TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1282
miRNA Sequence: UCGUUUGCCUUUUUCUGCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr532037 1986 1302 173 ----
NM_000084chrX106838 5626 5013 4787 2792 1577 1003 847 523 433 ----14639
NM_000088chr17----1964 --
NM_000091chr222731 2556 12781 ----
NM_000092chr243745 3637 3177 2963 32870 1684 1191 1173 --
NM_000097chr311008 ------
NM_000108chr741887 693 658 459 --1488 --
NM_000109chrX21796 404 1610 ----
NM_000112chr544766 4169 1300 1227 ------
NM_000115chr1311713 ----1512
NM_000125chr664263 4211 4102 3483 2807 1166 ----13612
NM_000138chr1542069 1040 366 358 --1311 --
NM_000165chr641491 1196 633 307 ------
NM_000176chr552956 1401 984 875 823 ------
NM_000194chrX1569 ------
NM_000202chrX53344 3327 1308 752 281 --126 --
NM_000210chr242166 1568 749 39 --1587 --
NM_000217chr1264599 4545 4500 2099 1448 438 1849 ----
NM_000233chr23814 730 671 ------
NM_000245chr731718 1483 500 ------
NM_000248chr352432 2074 537 368 199 12913 ----
NM_000259chr1575751 5049 2318 2044 1678 780 749 1119 --15152
NM_000267chr1743347 3258 2200 833 ------
NM_000297chr431735 1548 503 ------
NM_000325chr43664 652 247 ------
NM_000337chr575601 5472 1823 1633 1537 823 665 ------
NM_000346chr1741699 1558 777 212 --21448 315 --
NM_000348chr271557 1448 1371 1306 1087 475 236 21463 489 ----
NM_000362chr2253097 2625 694 488 109 13067 ----
NM_000368chr954585 3554 3001 638 301 ------
NM_000369chr1431756 1209 700 --1380 11198
NM_000415chr123971 696 324 ------
NM_000461chr354447 3590 2844 1274 1133 --13980 --
NM_000500chr6182 ------
NM_000503chr851783 1734 1288 684 360 --1305 --
NM_000530chr121105 1004 ----1952
NM_000555chrX87615 7465 7076 4848 2673 2343 985 663 11933 ----
NM_000601chr71363 ------
NM_000610chr1121222 559 ------
NM_000611chr11126515 6409 6170 6000 4668 4451 2362 2256 2016 1086 468 94 26603 2454 ----
NM_000612chr11102835 1527 1257 1155 1104 1087 1039 995 948 654 --13322 1794
NM_000618chr1295885 5739 4033 4007 2266 1103 685 310 152 1770 ----
NM_000618chr1295885 5739 4033 4007 2266 1103 685 310 152 1770 ----
NM_000621chr1321108 1011 11163 ----
NM_000624chr142875 796 ------
NM_000636chr63597 525 503 ------
NM_000676chr171350 ------
NM_000681chr1051393 1112 1094 1069 329 ------
NM_000689chr91502 ------
NM_000719chr1256731 5857 2543 900 136 11644 1342 --
NM_000721chr112484 ------
NM_000726chr231485 1259 1010 21214 335 ----
NM_000756chr8----1411 --
NM_000787chr91563 ------
NM_000792chr121055 140 ------
NM_000793chr1464566 4371 2007 1845 1309 171 ------
NM_000808chrX2841 788 ------
NM_000809chr4128927 7966 7954 7883 7587 7490 7289 6984 6777 6102 1620 1093 --26353 1743 11342
NM_000810chr152566 208 ------
NM_000812chr41390 ------
NM_000813chr595029 4756 3616 3557 1298 1040 785 700 438 24986 1060 ----
NM_000814chr1573902 1562 1510 1342 807 399 103 23460 3268 ----
NM_000824chr42296 289 1234 ----
NM_000828chrX52091 1816 1656 1632 205 ------
NM_000833chr1641297 610 439 212 ------
NM_000872chr1041478 1313 1046 406 1482 ----
NM_000875chr1576736 4762 4509 2087 1805 196 26 26220 5027 15756 --
NM_000891chr1762958 2618 2508 410 285 130 --32894 1328 108 --
NM_000899chr1253651 3130 1606 648 618 --1654 --
NM_000912chr873255 3182 2599 2566 696 619 153 ------
NM_000919chr5196 ------
NM_000921chr12----1109 --
NM_000944chr41590 ------
NM_000945chr211907 --11848 --
NM_000950chrX32819 1329 447 --12398 --
NM_000956chr1431105 1048 88 ------
NM_000961chr2042862 1583 1228 290 --1871 --
NM_000963chr142453 2168 1894 973 11658 ----
NM_001001323chr1242833 2716 2596 1214 ------
NM_001001342chr1041106 521 423 148 1307 ----
NM_001001344chrX22240 2041 22068 1597 1554 --
NM_001001389chr1121222 559 ------
NM_001001390chr1121222 559 ------
NM_001001391chr1121222 559 ------
NM_001001392chr111605 ------
NM_001001396chr194375 4361 4188 3842 3011 2722 1309 1271 933 11653 ----
NM_001001419chr534590 1806 692 ------
NM_001001420chr534590 1806 692 ------
NM_001001481chr843177 2259 1200 965 ------
NM_001001549chr7102804 2699 2663 2631 2448 2273 2201 2180 1928 524 31736 586 169 ----
NM_001001550chr7102804 2699 2663 2631 2448 2273 2201 2180 1928 524 31736 586 169 ----
NM_001001555chr7102804 2699 2663 2631 2448 2273 2201 2180 1928 524 31736 586 169 ----
NM_001001664chr242699 1564 800 571 ------
NM_001001668chr1984210 3978 3050 2902 2697 904 383 346 --13591 --
NM_001001701chr422124 1470 ------
NM_001001890chr2184306 4004 3701 3175 3071 3057 1268 300 11699 ----
NM_001001994chrX2457 123 1511 ----
NM_001001996chrX2457 123 1511 ----
NM_001002032chr171736 ------
NM_001002243chr21220 ------
NM_001002258chr231898 1582 1404 ------
NM_001002909chr1731888 1845 822 --11572 --
NM_001003407chr1074836 3734 3692 1102 605 157 98 --24895 2006 1647
NM_001003408chr1074836 3734 3692 1102 605 157 98 --24895 2006 1647
NM_001003652chr1898287 8159 7214 3331 2051 1996 1454 1081 412 ------
NM_001003674chr1865853 2493 1685 211 168 124 26231 118 15155 --
NM_001003675chr1865853 2493 1685 211 168 124 26231 118 15155 --
NM_001003688chr4------1881
NM_001003712chr1233133 1190 600 ------
NM_001003800chr983606 3200 3004 2978 2945 2918 1492 541 --13110 --
NM_001004065chr953117 936 701 298 102 ------
NM_001004304chr1273141 2475 2219 2098 766 645 416 ------
NM_001004317chr663323 3255 3061 1692 1470 157 11607 --11151
NM_001004342chr176002 5979 5416 4294 1890 550 104 ------
NM_001004360chr2----1723 11939
NM_001005375chrY2655 397 ------
NM_001005404chr1743968 2826 574 66 14075 --1592
NM_001005463chr1042136 2125 2111 180 ------
NM_001005473chr576086 5355 4703 4450 2428 1100 70 25828 2120 15555 --
NM_001005474chr31513 11256 195 --
NM_001005609chrX63835 3281 3151 3093 2882 959 ------
NM_001005611chrX1382 ------
NM_001005746chr231485 1259 1010 21214 335 ----
NM_001005747chr231485 1259 1010 21214 335 ----
NM_001005751chr102508 99 ------
NM_001005861chr32931 761 ------
NM_001006118chrY150 ------
NM_001006120chrY150 ------
NM_001006600chr522222 863 ----1940
NM_001006610chr1641041 965 842 201 ------
NM_001006684chrX1574 ------
NM_001007023chr1464566 4371 2007 1845 1309 171 ------
NM_001007075chr42735 359 ------
NM_001007097chr974863 4371 3150 1588 1508 1442 637 1727 ----
NM_001007099chr12307 102 ------
NM_001007100chr12307 102 ------
NM_001007102chr61342 ------
NM_001007156chr1511452 --11549 --
NM_001007245chr71198 ------
NM_001007466chr684995 3738 3197 1747 1218 1096 787 641 194 ----
NM_001007526chrY150 ------
NM_001007553chr111169 ------
NM_001008239chr1843652 3214 1461 893 ------
NM_001008401chr1941401 1059 583 113 --11311 --
NM_001008405chr721837 192 ------
NM_001008410chr252293 2199 897 141 105 --1720 --
NM_001008495chr832211 1596 194 11982 ----
NM_001008660chr11------11139
NM_001008707chr1441878 1344 1191 600 ------
NM_001008726chr142593 114 1513 ----
NM_001008801chr1942081 711 527 172 --11991 --
NM_001008895chr131574 --11495 --
NM_001009554chr464674 4478 3791 3233 3048 1696 1716 23506 402 --
NM_001009554chr464674 4478 3791 3233 3048 1696 1716 23506 402 --
NM_001009894chr1221588 175 ------
NM_001009899chr386399 5602 5580 4957 2076 1406 524 45 ------
NM_001009960chr742420 264 247 220 1898 1601 12677
NM_001009993chr254148 3791 2790 1346 200 --13120 --
NM_001010853chr652262 907 447 337 184 ------
NM_001010857chr1----198 --
NM_001010861chr132457 1743 1704 1268 ----
NM_001010862chrX73263 2846 2030 1326 821 808 768 ------
NM_001010888chrX54387 3967 3229 3104 1275 ----1236
NM_001010891chr556757 6700 6268 5710 1259 25181 33 1718 --
NM_001010932chr71363 ------
NM_001010934chr7----1110 --
NM_001011515chr43867 356 194 ------
NM_001011516chr43867 356 194 ------
NM_001011546chr205718 214 149 127 70 ------
NM_001011666chr776608 6567 6310 4622 4193 2564 738 --12232 1879
NM_001011708chr232896 2751 2013 ------
NM_001012393chr11134955 4726 4640 4312 4012 1940 1877 1771 1671 1201 1045 763 76 ------
NM_001012754chr1341987 1916 744 533 --21886 1793 --
NM_001012755chrX13255 --13215 --
NM_001012761chr552046 1756 1701 905 562 12007 ----
NM_001012989chrX1154 ------
NM_001013031chr1053431 2933 2887 2808 2763 ------
NM_001013620chr12118233 8169 7436 6913 6773 5145 2250 1868 972 472 461 1773 --11720
NM_001013843chr15153 ------
NM_001014380chr1335608 3832 1753 11082 ----
NM_001014434chr1------1169
NM_001014449chr16------1169
NM_001014451chr16------1169
NM_001014797chr1087290 6389 5626 2385 2057 1990 1705 1591 --12755 --
NM_001015045chr432567 2545 437 --1484 --
NM_001015877chrX72835 2136 2096 743 737 397 378 --12515 1279
NM_001015880chr10------11679
NM_001017368chr1752794 2787 606 576 87 --11038 --
NM_001017371chr22928 294 --1467 --
NM_001017424chr121701 1594 ------
NM_001017425chr121701 1594 ------
NM_001017440chr788042 6779 6591 2583 2536 2031 83 63 28119 1145 ----
NM_001017523chr1241633 665 470 428 --1410 --
NM_001017923chr1441507 1445 1328 604 ------
NM_001017995chr564684 4319 3902 3093 1924 105 --13192 --
NM_001017999chr172309 1923 1916 1821 813 721 224 ----164
NM_001017999chr172309 1923 1916 1821 813 721 224 ----164
NM_001018000chr172309 1923 1916 1821 813 721 224 ----164
NM_001018000chr172309 1923 1916 1821 813 721 224 ----164
NM_001018001chr172309 1923 1916 1821 813 721 224 ----164
NM_001018041chr61373 ------
NM_001018053chr131884 1335 1272 135 1364 --
NM_001018056chr91422 ------
NM_001018065chr976050 3669 2389 1889 1287 587 100 14104 ----
NM_001018066chr976050 3669 2389 1889 1287 587 100 14104 ----
NM_001018072chr1241633 665 470 428 --1410 --
NM_001018074chr552956 1401 984 875 823 ------
NM_001018075chr552956 1401 984 875 823 ------
