069 534 53928 3735 1598 1200 608 --
NM_001025595chr471666 1566 1455 1023 404 243 41 --11458 2446 414
NM_001029955chr493437 3195 3051 2859 2155 2122 1257 1222 102 13452 --22603 1263
NM_001030055chr14114587 4294 3595 3370 3149 1867 1569 1318 1103 304 272 64495 3739 1730 1573 1397 1091 44592 3598 3549 811 13316
NM_001031623chr661360 1252 1123 573 490 160 --4276 229 135 107 --
NM_001031695chr2274754 4628 3871 2098 1828 180 168 35342 4686 1487 34692 858 183 --
NM_001031700chr462517 2399 919 868 573 220 --135 2990 694
NM_001032283chr128947 876 837 761 432 314 298 150 --2816 303 --
NM_001032284chr128947 876 837 761 432 314 298 150 --2816 303 --
NM_001032394chr672862 2699 2620 2454 1858 392 239 1955 32702 302 253 11956
NM_001032395chr672729 2566 2487 2321 1725 259 106 1822 32569 169 120 11823
NM_001033045chr284252 4102 3375 1731 1613 1085 782 179 11045 14329 11617
NM_001033117chr373921 479 415 383 373 357 345 --1426 --
NM_001033557chr261400 1366 1305 1232 1134 934 21045 310 --11342
NM_001033576chr17132617 2550 2348 2122 1778 1759 1044 962 681 553 406 335 221 12595 ----
NM_001033578chr882348 2038 1659 1639 1589 201 112 86 12135 2140 77 1375
NM_001033756chr6111808 1590 1542 1520 1509 1490 1322 1277 356 345 299 11836 41535 1495 413 361 1309
NM_001033756chr6111808 1590 1542 1520 1509 1490 1322 1277 356 345 299 11836 41535 1495 413 361 1309
NM_001033910chr1102125 1967 1478 831 797 673 527 233 225 106 --1859 --
NM_001034841chr16145138 5100 5064 4539 4217 3880 3596 3555 2020 1993 1388 835 754 684 --34558 2029 567 --
NM_001037132chr7112158 1893 1825 1612 1521 729 698 549 497 404 101 2349 117 --1169
NM_001037133chr7112158 1893 1825 1612 1521 729 698 549 497 404 101 2349 117 --1169
NM_001037174chr2102232 1907 1674 1667 1553 1425 619 508 473 465 11840 21766 88 --
NM_001037317chr172784 2659 2435 2427 679 544 407 32623 576 328 22137 966 --
NM_001037535chrX31542 434 258 1150 2545 273 1125
NM_001037536chrX31542 434 258 1150 2545 273 1125
NM_001037540chrX31542 434 258 1150 2545 273 1125
NM_001037954chr1143392 3334 3319 1234 13431 13413 21240 1010
NM_001039547chr3118092 7912 7822 6807 6367 2785 1540 1413 657 549 501 18076 35025 4923 4915 14976
NM_001039585chr173731 3560 3217 3166 2813 1193 89 --32822 1553 92 13888
NM_001039590chrX133794 3771 3702 3502 3448 2749 2729 2487 1300 969 836 244 165 2738 253 32905 2461 826 --
NM_001039591chrX133794 3771 3702 3502 3448 2749 2729 2487 1300 969 836 244 165 2738 253 32905 2461 826 --
NM_001039618chr11175831 5806 5623 5419 5379 4624 4510 4322 3867 3796 3668 1995 1981 1837 1823 1317 1031 34274 4142 1007 45834 5120 1984 467 11915
NM_001039693chr274113 4047 3844 3786 1397 1225 676 22780 1493 1251 14138
NM_001039840chrX185659 5091 5062 4756 3917 3819 2157 2070 1875 1818 1784 1636 1380 1251 1126 819 631 245 66096 5299 4983 4863 739 523 15853 14671
NM_001040001chr672018 1982 1934 1859 1727 99 27 21341 1289 11972 11387
NM_001040020chr761478 1152 621 572 397 326 --41410 1155 407 319 --
NM_001040110chr761574 1494 371 359 348 310 --11615 --
NM_001040142chr2102389 2226 1520 819 811 781 530 455 364 121 12044 1547 --
NM_001040143chr2102389 2226 1520 819 811 781 530 455 364 121 12044 1547 --
NM_001040152chr775090 5074 4622 3716 3192 1024 666 13839 2453 170 14710
NM_001040157chr492368 2274 2247 856 410 278 242 129 54 22712 388 22920 2250 12278
NM_001040202chr442569 2263 1881 44 22484 1875 22077 1664 22573 1624
NM_001040284chr16145531 5207 4599 4210 3913 3802 2014 1594 1531 1418 1264 1193 652 504 22232 2106 55582 5232 1768 482 300 --
NM_001040402chr482945 2740 2253 1232 602 279 258 205 22669 2107 32930 2394 330 --
NM_001040429chr13123101 2782 2656 2405 2388 2272 1259 1138 1106 1089 1082 153 1216 2894 812 --
NM_001040441chr184933 4893 4199 3501 2097 1495 1472 1097 11131 34349 1544 1156 --
NM_001040665chr793823 3487 3462 1255 1172 610 506 271 227 33403 960 469 23239 621 24849 4054
NM_001040712chr9132891 2848 2238 2190 1411 1370 1359 1328 930 901 893 577 376 ----1763
NM_001040876chr491834 1715 1674 1468 1422 705 516 475 277 2507 302 21566 746 11678
NM_001042473chr1092065 1915 1822 1732 1545 1386 711 152 142 --31570 762 155 --
NM_001042481chr14132522 2493 2427 2387 2344 2169 1900 1051 1011 932 902 889 726 --12496 1893
NM_001042492chr17103271 3252 3105 3085 3041 1176 864 687 478 231 23124 1076 33118 1100 875 --
NM_001042506chrX71404 1367 1348 1333 556 114 105 ----11408
NM_001042550chr922075 291 --21866 162 31724 1436 262
NM_001042555chr12114349 4113 3914 3729 3357 3114 2904 1806 1456 925 506 --23321 3270 --
NM_001042599chr2157332 7194 6630 6593 6471 6376 6211 5820 4757 3007 2934 1627 1297 683 627 --37852 5437 2788 --
NM_001042601chr383283 3217 3051 2955 1267 1158 485 202 32976 2809 761 53190 2960 2695 1170 858 --
NM_001042603chr1295361 5347 4489 3855 2048 1427 1234 1226 1218 25286 4970 24004 1239 --
NM_001042604chr3104541 3952 3702 3530 1212 1170 1163 1090 1031 107 31711 1434 840 24745 1181 --
NM_001042749chrX92046 2029 1913 1906 1856 1685 1637 811 775 21389 1339 22049 432 11796
NM_001042750chrX92046 2029 1913 1906 1856 1685 1637 811 775 21389 1339 22049 432 11796
NM_001042751chrX92046 2029 1913 1906 1856 1685 1637 811 775 21389 1339 22049 432 11796
NM_001044385chr2103882 3751 3723 3165 952 545 347 279 89 78 11580 164 --
NM_001049chr1492340 2201 2025 2016 1677 1660 1648 1633 1611 12102 11653 22491 2344
NM_001099678chr3176464 6384 6281 6122 5976 5585 5053 4659 2315 2274 2158 1575 1256 454 445 436 420 56411 5754 5156 4428 1634 76429 5368 2003 1785 1578 1241 719 35381 1558 458
NM_001106chr3149786 9392 9323 9194 9095 9006 8851 7848 6854 5935 3001 2331 2166 1528 13546 68525 7853 7834 7783 5938 1496 19400
NM_001113490chrX73563 3369 3202 2921 2819 1062 679 12560 1720 13267
NM_001117chr1872193 1757 899 337 244 231 218 --1106 1222
NM_001121chr1071872 1733 1680 1666 740 411 182 11672 ----
NM_001148chr442153 1613 1545 553 --21562 1550 12171
NM_001167chrX196635 6558 6449 5776 5651 5252 4967 4875 2506 1783 1745 1413 1161 1043 703 677 373 276 28 46588 6527 5216 194 25210 2363 36453 879 644
NM_001173chr14114587 4294 3595 3370 3149 1867 1569 1318 1103 304 272 64495 3739 1730 1573 1397 1091 44592 3598 3549 811 13316
NM_001174chrX42105 1868 1855 1848 22233 1470 31882 1858 1727 --
NM_001198chr6102373 2071 1948 1540 1505 724 532 273 232 197 1900 31549 455 259 --
NM_001200chr206890 433 365 358 309 28 --4893 242 168 43 --
NM_001201chr4103911 3872 3694 3677 3555 1281 1222 668 563 182 13201 11482 33223 2512 2431
NM_001204chr2227695 7669 7459 7144 6812 6191 5637 5593 5429 5417 5397 2653 2493 2296 2290 2197 1835 1722 1381 448 265 237 27587 5972 1325 --
NM_001219chr762255 1729 1639 464 447 267 22029 236 --1243
NM_001233chr792374 2169 2071 2040 702 687 681 622 435 11992 1562 --
NM_001259chr7135712 5604 5030 4361 4351 4041 3938 1896 1786 1635 1467 699 204 --54077 4058 4044 1294 1146 --
NM_001289chrX91637 1308 1276 1163 1091 417 171 137 30 1616 11495 --
NM_001310chr12132883 2522 2149 1943 1905 1876 864 830 712 582 568 343 300 12572 12514 1572
NM_001364chr11104652 4093 4082 4075 3356 806 731 102 85 56 --13907 1724
NM_001412chrX103575 3448 3388 3381 2812 2452 1162 894 781 394 1816 33033 2298 1108 11080
NM_001419chr1961607 917 885 705 461 232 24855 4161 24644 1637 1236
NM_001432chr4153721 3541 3325 2917 2661 2462 1134 952 447 400 391 363 177 114 83 23130 771 53621 3464 2951 2920 1076 1473
NM_001438chr1143568 3562 3493 3283 3182 3062 2748 2739 2726 2650 2449 2256 1274 1158 --33571 3551 2833 --
NM_001460chr193082 2677 2352 1449 1239 906 854 790 359 --21080 859 1910
NM_001480chr1841181 297 286 223 --3445 302 289 --
NM_001621chr793063 2993 2725 2677 2647 2348 2305 809 585 12885 11118 21957 1919
NM_001621chr793063 2993 2725 2677 2647 2348 2305 809 585 12885 11118 21957 1919
NM_001650chr1884112 3980 3103 2844 1208 952 795 239 12530 33835 3195 1250 14074
NM_001656chr5102045 1740 1582 1428 531 525 283 254 108 61 41955 1932 1901 1822 ----
NM_001684chr173989 3737 3722 3707 1326 870 445 --34037 2546 425 13065
NM_001690chr382533 2452 2400 2241 1590 965 791 58 22573 1795 42536 2455 2338 1593 --
NM_001695chr8123904 3768 3186 3074 2625 1372 853 728 540 438 387 180 21565 1141 11238 --
NM_001709chr11122874 2767 2758 2517 2303 837 671 639 547 116 57 31 12783 32912 2877 642 --
NM_001730chr1371529 1176 534 520 216 136 125 1164 11145 11611
NM_001730chr1371529 1176 534 520 216 136 125 1164 11145 11611
NM_001742chr761824 1782 1478 599 564 415 11194 21661 729 11854
NM_001746chr582914 2336 2128 1904 1821 1013 750 625 1612 --1347
NM_001777chr3104082 3966 3852 3270 3189 2776 1410 1080 894 213 --34065 897 693 13856
NM_001821chr1104902 4732 4682 3746 3488 3402 3163 481 271 104 34472 4421 1439 1316 --
NM_001854chr141312 580 500 307 --2583 310 1506
NM_001858chr6124946 4937 4866 4799 3903 3886 3854 3645 3558 1914 1696 1090 13253 22015 212 --
NM_001918chr1149195 8493 8308 6538 5890 3578 3552 3396 2215 2201 1301 791 633 92 48293 7756 2295 839 19109 18744
NM_001938chr181919 1761 1305 1187 617 584 518 503 --11392 11860
NM_001944chr1882375 2291 2082 1616 1596 885 825 85 --1177 22379 2356
NM_001981chr182382 2288 2065 2004 1987 1907 1892 968 --1971 11993
NM_001987chr1283508 3353 3126 2755 2689 1648 420 407 --1425 --
NM_001992chr562217 2160 2064 517 303 293 12243 1157 22164 319
NM_002006chr4185712 5340 5015 4945 4807 4713 4627 4317 4264 3879 3745 3562 1941 608 207 190 144 48 --25390 3882 15734
NM_002015chr13103281 2876 2765 2516 2318 1113 1058 906 359 336 12627 53014 2695 2664 1118 1104 12713
NM_002025chrX118097 7978 5933 3148 2959 2395 1912 1724 1542 981 110 17121 16847 --
NM_002035chr1884004 3865 3710 3592 3038 2666 1082 532 22972 2942 53597 3102 3011 2959 95 23653 3466
NM_002040chr2182456 2311 2038 2025 1203 1074 902 192 32718 519 200 33102 559 181 11985
NM_002048chr9101321 1263 1167 1138 1080 977 928 880 860 411 ----1939
NM_002069chr791583 1533 1333 1310 512 441 278 241 53 21158 524 21700 291 --
NM_002092chr4114995 4941 4322 3969 3918 3698 3166 1791 1547 965 532 24749 1431 24906 1862 21408 310
NM_002126chr1762743 2561 1566 1239 1098 161 --42658 1569 1488 1103 11505
NM_002158chr2113517 3490 3247 3225 3058 2938 2921 2735 2496 1440 320 23311 901 42945 2738 2628 418 12765
NM_002182chr3102742 2644 2593 2541 2494 1891 1695 1052 297 229 22780 1729 ----
NM_002203chr5113846 3816 3775 3497 3479 2889 2541 1137 687 453 431 13835 33849 3821 3462 --
NM_002210chr2113412 3330 3119 3098 3089 2921 2746 1387 1002 260 146 23261 642 ----
NM_002214chr7125224 4032 4003 3893 3855 3779 3478 1334 694 661 435 249 24476 1035 35596 5388 3784 15305
NM_002222chr371245 344 316 299 168 138 25 1496 2309 173 --
NM_002223chr12113993 3966 3655 2876 2794 2599 2543 2528 983 812 733 11135 21025 830 --
NM_002239chr2131149 981 973 905 457 439 415 364 316 298 292 278 95 --1325 2368 216
NM_002247chr10102069 2057 2043 2021 2011 1597 867 806 732 131 11979 11968 --
NM_002270chr5165638 5614 5135 4798 3868 3801 3699 1916 1677 1520 1482 1365 1147 1072 971 238 55696 5424 4524 4163 184 45617 3678 1623 1443 25288 4181
NM_002285chr2104216 3907 3720 3619 3359 3174 2924 1543 1245 173 13640 23910 1394 1543
NM_002310chr5105754 5485 5461 4600 3992 2086 1953 1775 1444 1355 45259 5009 4684 1729 46619 6575 1508 1383 16001
NM_002336chr12114698 4620 4601 4426 3715 3244 1571 1089 1065 1022 729 34916 3338 1238 64909 4594 1723 1179 1136 182 --
NM_002356chr652792 2780 2018 975 374 12706 42500 2272 1749 536 1783
NM_002500chr25831 386 376 279 130 11262 31034 389 135 1197
NM_002581chr9155687 5464 5407 4981 4971 4953 4941 4921 4539 4169 3928 3861 3622 2145 539 15676 15041 --
NM_002594chr20102309 2254 2240 2230 1938 1904 1880 1870 1847 1837 1732 ----
NM_002610chr253050 3014 747 341 199 32140 77 44 22747 2562 12153
NM_002645chr1173071 2995 2777 2548 780 355 266 33144 3050 2260 13100 --
NM_002655chr8215310 5292 5271 5060 5020 4959 4847 4431 4344 3825 3745 3726 3354 2110 2004 1896 1663 1324 813 552 34 14754 75041 4614 4559 3416 2044 1538 1143 22114 1461
NM_002667chr661251 1236 1058 1017 347 163 1391 21314 166 21240 992
NM_002670chr371652 1630 1565 1536 1470 1354 540 11147 61503 1436 1359 1099 219 119 --
NM_002734chr1792206 2069 1897 1875 1753 1459 1438 415 407 11705 1129 --
NM_002736chr7121882 1739 1656 1531 1496 1427 852 757 725 568 334 279 ------
NM_002740chr372842 2550 2467 2199 1041 471 93 2982 444 32020 1927 23 --
NM_002745chr2294511 4007 3950 3789 3705 3413 3225 2902 632 23922 3170 --13120
NM_002833chr1561617 1536 570 563 551 489 11506 1573 --
NM_002834chr12124069 4006 3756 3724 3557 3383 3307 2845 489 312 262 179 24051 3909 ----
NM_002837chr12104548 4251 3814 1765 1470 1453 1045 209 185 110 13575 42934 1473 874 212 --
NM_002839chr9132891 2848 2238 2190 1411 1370 1359 1328 930 901 893 577 376 ----1763
NM_002858chr171042 993 975 958 945 221 199 --1202 21118 471
NM_002940chr491834 1715 1674 1468 1422 705 516 475 277 2507 302 21566 746 11678
NM_002977chr2133423 3412 3221 3108 2810 2338 2304 2267 1245 1130 616 584 535 13265 22341 1298 --
NM_002994chr461891 1801 1794 784 355 182 11909 51811 1787 1772 787 599 41895 1805 1781 507
NM_003034chr1298051 7790 6906 5637 5469 5430 2478 1120 985 1582 35573 2080 1027 --
NM_003043chr394250 4208 4124 4011 3959 3776 334 311 87 --33877 3779 279 --
NM_003046chr8135416 5394 5138 4884 4535 4157 3334 3311 2162 1610 271 259 247 14436 1898 --
NM_003099chr15136544 6453 6366 6357 4467 1880 1824 1626 1617 828 291 277 180 --1183 16565
NM_003108chr286781 6167 5943 5020 4988 1312 1283 1084 14572 47130 6584 5133 960 14943
NM_003112chr7133060 2450 2276 2169 2137 1172 931 866 819 462 403 249 103 21261 1131 22815 2279 22548 1185
NM_003161chr1783563 3432 2982 2871 2527 1318 1149 527 23578 2608 23083 530 --
NM_003199chr18155683 5660 5448 5348 5086 4665 4422 3889 3801 3785 2076 1948 657 645 633 163 24008 2185 21748 661
NM_003242chr362241 355 337 317 309 290 1923 --22375 1571
NM_003262chr385054 4580 1786 1627 831 726 142 55 11031 41403 918 205 121 14885
NM_003274chr2152637 2433 1931 1091 776 32968 2504 2061 42945 1934 793 754 11181
NM_003292chr141881 1566 360 88 11552 22020 1919 11809
NM_003298chr3116137 4883 4355 4135 4114 4087 4076 1510 559 357 253 14118 --1104
NM_003304chr3101238 1134 639 509 406 293 167 147 89 57 --51454 1201 1137 608 92 1151
NM_003338chr1081853 1654 1555 771 462 422 382 23 11789 1448 --
NM_003350chr881045 950 830 773 766 685 166 150 --1142 --
NM_003376chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_003376chr6111874 1656 1608 1586 1575 1556 1388 1343 422 411 365 11902 41601 1561 479 427 1375
NM_003387chr242706 2519 691 100 1654 22474 574 22530 1793
NM_003392chr3114186 3789 3449 3324 2702 2666 1470 1448 1432 1218 609 --33829 2896 2705 --
NM_003407chr193645 569 543 --2634 546 1649
NM_003410chrX132587 2535 2111 2098 1191 896 876 864 840 710 359 288 95 11898 --12475
NM_003413chrX51951 1560 1456 1254 106 12027 61878 1563 1314 1257 480 198 --
NM_003423chr19102480 2450 2435 2302 1022 874 606 477 223 191 12535 22438 700 12484
NM_003463chr693372 3325 3295 3157 2214 609 504 377 166 21134 628 33375 3146 1155 --
NM_003468chr2103934 3794 3781 3763 3754 3303 1513 1417 253 197 24177 3973 2400 256 34231 4040 3798
NM_003471chr3101982 1938 1912 1902 1769 1744 1666 1585 856 485 --32270 564 342 --
NM_003478chr1152180 2111 1145 1135 147 1741 33141 1156 1148 --
NM_003483chr1292730 2615 2501 2012 1930 1127 654 617 85 22886 186 11984 --
NM_003489chr21132936 2906 2863 2854 2806 2706 2679 2668 2491 2355 717 619 504 --42721 2671 2181 622 11224
NM_003566chr1273269 3167 2105 709 589 510 131 33481 541 444 63467 3202 2820 1309 1017 298 --
NM_003574chr18125719 5707 5700 5684 5578 4228 4202 3787 2131 1739 937 661 1207 45760 4745 2246 1532 --
NM_003583chr12103745 3716 3216 3127 3030 1527 1393 758 343 249 11547 23801 2730 13850
NM_003590chr293974 3222 3004 2997 1408 1294 968 888 547 --43068 3056 2764 971 --
NM_003615chr3103937 3333 2798 1241 1213 1150 594 71 43 35 21276 988 42935 2737 353 165 --
NM_003617chr1115028 4990 4933 3582 3222 3043 1914 1588 1474 1365 1264 15021 24890 760 2613 532
NM_003618chr271226 1211 1199 1150 475 463 395 1415 31297 1202 173 --
NM_003622chr1282416 2127 1970 1822 697 508 413 73 --1495 1246
NM_003663chr3113385 3354 3313 1219 1061 613 541 529 328 130 81 13328 23507 1310 12304
NM_003670chr321379 1230 --11318 21247 1234
NM_003672chr1141854 1836 1778 1766 1755 1512 1365 1331 448 405 378 332 306 206 --41900 1297 337 281 --
NM_003677chr12181819 1466 874 633 605 247 237 227 215 205 193 171 163 143 117 97 79 21 --21532 254 --
NM_003722chr381857 1778 1749 673 649 500 345 335 21974 682 31752 843 652 --
NM_003749chr13112403 2392 2331 2127 2106 2094 1895 1777 1631 752 716 --22262 1571 --
NM_003759chr4104304 4288 3789 3571 3435 3290 1702 1323 996 990 23469 1228 23419 1684 14159
NM_003774chr12113348 2875 2481 1261 902 694 555 446 353 151 82 ----1700
NM_003794chr36939 910 838 823 386 246 --31061 942 170 1696
NM_003822chr172978 2685 2616 2099 334 203 188 --32440 1063 678 1657
NM_003884chr371864 1711 1694 1437 514 479 166 --41833 517 169 93 --
NM_003887chr282220 2170 2011 1998 1705 595 585 34 21903 862 22223 1656 --
NM_003895chr2192222 2089 1760 1630 1561 1460 1371 476 160 12072 1210 11989
NM_003913chr6104182 4105 3916 3760 3489 2828 1246 385 249 74 --34008 3907 123 --
NM_003941chr782506 2423 2310 2071 1990 289 111 22 --21993 27 --
NM_003966chr587798 7544 7023 5534 1864 1699 1630 1416 47779 5339 5142 983 37571 5216 2393 --
NM_003994chr1294382 4302 4218 4089 4073 2980 1577 1139 872 --12996 --
NM_004006chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004007chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004009chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004010chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004011chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004012chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004013chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004014chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004015chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004016chrX52541 612 600 592 95 22604 2558 12446 --
NM_004017chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004018chrX52541 612 600 592 95 22604 2558 12446 --
NM_004020chrX62627 1633 698 686 678 181 22690 2644 12532 --
NM_004021chrX52541 612 600 592 95 22604 2558 12446 --
NM_004022chrX52541 612 600 592 95 22604 2558 12446 --
NM_004023chrX52541 612 600 592 95 22604 2558 12446 --
NM_004028chr1884112 3980 3103 2844 1208 952 795 239 12530 33835 3195 1250 14074
NM_004087chr331686 1575 703 2445 177 11737 22037 1703
NM_004093chr1352495 2349 2284 2271 2260 --22948 1033 12288
NM_004124chr1483291 3149 2932 1305 981 911 561 204 32541 1314 490 11379 2325 36
NM_004136chr15123261 3091 3073 2808 2318 2281 2269 2167 2036 2012 1120 687 43305 1058 767 478 13226 23265 672
NM_004171chr11229657 9457 9328 8864 8269 8138 7899 6693 6661 3747 3013 2961 2930 2846 2765 2545 2114 830 746 697 111 102 32142 1588 227 88896 8123 7909 6962 6939 6820 6777 1090 18144
NM_004229chrX72050 1757 754 561 431 420 327 12025 21773 689 --
NM_004241chr107694 686 522 320 246 163 66 1236 2711 283 --
NM_004272chr531574 238 155 1242 41839 1358 1275 696 21766 1700
NM_004274chr1493065 2231 2201 1035 883 853 800 754 434 1645 33212 3201 2234 --
NM_004279chr782297 1902 1476 826 766 753 192 76 2587 159 21517 36 --
NM_004330chr156868 749 422 355 239 232 2217 144 1358 --
NM_004338chr18176784 6710 6633 6173 5896 5411 5266 5070 4996 4973 4790 4766 2577 2128 1123 1108 641 14567 21033 322 25011 413
NM_004342chr782012 839 760 692 157 143 84 78 3827 595 147 22254 876 --
NM_004392chr1382638 2008 1729 1042 846 813 804 714 32380 2178 120 22473 895 --
NM_004397chr1194247 4231 3962 3889 2988 2824 1463 1043 1023 --43007 2827 1050 731 --
NM_004434chr1471868 1499 1445 1381 345 280 204 --11397 11355
NM_004458chrX62431 2294 2221 1805 420 100 --22556 661 2973 424
NM_004464chr4144330 4236 4112 3993 3199 3179 3107 2822 2699 2626 1703 1652 273 115 22926 2852 1625 23183 1670
NM_004466chr135736 668 658 200 101 ----2245 118
NM_004500chr1462035 2010 1810 826 700 278 11683 2771 494 11350
NM_004504chr282580 1105 913 906 887 404 224 154 33067 228 137 22034 1006 --
NM_004571chr2183345 2297 1040 895 855 643 110 83 --23396 75 11071
NM_004586chrX145415 5381 5128 4655 4643 4537 4245 3940 3708 2120 2064 773 508 456 44971 1044 418 387 13517 --
NM_004612chr9104402 4224 4112 4054 4011 4002 3975 3905 1243 571 24286 705 --13823
NM_004619chr1102125 1967 1478 831 797 673 527 233 225 106 --1859 --
NM_004657chr251239 1168 988 457 440 --31254 481 386 --
NM_004685chr13102934 2843 1929 1886 1862 1837 1207 935 816 685 22237 291 21840 234 --
NM_004719chr1282873 2424 2259 1928 1092 513 363 291 22825 2478 11931 22404 451
NM_004726chrX165782 5636 5607 5502 5449 3693 3636 2001 1430 1098 1070 1021 839 417 342 163 15769 25505 3722 --
NM_004730chr562059 2049 2015 1982 501 302 --32052 2030 2018 12063
NM_004744chr4123943 3737 3705 3643 3470 2739 969 808 522 367 52 29 12964 43744 3678 2747 46 1973
NM_004745chr8147010 6966 6380 6372 5695 2668 2370 1878 1823 1298 1097 1053 902 816 26300 2041 66933 2054 1851 1826 1148 917 --
NM_004748chr1594123 1483 1395 1217 1161 1118 561 384 221 23894 3419 32741 1164 317 --
NM_004775chr1862127 1938 1686 890 674 341 32402 2010 806 22357 2130 --
NM_004788chr11152746 2679 2387 2336 2226 2131 1868 1858 993 928 905 841 822 461 401 1311 ----
NM_004795chr1371770 1664 1528 1499 1391 629 584 11915 21531 1504 --
NM_004797chr383738 3642 3627 3598 3444 3058 927 179 13635 13034 --
NM_004815chr1114173 3679 1940 1894 1559 1242 1197 596 319 224 138 23959 697 33753 686 458 --
NM_004857chr14104819 4215 4033 3780 3579 2999 1652 1047 441 298 --23678 444 --
NM_004866chr5134084 4039 3483 3266 3187 3061 1859 1722 1119 875 419 79 60 33294 1975 616 --11920
NM_004869chr1891776 1681 1554 1201 378 335 229 147 31 11691 134 11296
NM_004904chr7116303 5633 4705 4668 4564 4170 3977 2252 2159 1540 284 24996 2540 26421 5463 --
NM_004938chr971175 1165 1142 489 467 414 366 ----11179
NM_004956chr794487 4425 4395 3766 1545 1082 1070 593 98 24533 3501 13834 1945
NM_004985chr12103852 3714 3666 3605 3467 2855 1768 1647 769 596 11713 24264 4084 --
NM_004992chrX107196 7185 7113 6870 5495 5483 2442 2212 2043 1109 --18410 12761
NM_004992chrX107196 7185 7113 6870 5495 5483 2442 2212 2043 1109 --18410 12761
NM_004999chr6104457 4161 3714 3688 3069 3044 2861 1195 1016 702 11506 2611 602 --
NM_005010chr7112158 1893 1825 1612 1521 729 698 549 497 404 101 2349 117 --1169
NM_005011chr761574 1494 371 359 348 310 --11615 --
NM_005014chr92719 675 --194 2109 78
NM_005054chr241785 1474 1429 133 --61591 1398 1182 179 154 138 11251
NM_005056chr1285605 5591 4733 4099 1671 1478 1470 1462 25530 5214 24248 1483 --
NM_005065chr14115214 4307 3910 3827 3384 3338 1697 1583 1424 1324 269 35309 3633 1147 13903 13394
NM_005121chr17143536 3415 3108 2944 2839 2397 1227 1209 901 810 648 559 481 466 23082 2982 23489 3420 --