NM_001018076chr552956 1401 984 875 823 ------
NM_001018077chr552956 1401 984 875 823 ------
NM_001018089chr1521184 427 ------
NM_001018090chr1562348 1876 1135 1001 781 535 1296 ----
NM_001018091chr1552458 1986 1111 891 645 1406 ----
NM_001018102chr1562348 1876 1135 1001 781 535 1296 ----
NM_001023567chr1512426 ------
NM_001024094chr552956 1401 984 875 823 ------
NM_001024218chr142239 221 1141 ----
NM_001024647chr1245804 4866 1068 121 17249 ----
NM_001024649chr552170 1160 1034 363 258 --11847 --
NM_001024680chr211114 ------
NM_001024934chr6----141 --
NM_001024935chr6----141 --
NM_001024936chr6----141 --
NM_001024947chr54918 796 288 77 --1137 --
NM_001025076chr1055942 4935 4611 2357 772 --1655 --
NM_001025077chr1077300 6293 5969 2130 1270 373 364 --12013 --
NM_001025079chr344025 1654 1420 1155 ------
NM_001025108chr234154 3206 685 12959 34195 3485 737 --
NM_001025579chr1721032 461 ------
NM_001025580chrX93828 3457 3367 2856 2691 1036 837 765 40 12793 ----
NM_001025595chr441677 1464 553 187 ------
NM_001025596chr111506 ------
NM_001029860chr8180 ------
NM_001029863chr653256 2997 2896 1217 180 ----13036
NM_001029875chr562777 1898 1872 787 675 500 12633 ----
NM_001029989chr151682 ------
NM_001029997chr192558 536 --1258 --
NM_001029998chr431098 1022 276 11211 ----
NM_001030007chr1643953 3872 2573 668 ------
NM_001030055chr1441229 758 586 45 ------
NM_001030272chr11----1326 --
NM_001030273chr11----1326 --
NM_001031623chr63215 179 103 1367 ----
NM_001031679chr1233405 1159 616 --1211 13336
NM_001031695chr2254779 3771 3288 703 396 11568 124 14089
NM_001031710chr71800 ------
NM_001031804chr1664049 3927 3752 3589 1447 1268 23812 1591 ----
NM_001032283chr123862 428 141 ------
NM_001032284chr123862 428 141 ------
NM_001032380chr1031685 774 538 ------
NM_001032394chr642781 1000 192 183 ------
NM_001032395chr642648 867 59 50 ------
NM_001032409chr121206 ------
NM_001033030chr33228 222 196 ------
NM_001033031chr33228 222 196 ------
NM_001033032chr33228 222 196 ------
NM_001033047chr452635 2239 1910 330 213 11989 ----
NM_001033057chr341696 1360 551 246 ----1579
NM_001033059chr611789 ------
NM_001033085chr2134 ------
NM_001033087chr2023088 2123 12351 ----
NM_001033507chr142012 1830 1231 283 ------
NM_001033557chr2------1475
NM_001033564chr6174 ------
NM_001033602chr1331993 1742 815 --1210 --
NM_001033925chr1011776 --21562 624 --
NM_001034837chr51768 ------
NM_001034838chr51768 ------
NM_001034841chr1664749 3973 3811 1058 215 30 14117 11797 --
NM_001034845chr4----1127 --
NM_001034915chr871326 1054 264 227 155 140 94 ------
NM_001034954chr1053164 2640 2222 1053 221 ------
NM_001034955chr1053164 2640 2222 1053 221 ------
NM_001034956chr1053164 2640 2222 1053 221 ------
NM_001034957chr1053164 2640 2222 1053 221 ------
NM_001035003chr451411 1027 1014 119 35 ------
NM_001035004chr451411 1027 1014 119 35 ------
NM_001035260chr1021208 378 ------
NM_001037131chr251266 1156 948 474 416 ------
NM_001037164chr721992 1822 1531 ----
NM_001037165chr798810 7605 6259 5751 954 879 838 729 87 --12891 --
NM_001037317chr132457 1743 1704 1268 ----
NM_001037339chr181848 1798 1732 1601 720 589 205 161 --11611 --
NM_001037340chr181848 1798 1732 1601 720 589 205 161 --11611 --
NM_001037341chr181848 1798 1732 1601 720 589 205 161 --11611 --
NM_001037341chr181848 1798 1732 1601 720 589 205 161 --11611 --
NM_001037553chr21104205 3698 3601 3498 2042 1773 1723 1538 1510 547 --24427 613 --
NM_001037954chr1153544 3143 548 481 197 1286 ----
NM_001038493chr211336 --11129 --
NM_001039348chr22991 762 ------
NM_001039349chr22991 762 ------
NM_001039538chr222419 2324 --23662 3116 --
NM_001039590chrX33725 2716 1372 --13898 --
NM_001039591chrX33725 2716 1372 --13898 --
NM_001039618chr1165969 5471 4959 1774 739 673 15280 ----
NM_001039715chr121055 140 ------
NM_001039716chr121119 204 ------
NM_001039762chr1061670 1575 909 686 456 411 ------
NM_001039840chrX116070 5599 5538 5423 4848 3738 2229 1826 1747 1480 676 --11377 --
NM_001039937chr1353381 2660 816 464 126 13796 --12965
NM_001040101chr471607 1165 1029 422 371 145 39 11243 ----
NM_001040135chr73592 576 291 ------
NM_001040142chr272312 2175 1745 1496 184 169 118 1270 ----
NM_001040143chr272312 2175 1745 1496 184 169 118 1270 ----
NM_001040152chr764105 3990 3561 1904 1545 102 ------
NM_001040153chr131876 ------
NM_001040157chr432469 2433 374 ------
NM_001040159chr411369 ------
NM_001040272chr962146 1887 612 495 380 257 ------
NM_001040284chr16104833 3596 2342 1850 1832 1149 829 591 204 105 ----1775
NM_001040402chr433179 2763 2070 ------
NM_001040429chr1343318 2995 2904 546 11013 1982 --
NM_001040441chr134184 4112 325 23873 1195 13596 --
NM_001040450chr1532896 279 269 ------
NM_001040453chr1532896 279 269 ------
NM_001040665chr754150 3729 2009 336 170 13898 ----
NM_001040712chr942182 1028 1009 557 23600 2616 ----
NM_001040876chr441682 1493 1253 320 ------
NM_001042403chr122759 702 ------
NM_001042440chr551966 1861 1703 1296 756 ------
NM_001042441chr551966 1861 1703 1296 756 ------
NM_001042442chr551966 1861 1703 1296 756 ------
NM_001042443chr551966 1861 1703 1296 756 ------
NM_001042444chr551966 1861 1703 1296 756 ------
NM_001042445chr551966 1861 1703 1296 756 ------
NM_001042446chr551966 1861 1703 1296 756 ------
NM_001042473chr1041934 1806 1519 428 3640 448 172 ----
NM_001042479chrX51692 1456 588 517 362 ------
NM_001042480chrX51692 1456 588 517 362 ------
NM_001042481chr1452152 2089 1704 1036 554 ------
NM_001042492chr1743347 3258 2200 833 ------
NM_001042494chr1563180 759 493 481 265 201 12606 ----
NM_001042495chr1563180 759 493 481 265 201 12606 ----
NM_001042496chr1563180 759 493 481 265 201 12606 ----
NM_001042497chr1563180 759 493 481 265 201 12606 ----
NM_001042517chr132697 667 --1916 --
NM_001042537chrX42401 2085 1562 838 ----1652
NM_001042550chr941431 759 231 47 1153 ----
NM_001042555chr1244462 4358 3229 1134 ------
NM_001042599chr2117896 7762 6673 6400 6360 6220 5112 4847 2883 1235 1165 36845 5984 1672 ----
NM_001042601chr342876 2456 1154 1021 ------
NM_001042603chr1221598 952 14065 14834 --
NM_001042683chr641588 1134 657 346 ------
NM_001042749chrX41960 553 191 175 11571 ----
NM_001042750chrX41960 553 191 175 11571 ----
NM_001042751chrX41960 553 191 175 11571 ----
NM_001042784chr41127 ------
NM_001043351chr111769 --11721 --
NM_001044305chr641643 1012 557 413 11121 ----
NM_001046chr542960 2363 2209 1004 ------
NM_001071775chr1321846 1556 ------
NM_001079874chr141568 670 543 287 ------
NM_001086chr31310 ------
NM_001099678chr366296 4318 4309 1936 1884 1877 ------
NM_001100108chr197357 7296 7117 7016 5768 2244 773 540 178 --15972 --
NM_001106chr3149498 9073 8032 7944 7702 7648 7506 7412 6142 3271 2587 2579 1995 412 12569 ----
NM_001116chr1642713 2684 2246 82 --22309 711 --
NM_001117chr1872530 2280 1947 1812 1551 989 401 ------
NM_001126chr1181 ------
NM_001128chr1643953 3872 2573 668 ------
NM_001143chrY2104 34 ------
NM_001144chr1641453 883 350 217 ------
NM_001149chr102913 873 ------
NM_001160chr1212587 21928 174 12169 1236
NM_001167chrX116322 6007 5600 5586 5501 4867 4347 2163 1839 942 358 11952 ----
NM_001172chr141494 ------
NM_001173chr1441229 758 586 45 ------
NM_001177chr1242256 2127 1907 1595 --12200 --
NM_001178chr11----1326 --
NM_001186chr2143237 2737 2705 231 22491 1311 12034 --
NM_001198chr622408 2109 --1115 --
NM_001202chr14----1203 --
NM_001204chr2107569 6182 5764 5676 5533 2555 2461 1585 1282 377 16625 ----
NM_001241chr21267 ------
NM_001241chr21267 ------
NM_001263chr41191 ------
NM_001273chr121553 ------
NM_001289chrX61550 1477 1047 479 220 77 ------
NM_001290chr42111 60 1334 ----
NM_001304chr1733830 1219 658 ------
NM_001310chr1222707 2459 1438 ----
NM_001316chr201162 ------
NM_001329chr1011597 ------
NM_001332chr531520 1358 88 ------
NM_001343chr531709 1165 22 ----1669
NM_001356chrX52310 1998 797 592 550 ------
NM_001364chr1164360 3699 3671 1726 1353 1120 --14808 21063 468
NM_001387chr543196 2232 936 96 ----1779
NM_001390chr1842714 960 347 37 --11116 --
NM_001396chr2152695 2490 2344 2030 908 ------
NM_001399chrX63835 3281 3151 3093 2882 959 ------
NM_001419chr1954845 4474 1790 642 170 13373 ----
NM_001432chr443321 2974 2813 509 11145 13683 21481 340
NM_001438chr111043 1996 23531 1466 --
NM_001444chr8167 ------
NM_001448chrX41762 691 370 226 11459 ----
NM_001449chrX11193 ------
NM_001455chr664729 4453 1658 923 479 36 34850 4155 1008 ----
NM_001483chr711036 ----1770
NM_001550chr71198 ------
NM_001609chr1054312 4069 3206 3080 53 ----1763
NM_001616chr232509 1299 220 ------
NM_001620chr114821 739 624 303 --1142 --
NM_001621chr71733 ------
NM_001621chr71733 ------
NM_001634chr611789 ------
NM_001650chr1873432 3250 840 808 722 235 25 --11426 13685
NM_001663chr1462395 632 613 580 486 456 12079 ----
NM_001668chr15890 782 730 76 64 ------
NM_001682chr1252547 2430 2310 1150 928 ------
NM_001684chr184092 4078 3905 3559 2728 1026 988 650 11370 ----
NM_001689chr231898 1582 1404 ------
NM_001690chr352263 2122 335 267 44 ------
NM_001695chr821165 361 --23495 1042 --
NM_001701chr951156 1020 642 307 36 ------
NM_001730chr1351562 1550 564 490 351 21419 48 11166 --
NM_001730chr1351562 1550 564 490 351 21419 48 11166 --
NM_001731chr121705 ------
NM_001742chr731649 500 265 --1249 --
NM_001746chr552170 1160 1034 363 258 --11847 --
NM_001748chr13946 740 117 ----1218
NM_001750chr551966 1861 1703 1296 756 ------
NM_001753chr751771 1717 1357 1150 458 ------
NM_001754chr2184306 4004 3701 3175 3071 3057 1268 300 11699 ----
NM_001759chr1264863 3984 1201 733 718 238 --14663 --