NM_005126chr3122266 2245 2162 2142 2134 2051 1527 820 744 473 82 69 12098 1843 --
NM_005156chr9105316 5292 5112 4150 1972 1116 1032 483 163 130 35202 4459 286 24346 518 --
NM_005160chr22116482 6355 5536 5480 5406 5350 4937 2076 1391 1016 967 35583 5396 5357 --15412
NM_005171chr1251241 500 485 476 394 21138 973 21033 488 --
NM_005188chr11118014 7119 6028 5831 3274 2811 2583 2227 1859 1206 185 58228 8104 560 529 260 ----
NM_005197chr14125993 5916 5679 5572 5461 5347 5323 4836 4762 4679 4452 1070 --26188 1352 --
NM_005233chr392591 2532 2487 2462 2234 1838 1830 1615 596 --1805 12404
NM_005235chr2157332 7194 6630 6593 6471 6376 6211 5820 4757 3007 2934 1627 1297 683 627 --37852 5437 2788 --
NM_005238chr1173555 3318 3301 3274 3166 3157 3139 12617 1947 13172
NM_005239chr2151533 553 523 506 458 --11777 2669 462
NM_005259chr271176 1092 1012 959 451 255 157 21530 1161 11412 21141 266
NM_005358chr1381741 1640 1632 1619 1583 1279 1259 76 11681 21744 433 --
NM_005359chr18126548 4513 4330 4128 2546 1262 854 776 766 656 341 263 52594 1085 974 573 417 31238 534 82 --
NM_005385chr392749 2565 2558 795 689 453 368 273 176 31829 1699 601 12220 1804
NM_005399chr174233 3432 3167 3010 844 491 111 13226 1768 13977
NM_005433chr1872445 2424 2027 1888 903 777 520 11937 42735 2030 1891 1006 --
NM_005437chr1041394 535 489 360 21433 1263 1369 1539
NM_005497chr1794895 4866 4669 4576 1297 1044 750 735 349 45826 4143 1820 385 ----
NM_005504chr12136549 6525 6517 5044 4882 4769 4130 2234 1653 1053 964 852 628 36359 938 792 ----
NM_005509chr581857 1507 1483 1350 644 580 536 115 1243 21860 1330 1648
NM_005578chr3104995 4944 4915 4551 3561 1969 1848 1467 762 296 --24346 468 --
NM_005585chr152326 162 --1285 2166 149
NM_005587chr158864 853 808 747 333 129 111 99 --2921 92 1728
NM_005596chr9146079 5493 5439 5275 4357 4287 4263 3898 2054 1934 1889 1365 1085 610 15432 56415 5728 4072 2061 406 26154 4159
NM_005613chr172061 1530 542 524 502 459 433 31769 1491 79 1373 1463
NM_005665chr1154562 4524 4514 3792 3684 1725 1699 668 635 411 405 306 224 95 87 24566 4419 21594 146 --
NM_005668chr5174066 4036 4028 4014 3963 3908 3777 3588 3559 3543 3215 1815 1659 830 519 507 244 --64310 3537 3218 1820 1605 306 31431 1205 1188
NM_005725chr1112307 2283 2275 2258 2231 2218 2208 2171 2141 2127 145 ------
NM_005746chr7122728 997 885 844 754 704 689 617 366 355 349 294 12711 31913 1802 397 1621
NM_005748chr1272801 1276 1190 595 412 377 270 12872 --1381
NM_005795chr283001 2843 2697 2666 2110 1084 1001 685 32829 2199 1024 42794 2352 1212 1172 --
NM_005813chr272607 2197 1698 451 342 320 253 --32456 660 345 --
NM_005840chrX267016 7007 6150 6057 5803 5635 5604 5385 5369 4867 4690 2958 2945 2904 2885 2307 2248 2186 2065 1691 1073 885 652 630 522 264 --65388 5372 4886 2935 2925 2907 12198
NM_005841chr43971 962 823 ----31194 1171 429
NM_005877chr2232446 2427 808 32438 2403 835 2813 624 22415 562
NM_005901chr18148595 7895 7716 7649 7435 6944 2773 1697 1686 1233 491 484 318 164 36206 5880 5751 38598 6104 6047 --
NM_005903chr5175169 5090 5069 4914 4290 3909 3799 3721 3225 3191 1913 787 710 650 173 145 27 24324 952 --15155
NM_005904chr1811488 11265 21328 1257 11280
NM_005935chr495128 4907 4409 4286 3589 3437 2027 1102 1078 --35044 4799 4585 24778 4403
NM_005966chr2102199 2178 2059 1876 1845 1761 1566 807 704 431 1732 22181 313 12147
NM_006007chr9123819 3594 3428 3168 1457 1214 1192 1072 547 386 200 47 11463 11421 --
NM_006011chr1543227 418 162 142 14188 33236 3216 167 --
NM_006037chr2114501 4241 3986 3701 3630 3616 3608 1486 1238 1150 1135 --33641 1163 1153 --
NM_006095chr4104091 2941 2832 2773 1664 1644 1274 1263 810 149 23222 153 12743 --
NM_006106chr1163328 2723 2297 2184 1066 978 13295 23467 179 23392 644
NM_006154chr1592885 2867 2350 2197 2189 2162 1002 942 593 22711 1081 22642 493 --
NM_006166chr1262609 2349 1879 507 278 96 1108 32439 1627 745 --
NM_006197chr872273 2224 1871 1630 1602 333 52 11737 12022 1421
NM_006203chr5155533 5485 5032 4012 3420 2110 1786 1423 1345 1063 849 641 625 568 418 11856 34436 3785 612 11505
NM_006206chr492961 2945 2784 2717 2638 2373 1149 1044 654 31048 787 395 22649 1154 12889
NM_006241chr362099 1634 1492 931 428 182 --31813 187 122 --
NM_006251chr5203335 3325 3307 2903 2821 2757 2701 2309 2286 2191 1354 1334 1324 1296 1233 1097 1067 694 278 214 --1898 2348 331
NM_006252chr1147051 6469 6223 5378 5266 2570 2243 1497 1393 1370 1314 1184 566 49 35601 5270 3013 56359 5300 4614 1189 676 --
NM_006256chr192559 2115 1773 997 969 808 609 587 383 11706 32167 2122 990 --
NM_006282chr2094379 4356 3207 2870 1834 984 673 376 224 24699 206 13519 --
NM_006283chr894902 4496 4248 3207 1996 1704 1484 1469 527 11595 34960 4251 3755 --
NM_006287chr292662 2618 2561 2043 1857 773 570 473 248 --22592 102 12691
NM_006298chr6132695 2443 2357 2305 2135 1273 957 640 607 581 477 416 235 ----13008
NM_006300chr19142456 2255 1959 1949 1867 1689 1567 485 425 393 348 238 48 42 185 2933 212 --
NM_006306chrX125166 5150 3977 2364 1864 1595 1407 697 541 371 342 330 --54892 2087 1931 1638 557 --
NM_006313chr1291522 1414 1185 1117 628 438 291 234 218 11470 11248 --
NM_006330chr861371 1331 1318 469 457 448 21167 224 21482 193 --
NM_006364chr1471263 1231 1136 471 313 262 105 1115 21079 1055 1926
NM_006379chr762160 2086 1946 1610 706 390 1715 2560 219 --
NM_006380chr17104380 4344 3968 3868 3859 3275 1012 825 396 189 22715 562 24367 179 --
NM_006393chr10114410 4133 4030 3615 3440 1809 977 644 521 110 38 --34579 2865 288 11623
NM_006420chr2073433 3357 3233 2814 2684 2521 844 22741 1189 --1397
NM_006449chr282082 1962 1557 1541 771 561 539 85 --2647 440 1551
NM_006457chr474037 3986 3703 3042 915 423 215 43405 2980 1036 828 13965 --
NM_006482chr12103745 3716 3216 3127 3030 1527 1393 758 343 249 11547 23801 2730 13850
NM_006504chr1052891 2787 219 110 44 12795 2222 113 1191
NM_006526chr2092185 2007 1912 1807 1618 629 523 455 382 32177 1856 560 32158 2073 1960 --
NM_006534chr2093320 3219 3063 2757 2744 2554 2474 2148 1007 22957 995 12762 --
NM_006540chr841537 1239 546 331 --31531 336 322 --
NM_006544chr14165986 5971 5747 4776 4683 4587 4316 4060 3995 3904 3819 2260 2048 1234 762 197 55143 4840 4770 4176 3754 35700 4759 3811 14794
NM_006561chr10106058 5063 4501 4048 3974 1081 783 732 593 420 23893 2407 36061 3994 1383 13771
NM_006572chr17113257 3194 3125 2952 2673 2346 2264 2240 1178 1129 780 --33216 2529 875 --
NM_006577chr251312 1205 815 446 38 187 21025 818 11114
NM_006599chr16248259 8178 8095 7255 6994 6845 6839 6646 6627 6519 6160 6144 6124 2997 2440 2053 2043 1972 1965 853 761 748 358 209 37628 5481 863 26111 2390 --
NM_006603chrX92046 2029 1913 1906 1856 1685 1637 811 775 21389 1339 22049 432 11796
NM_006614chr3113633 3597 3413 2883 2603 1258 1097 294 207 196 140 23616 908 43332 2941 2353 880 21262 998
NM_006628chr1594666 4411 4069 3274 2992 1219 393 378 241 34421 763 349 24414 986 2245 57
NM_006654chr12114349 4113 3914 3729 3357 3114 2904 1806 1456 925 506 --23321 3270 --
NM_006717chr9102751 2561 2514 1107 1021 887 434 427 413 385 ----147
NM_006722chr353029 905 811 554 178 23010 969 4962 557 471 143 --
NM_006729chrX135637 4906 4257 4147 2260 2002 1828 1566 1414 1120 1114 1098 433 21970 1195 22091 1123 13958
NM_006731chr9105811 5660 5487 4503 4445 2321 2105 1091 891 669 24429 446 35593 2272 1346 --
NM_006746chrX31542 434 258 1150 2545 273 1125
NM_006750chr16218083 8069 7964 7838 7547 6660 6327 6180 5758 5693 5094 5080 3140 2856 2847 2607 2324 2119 1910 1889 1371 --12850 --
NM_006754chr791260 1188 1095 1069 1057 451 335 311 32 1501 3185 111 35 --
NM_006775chr692921 2804 2703 2568 2396 2239 2214 968 581 32810 2644 2338 53126 2783 2752 2664 973 --
NM_006785chr18132248 2221 1398 1389 829 654 557 545 516 336 255 248 97 1579 42224 1415 832 538 --
NM_006827chr1482908 2656 2454 2079 1359 952 662 333 --43133 1275 1034 996 --
NM_006873chr2103329 3109 2968 2912 1249 1181 610 583 168 43 21397 779 23203 2190 12974
NM_006885chr1664237 3938 3137 2609 826 334 12646 43744 3381 3140 2620 1550
NM_006888chr1463519 3112 2897 2618 2602 612 1356 43124 2611 1208 174 --
NM_006895chr261547 832 766 628 35 21 --22052 1473 --
NM_006914chr981161 504 489 482 469 410 311 271 1623 21492 1178 1612
NM_006915chrX62534 2514 2443 2218 1882 739 32460 1699 82 --12364
NM_006918chr1165699 5247 4592 3725 1284 771 23622 2233 45825 3728 1049 786 1821
NM_006922chr2112583 2428 2074 1918 1041 997 958 803 743 621 60 22469 912 22586 1591 --
NM_006948chr21102437 2299 2052 1833 1619 896 878 689 319 273 2402 376 ----
NM_007006chr16143499 3491 3466 3268 2965 2922 2797 2658 2293 2248 2242 1248 1085 466 23190 422 33361 3325 2369 1788
NM_007007chr12114824 4769 3433 3137 3080 1785 1163 1097 1041 679 193 34351 3893 3292 34267 2959 1387 23628 3317
NM_007038chr21205819 5763 5422 5359 5230 4395 4369 4193 4160 4065 2373 2127 1929 1256 1092 943 891 732 580 449 35652 5271 1719 35608 4549 452 15329
NM_007054chr5163961 3944 3928 3918 3910 3708 3160 2812 1501 1140 1061 798 432 418 332 294 12560 33947 3064 1504 1171
NM_007073chr693198 3146 3102 1270 740 543 525 477 246 23094 1035 24233 249 1274
NM_007114chr393145 3124 3051 2895 2888 2624 2057 372 320 --23283 325 22406 378
NM_007124chr652005 1955 1815 607 298 --51911 1386 1287 547 503 1203
NM_007125chrY101410 1127 955 937 930 906 895 467 325 285 --2898 218 --
NM_007137chrX64507 4382 4322 1207 627 552 34040 3681 371 21210 566 22113 68
NM_007146chr1752300 1968 1906 1854 1816 32865 2700 1009 21821 882 1540
NM_007147chr198810 800 792 770 479 470 458 347 11060 --194
NM_007157chrX82759 2741 2466 2327 2120 981 768 572 ----12745
NM_007159chr371597 1426 699 622 466 456 159 1253 1471 --
NM_007195chr18113676 3561 3119 2537 2403 1337 647 516 486 306 294 2228 80 43191 3105 2320 299 2965 651
NM_007203chr973564 3546 3526 1306 847 804 783 33904 1337 995 23718 3677 --
NM_007212chr161940 1826 1479 433 319 227 2813 784 51610 1482 897 400 101 --
NM_007231chrX112445 1790 1554 492 378 339 280 264 195 107 22 12072 1555 --
NM_007249chr13109280 9067 9060 8167 8070 8006 3046 2383 2042 2032 --29079 1755 18277
NM_007276chr771137 1083 856 424 252 35 25 --2118 28 --
NM_007345chr1882321 2290 2239 1980 1790 1599 1593 1487 1335 1915 12118
NM_007347chr1593018 2400 2131 2067 1031 956 481 262 205 --22134 129 --
NM_007358chr192040 1986 1388 763 671 607 591 459 22 --2574 524 --
NM_012081chr5103622 3378 2950 1400 1357 1344 1126 989 566 268 --11182 --
NM_012092chr281585 1529 1408 1297 782 747 735 719 11605 1772 --
NM_012096chr3163744 3696 3505 3269 3090 2885 2786 2519 1337 1309 1105 1067 915 842 110 78 23403 1255 1987 1211
NM_012097chr2102232 1907 1674 1667 1553 1425 619 508 473 465 11840 21766 88 --
NM_012120chr6132962 2860 2829 2572 2349 2298 1064 860 775 694 578 499 163 22987 313 51984 739 512 352 168 --
NM_012129chr782464 2380 1720 1565 1015 521 362 127 2680 171 22536 1681 --
NM_012156chr2062139 1040 944 179 163 151 1948 ----
NM_012158chr1381841 1735 1598 733 537 468 345 126 21204 1178 --41845 725 302 44
NM_012164chr995988 5105 5069 4852 2674 2666 2378 245 140 11674 35366 1699 896 --
NM_012214chr2156391 6204 5440 5245 5083 3882 1141 1077 866 853 553 419 409 167 64 25784 2543 26207 6198 11065
NM_012234chr393612 3434 3181 2624 1029 712 647 500 478 13685 43655 2700 715 203 13421
NM_012252chr7124962 4854 4843 4673 4571 4529 4296 3592 1885 1790 805 514 24365 3427 44261 3882 808 80 25376 1794
NM_012262chr195149 4738 4202 3787 3436 3349 1070 112 99 14971 1981 --
NM_012287chr3194379 4365 4273 3285 3179 3045 1756 1646 1598 1406 1091 1006 896 804 784 620 521 425 49 --23350 143 --
NM_012309chr1174810 4775 4599 4536 4362 3294 1905 --24266 3248 14823
NM_012316chr184046 3529 1173 1163 1122 937 459 255 1591 25609 1050 11183
NM_012329chr1751668 1591 1426 1131 278 11212 21429 1064 21609 1182
NM_012347chr682872 2309 2285 852 810 285 101 47 11025 32312 2099 549 --
NM_012382chr5104558 4466 3804 3296 3144 1699 1609 512 262 197 41313 1271 1114 808 53075 1761 1201 302 113 33828 2954 1527
NM_012388chr1583010 2888 2639 2556 2515 896 838 192 12290 2841 105 12560
NM_012399chr2291397 770 477 445 362 266 219 205 187 --1619 --
NM_013231chr1474207 3941 3193 2789 2775 895 818 11485 64400 3098 3041 2832 1161 849 13291
NM_013242chr162370 349 --1420 1359
NM_013255chr7188896 8832 8353 7961 7940 6425 6367 3467 3253 3055 3049 2792 2476 2332 1449 688 568 242 35620 2585 546 68865 7710 2395 1530 710 255 --
NM_013257chr882348 2038 1659 1639 1589 201 112 86 12135 2140 77 1375
NM_013354chr871205 1161 1139 1082 1066 970 51 --21164 1073 --
NM_013386chr171816 1769 1528 1447 585 376 166 21439 665 21819 398 --
NM_013396chr2151533 1247 609 457 216 2474 466 11450 --
NM_013423chrX71067 830 817 810 370 360 342 21195 432 3844 820 378 --
NM_013427chrX71067 830 817 810 370 360 342 21195 432 3844 820 378 --
NM_013943chr1123320 3285 3137 2588 2440 2363 1180 785 594 529 472 93 13305 33251 2962 438 --
NM_013989chr14165132 5025 4019 3956 3550 3444 1904 1690 1681 1529 1501 1409 1204 997 986 585 24670 511 21215 875 --
NM_013995chrX102572 2346 1908 1854 1834 1688 729 608 562 84 12435 1908 --
NM_014021chr1122873 2852 2808 1160 970 765 485 428 419 386 239 193 23365 516 2461 196 22549 611
NM_014028chr6122889 2692 2540 2102 1133 984 872 828 711 495 462 235 23284 1140 22473 476 --
NM_014034chr651322 1273 942 269 245 --21325 947 1249
NM_014048chr16125211 5202 5111 5076 1333 1258 1188 908 790 769 629 313 --2900 110 24407 775
NM_014089chr1372114 1693 1511 1404 813 459 447 --32154 2137 816 --
NM_014112chr8145446 4838 3774 3704 3445 3353 1921 1895 1357 1322 1117 1088 997 267 --23781 317 24844 1508
NM_014154chr3101549 1213 1160 647 487 443 376 360 345 199 1512 ----
NM_014155chr11167350 7312 7294 7288 7144 7059 6331 6272 6192 5962 5045 2983 2501 2053 1159 1151 --87353 7297 7153 6277 6083 2058 1106 1092 --
NM_014253chrX82286 2246 2166 1836 822 766 96 69 22432 2011 42198 1956 1889 301 --
NM_014309chr2274744 4618 3861 2088 1818 170 158 35332 4676 1477 34682 848 173 --
NM_014319chr12151826 1647 1624 1615 1360 1325 1301 746 722 712 686 577 552 538 291 ------
NM_014331chr4237745 7738 7497 7293 6872 6859 6414 5960 5914 5570 5045 4933 3086 2716 2367 2026 1846 1733 1688 1642 1057 649 359 36879 5945 5690 76911 6300 6283 5446 2721 2188 136 37749 1119 312
NM_014333chr1162762 2751 2608 2454 1733 1719 --42732 2504 2467 1736 --
NM_014388chr186080 6026 2087 1354 1340 1189 884 604 11842 33911 1415 887 --
NM_014395chr471917 1882 1824 1811 1393 1360 451 11400 21435 1383 --
NM_014415chr321678 1622 21129 501 31451 1140 633 11369
NM_014423chr5145498 5069 5002 4683 4379 4140 3988 3685 3571 3527 1936 1323 1195 647 25662 5433 55441 5026 4040 3839 3746 1858
NM_014447chr471665 1565 1454 1022 404 243 41 --11457 2446 414
NM_014458chr171406 1380 1188 1064 366 38 25 --21214 28 1454
NM_014552chr261559 1471 1298 1280 243 226 11201 11530 11242
NM_014554chr1292107 2063 1976 1758 1508 934 922 575 496 --1897 --
NM_014615chr1663665 3568 3286 871 823 792 13264 13615 1798
NM_014616chr363499 2331 686 679 458 309 13455 23305 974 --
NM_014635chr221397 97 166 71760 1563 1366 1145 143 118 102 11448
NM_014666chr571313 1268 1040 995 523 488 445 --21043 491 --
NM_014701chr1553142 3061 2921 1168 1069 23370 487 53131 2745 2725 2426 2184 --
NM_014702chr683470 3166 2229 1215 1173 457 398 254 21319 25 31384 409 346 22551 735
NM_014705chr7112054 1817 1805 1670 1654 1594 1457 1399 1370 673 274 ----11658
NM_014707chr7112256 2191 1994 1848 1773 1453 860 589 430 107 56 11544 12245 --
NM_014711chr1662063 1602 1455 1398 799 780 1621 31610 1458 765 --
NM_014720chr1071836 1789 1677 1664 1654 262 243 11396 1501 --
NM_014721chr6227435 7170 7091 7077 6904 6895 6354 6255 6127 5996 5468 5445 4843 4737 4506 2496 1967 1399 1303 1190 608 579 36853 2132 430 36938 4846 465 --
NM_014733chr5121788 1713 1591 827 759 701 692 626 603 436 394 98 --11613 1611
NM_014735chrX41878 1622 1523 307 --22007 48 2313 88
NM_014739chr694126 3880 3607 3591 1495 1379 1277 1205 175 13757 11606 --
NM_014746chr2104237 4135 4090 3709 3566 3284 1282 1072 855 703 11386 24336 4147 --
NM_014752chr11101927 1895 1888 1661 1425 1212 616 597 475 396 --11685 --
NM_014755chr294195 4024 3795 3137 1634 1042 715 554 396 24283 3178 33151 3086 2593 --
NM_014787chr152582 2500 2232 2074 1837 12236 22503 2173 12194
NM_014803chr1092963 2940 2370 1870 1068 982 782 161 133 --12117 11874
NM_014819chr562221 1749 1624 114 107 82 21761 239 32366 232 91 --
NM_014832chr1371586 1420 410 360 278 229 190 11944 22108 440 11488
NM_014839chr152530 2416 2407 2168 301 --52493 2057 920 414 47 --
NM_014850chr373921 479 415 383 373 357 345 --1426 --
NM_014873chr174599 4380 3998 3838 1918 1373 362 23194 389 44095 3453 201 91 --
NM_014877chr17247150 7070 6820 6489 6415 6075 5807 4969 4952 4915 2814 2801 2793 2434 2258 2252 1692 1588 1354 1315 1092 581 249 170 1447 77784 7760 5458 2312 341 261 118 --
NM_014888chr761478 1152 621 572 397 326 --41410 1155 407 319 --
NM_014893chrY112275 2133 2002 1994 1963 1880 1667 836 616 586 221 --1224 --
NM_014897chr17113173 3047 2987 2634 2439 2145 1315 1300 793 669 491 --1626 12997
NM_014898chr1962437 2180 1969 385 293 36 21772 477 32365 2106 1714 1145
NM_014900chr281182 950 838 832 805 360 289 79 --2953 778 1103
NM_014903chr1272239 2085 2046 1830 1553 947 641 11531 32421 2372 1632 --
NM_014904chr10154043 3382 3265 3078 2941 2880 2563 1213 528 502 493 479 467 451 21 --43851 3649 2529 486 1725
NM_014912chr1063322 3093 2681 2617 2257 1407 22774 1089 11177 43462 2454 2261 1288
NM_014920chr673403 3068 1397 1327 749 277 265 23538 609 23670 3335 --
NM_014923chr13152335 2310 2222 2215 1874 1816 1697 1665 894 845 815 606 463 147 67 --32225 1540 609 1898
NM_014936chr682850 2529 2365 2187 1084 473 465 311 22630 443 22190 392 12234
NM_014946chr232940 2086 315 12630 53120 2844 2727 2242 784 12000
NM_014953chr13144198 4175 3920 3756 3412 2807 1697 1685 1434 1424 1368 1310 776 526 --11456 --
NM_014982chr14135270 4550 4501 3938 3872 3819 3767 3349 2123 2094 1975 1542 615 11598 35383 1953 1236 11284
NM_014992chr146823 654 234 171 157 147 1228 --1161
NM_015000chr1252765 2553 1159 894 512 42648 2633 1057 757 32700 2406 684 --
NM_015001chr16800 694 684 677 667 194 ------
NM_015026chr12174513 4489 4412 3847 3752 3445 3181 3163 1757 1440 1303 1209 1141 1112 936 898 644 21120 1091 14782 1703
NM_015032chr13112697 2522 2215 2028 1884 1153 1068 952 911 422 416 ------
NM_015040chr253315 3291 2483 2368 611 13127 33318 3309 2413 1731
NM_015049chr292875 2571 2477 2214 945 937 703 667 523 22289 2171 21037 492 --
NM_015076chr6104527 4246 4219 4205 4033 3470 2908 1533 937 56 11093 --34209 4041 1161
NM_015087chr13142704 2392 2299 2222 2125 2107 1970 1727 1714 823 703 666 655 212 2890 709 2363 109 12143
NM_015097chr372286 1814 1796 1648 1569 820 144 --22373 1895 11820
NM_015115chr482945 2740 2253 1232 602 279 258 205 22669 2107 32930 2394 330 --
NM_015137chr8122259 2251 2084 1886 1855 1720 1690 1018 816 540 287 169 32599 921 87 51965 1889 1754 819 440 1748
NM_015149chr1102010 1972 1960 1933 1838 1389 784 428 310 265 --32017 1936 278 --
NM_015156chr1453780 3742 2717 2603 515 --53827 2606 1557 1193 518 --
NM_015192chr2062669 2278 1910 1009 849 224 12553 32478 2272 566 1853
NM_015208chr18103092 2959 2626 2550 1572 1480 1030 770 373 219 23140 2927 11241 --
NM_015215chr183175 2274 2160 1202 1184 1175 1019 350 11069 11178 11188
NM_015216chr571467 1388 1225 504 122 56 48 ----21347 1313
NM_015265chr242410 439 430 407 --21813 704 2528 445
NM_015271chr4134196 4065 3974 3917 3808 3763 2623 1688 1205 1183 1123 322 178 --24109 4057 11152
NM_015296chr1361159 1125 988 931 848 798 21241 1006 --1854
NM_015310chr8228381 8224 8206 8136 7831 7731 7625 6495 6083 5802 5580 5328 5246 2931 2154 1922 1875 1098 914 441 266 137 25522 1659 45236 2174 320 81 --
NM_015313chr11144851 4741 4727 4509 4277 3980 3857 3249 3202 1879 1809 1485 1450 276 34250 4011 3353 43750 3578 1488 341 --
NM_015314chr7132602 2596 2559 2483 2468 2435 1622 968 815 648 477 402 45 22245 49 1505 --
NM_015317chr2131847 1833 1797 1762 1012 828 703 691 536 429 261 201 168 12798 ----
NM_015349chr683029 2989 1966 1062 957 891 871 718 --12455 1897
NM_015355chr17101872 1629 1315 743 675 488 434 311 185 73 --2283 93 --
NM_015365chrX114184 3864 3732 2771 2718 1595 1531 1441 963 605 237 21069 534 53928 3735 1598 1200 608 --
NM_015387chr2112121 2000 1938 1724 1487 799 529 515 178 82 55 21639 806 11376 --
NM_015436chr483327 2988 2909 2884 1224 567 525 191 33293 412 294 43330 2076 1111 812 --
NM_015455chr5114013 3693 3475 3427 3232 2630 2616 1010 828 521 460 --43953 3727 2661 1340 --
NM_015461chr185569 523 192 112 91 3702 132 95 1530 1212
NM_015509chr1251645 1622 1560 1330 1031 --11586 21580 1348
NM_015532chr1591975 1916 1832 1782 996 966 516 260 240 12363 42352 2083 1082 233 11786
NM_015553chr695113 5065 4797 4190 1093 1012 983 976 30 --64898 3747 1096 1080 1029 773 --
NM_015554chr157835 802 745 563 447 399 393 ----12732
NM_015555chr661360 1252 1123 573 490 160 --4276 229 135 107 --
NM_015569chr1194842 4748 4544 4313 4227 4189 4182 4126 3408 3290 3260 3248 3157 3139 3116 1590 998 815 794 11474 2289 219 --
NM_015570chr761668 1416 1390 1166 431 135 21458 171 3576 212 177 --
NM_015571chr682220 2070 2044 1979 1877 1699 987 421 --21982 247 3671 180 157
NM_015575chr2133617 3602 3594 3583 3563 3549 3539 3514 3341 3319 1458 904 668 --33622 3566 3530 13606
NM_015640chr1114917 4903 4797 1989 1727 1457 729 598 524 280 206 25163 1558 34419 527 218 15116
NM_015850chr872173 2167 1984 1756 848 667 627 11973 32026 809 670 1760
NM_015852chr763183 3168 2803 2718 2536 2396 13273 33440 3171 2221 13523
NM_015886chr8245745 5679 5528 5494 4955 4886 4770 4746 4491 4014 3738 2078 1994 1900 919 748 402 381 361 347 320 302 234 53 35014 4130 3829 54624 4518 4444 4221 323 14851
NM_015888chr1103070 2793 2402 1154 1134 1122 879 767 484 296 22444 323 12811 --
NM_015891chr66733 662 537 528 73 57 21966 1462 51742 665 531 413 368 --
NM_015906chr184007 3822 3799 1814 1086 1047 959 535 34787 3559 3295 24118 4061 --
NM_015912chr862399 2389 2374 2366 2275 1823 1888 --22403 365
NM_016018chr8112540 2314 1971 1937 1816 838 829 813 376 345 262 12654 32543 658 625 --
NM_016075chr13113144 2856 2564 2360 2287 2063 1996 1172 1054 917 547 22883 2402 43066 1988 550 540 12872
NM_016076chr1102899 2891 2061 2042 1143 1027 774 685 274 143 --31130 824 785 --
NM_016083chr6103874 3689 3413 3268 2977 2473 1443 967 913 87 22564 569 11378 23860 433
NM_016087chr771512 1432 1364 1132 655 253 226 11281 31492 1177 256 11161
NM_016132chr15103273 3046 3011 2651 2245 2226 1114 1086 1029 375 11284 23267 2420 --
NM_016195chr105322 211 169 81 65 ----187
NM_016206chr3198852 8695 8674 7559 6815 6702 6402 6348 6302 6000 5783 5653 3618 1940 1672 1628 1176 718 272 68778 6628 5694 3405 1550 1289 46226 5904 1765 456 16564
NM_016217chr6123666 3191 3112 2651 1309 1296 1150 1084 1047 934 671 414 11377 23115 642 13672
NM_016248chr13113490 3276 3258 3084 3046 2936 2781 2674 1379 164 22 13800 33856 3239 254 --