NM_001777chr344025 1654 1420 1155 ------
NM_001797chr162202 69 ------
NM_001799chr5271 53 ------
NM_001826chr11328 ------
NM_001829chr42910 156 ------
NM_001830chrX103836 3639 3536 3057 2900 2735 2724 1467 1448 1049 --23995 3015 --
NM_001858chr674463 3818 3441 1947 1235 815 173 --11044 --
NM_001918chr189250 8101 8056 7350 6495 6429 1000 51 36775 6463 6037 ----
NM_001938chr111778 ------
NM_001949chr673223 3066 2730 2543 897 190 120 --2776 481 --
NM_001969chr1432809 460 42 13758 12883 13103
NM_001981chr152432 2255 935 832 477 11660 11804 --
NM_001987chr12124294 4130 4057 3741 3586 3050 3021 1302 849 454 435 144 24229 3558 12947 --
NM_001992chr542014 1376 813 508 --11672 --
NM_001993chr12827 321 --129 188
NM_001995chr44999 483 384 196 --11067 --
NM_001999chr521020 440 ------
NM_002006chr465174 4146 4027 4019 1346 509 ------
NM_002009chr1562599 2318 2144 1975 1125 1111 ------
NM_002015chr1333029 2452 704 11269 --12558
NM_002024chrX52158 2116 1979 1761 641 11822 ----
NM_002025chrX129131 9116 9006 8478 8218 8142 7661 7016 3440 3320 1636 1500 67801 6539 3704 2842 2669 1958 ----
NM_002037chr61336 ------
NM_002069chr711418 141 2275 108 --
NM_002073chr221159 ----11137
NM_002074chr14696 632 315 207 11599 --11275
NM_002076chr1262898 2600 2586 2461 590 332 11310 ----
NM_002077chr942111 1569 728 647 ------
NM_002126chr1763435 2896 2823 2616 2541 73 12604 ----
NM_002128chr13------21858 1791
NM_002139chrX1527 --2542 218 --
NM_002140chr911052 --1766 --
NM_002166chr21600 ------
NM_002199chr43864 777 731 ------
NM_002214chr785436 5044 4790 4382 4188 3993 3926 884 32253 1511 132 11643 --
NM_002232chr131101 515 244 11293 11309 11337
NM_002233chr11------192
NM_002239chr21245 ------
NM_002242chr251953 1413 762 684 371 ------
NM_002247chr1031809 1512 198 --1207 --
NM_002253chr421327 1066 --1548 --
NM_002264chr3104705 4697 4353 4235 4000 3634 3464 3065 907 97 --11335 34649 4116 1423
NM_002265chr1741183 1156 1134 971 ------
NM_002267chr1372212 2174 1681 893 781 724 133 2510 65 ----
NM_002270chr565241 5143 4308 2195 2084 113 1680 ----
NM_002271chr1372458 2221 1921 971 899 452 44 ------
NM_002285chr234154 3206 685 12959 34195 3485 737 --
NM_002293chr11165 ------
NM_002294chrX140 ------
NM_002296chr141751 1541 1269 539 ------
NM_002310chr576061 5436 2331 2022 1515 860 711 ------
NM_002313chr1074836 3734 3692 1102 605 157 98 --24895 2006 1647
NM_002336chr1264317 3532 1487 421 264 105 15064 11991 --
NM_002345chr121126 1259 1614 --
NM_002349chr241275 593 440 402 1616 ----
NM_002351chrX31255 244 95 ------
NM_002356chr622489 341 1411 ----
NM_002374chr222419 2324 --23662 3116 --
NM_002387chr574374 3905 3690 3617 1518 236 41 ------
NM_002402chr72818 225 --11069 --
NM_002430chr2252352 1838 1818 682 272 --1849 --
NM_002467chr84454 139 83 71 ------
NM_002481chr157963 6171 5407 2935 2876 16405 1663 --
NM_002487chr151548 ------
NM_002500chr21107 ------
NM_002514chr85873 826 479 255 187 ------
NM_002515chr1421922 1516 ----1118
NM_002522chr1773826 3692 3485 2684 1569 998 505 ------
NM_002527chr121299 ------
NM_002538chr5------170
NM_002544chr171219 ------
NM_002545chr11134955 4726 4640 4312 4012 1940 1877 1771 1671 1201 1045 763 76 ------
NM_002547chrX63298 3046 2997 2822 1080 859 ------
NM_002568chr81169 --1154 --
NM_002577chr341205 1018 643 251 13200 13680 33179 3038 127
NM_002581chr955426 4789 4566 4064 1127 14057 --14093
NM_002582chr164888 833 96 22 ------
NM_002586chr611583 ------
NM_002590chr132536 161 ------
NM_002594chr2032451 676 260 ------
NM_002595chr1221926 566 ------
NM_002600chr181848 1798 1732 1601 720 589 205 161 --11611 --
NM_002612chr71718 1101 --11950
NM_002613chr16105231 5040 4950 4738 3694 1654 1472 1059 1040 1014 ------
NM_002641chrX41786 1759 649 322 ------
NM_002645chr1141092 1070 979 44 --22015 2009 --
NM_002655chr835180 1378 282 1485 14653 --
NM_002656chr621086 236 ------
NM_002687chr1421058 315 ------
NM_002709chr242444 1320 658 425 ------
NM_002710chr121233 ----1171
NM_002715chr531148 389 307 ------
NM_002731chr173024 2274 2259 2001 949 721 192 12995 ----
NM_002737chr1741573 743 282 146 26133 4778 25988 1230 --
NM_002742chr143635 501 295 ------
NM_002745chr2254210 3461 3047 2870 952 --13818 --
NM_002755chr151806 ------
NM_002828chr1851026 977 802 732 23 --181 --
NM_002829chr931314 1284 1096 ------
NM_002830chr21374 ------
NM_002839chr942182 1028 1009 557 23600 2616 ----
NM_002841chr32269 33 ------
NM_002844chr631138 1131 427 ------
NM_002845chr182273 22 ------
NM_002858chr131341 1282 312 21062 869 ----
NM_002873chr51378 ------
NM_002874chr91468 --1986 --
NM_002892chr142644 287 ------
NM_002920chr121363 ------
NM_002940chr441682 1493 1253 320 ------
NM_002941chr351159 606 463 256 232 11283 1547 --
NM_002958chr32931 761 ------
NM_002968chr164892 717 280 211 --2919 223 --
NM_002979chr12307 102 ------
NM_002998chr882154 1514 1407 1392 743 636 533 280 --1887 --
NM_003013chr41721 ------
NM_003016chr1731731 667 211 --11926 --
NM_003022chrX31165 492 135 ------
NM_003026chr921309 477 ------
NM_003031chr163965 842 201 ------
NM_003045chr1355043 4840 4320 3629 739 2673 510 13927 14476
NM_003070chr93815 604 212 ------
NM_003099chr1555758 4334 4310 1363 288 --25980 2172 --
NM_003108chr2105128 4900 4598 4559 2719 1491 1173 813 734 724 --11477 --
NM_003111chr22928 294 --1467 --
NM_003129chr81323 ------
NM_003133chr12898 286 --1171 --
NM_003136chr141342 ------
NM_003151chr2------139
NM_003152chr1721242 946 ------
NM_003161chr1783623 3276 2294 1090 946 497 424 145 ----1662
NM_003171chr10142 ------
NM_003185chr205971 950 917 438 286 --165 --
NM_003198chr11280 ------
NM_003199chr1855534 5157 1903 1658 412 11279 31910 549 144 --
NM_003201chr102194 104 --1244 --
NM_003203chr242445 1776 1606 642 ------
NM_003222chr201772 ------
NM_003238chr11260 ------
NM_003247chr621518 1301 1629 1710 1574
NM_003253chr2121173 312 ------
NM_003262chr354057 3430 1544 953 430 14185 ----
NM_003274chr2132676 2335 2054 ------
NM_003286chr201302 ------
NM_003290chr1931228 202 119 --11033 --
NM_003292chr132004 756 542 22176 804 ----
NM_003297chr12125 ------
NM_003298chr3105734 5661 4183 1951 1757 1517 1066 773 719 90 1854 1478 --
NM_003304chr311420 --1358 --
NM_003339chr531574 1520 1441 ------
NM_003342chr1732320 840 119 1599 --22329 1224
NM_003345chr16173 ------
NM_003348chr121154 ------
NM_003350chr831032 885 114 ------
NM_003360chr4198 ------
NM_003373chr1041934 1841 419 257 ------
NM_003383chr91422 ------
NM_003392chr363839 3267 3228 1084 983 647 1796 ----
NM_003400chr22347 289 ------
NM_003410chrX43108 2224 2150 665 1764 --11209
NM_003412chr341982 1142 667 277 --13143 --
NM_003418chr31654 ------
NM_003430chr193310 293 226 ------
NM_003473chr102319 274 ----1732
NM_003474chr1042307 907 872 624 ------
NM_003478chr1142959 2134 1122 629 ------
NM_003482chr1242231 647 638 593 12776 12017 1874
NM_003483chr1262333 2035 1995 682 388 243 12172 ----
NM_003489chr2133218 2933 2654 ------
NM_003507chr211484 ------
NM_003557chr121610 1064 ------
NM_003558chr91689 ------
NM_003566chr1222806 1305 1329 ----
NM_003589chr131574 --11495 --
NM_003590chr233855 1541 1306 --13968 --
NM_003592chr72525 39 ------
NM_003597chr241980 1600 825 493 12275 ----
NM_003607chr154151 3723 3604 887 312 13217 1454 --
NM_003615chr333873 3329 2942 11437 ----
NM_003626chr1121038 219 1323 ----
NM_003629chr143175 2682 2195 1076 --1776 --
NM_003633chr522246 1991 --11914 --
NM_003642chr2134 ------
NM_003668chr121342 ------
NM_003671chr953509 3311 3262 1299 183 ----1189
NM_003677chr1231656 1567 346 --11910 --
NM_003692chr91292 ----1338
NM_003701chr133935 689 387 ------
NM_003722chr332065 2036 759 --12580 --
NM_003732chr51303 ------
NM_003758chr1541507 1296 599 90 11595 --1164
NM_003758chr1541507 1296 599 90 11595 --1164
NM_003760chr11186 ------
NM_003774chr1243117 864 667 614 ------
NM_003783chr131164 1079 23 ------
NM_003787chr1811527 ------
NM_003795chr61562 ------
NM_003800chr621893 415 31953 904 515 ----
NM_003812chr2193 --1213 --
NM_003819chr11114 ------
NM_003822chr172985 2926 1990 1263 628 209 177 11274 1794 --
NM_003831chr1821785 521 ----162
NM_003861chr1432916 2203 736 ------
NM_003877chr12----1674 --
NM_003878chr8128 ------
NM_003884chr331258 724 624 --21788 1404 --
NM_003885chr1742321 2196 2077 1852 --1817 --
NM_003895chr2161965 1819 1804 1543 1506 1483 --1629 --
NM_003913chr663236 1422 1344 876 331 103 1597 ----
NM_003930chr742563 1930 1641 1598 --2600 41 --
NM_003931chr6----141 --
NM_003932chr2241902 1665 404 151 ------
NM_003957chr111719 ------
NM_003972chr10164 ------
NM_003980chr62559 502 ------
NM_003994chr1253651 3130 1606 648 618 --1654 --
NM_003998chr42699 30 ------
NM_004006chrX21796 404 1610 ----
NM_004007chrX21796 404 1610 ----
NM_004009chrX21796 404 1610 ----
NM_004010chrX21796 404 1610 ----
NM_004011chrX21796 404 1610 ----
NM_004012chrX21796 404 1610 ----
NM_004013chrX21796 404 1610 ----
NM_004014chrX21796 404 1610 ----
NM_004015chrX21796 404 1610 ----
NM_004016chrX21710 318 1524 ----
NM_004017chrX21796 404 1610 ----
NM_004018chrX21710 318 1524 ----
NM_004020chrX21796 404 1610 ----
NM_004021chrX21710 318 1524 ----
NM_004022chrX21710 318 1524 ----
NM_004023chrX21710 318 1524 ----
NM_004028chr1873432 3250 840 808 722 235 25 --11426 13685
NM_004067chr731279 551 465 ------
NM_004075chr122632 527 ------
NM_004081chrY2655 397 ------
NM_004094chr1452773 2681 2532 394 356 --12245 --
NM_004100chr632670 2011 627 1264 ----
NM_004105chr22991 762 ------
NM_004136chr1552449 2311 2159 1154 747 ------