NM_016260chr2197409 7390 7373 7114 7094 6749 5985 5927 5114 5096 2870 2694 2389 2375 2061 1785 910 590 556 67622 7493 6353 5125 4879 4755 22298 915 --
NM_016271chr18112243 1905 1857 1809 1447 928 916 890 822 528 306 197 22340 1431 --
NM_016315chr291858 1658 1620 1504 1441 1406 480 320 216 --51882 1661 1507 1409 596 11732
NM_016356chr651894 1180 984 732 24 42232 893 817 716 --12817
NM_016374chr181536 1166 1134 1096 1085 361 346 107 --21575 351 11540
NM_016374chr181536 1166 1134 1096 1085 361 346 107 --21575 351 11540
NM_016376chr1774066 1647 1583 1548 1475 1375 540 --24071 3808 23516 1258
NM_016485chr662173 2085 2079 842 317 216 --22176 27 1716
NM_016507chr1752983 2968 2392 2236 135 --22226 1137 13159
NM_016513chr673403 3068 1397 1327 749 277 265 23538 609 23670 3335 --
NM_016531chr4114076 3742 3089 3000 2930 2571 2560 1421 1321 1159 1073 14131 33509 2565 334 23746 364
NM_016587chr771137 1083 856 424 252 35 25 --2118 28 --
NM_016599chr461420 1397 1390 991 619 492 --21001 557 11401
NM_016603chr582184 2176 2157 2038 1725 1687 669 42 1585 11905 12003
NM_016613chr482721 2560 2517 2399 919 868 573 220 --22703 35 2990 694
NM_016626chr1841609 1462 1223 1085 --31721 1668 1455 11512
NM_016824chr1071872 1733 1680 1666 740 411 182 11672 ----
NM_016953chr2135759 5748 5318 4793 4626 4496 4328 4264 4228 3785 2070 1096 474 11055 13853 15704
NM_017420chr14163860 3753 3639 3565 3061 2675 2386 2377 1266 1131 696 643 479 337 254 114 23464 1366 42416 964 734 701 --
NM_017447chr21124390 4368 4332 3487 3355 3038 3003 2960 2948 485 468 420 11005 44362 3049 599 514 21237 1143
NM_017545chr202549 370 2573 29 --2229 49
NM_017563chr3136279 5999 5458 5131 5021 5011 3965 2049 1628 1448 1325 474 303 1860 14722 --
NM_017610chr1581640 1522 1453 511 438 257 237 163 1473 1183 --
NM_017628chr495070 4039 3852 3622 1700 1103 706 483 184 32040 1527 225 44464 3688 1457 1327 1343
NM_017633chr6133513 3256 2855 2831 2671 1375 1153 1074 1061 1046 1034 794 158 13593 11248 13414
NM_017637chr9169329 9072 9021 8446 8103 7664 7410 7279 6992 6948 6562 3656 2542 2049 568 126 39467 2373 668 47879 5698 2101 1926 17416
NM_017641chr1251027 880 208 119 51 --4864 751 401 227 --
NM_017643chr1763020 2982 2891 1111 1044 219 22674 907 32883 2688 657 --
NM_017644chr3155071 4677 3951 3836 3644 3613 3560 3411 2053 1592 1560 489 376 355 339 15215 14419 --
NM_017650chr7185890 5730 5601 5551 5344 5139 4791 4721 4582 4280 2290 2241 2183 2151 2111 1834 1604 1359 15383 55562 5020 5012 4856 3682 --
NM_017658chr14184595 4555 4498 4341 4188 4013 3730 3682 3376 1783 1700 1622 1507 1212 865 684 413 290 44478 4369 4199 2959 54503 3687 3647 2865 1705 --
NM_017693chr1361523 556 230 185 158 34 --21251 1094 11527
NM_017752chrX82168 1828 1795 1747 442 286 275 122 ----32130 1832 1448
NM_017769chr1483203 3058 2782 2415 2068 1276 1084 899 33062 2816 560 22381 475 --
NM_017770chr662671 2275 1154 890 417 399 1430 1146 1139
NM_017779chr152739 615 547 541 518 12511 42678 688 620 489 --
NM_017813chr8145518 5159 5102 4470 4101 4073 2114 1782 1345 1264 1073 1000 509 255 54754 3906 2233 1507 516 54724 4641 3794 2329 260 --
NM_017824chr1062756 2441 2166 735 509 113 11075 21702 1662 1457
NM_017848chrX84441 3751 1059 1041 1029 1001 941 925 14389 14444 --
NM_017919chr994963 4524 4480 2182 997 794 220 213 94 25630 5330 1150 --
NM_017946chr741035 1029 996 350 11104 1117 11006
NM_017987chr1082062 1916 1716 1698 1516 1437 466 26 --2191 162 --
NM_018061chr151737 1722 1219 1113 267 1528 --21463 555
NM_018105chr881217 1010 840 480 464 452 401 144 --21136 1119 --
NM_018155chr3123420 3052 2391 2378 2345 2311 2220 2197 2157 925 553 343 23427 2781 12144 --
NM_018157chr12113226 3189 3173 3160 3061 3027 1204 1194 1156 967 531 12373 13064 --
NM_018227chr472957 2936 2887 2622 2552 821 308 2275 263 33046 2960 2939 --
NM_018247chr6102652 2501 1178 731 533 402 363 344 203 176 12469 21005 374 --
NM_018254chr192107 1968 1922 1617 1505 909 335 311 226 1466 3595 508 229 --
NM_018299chr883181 3171 2973 2590 2186 949 715 511 1680 21392 306 12454
NM_018313chr382631 2395 2348 2112 806 653 374 264 22142 184 21687 226 --
NM_018318chr123890 785 613 ----2350 325
NM_018339chr941511 1214 340 225 11791 1228 21798 1689
NM_018351chr12104741 4696 3367 3303 3158 3081 3064 3057 2905 782 2304 187 34744 4640 3150 --
NM_018361chr8143912 3904 3814 3702 3666 3081 2728 1485 1356 1290 596 564 480 298 --23922 2633 --
NM_018364chr173891 3527 3366 3354 2930 1613 716 22642 1601 23323 1630 --
NM_018373chr1486320 5975 5588 4888 4406 2257 1932 508 46358 5789 5713 2117 46123 4615 1865 238 --
NM_018374chr7124875 4426 4227 3751 3408 2064 1934 1838 1789 1316 1243 938 25052 668 35030 4118 185 14581
NM_018394chr371013 634 550 524 510 501 35 1280 2642 140 1530
NM_018409chr493227 2637 2622 2351 1273 1257 953 73 56 --23044 2407 --
NM_018429chr5102898 2811 2210 1990 1983 1119 847 601 470 319 32578 2466 1928 22549 611 1511
NM_018440chr8148665 8631 8532 8385 2914 2883 1978 1917 1566 1488 1125 1086 959 887 11129 27869 7234 --
NM_018557chr291690 1422 1268 695 670 592 499 61 34 --11078 21415 1393
NM_018566chr154690 3512 3464 763 606 55133 4809 3979 3755 3229 24440 840 11442
NM_018590chr1031290 1186 1119 11392 --21525 661
NM_018638chr12195718 5664 5643 5221 5141 4958 4894 4615 4583 4545 4446 3945 1956 1647 1238 1038 917 851 277 1736 35262 1506 1092 24165 3897
NM_018640chr1292826 2202 2043 1839 1007 429 413 373 293 --21842 301 --
NM_018841chr1113824 3727 2570 2411 2399 643 460 433 399 321 238 23303 2498 12617 --
NM_018844chr771418 585 573 487 259 191 134 32086 1966 56 2701 177 --
NM_018976chr1282880 2787 2600 2453 2418 2397 1109 950 22774 193 32456 2400 2383 --
NM_018981chr241212 879 867 225 --3892 553 264 1844
NM_018994chr13423 185 177 ----1197
NM_018999chr10124469 3919 3912 3604 3304 1741 1652 1463 1457 1211 1079 323 14879 54120 3183 1543 1526 1388 23925 3324
NM_019001chr3104541 3952 3702 3530 1212 1170 1163 1090 1031 107 31711 1434 840 24745 1181 --
NM_019027chr472596 2542 2127 588 551 444 386 --1313 1399
NM_019035chr481972 1893 378 215 189 146 126 34 11655 --21976 1827
NM_019045chrX6940 599 306 231 221 46 --2922 124 2944 295
NM_019050chr4102244 2091 1902 1738 1621 842 442 251 235 225 ----11873
NM_019072chr5103961 3842 3448 3064 2637 1664 1236 653 526 146 1300 13674 --
NM_019096chr641091 1067 1051 44 --21094 1076 --
NM_019114chr952517 1986 1749 1616 494 11625 32179 1813 1599 11846
NM_019903chr1071872 1733 1680 1666 740 411 182 11672 ----
NM_020122chr295811 5615 5552 5530 1998 887 319 149 40 32173 1127 1020 32281 943 825 12238
NM_020245chr664460 4101 3612 3461 1829 379 34955 4588 503 13840 13372
NM_020297chr12133601 3552 3521 3149 2832 2295 1434 1410 1392 1320 966 703 487 23225 243 43562 379 181 28 --
NM_020342chr282606 2324 2162 2054 2038 1716 655 599 1703 41875 602 450 251 --
NM_020346chr1161698 1499 1123 1113 1073 392 21355 1092 1378 --
NM_020347chr3112061 1709 1692 1510 919 913 891 824 794 450 326 22303 682 22070 67 12286
NM_020357chr391451 1386 1296 1192 1186 1178 1157 434 175 ------
NM_020390chr3114327 4061 3971 3776 1760 1753 1550 1409 1093 866 181 24918 1556 54891 3341 1259 436 211 13108
NM_020432chr7112303 1835 1771 1607 1555 861 810 660 537 196 149 --32060 1845 1617 --
NM_020455chr672862 2699 2620 2454 1858 392 239 1955 32702 302 253 11956
NM_020456chr1382261 2244 1802 751 282 274 178 26 2805 464 4315 285 136 92 12267
NM_020673chr20177794 7560 6746 6523 6138 5827 5811 5208 4827 4816 2828 2701 2309 1692 1546 896 878 --1748 --
NM_020727chr2174055 3984 3861 3815 2992 1302 1091 --32651 2538 963 11398
NM_020734chr12112970 2844 2780 2752 2715 2702 2427 1309 1091 741 726 32415 2288 450 33389 2255 1060 22974 2115
NM_020739chr1594123 1483 1395 1217 1161 1118 561 384 221 23894 3419 32741 1164 317 --
NM_020742chrX122724 2706 2345 2202 2070 2062 1947 1072 760 752 630 600 ------
NM_020747chr55907 650 223 213 189 --2336 246 --
NM_020748chr1771920 1351 1343 841 781 660 300 --32076 673 214 12053
NM_020760chr292012 1932 1798 1674 1376 796 790 610 268 11836 22015 432 --
NM_020766chrX94506 4375 3690 3601 1558 1213 982 590 104 14391 2301 127 1281
NM_020771chr6101364 1255 1041 621 603 544 507 500 427 170 1291 31471 981 547 1374
NM_020772chr17208231 8065 8027 7065 6456 6357 6105 5517 3226 3133 2567 2404 1924 1796 1451 1443 568 154 140 130 38349 6460 3475 67912 6411 2407 1932 1179 891 --
NM_020774chr18136192 6138 6073 5331 5264 5255 4727 4086 4063 2328 2154 1212 35 --26141 3981 --
NM_020782chr1274684 3410 1824 753 499 363 119 14724 21872 893 1773
NM_020783chr1841812 1775 470 69 22213 170 11815 22162 1563
NM_020794chr181563 623 548 524 457 445 376 120 --1448 2196 134
NM_020800chr3101433 1425 1214 1207 947 921 448 261 192 127 21486 354 1177 --
NM_020802chr1143417 3332 3308 361 --23337 1137 1365
NM_020805chr1881847 1626 1571 1557 1526 1514 776 377 --11327 1724
NM_020809chr1172274 2204 2160 2082 2056 1774 661 ----22187 2117
NM_020830chr293192 2965 2777 2747 2507 2493 2108 2039 1245 13095 --12703
NM_020841chr12173456 3396 3246 3136 2913 2649 1622 1614 1312 1252 883 689 673 395 336 324 277 --23569 1298 13869
NM_020844chr8187612 7472 7440 7406 7225 7016 6999 6983 6938 6708 6474 5962 5619 5432 5266 2177 1954 305 25025 1371 47443 7123 7023 5416 17721
NM_020870chr482094 1924 1813 1750 513 500 273 209 11754 2797 785 --
NM_020871chrX72561 2496 1708 1580 891 701 404 32565 2380 512 12149 2865 644
NM_020872chr361707 1590 1518 1235 1191 1169 --21646 1521 11800
NM_020917chr1983046 2803 2775 2569 1577 1366 333 23 1105 42672 956 561 120 23150 337
NM_020935chr2114537 4505 4041 3862 3837 3622 1438 801 791 477 268 13445 43865 3134 2958 1770 1724
NM_020940chr10132811 2571 2496 2105 1977 1968 1787 1078 777 631 624 396 215 1339 ----
NM_020948chr1123691 3518 3101 2868 2288 1084 701 654 586 550 317 239 --32962 2622 2558 1342
NM_020951chr19202383 2142 2100 1802 1497 891 866 841 826 791 758 749 734 720 712 685 667 650 598 169 32190 285 217 22090 423 --
NM_020977chr442153 1613 1545 553 --21562 1550 12171
NM_021007chr2102389 2226 1520 819 811 781 530 455 364 121 12044 1547 --
NM_021038chr382460 2069 1257 910 895 612 468 89 --33300 382 329 12876
NM_021072chr5122634 2626 2477 2368 2356 2181 1875 513 319 230 175 153 1947 --22510 2317
NM_021097chr282893 2424 2332 1979 1130 60 41 31 12704 22643 2377 --
NM_021120chrX6571 543 527 503 495 125 23169 632 22072 578 1551
NM_021140chrX91108 1097 975 957 942 932 921 300 240 --1924 --
NM_021148chr7112492 2115 1835 1780 1773 1750 1736 1685 705 416 54 --32050 1968 508 11586
NM_021167chr751911 1084 977 969 172 --32291 2262 951 --
NM_021252chr1091838 1801 1732 1681 1644 1594 1577 668 58 11557 21343 305 --
NM_021622chr1082362 2316 2284 2220 1565 818 787 273 1106 22038 1885 11706
NM_021629chr3154613 4497 4374 4281 4158 1684 1675 1571 1550 1532 1414 443 272 87 34 33128 1247 213 14634 13777
NM_021647chr4104739 4555 4481 4257 4087 3478 3250 3014 1172 530 --1922 13132
NM_021813chr695333 4459 2116 2024 1074 931 455 442 435 --35105 4986 2061 --
NM_021815chr263122 2418 957 811 686 299 12802 22852 610 190
NM_021818chr1461400 1380 1159 957 501 494 21163 226 31534 1214 134 --
NM_021911chr5165589 4455 4064 4005 3535 3465 3435 3423 2014 1831 1625 1500 1389 1285 1253 1203 --64912 3509 3480 1598 1529 1392 --
NM_021912chr1593563 1027 254 195 187 177 158 133 115 3995 971 411 42614 1500 1009 198 --
NM_021961chr11167471 7302 7116 6368 6264 4872 1301 1293 1195 905 783 761 754 250 50 34 --37280 1609 398 --
NM_021964chr3126240 5119 4968 4928 4602 4595 4477 1826 1402 888 860 565 25667 1481 45852 5623 5551 1793 11681
NM_022048chr15126054 5950 5856 5766 5604 4955 4820 3979 2171 2146 1480 815 15677 15329 15655
NM_022049chr171591 1417 1384 1351 451 391 361 1518 21776 1387 11355
NM_022058chr281841 1655 1597 657 625 572 411 123 11900 21954 171 11748
NM_022133chr891886 1833 1771 1510 1409 1365 325 194 122 1356 41548 400 304 172 21375 691
NM_022351chr8183779 3733 3701 3343 3149 3125 2941 2715 2685 2634 2547 1476 1124 712 539 277 116 101 --11419 23783 3724
NM_022456chr12217671 7510 7360 7345 7330 7310 7205 4740 3056 2692 2419 1899 1589 1545 1316 1250 778 685 670 656 468 22052 1463 31257 1053 631 1338
NM_022459chr13176384 5920 5793 5475 5410 5105 4790 3900 2103 1787 1531 1016 843 381 269 213 135 --36106 4742 3959 --
NM_022716chr193146 3124 2148 2076 989 976 958 947 365 --3981 969 961 12763
NM_022763chr3173181 3153 3126 3066 2610 2600 2581 2526 2058 2028 850 840 804 607 380 361 262 13100 43191 2613 2124 493 --
NM_022817chr282326 2157 1964 1488 786 725 221 212 11886 22142 203 --
NM_022826chr261043 872 148 138 124 111 --1155 --
NM_022843chr1371414 1375 1356 562 430 225 122 11516 21378 442 --
NM_022893chr2123082 2785 2390 2306 2294 2235 2000 840 634 371 345 245 1380 ----
NM_022900chr761161 1129 420 268 159 149 2955 825 21144 162 1798
NM_022901chr981852 1836 1802 1629 403 342 156 142 --11655 1346
NM_022970chr1081089 454 421 413 390 375 146 102 --2431 401 1425
NM_022977chrX62431 2294 2221 1805 420 100 --22556 661 2973 424
NM_023105chr872173 2167 1984 1756 848 667 627 11973 32026 809 670 1760
NM_023106chr872173 2167 1984 1756 848 667 627 11973 32026 809 670 1760
NM_023110chr872173 2167 1984 1756 848 667 627 11973 32026 809 670 1760
NM_023111chr872173 2167 1984 1756 848 667 627 11973 32026 809 670 1760
NM_023929chr8132817 2660 2381 2356 2180 2019 1999 1991 1906 1719 526 170 115 12782 11829 22463 2003
NM_024345chr9185729 5719 5697 5537 5347 4850 4813 4671 4484 4291 4265 4145 4119 1443 895 735 541 531 24735 2139 --24894 4825
NM_024511chr4113256 3194 2652 2622 2599 2261 1023 978 737 676 489 42670 2534 1361 134 23181 2427 --
NM_024524chr3113114 3100 2886 2760 2416 980 899 623 291 170 50 --12524 32975 2328 2315
NM_024548chr351093 355 224 139 126 --11199 1324
NM_024613chr871712 1318 1180 1170 750 709 217 --31321 753 143 --
NM_024665chr3104679 3186 3150 3045 1537 1099 540 385 148 133 --34735 4115 639 --
NM_024686chr15452 181 133 117 104 1171 1161 --
NM_024744chr2112692 2656 2608 1840 1776 1706 1028 755 734 400 380 21937 1079 1142 --
NM_024745chr1661112 442 377 102 95 86 11021 ----
NM_024761chr985332 5220 4730 4443 4181 4137 2135 1421 25245 1099 21968 761 25006 1414
NM_024770chr296089 6030 5782 4960 4488 4275 1596 1403 109 1477 24315 1897 --
NM_024818chr371384 1325 613 452 377 104 25 --1616 11287
NM_024828chr961149 1096 1076 455 386 33 21194 179 --192
NM_024921chrX61514 494 482 475 392 299 31716 1542 1337 1215 --
NM_024930chr5102834 2715 1966 1840 916 784 477 461 111 87 22808 2632 ----
NM_024947chr3219572 9371 9292 9217 9095 8596 8572 8223 7784 7751 7472 6760 6088 3710 3463 2631 2620 1901 1824 1723 960 89582 9126 8407 3664 2277 1954 1544 434 59594 9104 8601 8575 3790 18556
NM_024953chr12132756 2693 2637 2621 2585 2210 2021 1898 907 891 881 182 158 --22759 2223 --
NM_024989chr2268048 7978 7939 7865 7496 7261 7195 6725 6575 6494 6459 6437 5656 5610 5361 5066 2684 2668 2662 2349 2078 1885 1856 1390 973 239 57948 7411 6651 6594 2866 97314 6497 6069 5922 2086 1859 1789 692 596 --
NM_025040chr1932407 2381 304 22052 265 12464 21772 1763
NM_025054chr8163824 3610 3158 3093 2608 1665 1604 1560 1340 1241 1035 903 891 246 103 45 --11563 32670 1245 698
NM_025107chr64797 304 241 226 21754 694 32263 307 234 --
NM_025134chr1682380 1677 1666 1629 1584 670 534 295 --21632 305 11793
NM_025160chr194167 3996 3522 3395 3075 2966 2672 548 288 13030 1293 --
NM_025208chr1172398 792 389 307 282 240 178 1492 32356 338 265 --
NM_025235chr1041837 707 572 500 --1503 22018 288
NM_030621chr14113826 3712 3647 3149 3129 2587 1651 1411 865 833 171 23551 3173 23875 3739 11420
NM_030625chr10112387 2252 1990 1901 1859 1790 831 771 611 172 44 --2759 614 --
NM_030627chr5114000 3819 3748 3692 3670 3204 2742 1264 1094 931 905 ------
NM_030647chr7116261 6199 6174 5176 5120 4845 2001 1712 1383 1219 591 16227 3926 617 300 --
NM_030648chr485259 5215 5054 3842 3785 3616 825 413 24901 165 25111 4119 --
NM_030650chr2143333 3320 3232 3122 2817 2583 1615 1431 815 787 702 686 310 159 11169 33415 3065 3027 13326
NM_030664chr1072219 2199 2159 2142 2070 904 837 22092 1704 42166 2022 2005 589 1729
NM_030665chr1761336 1290 1281 1259 953 935 11232 1960 1941
NM_030751chr1081828 1821 1392 1371 1343 639 479 389 21545 1439 11454 11597
NM_030751chr1081828 1821 1392 1371 1343 639 479 389 21545 1439 11454 11597
NM_030755chr14123133 3075 2242 1225 1121 1025 734 660 512 493 458 255 --23046 1039 12919
NM_030791chr1491710 1379 1340 437 416 321 312 284 277 2375 259 31860 455 62 1325
NM_030885chr372312 2279 2067 2016 1959 828 554 --21896 1525 11963
NM_030918chr1135305 5284 4474 3801 2028 1458 1242 1234 1211 1186 1135 932 439 --24411 1247 --
NM_030945chr592680 2328 2319 2305 1903 1874 859 628 101 --32525 2466 2333 --
NM_031217chr113487 440 415 --2398 78 1561
NM_031314chr1462035 2010 1810 826 700 278 11683 2771 494 11350
NM_031362chr282819 2740 2651 2025 1071 925 727 652 11014 32726 2715 1020 --
NM_031365chr272955 2876 2787 2161 1061 863 788 11150 32862 2851 1156 --
NM_031366chr272955 2876 2787 2161 1061 863 788 11150 32862 2851 1156 --
NM_031371chr181536 1166 1134 1096 1085 361 346 107 --21575 351 11540
NM_031371chr181536 1166 1134 1096 1085 361 346 107 --21575 351 11540
NM_031438chr541623 1373 1210 489 2429 203 11962 1730
NM_031442chrX63045 3027 2884 2783 2636 1014 12809 1242 12284
NM_031461chr841594 878 316 237 --1918 2828 299
NM_031468chr798212 8126 7830 7822 7107 6537 5863 1152 813 26791 5240 37845 7110 818 28141 8130
NM_031469chr6104110 3911 3892 2966 1117 915 843 780 686 407 12729 42668 948 856 751 --
NM_031483chr2062399 2337 2243 2219 2186 1022 23437 3429 42340 1234 1186 965 --
NM_032012chr985279 5121 5047 4489 1614 884 828 184 63388 1204 1078 593 321 313 44617 3746 410 327 1521
NM_032116chr13175879 5796 5611 5523 5335 4697 4464 4405 4268 2172 1963 1544 1385 1286 960 456 388 12097 25412 4731 --
NM_032145chr661792 1213 519 119 60 27 --1767 180
NM_032228chr11153463 3307 3083 2748 2740 2717 2423 2417 2333 2248 1403 1243 816 137 68 21374 641 23427 980 12942
NM_032321chr283268 3131 2957 2429 2208 2185 2177 937 53011 2193 1318 813 175 13098 --
NM_032373chr10195893 5728 5675 5504 5321 4910 4596 3834 2370 2230 2135 2107 1506 1473 1209 909 844 675 462 13717 55798 5680 5491 4599 1604 15107
NM_032433chr1951581 1567 1349 190 85 11498 41586 1523 1394 199 --
NM_032445chr1572578 2478 2400 1794 1654 413 294 --22581 305 --
NM_032446chr5103719 3433 3135 2936 2929 2903 2692 1287 1158 1130 11215 23108 1198 12997
NM_032457chr493463 3060 2759 2592 1475 935 782 746 37 23169 563 52536 1046 785 661 460 23827 2800
NM_032466chr851648 1275 525 340 170 ----21189 383
NM_032468chr851648 1275 525 340 170 ----21189 383
NM_032505chr382538 2458 2323 2201 1972 1834 1697 478 22517 2041 22478 2204 11987
NM_032521chr2073034 2259 2081 797 658 374 74 13217 22829 2314 --
NM_032547chr441342 1058 886 513 31017 921 174 31301 236 204 --
NM_032632chr1451990 1934 304 274 268 --32024 659 380 --
NM_032810chr1071530 1293 1147 501 424 404 387 21057 397 31276 443 253 --
NM_032828chr19154955 4668 4623 4324 4170 3442 3315 3281 3154 1578 1367 1190 1069 668 640 14434 23445 1547 --
NM_032833chr192657 2648 2107 1797 936 666 596 465 455 1499 32692 939 728 --
NM_032842chr771553 1462 1348 1151 1118 552 173 1113 21176 1077 11383
NM_032859chr13173778 3740 3682 3674 3643 3604 3476 3299 3285 3031 2957 1459 1268 522 338 247 30 13143 33518 3302 226 13019
NM_032869chr862008 1975 1739 1701 416 105 --31744 419 147 --
NM_032873chr11144424 4376 4349 4317 4215 3373 3196 1777 1750 1580 1496 1463 1380 1070 2925 886 11785 21584 934
NM_032968chrX184265 4243 4071 4065 4056 3933 3612 3570 3181 2803 2796 1601 1298 650 628 609 197 39 34218 3763 3119 44059 3740 3030 1313 14269
NM_032969chrX184265 4243 4071 4065 4056 3933 3612 3570 3181 2803 2796 1601 1298 650 628 609 197 39 34218 3763 3119 44059 3740 3030 1313 14269
NM_032973chrY184257 4235 4063 4057 4048 3925 3604 3566 3176 2798 2791 1600 1298 650 628 609 197 39 34210 3755 3114 54051 3732 3025 2924 1313 14261
NM_033020chr184007 3822 3799 1814 1086 1047 959 535 34787 3559 3295 24118 4061 --
NM_033114chr125851 842 800 760 642 2619 270 1749 1961
NM_033132chr1372201 2106 2071 1823 745 362 338 11657 42213 2204 1735 877 21840 372
NM_033135chr1172398 792 389 307 282 240 178 1492 32356 338 265 --
NM_033138chr782012 839 760 692 157 143 84 78 3827 595 147 22254 876 --
NM_033139chr782012 839 760 692 157 143 84 78 3827 595 147 22254 876 --
NM_033140chr782012 839 760 692 157 143 84 78 3827 595 147 22254 876 --
NM_033143chr4134661 4567 4443 4324 3530 3510 3438 3153 3030 2957 2828 604 446 23257 3183 1956 13514
NM_033157chr782012 839 760 692 157 143 84 78 3827 595 147 22254 876 --
NM_033181chr6103874 3689 3413 3268 2977 2473 1443 967 913 87 22564 569 11378 23860 433
NM_033224chr7158081 8063 7474 6766 6363 5753 5518 2733 2726 2664 2643 2177 2133 1801 1491 12819 25746 1842 --
NM_033225chr852202 2186 737 408 368 --22922 2215 13091
NM_033285chr8144008 3829 3659 3432 2816 2806 1661 1074 920 740 446 130 64 50 1362 23435 552 33557 3217 278
NM_033360chr1293973 3835 3787 3726 3588 2976 1768 890 717 11834 24385 4205 --
NM_033394chr23468 347 137 --41361 1312 634 409 21183 1089
NM_033425chr1143392 3334 3319 1234 13431 13413 21240 1010
NM_033430chr4163950 3872 3593 3584 2954 2852 2619 1679 1571 1103 573 503 191 120 101 93 23954 3816 53893 3462 3011 2793 1180 --
NM_033437chr4163950 3872 3593 3584 2954 2852 2619 1679 1571 1103 573 503 191 120 101 93 23954 3816 53893 3462 3011 2793 1180 --
NM_033480chr682872 2309 2285 852 810 285 101 47 11025 32312 2099 549 --
NM_033481chr682872 2309 2285 852 810 285 101 47 11025 32312 2099 549 --
NM_033484chr51615 1142 2609 482 1621
NM_033495chrX7965 920 827 705 293 209 84 --1968 190
NM_033505chr2156660 6267 6096 6075 6052 5996 4934 4846 4622 4080 2656 1583 1414 1356 1049 11872 36089 6063 5882 --
NM_033656chr21105834 5308 4501 3685 2371 1110 961 941 421 109 1647 54669 4619 4156 3633 103 21341 276
NM_052832chr872952 2797 2755 2471 2451 2352 1986 11071 21096 918 12749
NM_052851chr13102356 2342 2118 1770 382 363 355 347 334 239 ----1243
NM_052879chr12134069 4063 3616 3534 3506 3466 3393 2493 1557 490 241 217 63 23818 1213 33619 2509 2496 33399 1632 1542
NM_052885chr12194844 4791 4762 4672 4654 4610 4542 4499 4237 4226 3816 3765 3038 1754 1598 1371 860 759 373 --34659 3438 383 23786 3371
NM_052905chr251739 1487 1253 708 436 21747 261 11492 11201
NM_052910chr1332163 361 353 --2794 472 22167 1539
NM_052917chr273250 3165 2079 1278 1239 1172 781 23426 978 33279 3168 1086 11101
NM_052927chr552133 1951 787 644 285 1632 31627 675 647 --
NM_052937chr872263 2105 2095 771 509 491 335 --42583 1995 496 155 12215
NM_053016chr9146931 6498 6354 5558 5514 5428 5411 5011 2657 2468 1714 1537 1373 857 15572 36051 5416 2648 --
NM_053023chr1173304 2519 2200 2099 902 604 44 --12340 1380
NM_057168chr771512 1432 1364 1132 655 253 226 11281 31492 1177 256 11161
NM_078487chr923160 3065 12977 32625 2175 2133 12115