NM_004161chr211353 --11208 11004
NM_004171chr11128197 7573 7074 6739 6376 3841 2865 2553 1878 1419 522 387 32041 1843 866 28711 2260 --
NM_004225chr83969 475 75 --1208 11461
NM_004227chr772860 874 417 390 369 203 110 ------
NM_004229chrX12001 ------
NM_004232chr1813821 ------
NM_004235chr93807 728 646 --1785 --
NM_004249chr4132 ------
NM_004261chr13666 396 177 146 --1276
NM_004274chr1422862 167 ----11204
NM_004285chr196427 6374 6232 6155 6077 5401 5263 5154 5132 24284 864 --14298
NM_004296chr1442929 2666 1567 399 23795 3593 23750 1284 --
NM_004311chr104838 719 646 83 1953 ----
NM_004331chr81643 --1274 1419
NM_004338chr1865853 2493 1685 211 168 124 26231 118 15155 --
NM_004389chr22826 329 ------
NM_004432chr932242 2214 567 ------
NM_004434chr1441878 1344 1191 600 ------
NM_004438chr243286 2603 1207 1038 1662 ----
NM_004439chr4150 ------
NM_004441chr331180 947 291 ------
NM_004442chr171743 1546 1395 573 492 418 134 1179 ----
NM_004447chr123960 711 134 ------
NM_004457chr23465 171 88 ------
NM_004458chrX32454 2072 836 ------
NM_004459chr1732016 1283 774 ------
NM_004504chr222729 1074 11219 ----
NM_004505chr1722041 233 ----1489
NM_004525chr211325 ------
NM_004529chr921360 210 ------
NM_004535chr20----11520 --
NM_004538chrX1716 ------
NM_004571chr2172773 2631 1140 841 508 499 46 ------
NM_004586chrX32034 465 92 --14650 --
NM_004595chrX134 --1150 --
NM_004598chr531310 1289 1248 ----12959
NM_004600chr121056 468 ------
NM_004612chr954326 3992 3646 3413 1506 --11256 --
NM_004620chr112634 78 1160 ----
NM_004657chr221378 39 ----1566
NM_004670chr10------11679
NM_004673chr121288 286 ------
NM_004697chr921030 1016 162 1378 --
NM_004703chr175905 608 438 206 171 11699 11900 --
NM_004709chrX11751 11787 --11671
NM_004725chr101227 11513 11045 --
NM_004726chrX65036 4674 4642 3745 1516 301 --32273 2148 1018 --
NM_004730chr561781 1343 709 637 368 228 ------
NM_004731chr1231891 1187 146 ------
NM_004744chr433144 1145 570 1461 ----
NM_004745chr8106185 6171 5619 5076 4332 2820 2273 2050 804 400 14368 ----
NM_004748chr15104225 3595 3234 3228 1376 1025 927 593 496 142 --1184 --
NM_004774chr1753168 2131 942 749 66 ----1497
NM_004776chr2042885 419 252 164 ----1457
NM_004800chr131244 ------
NM_004801chr241367 1305 1288 477 ------
NM_004815chr143829 3598 589 292 14951 ----
NM_004820chr8----185 --
NM_004834chr253326 2461 1270 298 121 13282 12484 --
NM_004840chrX52044 893 749 512 482 ------
NM_004849chr631303 497 122 ----11523
NM_004857chr1441557 1300 966 588 188 13147 --
NM_004859chr1742350 2254 1970 376 1955 ----
NM_004869chr18--21359 445 11523 --
NM_004896chr1021123 293 ------
NM_004904chr776608 6567 6310 4622 4193 2564 738 --12232 1879
NM_004926chr1421702 1480 ------
NM_004929chr811058 21463 1070 1344 --
NM_004932chr53615 609 188 ------
NM_004951chr134320 203 176 34 ------
NM_004956chr724588 967 11288 14121 --
NM_004966chr102884 191 ------
NM_004973chr611617 ------
NM_004992chrX88459 7378 2939 2775 1864 1034 134 29 18391 --12121
NM_004992chrX88459 7378 2939 2775 1864 1034 134 29 18391 --12121
NM_004999chr621090 172 11431 11481 --
NM_005014chr92240 70 ------
NM_005044chrX54020 3829 3801 3091 74 ------
NM_005056chr1221842 1196 14309 15078 --
NM_005058chrY150 ------
NM_005095chr12690 398 1453 --1162
NM_005096chrX1276 ------
NM_005097chr10------197
NM_005109chr322015 222 12361 ----
NM_005112chr41832 ------
NM_005114chr42582 571 ------
NM_005119chr111314 ------
NM_005125chr11------1143
NM_005131chr18186 ------
NM_005135chr1563180 759 493 481 265 201 12606 ----
NM_005153chr161696 ------
NM_005168chr22556 57 1254 ----
NM_005197chr1466002 5223 5095 1891 1782 527 ------
NM_005206chr172528 428 ----164
NM_005219chr551740 1207 562 443 44 ------
NM_005233chr382328 2238 1700 1645 720 443 136 67 ------
NM_005235chr2117896 7762 6673 6400 6360 6220 5112 4847 2883 1235 1165 36845 5984 1672 ----
NM_005238chr1132774 2297 224 --1978 --
NM_005249chr143760 751 356 --1783 --
NM_005257chr1811019 ------
NM_005259chr221103 140 ------
NM_005263chr15994 955 443 287 21 --1783 --
NM_005278chrX2457 123 1511 ----
NM_005296chrX21097 906 ------
NM_005311chr7102804 2699 2663 2631 2448 2273 2201 2180 1928 524 31736 586 169 ----
NM_005316chr111237 1223 1802 --
NM_005324chr1731611 734 482 ------
NM_005339chr432998 1629 181 ------
NM_005359chr1856190 4748 1881 1134 151 ------
NM_005399chr184350 4319 2834 1686 1293 909 851 354 ------
NM_005400chr263040 2290 2024 361 276 222 --13025 --
NM_005402chr71570 ------
NM_005410chr53725 289 112 ------
NM_005431chr751547 1507 1323 1287 41 ------
NM_005458chr982462 2400 2300 2238 871 739 561 262 ------
NM_005475chr1263266 3211 2322 953 689 425 --13055 --
NM_005497chr1764601 4172 2127 1004 448 81 ------
NM_005502chr932431 837 112 --12720 --
NM_005504chr1255456 1368 1355 360 184 --15971 --
NM_005523chr71546 ------
NM_005530chr1521318 249 ------
NM_005537chr1321000 937 1693 ----
NM_005565chr51570 ----122
NM_005570chr1831184 1084 348 ------
NM_005573chr51124 ------
NM_005578chr354066 1874 1727 1411 1039 13963 ----
NM_005582chr5127 ------
NM_005584chr133281 100 61 ------
NM_005596chr9105489 5272 4093 2311 2292 2267 2217 1393 1297 1211 35736 5676 1632 --16288
NM_005602chr331237 331 321 ------
NM_005613chr142227 1902 839 250 ------
NM_005614chr72406 54 21013 173 11066 --
NM_005618chr6----1587 --
NM_005647chrX113283 3209 3111 2888 2871 2639 2628 2459 216 205 189 ------
NM_005668chr564420 3525 3446 1159 735 301 ------
NM_005686chr111482 ------
NM_005688chr321187 200 ------
NM_005725chr141661 828 565 47 ------
NM_005738chr721992 1822 1531 ----
NM_005746chr722273 512 --12350 --
NM_005759chr234578 178 162 52946 2898 1554 583 107 ----
NM_005766chr1321377 1191 1273 11325 1469
NM_005786chr1831179 805 41 --1874 --
NM_005795chr263031 2459 1969 997 538 347 ------
NM_005822chr632276 841 402 11735 ----
NM_005832chr341463 1431 910 159 ------
NM_005833chr91140 ------
NM_005840chrX56990 6690 5592 2632 251 16510 22237 1028 --
NM_005842chr13------1722
NM_005843chr221393 1305 ------
NM_005848chr15121 ------
NM_005853chr161160 ------
NM_005863chr1011141 21433 1416 1362 --
NM_005875chr3----191 --
NM_005900chr4------1881
NM_005901chr1898287 8159 7214 3331 2051 1996 1454 1081 412 ------
NM_005902chr1583927 3621 1640 1162 1142 533 438 163 --13127 11203
NM_005903chr534590 1806 692 ------
NM_005904chr1851400 1392 520 463 98 11499 1938 --
NM_005937chr1744147 3995 3954 251 --1280 --
NM_005941chr873722 3634 3361 2896 2596 1238 397 --13103 --
NM_005955chr154703 4453 3866 1086 129 ------
NM_005964chr1741440 1111 529 85 ------
NM_005966chr242171 2135 1624 1519 ------
NM_005994chr171645 ------
NM_006007chr932807 606 197 --14345 --
NM_006016chr631927 766 324 22027 400 ----
NM_006037chr254420 942 456 244 228 1980 23012 1283 13168
NM_006047chr2063484 3130 2843 2835 2815 2637 1268 ----
NM_006048chr151251 490 111 103 53 --1142 --
NM_006051chr51296 ------
NM_006055chr263103 2603 2152 1153 598 440 ------
NM_006079chr63671 335 132 ------
NM_006094chr842181 2023 757 729 ------
NM_006095chr464482 3965 1453 720 640 280 --1234 --
NM_006106chr1133203 1222 116 ----1798
NM_006113chr141568 670 543 287 ------
NM_006141chr1641758 1712 778 251 ----1327
NM_006154chr1562717 2584 2486 2078 706 482 11933 ----
NM_006157chr111293 ------
NM_006178chr172414 399 ----11608
NM_006194chr1411264 ------
NM_006203chr584921 4822 4033 4018 3999 2072 1020 999 14473 --12168
NM_006218chr31264 ------
NM_006226chr211347 ------
NM_006246chr1451201 949 923 360 223 ------
NM_006251chr532620 2409 62 ----12661
NM_006252chr176407 6035 5612 2920 2780 2418 310 26276 288 --11518
NM_006256chr142708 2521 2322 1054 12255 1458 12788
NM_006265chr811374 ------
NM_006275chr203778 592 583 ------
NM_006281chr83955 800 400 ------
NM_006281chr83955 800 400 ------
NM_006283chr864662 4140 3475 3354 1387 327 13731 ----
NM_006292chr111189 ------
NM_006313chr1221629 327 ------
NM_006315chr464303 4284 3691 2741 706 524 34476 3706 3486 --13772
NM_006321chr31357 ----11716
NM_006330chr841182 261 118 57 ------
NM_006345chr421355 1043 ------
NM_006350chr51347 ------
NM_006352chr131729 1610 472 ------
NM_006359chrX42401 2085 1562 838 ----1652
NM_006361chr1722023 1736 ------
NM_006364chr1431114 1050 320 ------
NM_006366chr611302 ------
NM_006371chr324428 1915 ------
NM_006375chrX41312 1262 1171 598 1542 ----
NM_006386chr2251951 1747 967 953 31 ----1854
NM_006393chr1074552 4102 3922 3509 1121 722 487 ----14494
NM_006410chr111474 ----1394
NM_006413chr1041475 1222 1016 273 1162 ----
NM_006415chr941139 1006 829 127 ------
NM_006434chr1053164 2640 2222 1053 221 ------
NM_006454chr4102715 2660 2648 2496 1902 776 712 657 319 305 ------
NM_006466chr202732 99 ----137
NM_006489chr1421922 1516 ----1118
NM_006496chr111850 11518 11478 --
NM_006526chr201429 ------
NM_006534chr2053038 2820 2499 686 634 23186 44 ----
NM_006546chr1766359 6191 2470 1632 1165 254 --14169 1522
NM_006547chr752096 1970 795 701 544 ------
NM_006548chr341718 380 96 72 ------
NM_006558chr81431 ------
NM_006560chr111506 ------
NM_006561chr1055942 4935 4611 2357 772 --1655 --
NM_006565chr163313 196 49 ------
NM_006566chr182481 473 --1926 --
NM_006575chr1421475 1257 124 --1123
NM_006593chr21226 ------
NM_006595chr1111828 ------
NM_006597chr11171 ------
NM_006599chr16138268 7360 7348 6864 6783 5776 2926 2715 2345 1126 554 299 118 12201 ----
NM_006603chrX41960 553 191 175 11571 ----
NM_006609chr262915 2441 806 768 677 640 ------
NM_006614chr332865 2490 441 ------
NM_006618chr111126 --1112 --
NM_006624chr1031996 1513 259 ------