NM_080629chr141312 580 500 307 --2583 310 1506
NM_080630chr141312 580 500 307 --2583 310 1506
NM_080759chr1382638 2008 1729 1042 846 813 804 714 32380 2178 120 22473 895 --
NM_080760chr1382638 2008 1729 1042 846 813 804 714 32380 2178 120 22473 895 --
NM_080764chr2263176 2493 2215 1091 151 123 12164 23168 3129 1155
NM_080832chrX91796 1783 1614 1479 1294 524 424 296 244 11277 41546 1407 547 504 --
NM_080927chr3113332 3270 2479 2350 1208 1149 1075 937 634 464 78 --23273 3166 189
NM_130391chr9132891 2848 2238 2190 1411 1370 1359 1328 930 901 893 577 376 ----1763
NM_130392chr9132891 2848 2238 2190 1411 1370 1359 1328 930 901 893 577 376 ----1763
NM_130393chr9132891 2848 2238 2190 1411 1370 1359 1328 930 901 893 577 376 ----1763
NM_130435chr1052891 2787 219 110 44 12795 2222 113 1191
NM_130773chr27961 935 905 881 875 849 609 --1964 --
NM_130809chr583140 3132 3011 2504 1155 1045 1017 740 --13106 11085
NM_133265chrX73563 3369 3202 2921 2819 1062 679 12560 1720 13267
NM_133334chr4106304 6222 5947 5608 5402 4684 4046 2481 2347 2197 24353 1561 56307 6288 5680 2484 464 --
NM_133372chr582864 2680 2633 1068 899 639 573 147 22915 552 1644 --
NM_133468chr77921 736 625 490 193 130 120 1385 3628 219 145 2990 570
NM_133477chr4133241 3023 2968 2956 2907 2410 1996 1213 1176 998 705 289 169 23275 2319 ----
NM_133493chr6154294 4255 4217 3984 3756 3135 2956 2889 1427 1378 1248 1117 801 225 156 34608 3871 3851 74634 4557 4089 3625 3531 3103 1505 13061
NM_133496chr194577 3916 3397 3229 2814 1100 1056 973 658 12915 34461 3466 622 --
NM_133646chr2125514 5287 5202 5184 4873 2237 1864 1525 1370 1032 330 210 --24207 848 --
NM_138270chrX103432 3246 3056 2705 2657 2500 2438 2322 2166 731 --22325 376 11249
NM_138286chr19164058 4014 3581 3348 3253 3000 2829 2822 2814 1307 1279 1090 1066 847 716 449 --34291 4249 3784 --
NM_138292chr1183435 3322 3309 2748 2366 1001 781 48 2721 662 12369 13535
NM_138400chr793470 3370 3326 3243 3151 2767 2721 879 167 --13438 1124
NM_138423chr1572040 1950 608 581 339 265 165 32203 2138 186 12263 --
NM_138426chr7112485 2387 2337 1979 1846 1736 1689 548 393 251 30 11006 22078 1702 12262
NM_138444chr1394773 4141 3592 3580 1987 1978 1242 1102 943 --54958 4572 3675 3498 3222 --
NM_138459chr6103653 3560 3099 2766 2683 2484 2259 1319 724 205 12594 33574 2932 452 --
NM_138468chr245840 4662 1310 385 36347 4978 840 25764 963 15844
NM_138473chr12165012 3455 3388 3361 3342 3248 1968 1886 1859 1379 1202 637 524 445 421 369 1413 23448 3345 --
NM_138494chr7132803 2788 2723 2711 2645 2574 2508 2377 2235 1023 782 432 82 12064 32519 785 251 --
NM_138554chr962681 2515 2459 2437 2205 637 22032 349 32794 2127 622 --
NM_138635chr7113223 2998 2965 2284 2084 2001 1980 870 702 258 239 33076 2215 22 22287 2004 --
NM_138713chr16248259 8178 8095 7255 6994 6845 6839 6646 6627 6519 6160 6144 6124 2997 2440 2053 2043 1972 1965 853 761 748 358 209 37628 5481 863 26111 2390 --
NM_138714chr16248259 8178 8095 7255 6994 6845 6839 6646 6627 6519 6160 6144 6124 2997 2440 2053 2043 1972 1965 853 761 748 358 209 37628 5481 863 26111 2390 --
NM_138731chr14134246 4078 4056 3926 3723 3530 3322 3182 3075 1567 893 569 455 --54249 4214 3969 3420 3120 2598 204
NM_138771chr771394 1329 1247 1143 597 471 360 11001 1551 11583
NM_138782chr592426 2217 2118 1857 1727 1715 1588 297 193 --11742 --
NM_138806chr38989 817 794 727 707 389 376 94 ----1800
NM_138959chr1106507 5079 4276 2693 2510 2264 2253 432 57 45 1446 22552 435 --
NM_139318chr14575 67 58 50 42 1202 180 131
NM_144571chr4206959 6945 6399 5598 5445 4687 2584 2522 2319 2179 2130 1547 1529 1420 1217 800 767 693 312 250 1256 25651 5417 --
NM_144578chr14155179 4769 4645 4194 3613 1460 1393 1198 1098 698 505 262 176 69 49 34876 4715 1686 64906 4708 3985 3616 3499 1483 15488
NM_144599chr15125424 4975 4348 4137 3960 1394 1290 1254 1134 776 708 465 --55364 4871 4384 3411 711 --
NM_144664chr1172512 2463 2348 1908 783 771 531 12617 --12425
NM_144710chr261247 955 527 437 380 108 --41387 1319 530 520 --
NM_144721chr472714 2377 2001 837 829 775 209 --42717 2706 778 187 --
NM_144778chr1382717 2414 2293 2181 765 501 206 177 11828 11760 11855
NM_144963chr8102586 2479 1847 718 683 536 372 292 261 215 11722 --1337
NM_144973chr12125186 5171 5116 4858 4507 4474 4269 4215 3778 1614 479 158 1252 24272 556 --
NM_145005chr94812 720 174 165 --1177 1711
NM_145259chr2237033 7024 6834 6703 6629 5797 5766 5504 5466 5244 5148 4958 2778 2754 2689 2584 2434 2365 2283 2170 1724 504 443 35594 2514 199 37053 1494 1117 21779 266
NM_145263chr451798 1609 951 806 593 --21689 182 1577
NM_145307chr1064657 3470 3183 3018 2848 1611 13264 13571 13715
NM_145698chr1092065 1915 1822 1732 1545 1386 711 152 142 --31570 762 155 --
NM_145759chr1102125 1967 1478 831 797 673 527 233 225 106 --1859 --
NM_147147chr693198 3146 3102 1270 740 543 525 477 246 23094 1035 24233 249 1274
NM_147150chr973564 3546 3526 1306 847 804 783 33904 1337 995 23718 3677 --
NM_148955chr15136544 6453 6366 6357 4467 1880 1824 1626 1617 828 291 277 180 --1183 16565
NM_152265chr161598 1585 1526 1378 302 292 1124 --11490
NM_152275chr261912 380 359 133 87 66 --22276 2166 1756
NM_152330chr14132522 2493 2427 2387 2344 2169 1900 1051 1011 932 902 889 726 --12496 1893
NM_152352chr1882656 2650 2644 2525 2504 667 570 424 32347 700 401 23001 2432 --
NM_152388chr2103882 3751 3723 3165 952 545 347 279 89 78 11580 164 --
NM_152400chr461939 1732 831 680 188 43 --3599 191 65 32092 1994 1943
NM_152407chr552360 1209 358 78 49 1987 1106 23130 1285
NM_152409chr593562 3432 3111 2238 885 849 685 661 198 23205 2556 43340 3327 2215 1447 --
NM_152414chr851595 1253 1241 1072 620 ----21601 1257
NM_152519chr262208 1913 689 527 437 331 ----2421 110
NM_152529chr284252 4102 3375 1731 1613 1085 782 179 11045 14329 11617
NM_152542chr4101859 1797 1708 1522 1502 1450 528 405 189 161 11950 ----
NM_152551chr6102983 2658 2522 1227 939 628 522 310 272 215 123 12485 163
NM_152588chr1291749 1624 1613 1595 1537 725 648 569 343 11874 --11755
NM_152594chr15132250 2233 2152 1734 1699 1650 1592 1576 711 583 511 491 309 --31909 1781 617 --
NM_152624chr5157132 7066 5866 5849 5132 2894 2887 2633 2502 1275 1061 850 832 377 282 26643 4935 45621 2571 1109 304 16709
NM_152641chr1282915 2738 2384 1117 1061 1005 942 415 1891 2753 566 12849
NM_152754chr7163833 3320 3152 2463 1274 1225 1199 1180 1103 796 705 410 393 264 142 65 23848 1146 43495 2466 1277 1106 22552 2396
NM_152756chr5104179 4142 2948 1693 1313 1246 1232 1189 688 38 21122 619 2786 41 --
NM_152774chr7102676 2670 2646 2630 2262 2208 1055 755 625 326 --32282 504 142 1768
NM_152785chr382570 2310 2262 931 888 867 856 623 --1872 1849
NM_152787chrX73417 3312 2728 2507 2489 2440 881 13596 13244 11091
NM_152793chr794634 4479 3826 3585 3470 1938 1430 1047 297 11784 44467 3500 1975 739 1346
NM_152826chr15136544 6453 6366 6357 4467 1880 1824 1626 1617 828 291 277 180 --1183 16565
NM_152835chr172158 1855 713 422 406 300 181 1195 22876 415 --
NM_152836chr891886 1833 1771 1510 1409 1365 325 194 122 1356 41548 400 304 172 21375 691
NM_152837chr891886 1833 1771 1510 1409 1365 325 194 122 1356 41548 400 304 172 21375 691
NM_152903chr13112802 2736 2126 1984 1913 1097 1031 995 854 259 253 1860 ----
NM_152999chr793823 3487 3462 1255 1172 610 506 271 227 33403 960 469 23239 621 24849 4054
NM_153013chr572336 2032 1828 966 906 515 234 12366 1508 1695
NM_153184chr351485 1272 518 328 299 11335 31729 1304 434 11769
NM_153188chr5165638 5614 5135 4798 3868 3801 3699 1916 1677 1520 1482 1365 1147 1072 971 238 55696 5424 4524 4163 184 45617 3678 1623 1443 25288 4181
NM_153207chr12154031 3865 3743 3436 3415 3293 2932 2896 1171 1123 1028 894 589 367 216 21050 732 54034 3176 2583 2534 1115 43747 1177 208 200
NM_153235chr6122437 2159 1841 726 545 529 497 479 454 384 345 267 ------
NM_153261chr1661621 1595 622 544 264 97 1272 31553 1047 320 --
NM_153262chr1113212 3122 3056 2573 2454 2411 1239 1046 791 783 180 --12557 1640
NM_153354chr54852 832 239 149 2922 132 3947 860 826 2845 838
NM_153456chr1386240 6212 6082 4993 1358 1042 943 860 --44213 4047 1784 1054 --
NM_153607chr5152938 2630 2548 2280 1976 992 791 772 757 744 677 609 526 516 449 --33032 1211 237 --
NM_153634chr1241550 1437 1263 1030 11614 21329 292 11507
NM_153686chr481647 1555 1528 985 562 468 307 145 1114 1156 --
NM_170709chr882348 2038 1659 1639 1589 201 112 86 12135 2140 77 1375
NM_170710chr4183182 3136 3113 3023 2911 2831 2807 2794 2782 2768 2734 2441 2238 2203 2181 2059 703 165 22937 822 32852 2444 1986 11227
NM_170725chr18662 618 549 481 286 218 212 202 ------
NM_170731chr11122874 2767 2758 2517 2303 837 671 639 547 116 57 31 12783 32912 2877 642 --
NM_170732chr11122874 2767 2758 2517 2303 837 671 639 547 116 57 31 12783 32912 2877 642 --
NM_170733chr11122874 2767 2758 2517 2303 837 671 639 547 116 57 31 12783 32912 2877 642 --
NM_170734chr11122874 2767 2758 2517 2303 837 671 639 547 116 57 31 12783 32912 2877 642 --
NM_170735chr11122874 2767 2758 2517 2303 837 671 639 547 116 57 31 12783 32912 2877 642 --
NM_170780chr38989 817 794 727 707 389 376 94 ----1800
NM_172071chr1197439 6588 5691 5613 5367 5024 4684 2865 1964 1816 1802 1782 1761 1426 1347 956 626 381 329 37487 7255 2478 32890 2749 1807 11767
NM_172127chr462071 1744 1727 1671 576 177 --72109 2074 1868 1758 1730 711 200 --
NM_172128chr462027 1700 1683 1627 532 133 --72065 2030 1824 1714 1686 667 156 --
NM_172159chr3101982 1938 1912 1902 1769 1744 1666 1585 856 485 --32270 564 342 --
NM_172160chr3101982 1938 1912 1902 1769 1744 1666 1585 856 485 --32270 564 342 --
NM_172193chr14131319 1251 1239 1171 1162 977 930 370 358 272 185 151 31 --11277 --
NM_172375chr1481059 1009 1001 992 984 976 949 939 11136 21014 952 1965
NM_173082chr641532 1479 509 111 21554 215 21294 494 1426
NM_173083chr141257 1143 240 182 21276 226 21001 234 11137
NM_173167chr17132617 2550 2348 2122 1778 1759 1044 962 681 553 406 335 221 12595 ----
NM_173214chr16248259 8178 8095 7255 6994 6845 6839 6646 6627 6519 6160 6144 6124 2997 2440 2053 2043 1972 1965 853 761 748 358 209 37628 5481 863 26111 2390 --
NM_173468chr4195993 5632 5469 5016 4556 2215 2203 2115 1970 1852 1682 1514 930 896 781 616 374 71 54 15862 35967 4419 4372 35230 721 631
NM_173470chrX51783 1065 663 186 98 --32897 2827 949 12192
NM_173475chr1681441 1383 1372 1356 1330 1321 1307 1142 --11337 --
NM_173531chr19123894 3187 3161 2914 2502 1380 1357 1324 1190 935 846 673 22737 617 32488 1394 578 --
NM_173576chr1072280 2237 1904 1647 1580 543 132 21972 210 11589 31847 567 430
NM_173582chr11136036 5996 5967 5810 5395 5083 4250 4169 2325 2308 2187 2036 1794 16232 66268 4944 4655 3807 2282 625 14326
NM_173644chr2091989 1883 1877 1803 1640 1589 1279 654 381 21851 1344 31750 1697 502 --
NM_173808chr183892 3716 3585 3286 2710 1716 1355 363 13811 43719 3665 3588 1192 11214
NM_173827chr493148 2834 2744 2470 2306 1348 1152 846 502 12619 43151 2692 458 56 --
NM_173829chr5115876 5786 5437 5417 5070 4178 4136 4105 1303 953 886 --32319 956 159 182
NM_174916chr1582419 2411 2265 2175 2152 1949 1633 354 11759 32339 652 328 --
NM_175623chr12217671 7510 7360 7345 7330 7310 7205 4740 3056 2692 2419 1899 1589 1545 1316 1250 778 685 670 656 468 22052 1463 31257 1053 631 1338
NM_175624chr12207766 7605 7455 7440 7425 7405 7300 4835 2787 2514 1994 1684 1640 1411 1345 873 780 765 751 563 22147 1558 31352 1148 726 1433
NM_175625chr12207766 7605 7455 7440 7425 7405 7300 4835 2787 2514 1994 1684 1640 1411 1345 873 780 765 751 563 22147 1558 31352 1148 726 1433