NM_006646chr1342446 2328 328 198 ------
NM_006654chr1244462 4358 3229 1134 ------
NM_006667chrX1458 ------
NM_006682chr742160 1896 1820 217 12625 ----
NM_006696chr5147 ------
NM_006706chr51760 ------
NM_006708chr61904 ------
NM_006717chr952628 2129 599 345 109 --12808 --
NM_006718chr621086 236 ------
NM_006720chr1074836 3734 3692 1102 605 157 98 --24895 2006 1647
NM_006722chr352432 2074 537 368 199 12913 ----
NM_006726chr42842 288 ------
NM_006727chr5------1349
NM_006729chrX85367 4007 1724 1523 1501 1486 873 653 15131 ----
NM_006734chr61596 ------
NM_006742chr1611997 --11976 --
NM_006749chr8123 1445 1391 --
NM_006750chr16127692 7483 6473 6358 5554 2903 2878 2780 1381 1083 853 124 12891 --12809
NM_006761chr17----1319 --
NM_006763chr142123 1875 782 350 ------
NM_006775chr641944 1936 784 659 1914 1312 --
NM_006777chrX62723 1113 888 569 157 84 1522 ----
NM_006788chr1841818 1641 1589 1534 1818 11451 --
NM_006806chr211419 ------
NM_006807chr1721327 1310 ------
NM_006827chr1423166 1266 --12381 --
NM_006832chr141252 ------
NM_006835chr4130 ------
NM_006838chr121156 --1509 --
NM_006846chr51283 ------
NM_006868chr1853019 2687 2602 942 445 ------
NM_006870chr205718 214 149 127 70 ------
NM_006888chr1432692 2567 398 12820 12747 --
NM_006893chr1187 ------
NM_006895chr222225 132 11484 ----
NM_006898chr21673 ------
NM_006910chr161410 ------
NM_006915chrX31637 1625 1565 21810 1614 --1517
NM_006920chr261944 1420 770 758 296 168 ----1459
NM_006922chr262187 1731 1024 954 759 715 1488 ----
NM_006924chr1753377 1761 1715 1108 592 --24383 1058 --
NM_006939chr142986 268 ------
NM_006981chr972281 2071 1841 1104 999 534 485 11849 --1701
NM_006988chr212185 171 ------
NM_006997chr101386 ------
NM_006999chr541824 780 208 41 ----11941
NM_007006chr1632753 577 181 --13463 1871
NM_007007chr124738 378 295 149 ------
NM_007008chr21827 ------
NM_007010chr1751721 1646 1546 1378 413 ------
NM_007011chr1575288 4793 4388 2599 2093 736 516 --26375 4986 --
NM_007013chr82879 395 ------
NM_007030chr555133 3615 932 371 103 62084 2053 1991 1960 1929 1898 ----
NM_007038chr21116129 5470 5280 5164 5096 4940 4717 2092 1966 1588 1021 ------
NM_007050chr20127233 6537 5987 5563 5381 5012 2854 2752 2684 1596 1110 336 ------
NM_007106chr1332802 860 108 1611 ----
NM_007124chr6----21352 59 --
NM_007125chrY1395 ------
NM_007137chrX54155 2050 1549 912 535 11421 ----
NM_007146chr1762923 2095 1842 810 360 83 ------
NM_007158chr111169 ------
NM_007166chr11------11139
NM_007172chr2273352 3154 2970 2054 985 764 535 2822 471 ----
NM_007176chr1411137 ------
NM_007191chr121647 ------
NM_007195chr1831328 416 112 ------
NM_007203chr953117 936 701 298 102 ------
NM_007207chr12743 701 ------
NM_007214chr61385 ----1240
NM_007217chr31374 ------
NM_007242chr16------1169
NM_007249chr13128873 8732 8348 8212 7503 7096 6401 5719 3557 2788 1564 483 --28878 6569 18934
NM_007294chr1741376 1360 511 265 ------
NM_007295chr1741376 1360 511 265 ------
NM_007296chr1741376 1360 511 265 ------
NM_007297chr1741376 1360 511 265 ------
NM_007298chr1741376 1360 511 265 ------
NM_007299chr1741376 1360 511 265 ------
NM_007300chr1741376 1360 511 265 ------
NM_007302chr1741376 1360 511 265 ------
NM_007303chr1741376 1360 511 265 ------
NM_007304chr1741376 1360 511 265 ------
NM_007305chr1741376 1360 511 265 ------
NM_007325chrX52091 1816 1656 1632 205 ------
NM_007331chr412521 ------
NM_007350chr1264523 3959 3564 3428 2839 1752 --24485 3381 --
NM_007358chr121609 351 ------
NM_007373chr101593 ------
NM_007375chr13956 556 256 ------
NM_012064chr1271135 1035 1017 946 813 712 202 ------
NM_012069chrX52484 2369 935 923 285 ------
NM_012072chr2054186 2909 1321 803 118 ------
NM_012081chr553193 832 449 416 122 22678 62 ----
NM_012089chr141436 1362 1206 503 1332 ----
NM_012090chr131291 328 270 ------
NM_012092chr211517 ----1378
NM_012096chr342995 1056 471 249 11120 ----
NM_012104chr1143810 1542 572 128 ------
NM_012104chr1143810 1542 572 128 ------
NM_012120chr633021 864 228 ----1118
NM_012129chr722475 1623 ------
NM_012141chr1353381 2660 816 464 126 13796 --12965
NM_012158chr132507 373 --139 --
NM_012161chr431114 1095 183 ------
NM_012175chr111953 ------
NM_012193chr1145281 4642 1416 188 14603 1950 14399
NM_012214chr295797 5587 5528 4999 4972 3897 2025 600 572 11171 21805 1631 --
NM_012215chr103778 614 197 ------
NM_012234chr333637 3271 1411 ------
NM_012244chr141155 ------
NM_012249chr263574 3202 2572 965 546 489 1884 --153
NM_012252chr754912 3983 3582 1009 550 21579 352 --15019
NM_012262chr144340 3537 800 213 ------
NM_012286chrX143 ------
NM_012288chr655423 4661 2189 2096 795 15749 15508 --
NM_012293chr272315 2216 1768 826 582 418 83 --1524 --
NM_012297chr442202 1767 1729 702 ----11777
NM_012300chr552112 1869 1652 278 67 --12244 --
NM_012302chr121195 497 ------
NM_012309chr11114781 4438 4343 4007 3896 3587 3458 3151 712 354 26 181 ----
NM_012316chr175569 5522 5428 3928 3593 864 635 --1453 --
NM_012343chr53443 401 61 ------
NM_012345chr131169 ------
NM_012347chr622422 955 --13014 --
NM_012388chr1522590 483 22486 886 23045 161 --
NM_012402chr111882 ------
NM_012414chr12682 212 ------
NM_012428chr152782 204 ------
NM_012433chr2173 ------
NM_012448chr1712181 --1975 --
NM_012463chr1231484 243 225 11851 ----
NM_012464chr44735 458 393 87 22283 609 ----
NM_012471chrX21585 450 ------
NM_012479chr712762 ------
NM_013229chr1212587 21928 174 12169 1236
NM_013233chr221300 1179 --1239 --
NM_013248chr202224 59 ------
NM_013261chr483089 2976 1216 952 925 671 423 412 23273 3057 ----
NM_013281chr2051504 1480 610 269 22 ------
NM_013302chr1663805 3778 3550 3494 1639 1168 14097 33344 2999 36 --
NM_013309chr1562628 1955 1855 998 888 70 ------
NM_013322chr741743 246 233 38 ------
NM_013341chr232896 2751 2013 ------
NM_013372chr1532394 2128 238 13044 1576 --
NM_013374chr322784 820 ----1682
NM_013386chr11253 ------
NM_013411chr152670 2015 2002 863 548 ------
NM_013438chr92430 364 --11737 --
NM_013943chr112691 12285 --13226
NM_013956chr81103 ------
NM_013957chr81103 ------
NM_013960chr81779 ------
NM_013964chr81103 ------
NM_013989chr1464566 4371 2007 1845 1309 171 ------
NM_014000chr1041934 1841 419 257 ------
NM_014007chr9160 ------
NM_014011chr262283 1692 961 596 560 71 ------
NM_014023chr1042160 2019 1791 675 1777 ----
NM_014048chr16104627 4318 3974 3840 3557 3289 1784 1713 1432 394 ------
NM_014055chr121531 ------
NM_014106chr1542642 1930 1190 245 12777 ----
NM_014112chr885458 5139 5123 3749 1641 933 600 219 11734 21716 1633 14274
NM_014141chr785254 4742 4673 4497 4428 4091 2044 1358 11965 13540 --
NM_014142chr10------134
NM_014155chr1177174 5515 5190 4606 2371 666 92 ------
NM_014166chr132105 76 11160 ----
NM_014181chr252785 2303 594 268 112 --11026 --
NM_014217chr121701 1594 ------
NM_014243chr461880 1797 1492 1440 1381 460 1530 ----
NM_014264chr42587 433 --2652 496 --
NM_014271chrX1644 ------
NM_014283chr131023 564 463 ------
NM_014309chr2254769 3761 3278 693 386 11558 --14079
NM_014314chr921402 363 1163 ----
NM_014315chr14153 ------
NM_014319chr1221800 1450 11319 ----
NM_014350chr511043 --1255 --
NM_014361chr11----1194 --
NM_014372chr121773 676 ----11918
NM_014392chr471607 1165 1029 422 371 145 39 11243 ----
NM_014393chr822292 822 ------
NM_014395chr421844 1333 21795 84 11418 --
NM_014415chr311464 ------
NM_014445chr321965 363 ----11894
NM_014447chr441676 1463 553 187 ------
NM_014454chr62996 280 ------
NM_014458chr121364 122 ------
NM_014469chr113746 539 325 ------
NM_014476chr41383 --1170 --
NM_014491chr74823 798 714 177 --1364 --
NM_014500chrX1212 ------
NM_014516chr191228 ------
NM_014574chr1421464 1438 ------
NM_014592chr51768 ------
NM_014607chr252129 1735 1540 1320 466 ------
NM_014612chr911121 ------
NM_014616chr372839 2559 2305 1143 969 562 145 ------
NM_014652chr1160 ------
NM_014660chr7----1386 --
NM_014670chr23396 128 31 11021 ----
NM_014677chr85994 880 870 544 71 ------
NM_014679chr1121231 274 ------
NM_014682chr852208 1940 1878 616 45 21916 1628 11465 --
NM_014700chr1611303 ------
NM_014701chr1542228 835 522 286 ----12985
NM_014705chr711514 2839 326 1813 --
NM_014707chr731965 1520 599 --1717 1703
NM_014711chr1631827 1578 1292 ------
NM_014717chr191637 ------
NM_014721chr6107439 6694 6211 5992 5751 5198 5163 2953 1003 854 15704 ----
NM_014729chr842284 794 692 531 ------
NM_014735chrX32117 1845 1589 ------
NM_014736chr151707 ------
NM_014755chr284168 3956 3945 3664 3619 770 661 602 --12647 --
NM_014781chr821070 1041 11319 ----
NM_014795chr211101 ------
NM_014810chr1103479 3420 3336 3238 3207 2870 2717 868 474 22 ------
NM_014819chr54983 369 72 48 1552 ----
NM_014826chr154151 3723 3604 887 312 13217 1454 --
NM_014830chr1243832 3464 2416 990 13560 ----
NM_014832chr1331903 757 337 ------
NM_014836chr1031685 774 538 ------
NM_014839chr141927 990 486 298 ------
NM_014848chr1582791 2597 2374 1136 834 751 696 301 1825 ----
NM_014849chr11161 ------
NM_014864chr152680 897 732 477 68 23491 1276 ----
NM_014868chr121895 ------
NM_014871chr122625 468 ------
NM_014873chr173628 3160 1090 781 433 250 80 --14365 --
NM_014877chr1787336 5120 2522 2101 1791 1777 1661 440 --26201 1799 --
NM_014883chr432567 2545 437 --1484 --
NM_014892chr62232 198 ------
NM_014897chr1732956 2415 1208 ------
NM_014903chr1252406 1515 573 534 347 --12433 --
NM_014905chr251717 1439 1366 399 373 ------
NM_014914chr251266 1156 948 474 416 ------
NM_014920chr643446 3185 2409 104 --12514 --
NM_014923chr132261 183 42113 1894 1784 1562 ----
NM_014932chr311381 21426 1305 --148
NM_014946chr242839 2703 2311 685 1521 1183 --