NM_175854chr1372648 2610 2320 1908 1879 699 286 1840 32245 1857 1827 --
NM_175861chr12165936 5217 5105 4640 4362 4184 1861 1800 1435 1246 1157 1148 962 833 531 292 --44662 1151 934 803 11806
NM_175876chr1102661 2431 2034 2024 609 564 487 60 27 21 32321 77 67 1687 2568 52
NM_175921chr5104133 3256 3213 3033 2770 1690 1523 1377 572 323 13006 24237 713 44231 3037 561 173
NM_176824chr4101306 1270 1154 1077 1070 1061 970 855 546 292 --2376 310 2387 321
NM_177438chr14113826 3712 3647 3149 3129 2587 1651 1411 865 833 171 23551 3173 23875 3739 11420
NM_177452chr14122365 2343 2153 1680 1572 870 683 664 522 508 489 277 --2280 119 --
NM_177974chr1572040 1950 608 581 339 265 165 32203 2138 186 12263 --
NM_177985chr2102232 1907 1674 1667 1553 1425 619 508 473 465 11840 21766 88 --
NM_177996chr2062139 1040 944 179 163 151 1948 ----
NM_178006chr13102356 2342 2118 1770 382 363 355 347 334 239 ----1243
NM_178007chr13102356 2342 2118 1770 382 363 355 347 334 239 ----1243
NM_178011chr1053178 3168 2842 2021 1295 --33181 1279 309 12052
NM_178140chr542484 1022 642 511 2767 257 --22663 515
NM_178151chrX107211 6580 5881 5781 5558 2817 2320 1242 973 308 15566 66956 6596 6317 2822 2351 150 --
NM_178152chrX107211 6580 5881 5781 5558 2817 2320 1242 973 308 15566 66956 6596 6317 2822 2351 150 --
NM_178153chrX107211 6580 5881 5781 5558 2817 2320 1242 973 308 15566 66956 6596 6317 2822 2351 150 --
NM_178498chr1153882 3285 3240 3160 93 --1488 23244 1225
NM_178509chr17113461 3263 3088 2896 603 421 370 310 280 264 228 --13064 1430
NM_178584chr261247 955 527 437 380 108 --41387 1319 530 520 --
NM_178815chr1062106 1966 914 522 226 217 62746 2533 2220 2079 2060 1022 32621 847 449 --
NM_181265chr4183182 3136 3113 3023 2911 2831 2807 2794 2782 2768 2734 2441 2238 2203 2181 2059 703 165 22937 822 32852 2444 1986 11227
NM_181332chrX122724 2706 2345 2202 2070 2062 1947 1072 760 752 630 600 ------
NM_181358chr1114214 4052 3864 3853 3172 3043 2725 2701 1456 1421 1265 11479 13929 --
NM_181453chr221397 97 166 71760 1563 1366 1145 143 118 102 11448
NM_181481chr18176784 6710 6633 6173 5896 5411 5266 5070 4996 4973 4790 4766 2577 2128 1123 1108 641 14567 21033 322 25011 413
NM_181482chr18176784 6710 6633 6173 5896 5411 5266 5070 4996 4973 4790 4766 2577 2128 1123 1108 641 14567 21033 322 25011 413
NM_181483chr18176784 6710 6633 6173 5896 5411 5266 5070 4996 4973 4790 4766 2577 2128 1123 1108 641 14567 21033 322 25011 413
NM_181504chr5173955 3902 3882 3862 3844 3796 3748 3483 3026 2819 1668 1294 1159 710 701 582 525 14183 13911 --
NM_181521chr16157208 7054 6762 6353 6121 5795 5694 4847 4618 4460 2462 2451 2382 2298 303 17265 56007 5697 4644 2892 2096 --
NM_181523chr5173955 3902 3882 3862 3844 3796 3748 3483 3026 2819 1668 1294 1159 710 701 582 525 14183 13911 --
NM_181524chr5173955 3902 3882 3862 3844 3796 3748 3483 3026 2819 1668 1294 1159 710 701 582 525 14183 13911 --
NM_181659chr2093320 3219 3063 2757 2744 2554 2474 2148 1007 22957 995 12762 --
NM_181659chr2093320 3219 3063 2757 2744 2554 2474 2148 1007 22957 995 12762 --
NM_181705chr5165360 5225 5054 4731 4169 4141 3755 3619 2156 1243 1233 1139 1051 961 716 517 --75709 5649 4677 1761 1426 1236 274 --
NM_181706chr1192425 2402 2348 1786 1465 795 229 195 182 --32353 1928 1580 --
NM_181713chr23309 273 189 --2837 312 1261
NM_181723chr862104 1736 899 688 276 205 11462 1610 11518
NM_181780chr362056 1936 1467 1432 1370 440 1202 11901 11894
NM_181782chr6162289 1762 754 736 720 710 694 686 634 596 579 515 464 358 342 284 ------
NM_181783chr1291990 1827 1517 1493 694 686 650 500 174 2178 161 31496 1454 582 --
NM_181787chr8153849 3788 3391 3200 3079 3052 2514 1499 1345 1218 1071 886 497 444 328 43716 3573 1560 609 33634 750 565 1960
NM_181869chr1292849 2833 2821 2797 2762 1157 828 441 36 12773 22119 67 11910
NM_182485chr4113495 3331 3293 3276 2676 2668 2594 2446 429 266 243 23711 592 12806 12303
NM_182493chr16134618 4575 4298 3865 3668 3301 3265 2026 1876 1469 1423 1109 550 11500 45357 4763 3702 1048 25075 3774
NM_182503chr695585 4837 2176 1781 1268 1174 739 502 489 --65516 3607 2179 1881 97 89 --
NM_182515chr19136504 6224 5501 5461 5449 5201 4353 2603 2557 1886 1500 1248 699 --56091 4339 2560 1337 702 --
NM_182646chr4113495 3331 3293 3276 2676 2668 2594 2446 429 266 243 23711 592 12806 12303
NM_182715chr791260 1188 1095 1069 1057 451 335 311 32 1501 3185 111 35 --
NM_182758chr15193478 3400 3188 2981 2780 2678 2666 2654 2638 2626 1218 1202 1195 1040 1016 1009 959 900 822 23941 2478 33950 3309 2591 1147
NM_182762chr7145775 4570 4477 4417 4333 3815 3799 2333 2293 1334 1287 1063 280 265 35589 5448 177 65865 5741 4889 4336 1232 268 --
NM_182767chr12122129 2099 1855 1795 1626 1303 793 663 647 473 268 140 --22000 1566 21772 456
NM_182896chr361767 1318 450 297 237 205 --31321 512 430 11800
NM_182898chr7116303 5633 4705 4668 4564 4170 3977 2252 2159 1540 284 24996 2540 26421 5463 --
NM_182899chr7116303 5633 4705 4668 4564 4170 3977 2252 2159 1540 284 24996 2540 26421 5463 --
NM_182907chr6102373 2071 1948 1540 1505 724 532 273 232 197 1900 31549 455 259 --
NM_182920chr371401 1393 237 200 182 172 150 2531 494 --11447
NM_182972chr192757 2700 2195 2036 1827 333 162 75 61 11769 ----
NM_183050chr6112320 2229 2138 1815 1686 847 719 536 505 405 187 --32336 2027 1784 1881
NM_183079chr2061517 1508 1395 1299 1282 1220 --11302 11224
NM_194247chr2104350 4205 4155 4140 3364 1780 1433 1355 1170 324 ----11443
NM_194282chr4112563 2324 2288 2238 2150 2001 1943 1115 468 327 91 --1726 --
NM_194283chr594087 3682 2950 1432 633 507 402 253 158 14136 21631 161 --
NM_194291chr8102984 2841 2633 2201 2094 1885 570 298 262 206 33011 2514 962 22204 1919 32456 574 126
NM_194314chr1145617 5012 4987 4864 4444 4394 4121 4062 3825 2186 2048 2028 1755 848 35381 5277 2063 45119 4493 3783 2035 --
NM_194434chr18125719 5707 5700 5684 5578 4228 4202 3787 2131 1739 937 661 1207 45760 4745 2246 1532 --
NM_198066chr1482786 2682 2606 2319 1980 446 329 267 --2873 237 12840
NM_198128chr18112243 1905 1857 1809 1447 928 916 890 822 528 306 197 22340 1431 --
NM_198150chr561496 1439 1074 617 576 445 11330 31239 951 67 147
NM_198158chr353029 905 811 554 178 23010 969 4962 557 471 143 --
NM_198159chr353029 905 811 554 178 23010 969 4962 557 471 143 --
NM_198177chr353029 905 811 554 178 23010 969 4962 557 471 143 --
NM_198178chr353029 905 811 554 178 23010 969 4962 557 471 143 --
NM_198181chr1572575 602 558 513 500 466 99 22461 1944 31985 1010 697 --
NM_198182chr261559 1471 1298 1280 243 226 11201 11530 11242
NM_198212chr792336 2131 2033 2002 664 649 643 584 397 11954 1524 --
NM_198268chr1114214 4052 3864 3853 3172 3043 2725 2701 1456 1421 1265 11479 13929 --
NM_198269chr1114214 4052 3864 3853 3172 3043 2725 2701 1456 1421 1265 11479 13929 --
NM_198270chrX123466 3409 3376 3276 2982 2963 2688 2601 1250 986 575 450 1994 12547 --
NM_198281chr473379 3352 2930 2918 2639 2584 1148 1665 23176 3147 1328
NM_198329chr371384 1325 613 452 377 104 25 --1616 11287
NM_198400chr1592885 2867 2350 2197 2189 2162 1002 942 593 22711 1081 22642 493 --
NM_198401chr8121776 1723 1673 1591 1383 1165 1155 1120 1100 619 587 192 --11769 --
NM_198503chr1102098 1921 1878 1798 1790 1701 897 408 342 92 --11819 11802
NM_198513chr872025 1848 1837 1756 743 458 381 21828 756 1126 --
NM_198569chr672729 2566 2487 2321 1725 259 106 1822 32569 169 120 11823
NM_198578chr1271437 1388 1335 483 211 179 150 11295 1447 --
NM_198581chr2236796 6372 6348 6266 6239 6094 5638 5308 5012 2817 2182 1774 1190 1157 1144 1130 1109 927 791 755 635 441 289 21284 224 12161 --
NM_198715chr1186308 6275 5524 5294 5192 5179 5170 4193 3901 2476 2453 2430 2367 1380 1363 810 489 246 15419 54022 2135 813 690 497 23905 197
NM_198793chr3104078 3962 3848 3266 3185 2772 1406 1076 890 209 --34061 893 689 13852
NM_198904chr542038 1838 1822 378 11310 12087 22042 1898
NM_198990chr7113296 3233 2831 2504 2112 1241 1171 1006 482 440 323 11061 23103 2645 --
NM_199072chr7133211 3170 3134 3063 2839 2680 2640 2526 2520 1989 385 358 178 12776 --32299 342 225
NM_199168chr1061425 1385 1376 1214 998 214 1285 41297 1274 1262 1217 --
NM_199188chr12134069 4063 3616 3534 3506 3466 3393 2493 1557 490 241 217 63 23818 1213 33619 2509 2496 33399 1632 1542
NM_199190chr12134069 4063 3616 3534 3506 3466 3393 2493 1557 490 241 217 63 23818 1213 33619 2509 2496 33399 1632 1542
NM_199320chr462888 2833 2791 1878 1070 469 12814 --22539 950
NM_199320chr462888 2833 2791 1878 1070 469 12814 --22539 950
NM_199324chr4173745 3699 3654 3597 3552 3456 3160 2869 2847 2517 2458 1335 1289 1109 671 644 457 --13634 33765 3232 2368
NM_199327chr43971 962 823 ----31194 1171 429
NM_199436chr232940 2086 315 12630 53120 2844 2727 2242 784 12000
NM_199482chr2112121 2000 1938 1724 1487 799 529 515 178 82 55 21639 806 11376 --
NM_203403chr951291 816 283 68 43 --21220 794 21268 435
NM_203406chr592736 2334 1817 1079 945 885 371 237 112 21915 403 62852 2620 2526 661 534 21 --
NM_203446chr2183032 2899 2570 2440 2371 2270 2181 970 12882 11020 12799
NM_203459chr192182 1672 1647 1635 1035 964 940 448 382 12408 12129 1724
NM_203463chr294771 4327 3377 1926 1834 1352 950 726 270 2926 625 11709 --
NM_205860chr172978 2685 2616 2099 334 203 188 --32440 1063 678 1657
NM_206594chr1143568 3562 3493 3283 3182 3062 2748 2739 2726 2650 2449 2256 1274 1158 --33571 3551 2833 --
NM_206595chr1143568 3562 3493 3283 3182 3062 2748 2739 2726 2650 2449 2256 1274 1158 --33571 3551 2833 --
NM_206853chr6113984 3801 3776 3669 3134 2970 2832 1634 1238 583 447 2392 149 33000 2835 470 11495
NM_206854chr6135245 5062 5037 4930 4395 4231 4093 3682 3568 1844 1708 719 130 31653 1410 310 44261 4096 3308 1731 --
NM_206855chr6136210 6027 6002 5895 5360 5196 5058 4647 4533 3860 1684 1095 697 22375 1275 35226 5061 4273 --
NM_206907chr5203335 3325 3307 2903 2821 2757 2701 2309 2286 2191 1354 1334 1324 1296 1233 1097 1067 694 278 214 --1898 2348 331
NM_206909chr8228381 8224 8206 8136 7831 7731 7625 6495 6083 5802 5580 5328 5246 2931 2154 1922 1875 1098 914 441 266 137 25522 1659 45236 2174 320 81 --
NM_207015chr3102370 2155 1920 1468 749 578 277 267 209 137 --21747 914 12178
NM_207292chr382460 2069 1257 910 895 612 468 89 --33300 382 329 12876
NM_207293chr382460 2069 1257 910 895 612 468 89 --33300 382 329 12876
NM_207294chr382460 2069 1257 910 895 612 468 89 --33300 382 329 12876
NM_207295chr382460 2069 1257 910 895 612 468 89 --33300 382 329 12876
NM_207296chr382460 2069 1257 910 895 612 468 89 --33300 382 329 12876
NM_207297chr382485 2094 1282 935 920 637 493 114 --33325 407 354 12901
NM_207303chr10134074 3583 3332 2848 1634 1610 1427 1367 1331 1133 298 268 24 14155 2969 515 --
NM_207304chr1382604 2301 2180 2068 652 388 93 64 11715 11647 11742
NM_207406chr4125519 5464 5286 5096 4659 4489 4390 4323 4254 1470 1144 443 21535 205 34820 4503 4084 16288
NM_207517chr1561934 1854 1742 737 333 185 --41809 1745 208 89 --
NM_212471chr1792206 2069 1897 1875 1753 1459 1438 415 407 11705 1129 --
NM_212472chr1792206 2069 1897 1875 1753 1459 1438 415 407 11705 1129 --
NM_212558chr9124130 3922 3680 3534 3454 2680 1555 1443 1431 1296 858 403 23712 684 44139 4122 4106 1434 1770
NM_213589chr2205399 5363 5315 5054 4773 4670 4284 3975 3482 1858 1829 1178 1164 1012 968 281 212 194 180 127 1429 15413 --
NM_213651chr171816 1769 1528 1447 585 376 166 21439 665 21819 398 --
NM_213654chr3101549 1213 1160 647 487 443 376 360 345 199 1512 ----