NM_014962chr2052913 2026 986 280 80 ------
NM_014989chr612063 ------
NM_014996chr34775 346 226 98 ----1398
NM_015000chr1242352 2152 1087 424 ------
NM_015009chr33761 674 132 ------
NM_015018chr6----1151 --
NM_015025chr2------11088
NM_015026chr121756 ------
NM_015027chr1621579 1556 ------
NM_015032chr1362711 2621 2488 2145 925 629 ------
NM_015035chr2066601 4802 1431 198 191 144 --36463 4431 4200 --
NM_015046chr972781 2674 1856 859 799 323 44 22419 2153 ----
NM_015049chr263299 3114 1075 951 533 183 ------
NM_015051chr932735 2395 66 1275 ----
NM_015057chr132662 571 1217 ----
NM_015068chr752957 2842 2413 756 397 ------
NM_015071chr545013 4895 1454 316 ----12498
NM_015074chr164929 4737 4452 3352 3088 993 --11537 --
NM_015076chr643115 1539 592 87 13139 ----
NM_015087chr1351825 1776 1008 852 348 11641 168 --
NM_015090chr1126258 5507 5051 5004 4801 4570 3813 2049 1519 1504 1392 74 ------
NM_015091chr143687 104 53 ------
NM_015093chr631836 1314 605 ------
NM_015100chr121372 1268 --1343 --
NM_015113chr1721943 57 ----12408
NM_015115chr433179 2763 2070 ------
NM_015116chr1361340 1068 657 145 86 22 ------
NM_015130chr431406 999 430 11354 ----
NM_015135chr71139 ------
NM_015155chr1073285 3167 2819 2075 1167 652 329 150 13009 --
NM_015156chr1443760 2949 2669 1355 ------
NM_015170chr852076 1516 846 374 22 --1931 --
NM_015184chr31182 ------
NM_015192chr2052618 1136 514 267 256 1817 ----
NM_015199chr332624 2057 429 ----12900
NM_015200chr442343 689 280 79 ------
NM_015205chr13124390 4294 4285 4110 3710 3575 3568 3511 1944 1820 1507 966 23692 3557 14665 --
NM_015206chr1563818 3102 1563 957 937 127 ------
NM_015208chr1893749 3623 3244 2854 2819 1568 1150 257 138 ------
NM_015209chr172309 1923 1916 1821 813 721 224 ----164
NM_015213chr111629 ------
NM_015215chr112233 1938 1676 --
NM_015231chr113765 381 301 ------
NM_015233chr1331993 1742 815 --1210 --
NM_015250chr941908 1502 1306 1280 --11412 --
NM_015251chr161153 ------
NM_015263chr1531052 284 253 ------
NM_015267chr1231963 694 187 11852 --12202
NM_015271chr483490 3347 3130 2728 1301 687 604 292 --1901 --
NM_015275chr1221386 274 ------
NM_015288chr533241 1509 296 22909 480 13884 --
NM_015299chr1432999 965 954 ------
NM_015308chr112818 241 ------
NM_015310chr857842 7323 7214 5798 3285 ------
NM_015313chr1184673 1941 1656 1321 965 844 700 273 ------
NM_015317chr221141 564 ------
NM_015335chr1232487 1764 80 ------
NM_015336chr1242406 1880 307 168 ------
NM_015347chr1242034 1027 750 223 22648 650 ----
NM_015349chr622197 455 22438 407 22341 90 --
NM_015355chr1731801 1553 269 22002 1538 ----
NM_015358chr2141347 1201 402 140 ------
NM_015365chrX93828 3457 3367 2856 2691 1036 837 765 40 12793 ----
NM_015375chr123778 1863 1283 23570 341 11473
NM_015378chr162919 2754 2469 854 159 41 ------
NM_015385chr1053164 2640 2222 1053 221 ------
NM_015393chr442877 2688 2632 2498 ----13642
NM_015423chr1121569 147 ----1369
NM_015446chr141605 1447 622 119 1571 ----
NM_015455chr553944 3840 3363 527 40 11545 ----
NM_015460chr321799 481 ------
NM_015475chr241038 835 790 297 ------
NM_015508chr341476 1166 1148 360 ------
NM_015520chr342394 2058 944 132 ------
NM_015532chr1562348 1876 1135 1001 781 535 1296 ----
NM_015535chr233981 3732 3122 13265 11669 --
NM_015550chr763401 3379 3131 2282 1069 177 ------
NM_015555chr63215 179 103 1367 ----
NM_015565chr2132020 913 704 ------
NM_015569chr153821 1851 1459 1189 343 14084 13840 --
NM_015570chr761844 1566 706 526 469 46 ------
NM_015576chr352384 1931 1879 993 983 ------
NM_015577chr52704 691 ------
NM_015589chr141167 ------
NM_015630chr21754 ------
NM_015660chr71207 ------
NM_015690chr21588 ------
NM_015852chr7123471 1148 1064 980 896 812 728 644 429 308 224 140 --11229 13237
NM_015878chr832119 1941 404 ------
NM_015879chr18148553 7649 7345 7073 6743 6736 6534 6410 5672 1810 1493 848 650 26 ------
NM_015886chr875721 5694 1860 1669 996 864 824 --13645 --
NM_015888chr133222 760 673 12859 --12705
NM_015906chr184869 3174 1781 1590 1345 941 919 299 ------
NM_015912chr842220 2165 483 182 11955 ----
NM_015915chr142131 72 ------
NM_015948chr61414 ------
NM_015975chrX31470 165 156 ------
NM_015990chr42735 359 ------
NM_016009chr144066 3282 1531 315 21966 543 ----
NM_016018chr842266 2092 1776 208 12871 --1217
NM_016072chr1272062 1629 856 850 528 212 152 ------
NM_016131chr221721 329 --1893 --
NM_016132chr1572784 2743 2184 1298 1242 652 629 11188 ----
NM_016133chr21206 ------
NM_016141chr3147 ------
NM_016144chr51638 ------
NM_016156chr1142363 1569 1524 944 --1293 --
NM_016162chr121643 ------
NM_016206chr388300 7944 6285 6020 5518 3469 1678 594 28665 844 ----
NM_016227chr131023 564 463 ------
NM_016235chr163469 274 252 ------
NM_016252chr22938 179 ------
NM_016255chr623273 395 1331 --1228
NM_016260chr267309 7031 4731 684 461 87 --14824 --
NM_016271chr181375 ------
NM_016275chr342625 2197 291 96 12745 ----
NM_016281chr121785 ------
NM_016289chr21657 --1282 --
NM_016308chr131586 1320 471 1227 ----
NM_016315chr231869 592 513 1733 ----
NM_016319chr12----1172 --
NM_016351chr72393 82 ------
NM_016374chr121584 1552 --1262 --
NM_016374chr121584 1552 --1262 --
NM_016433chr1251491 1227 1121 1066 57 ------
NM_016436chr2052698 2109 895 308 213 ------
NM_016454chr151284 ------
NM_016467chr251287 1168 408 396 69 ------
NM_016483chr31308 ------
NM_016492chr171109 ------
NM_016513chr643446 3185 2409 104 --12514 --
NM_016531chr474020 3431 3268 2742 1046 302 253 13316 ----
NM_016544chr263918 3526 3224 1010 414 36 --12546 --
NM_016577chr384209 3937 3444 3122 2914 1464 479 365 ------
NM_016605chr592652 2339 2267 2261 1042 1008 226 191 153 ------
NM_016607chrX141 ------
NM_016618chr21130 ------
NM_016628chr101331 ------
NM_016631chr212650 419 ----1286
NM_016651chr141960 ------
NM_016816chr121346 ------
NM_016950chr411369 ------
NM_016953chr275658 5315 4801 3984 976 919 551 --1627 --
NM_017413chrX----1863 1997
NM_017420chr1451483 1152 561 372 42 --12728 12824
NM_017423chr411799 ------
NM_017437chr1452438 1651 1556 808 318 22091 175 1166 --
NM_017447chr2154043 3917 3378 332 57 ------
NM_017449chr171743 1546 1395 573 492 418 134 1179 ----
NM_017455chr152782 204 ------
NM_017491chr41832 ------
NM_017519chr61342 ------
NM_017526chr12573 177 ------
NM_017540chr573036 2542 2048 2037 1067 113 51 ------
NM_017548chr351834 1557 1543 252 106 ------
NM_017551chr1032683 819 272 --11049 --
NM_017563chr365517 4455 4375 3869 2285 361 --11462 --
NM_017610chr15----11394 --
NM_017628chr455320 5093 4078 3905 1694 ----14410
NM_017633chr653774 1337 961 689 562 22532 577 13631 --
NM_017635chr1141380 1318 551 177 ------
NM_017637chr9188471 7762 7727 7061 6700 6631 6526 6004 3368 2949 2930 2637 2584 1811 1606 1389 958 23 17008 28696 2910 --
NM_017643chr1763046 2849 2822 2188 1929 1216 1393 --1376
NM_017644chr364189 4043 3487 1918 1588 1414 12030 ----
NM_017650chr755291 4239 1042 842 593 15923 ----
NM_017657chr21220 ------
NM_017664chr132949 134 11015 ----
NM_017694chr241563 678 603 190 1743 ----
NM_017719chr352535 2513 2055 893 718 ------
NM_017737chr151696 870 625 547 126 ------
NM_017738chr92448 247 --129 --
NM_017761chr141268 1002 985 373 ------
NM_017762chr1541921 1564 949 344 ------
NM_017813chr885668 5447 5405 1918 1565 1543 1303 502 25823 2040 ----
NM_017824chr1092710 2688 2229 2108 1806 515 343 309 253 32404 541 525 ----
NM_017847chr122261 2183 22042 739 ----
NM_017856chrX51692 1456 588 517 362 ------
NM_017880chr22127 105 ------
NM_017902chr1085750 5512 5233 3917 1283 900 843 83 ------
NM_017910chr21279 ------
NM_017919chr945768 4578 1266 503 13657 ----
NM_017922chr14275 24 ------
NM_017933chr22515 322 ------
NM_017944chr1151976 1968 321 300 205 --13067 --
NM_017988chr125943 912 637 368 307 ------
NM_018027chr1042975 2720 824 182 ------
NM_018036chr1473449 3107 1381 894 697 575 437 --23915 3480 --
NM_018061chr111082 ----11695
NM_018078chr42992 769 ------
NM_018084chr242306 1199 547 451 --1779 --
NM_018085chr1117946 7745 7558 7525 5283 5180 3094 2954 2206 1035 46 33137 2893 907 26595 5672 --
NM_018099chr124265 183 110 58 ------
NM_018105chr821146 864 ------
NM_018121chr1052720 2676 2435 2415 897 --1116 12331
NM_018133chr321934 634 ------
NM_018147chr33228 222 196 ------
NM_018149chr17----1185 --
NM_018151chr21621 ------
NM_018156chr162919 2754 2469 854 159 41 ------
NM_018157chr1232045 669 468 ----1442
NM_018169chr121462 ------
NM_018211chr152192 2099 746 693 475 ------
NM_018214chr61258 ------
NM_018227chr483190 2739 2347 1139 1117 736 672 424 ------
NM_018234chr252293 2199 897 141 105 --1720 --
NM_018247chr663113 2771 2134 832 806 21 ------
NM_018257chr2042539 2385 2302 2161 --196 --
NM_018293chr332484 842 425 ------
NM_018299chr843177 2259 1200 965 ------
NM_018313chr312237 --12355 --
NM_018318chr121294 --1903 --
NM_018327chr2051707 1329 734 334 310 11319 --1341
NM_018332chr16------1169
NM_018362chr1121325 253 --13943 --
NM_018364chr153810 3566 1572 1546 137 12501 ----
NM_018373chr1486241 5832 5306 5048 4724 4080 526 500 25516 225 26052 653 16424
NM_018388chrX61262 1147 1133 1051 149 133 --11153 11243
NM_018394chr331087 158 27 ------
NM_018398chr3----1217 --
NM_018403chr344107 4045 3686 514 ------
NM_018427chr1631244 1117 339 ----11520
NM_018429chr53345 218 211 --1886 --
NM_018439chr1831004 963 639 --1854 --
NM_018444chr832125 1788 302 133 ----
NM_018460chr2169 ------
NM_018469chr1711080 ----1315
NM_018482chr842366 2324 316 276 ------
NM_018489chr122169 2009 --1810 --
NM_018566chr154512 3888 3849 1135 203 1572 11576 --
NM_018569chr441611 1597 1135 41 ------
NM_018593chr6180 ------
NM_018638chr1275188 4552 4298 3755 1535 753 415 21514 1162 --11058
NM_018650chr111686 ------
NM_018685chr731113 958 800 ------
NM_018691chr531239 823 493 ------
NM_018695chr522222 863 ----1940
NM_018703chr161410 ------
NM_018710chr841338 1159 175 149 ------
NM_018844chr722079 434 --11361 --
NM_018846chr71800 ------
NM_018847chr92730 160 1201 11393 --
NM_018898chr551794 697 544 244 52 ------
NM_018899chr551794 697 544 244 52 ------
NM_018900chr551794 697 544 244 52 ------
NM_018901chr551794 697 544 244 52 ------
NM_018902chr551794 697 544 244 52 ------
NM_018903chr551794 697 544 244 52 ------
NM_018904chr551794 697 544 244 52 ------
NM_018905chr551794 697 544 244 52 ------
NM_018906chr551794 697 544 244 52 ------
NM_018907chr551794 697 544 244 52 ------
NM_018908chr551794 697 544 244 52 ------
NM_018909chr551794 697 544 244 52 ------
NM_018910chr551794 697 544 244 52 ------
NM_018911chr551794 697 544 244 52 ------
NM_018948chr1----2418 43 --
NM_018951chr71369 --11155 --
NM_018958chr1523203 2741 ------
NM_018963chr2141302 958 242 53 ------
NM_018976chr1242087 1927 703 53 ------
NM_018993chr201513 ------
NM_018999chr1084249 1754 935 838 653 496 205 160 ------
NM_019022chr1823207 1989 ------
NM_019035chr441919 1589 1467 766 21802 623 ----
NM_019050chr411731 ------
NM_019072chr534245 3603 33 ----13850
NM_019084chr1042543 2508 182 70 1837 ----
NM_019094chr1252952 2702 2664 402 93 11335 ----
NM_019098chr841849 1260 636 119 21601 494 ----
NM_019114chr911869 ------
NM_019556chrX51322 1206 1199 511 362 --1126 --
NM_019558chr21298 ------
NM_019593chr2042916 2478 2432 432 ------
NM_019610chr151755 1484 883 535 326 --32038 551 224 --
NM_019860chr1041557 1392 1125 485 1561 ----
NM_019885chr222753 143 ------
NM_020130chr81954 --1925 --
NM_020132chr21104205 3698 3601 3498 2042 1773 1723 1538 1510 547 --24427 613 --
NM_020141chr131656 732 451 --11935 --
NM_020144chr742157 1578 1409 186 11347 ----
NM_020177chr532798 2393 1019 ------
NM_020198chr1721349 439 --11364 --
NM_020204chr1------1169
NM_020228chr11------12135
NM_020318chr11371 ------
NM_020336chr2053503 3331 2967 920 720 --11461 --
NM_020337chr422870 2815 --12859 13147
NM_020341chr2032051 1691 263 ------
NM_020346chr1141602 1568 94 86 ------
NM_020357chr341523 600 566 353 11599 ----
NM_020371chr153374 343 29 ------
NM_020390chr394811 4721 4542 1873 1471 580 471 296 149 ------
NM_020403chr1341381 543 442 241 ------
NM_020420chrY2655 397 ------
NM_020424chr163144 99 56 ----129
NM_020445chr73592 576 291 ------
NM_020455chr642781 1000 192 183 ------
NM_020463chr231088 999 384 ------
NM_020466chr633216 738 238 ----13178
NM_020473chrX41786 1759 649 322 ------
NM_020532chr21827 ------
NM_020638chr1231572 501 248 --144 --
NM_020640chr331551 1425 544 ------
NM_020647chr821827 101 ----11744
NM_020654chr311254 ------
NM_020666chr52803 91 1788 ----
NM_020673chr2067770 7543 6439 5312 2085 1839 ----17657
NM_020682chr1041147 840 439 100 ------
NM_020690chr51328 ------
NM_020699chr145419 5297 4886 470 1478 ----
NM_020714chr1944335 3399 1297 168 1896 193 --
NM_020718chr16136061 6041 6008 5787 5534 5073 4840 4471 4264 2524 1327 1256 168 14004 ----
NM_020732chr61342 ------
NM_020739chr15104225 3595 3234 3228 1376 1025 927 593 496 142 --1184 --
NM_020747chr53730 307 159 ------
NM_020752chr1062654 2488 1970 1939 575 327 ------
NM_020766chrX64513 4039 1274 699 603 200 ----1717
NM_020769chrX2995 363 ------
NM_020772chr1788175 6748 5364 1921 1886 1770 1131 396 37374 6309 378 ----
NM_020774chr1865470 5288 5156 4636 4260 1830 15125 --15403
NM_020782chr1284760 4514 4161 4080 3079 657 334 232 ------
NM_020787chr1721137 978 1205 ----
NM_020796chr542082 1197 1183 567 ------
NM_020800chr331146 546 445 ------
NM_020801chr531979 1896 625 ------
NM_020806chr142239 221 1141 ----
NM_020808chr11240 ------
NM_020830chr212210 22576 51 12253 1289
NM_020841chr1233133 1190 600 ------
NM_020854chr183445 323 26 ------
NM_020856chr1911482 --1242 --
NM_020858chr1532354 2034 423 21548 688 12249 11747
NM_020860chr4144 ------
NM_020868chr2----1723 11939
NM_020871chrX52576 2080 1724 356 276 ------
NM_020899chr1742560 2043 1804 361 12223 ----
NM_020918chr1033462 3354 795 1786 --127
NM_020921chr1453643 3035 2448 918 833 12236 ----
NM_020926chrX3396 311 43 ------
NM_020927chr1672363 2053 922 627 329 290 88 --11466 --
NM_020935chr273453 3412 3376 3124 3012 1784 649 --13196 --
NM_020940chr1042636 388 120 104 ------
NM_020948chr122864 769 ------
NM_020958chr14----1129 --
NM_020960chr964944 4152 2000 1748 965 947 --25017 1699 --
NM_020962chr1522103 480 ----12051
NM_020981chr21675 ------
NM_020987chr102913 873 ------
NM_021004chr142375 349 ----1366
NM_021007chr272312 2175 1745 1496 184 169 118 1270 ----
NM_021033chr1323494 975 ----12471
NM_021038chr353234 2976 2382 2233 2123 ------
NM_021067chr201426 ------
NM_021110chr82788 760 ------
NM_021137chr1722377 2167 --11506 --
NM_021151chr71225 ------
NM_021155chr1952771 2637 2062 1991 327 ------
NM_021159chr441255 352 329 289 ------
NM_021165chr11875 ------
NM_021183chrX52381 2155 1752 432 114 ------
NM_021229chr1211212 ------
NM_021255chr1422620 1490 ----11166
NM_021627chr33836 373 249 ------
NM_021639chr1138 ------
NM_021647chr464674 4478 3791 3233 3048 1696 1716 23506 402 --
NM_021723chr72393 82 ------
NM_021813chr675877 5244 5119 4978 4550 1604 1113 24691 4237 ----
NM_021818chr1431293 205 68 ------
NM_021911chr595029 4756 3616 3557 1298 1040 785 700 438 24986 1060 ----
NM_021912chr1573902 1562 1510 1342 807 399 103 23460 3268 ----
NM_021940chr641643 1012 557 413 11121 ----
NM_021945chr673382 3013 2943 2205 925 606 295 33202 2324 1166 ----
NM_021949chrX22535 2336 22363 1892 1849 --
NM_021951chr91635 ------
NM_021954chr1343513 3430 2948 2688 ------
NM_021961chr11127031 6676 6088 5970 5549 4921 4869 2179 1224 599 394 95 45990 5417 5323 83 ----
NM_021964chr376180 5916 5332 5234 2463 2353 2291 ------
NM_021970chr41727 ------
NM_021973chr42763 63 --1627 --
NM_021977chr643479 3197 2509 1192 ------
NM_021979chr142422 24 --1441 1128
NM_022037chr22930 259 --199 --
NM_022041chr1621970 408 ------
NM_022051chr11463 ------
NM_022114chr1134741 4653 4622 4385 4275 3986 3248 3107 3059 3025 1826 584 531 1410 1747 --
NM_022118chr131200 ------
NM_022131chr331218 933 44 ------
NM_022133chr841817 1732 364 58 ------
NM_022166chr1685965 5444 5281 4802 4716 2506 307 191 --1516 --
NM_022173chr22930 259 --199 --
NM_022351chr853227 3139 2733 826 390 1870 ----
NM_022456chr1245804 4866 1068 121 17249 ----
NM_022459chr1366229 5986 5747 5297 1497 277 --14446 --
NM_022473chr15124448 4381 3888 3446 1659 1357 1216 1055 850 646 497 214 12937 ----
NM_022477chr2031156 503 79 31194 649 46 ----
NM_022571chr14133 ------
NM_022716chr162676 2605 2155 1045 1007 189 12635 12920 --
NM_022725chr1131466 612 548 ------
NM_022745chr132870 582 136 22710 348 1805 --
NM_022748chr742148 1851 856 99 --22310 2262 --
NM_022763chr363139 2772 2100 1158 403 319 ------
NM_022802chr1011597 ------
NM_022817chr252228 824 710 566 494 21551 1415 ----
NM_022824chr521596 719 ------
NM_022828chr521291 1283 ------
NM_022832chr442386 2181 895 674 ------
NM_022841chr1532343 1965 1933 11767 1748 --
NM_022843chr1321364 531 ------
NM_022893chr242608 2423 420 301 11189 ----
NM_022898chr1484411 3824 3236 3020 1642 1220 715 379 21801 497 --11133
NM_022900chr73979 926 105 ------
NM_022918chr1122072 1442 --1715 --
NM_022977chrX32454 2072 836 ------
NM_023000chr142644 287 ------
NM_023001chr142644 287 ------
NM_023016chr221109 417 ----12577
NM_023929chr842498 1883 1742 192 21817 707 ----
NM_024007chr562113 986 619 554 261 160 ------
NM_024052chr1732128 257 117 --2890 838 --
NM_024090chr451601 604 318 287 117 11711 ----
NM_024094chr81212 ------
NM_024095chr1211418 ------
NM_024104chr1911019 ------
NM_024122chrX2185 41 ------
NM_024295chr862053 2005 1518 1407 1348 231 ------
NM_024345chr933807 3748 1159 25586 1979 ----
NM_024556chr11173 ------
NM_024574chr42440 351 ------
NM_024607chr883517 3166 2949 2882 1485 636 460 162 ------
NM_024611chr1521184 427 ------
NM_024613chr831800 1377 213 --11471 --
NM_024628chr331200 1129 1122 --1868 --
NM_024665chr364449 3787 3595 3469 1660 370 33532 3101 1513 13760 --
NM_024670chr1041259 406 241 141 ------
NM_024692chr211581 ------
NM_024713chr1531610 1345 1120 ------
NM_024721chr842541 491 326 297 22177 115 ----
NM_024740chr1152641 1627 467 411 211 --13285 14054
NM_024751chr421999 179 21551 839 ----
NM_024755chr15153 ------
NM_024766chr22420 411 ------
NM_024770chr296427 5485 5356 4380 2506 2256 1248 1163 370 15440 14100 --
NM_024828chr941389 616 488 270 ------
NM_024830chr521662 819 --11798 --
NM_024841chr112930 165 --11856 --
NM_024854chr123591 324 296 140 ----
NM_024881chr192513 206 13170 31027 610 186 --
NM_024913chr741540 1425 1250 73 ------
NM_024915chr842820 2757 2079 2064 --12791 --
NM_024944chr211134 ----1253
NM_024947chr367867 7821 6809 6249 1306 1081 ----16715
NM_024949chr474960 3980 3948 1793 1664 1386 245 23503 768 23811 3793 --
NM_024953chr1252788 2554 2471 2363 738 ------
NM_024969chr21623 ------
NM_024991chr1053164 2640 2222 1053 221 ------
NM_025004chr11------1751
NM_025054chr874162 2729 1153 989 523 435 355 --22808 506 --
NM_025074chr452999 2154 1077 997 117 13040 ----
NM_025129chr191222 ------
NM_025134chr1632245 878 134 --22561 2501 --
NM_025146chr332427 1883 846 ------
NM_025160chr143351 2814 2669 76 ------
NM_025164chr1142058 1996 505 54 ------
NM_025179chr164925 4372 3611 1672 1177 508 23749 884 ----
NM_025181chr23733 666 539 ------
NM_025191chr142192 294 232 46 1573 1512 --
NM_025195chr871487 1417 1410 698 556 352 207 ------
NM_025221chr451411 1027 1014 119 35 ------
NM_030627chr543460 2653 583 183 ----14096
NM_030637chr141272 ------
NM_030647chr752491 1893 1709 1547 1191 --14635 --
NM_030648chr493981 3495 2222 1149 1057 1000 746 612 390 1303 ----
NM_030665chr17----11223 --
NM_030670chr1252326 2069 651 609 369 ------
NM_030671chr1252326 2069 651 609 369 ------
NM_030674chr1295139 4825 4572 4533 4215 4060 2108 1674 100 15310 --23818 749
NM_030796chr772127 1870 1570 688 533 370 132 ------
NM_030806chr198924 5900 5838 2196 2045 1929 1622 1002 94 ------
NM_030808chr172946 375 ------
NM_030816chr143210 585 491 82 ------
NM_030881chr2251951 1747 967 953 31 ----1854
NM_030912chr101706 ------
NM_030920chr131968 1518 710 ------
NM_030934chr131512 1383 201 --11859 11456
NM_030964chr522854 2365 --22325 858 --
NM_030979chr131177 --1162 --
NM_031262chr91995 --1709 --
NM_031263chr911052 --1766 --
NM_031268chr16105231 5040 4950 4738 3694 1654 1472 1059 1040 1014 ------
NM_031302chr121141 ------
NM_031362chr222657 2482 12707 ----
NM_031365chr222793 2618 12843 ----
NM_031366chr222793 2618 12843 ----
NM_031371chr121584 1552 --1262 --
NM_031371chr121584 1552 --1262 --
NM_031411chr551794 697 544 244 52 ------
NM_031419chr31513 11256 195 --
NM_031427chr1495290 5262 4983 3938 3642 2258 2052 1164 327 --11059 --
NM_031435chr1242825 2677 2174 860 --11287 --
NM_031442chrX3777 713 230 1266 1222 --
NM_031445chr243412 2107 1163 910 1916 ----
NM_031459chr121667 1051 --21128 386 11303
NM_031461chr841505 768 125 42 21411 586 ----
NM_031468chr788042 6779 6591 2583 2536 2031 83 63 28119 1145 ----
NM_031483chr2073511 2818 2504 2486 2475 433 348 ----2632 195
NM_031845chr222419 2324 --23662 3116 --
NM_031847chr222419 2324 --23662 3116 --
NM_031849chr551794 697 544 244 52 ------
NM_031857chr551794 697 544 244 52 ------
NM_031860chr551794 697 544 244 52 ------
NM_031866chr101409 ------
NM_031892chrX------11007
NM_031911chr452568 664 455 247 26 12827 ----
NM_031946chr71409 ------
NM_032012chr975321 5209 4905 4601 3675 3230 98 ------
NM_032013chr2031156 503 79 31194 649 46 ----
NM_032105chr168096 6304 5540 3068 3009 122 16538 1796 --
NM_032116chr1335608 3832 1753 11082 ----
NM_032144chr221357 589 --11507 --
NM_032147chr122759 702 ------
NM_032153chr342480 1748 948 309 1921 ----
NM_032160chr1811659 --23324 1077 14060
NM_032199chr1041067 947 514 394 1823 ----
NM_032208chr233337 611 540 1196 33266 2439 2351 --
NM_032217chr44379 351 324 309 ------
NM_032221chr2011985 ----12026
NM_032228chr1142689 1140 1022 580 ------
NM_032229chr131116 ------
NM_032291chr151886 689 680 663 550 ------
NM_032320chr111772 ------
NM_032352chr143319 299 48 --11364 --
NM_032373chr1085794 4994 4784 3750 3576 1574 179 118 --11955 15176
NM_032424chr111183 --127 --
NM_032438chr61342 ------
NM_032439chr1051505 1217 1072 1034 677 ------
NM_032445chr1561972 1965 1012 851 219 194 ------
NM_032446chr553769 3609 3241 932 693 13867 12847 --
NM_032456chr42668 149 --1543 --
NM_032458chrX73165 2466 2426 1073 1067 727 708 --12845 1609
NM_032471chr63837 354 275 ------
NM_032520chr161175 ------
NM_032521chr2043126 2350 950 124 22218 823 ----
NM_032547chr421360 1112 --1200 --
NM_032582chr172245 90 ----1500
NM_032590chr1211174 ------
NM_032632chr1452012 1815 1605 716 58 ------
NM_032635chr19164 ------
NM_032682chr372919 1447 1364 893 857 396 325 --11419 --
NM_032784chr64777 632 376 89 ------
NM_032804chr1011672 ----11909
NM_032832chr651719 1389 1255 1123 118 ------
NM_032859chr13103912 3587 3579 3503 3187 1477 686 557 400 342 ------
NM_032949chr132536 161 ------
NM_032968chrX44210 4001 3648 943 --1363 --
NM_032969chrX44210 4001 3648 943 --1363 --
NM_032973chrY44202 3993 3640 943 --1363 --
NM_032975chr1842714 960 347 37 --11116 --
NM_032980chr1842714 960 347 37 --11116 --
NM_033012chr133935 689 387 ------
NM_033020chr184869 3174 1781 1590 1345 941 919 299 ------
NM_033044chr131291 328 270 ------
NM_033055chr1----1305 --
NM_033081chr2031346 1322 497 ----1939
NM_033117chr92311 33 ------
NM_033121chr1231844 1343 646 ------
NM_033132chr1362306 2078 1928 540 462 275 ------
NM_033136chr531600 617 553 11306 1114 --
NM_033137chr531600 617 553 11306 1114 --
NM_033211chr531829 1524 1446 ------
NM_033222chr921424 155 ------
NM_033224chr787810 7462 6051 5378 5082 3191 870 295 16693 28044 688 11289
NM_033225chr843196 2768 522 161 ------
NM_033272chr21360 ------
NM_033281chr52762 315 ------
NM_033312chr1----170 --
NM_033326chr1132441 1563 663 12223 ----
NM_033331chr953509 3311 3262 1299 183 ----1189
NM_033389chr1753425 3332 1858 617 280 1678 14848 --
NM_033425chr1153544 3143 548 481 197 1286 ----
NM_033426chr1411800 --32884 2475 1924 --
NM_033429chr1552968 2620 1277 319 95 ------
NM_033430chr464133 3757 3509 3053 551 419 ------
NM_033437chr464133 3757 3509 3053 551 419 ------
NM_033480chr622422 955 --13014 --
NM_033481chr622422 955 --13014 --
NM_033484chr5----126 --
NM_033495chrX1328 ------
NM_033505chr255892 5612 4673 4252 94 1547 ----
NM_033535chr431114 1095 183 ------
NM_033626chrX21854 1693 ------
NM_033644chr552112 1869 1652 278 67 --12244 --
NM_033645chr552112 1869 1652 278 67 --12244 --
NM_033656chr2165671 5184 1797 1546 1309 1003 --13956 --
NM_052818chr1332002 857 219 1807 12154 --
NM_052832chr862509 2059 1144 1044 532 258 --22240 432 --
NM_052851chr1332417 2108 1973 --1698 11500
NM_052860chr52711 392 ------
NM_052885chr1234728 4430 963 14757 1239 --
NM_052896chr151785 1705 1656 924 239 --12378 --
NM_052898chr841221 692 603 596 --11372 --
NM_052900chr821812 1512 11629 ----
NM_052905chr231900 514 130 ------
NM_052917chr222495 216 ------
NM_052918chr1053630 3132 3086 3007 2962 ------
NM_052927chr531556 1538 152 --1784 --
NM_052937chr832309 433 104 1149 ----
NM_052951chr201220 ------
NM_052953chr32297 89 ------
NM_052961chr6141 ------
NM_052966chr153871 3463 1127 165 78 --1402 --
NM_053016chr977285 6394 5859 5030 2511 809 101 16587 ----
NM_053023chr1143092 2865 2299 297 ------
NM_057175chr43820 788 735 22376 2070 121 --
NM_057178chr1752794 2787 606 576 87 --11038 --
NM_058172chr441562 655 484 270 31513 1358 70 ----
NM_058241chr21167 ------
NM_058241chr21167 ------
NM_078471chr171810 ------
NM_078487chr963127 3025 2486 1082 423 114 ----2970 895
NM_080392chr11203 ----165
NM_080546chr921933 714 ------
NM_080552chr201715 ------
NM_080618chr2021233 503 1518 1870 --
NM_080666chr142593 114 1513 ----
NM_080676chr2023088 2123 12351 ----
NM_080867chr1454094 3958 3363 665 338 ------
NM_080872chr833558 3494 3181 --13883 --
NM_080927chr352538 2258 921 796 214 --12759 11246
NM_100264chr101331 ------
NM_100486chr101331 ------
NM_130385chr1182936 2867 2474 2005 1077 1050 906 884 ------
NM_130391chr942182 1028 1009 557 23600 2616 ----
NM_130392chr942182 1028 1009 557 23600 2616 ----
NM_130393chr942182 1028 1009 557 23600 2616 ----
NM_130436chr2152695 2490 2344 2030 908 ------
NM_130438chr2173272 3067 2921 2607 2283 2250 2199 ------
NM_130847chr11115779 5724 5643 5393 4213 1941 1431 915 888 351 245 14512 ----
NM_130850chr14----1203 --
NM_130851chr14----1203 --
NM_133170chr20127233 6537 5987 5563 5381 5012 2854 2752 2684 1596 1110 336 ------
NM_133172chr51296 ------
NM_133173chr51296 ------
NM_133174chr51296 ------
NM_133334chr485983 5888 5692 4723 4012 1594 1229 928 --15285 11587
NM_133338chr51378 ------
NM_133339chr51378 ------
NM_133340chr51378 ------
NM_133341chr51378 ------
NM_133342chr51378 ------
NM_133343chr51378 ------
NM_133344chr51378 ------
NM_133433chr52809 149 ------
NM_133496chr154260 2845 1422 1224 567 ------
NM_133631chr351159 606 463 256 232 11283 1547 --
NM_133638chr521267 471 ------
NM_133644chr191298 ------
NM_133646chr255603 4336 3477 895 32 --1227 --
NM_133647chr1563180 759 493 481 265 201 12606 ----
NM_138288chr14----12125 --
NM_138333chr992359 2269 908 859 841 628 370 208 62 ------
NM_138340chr18193 ------
NM_138348chr585660 5588 5499 1508 1087 354 273 250 ------
NM_138357chr1031779 1711 433 ------
NM_138444chr13104404 3936 3834 1705 1572 1427 1137 1049 866 181 34471 3428 1492 11410 --
NM_138453chr51175 ------
NM_138459chr653278 2474 824 777 272 13142 ----
NM_138494chr742420 264 247 220 1898 1601 12677
NM_138576chr1484411 3824 3236 3020 1642 1220 715 379 21801 497 --11133
NM_138694chr673732 3449 3433 3400 2689 1329 232 ------
NM_138713chr16138268 7360 7348 6864 6783 5776 2926 2715 2345 1126 554 299 118 12201 ----
NM_138714chr16138268 7360 7348 6864 6783 5776 2926 2715 2345 1126 554 299 118 12201 ----
NM_138731chr1484284 4234 2772 946 649 158 96 73 11098 ----
NM_138735chr241349 1287 1270 477 ------
NM_138766chr5196 ------
NM_138771chr711221 ------
NM_138782chr542262 2199 1515 349 ----1648
NM_138799chr221502 611 2585 372 11640 11568
NM_138821chr5196 ------
NM_138822chr5196 ------
NM_138959chr1106817 6574 6050 4978 4623 2484 1672 1320 1018 269 --15036 --
NM_138971chr1143810 1542 572 128 ------
NM_138971chr1143810 1542 572 128 ------
NM_138972chr1143810 1542 572 128 ------
NM_138972chr1143810 1542 572 128 ------
NM_138973chr1143810 1542 572 128 ------
NM_138973chr1143810 1542 572 128 ------
NM_139045chr93815 604 212 ------
NM_139048chr331254 246 122 ------
NM_139072chr21652 ------
NM_139078chr121342 ------
NM_139136chr12------21116 883
NM_139168chr551850 1356 455 294 75 --11961 --
NM_139279chr273506 2662 2628 1088 833 772 35 --11267 --
NM_139321chr2064194 4055 3345 2812 1448 635 --11388 --
NM_144571chr485829 5169 2489 2411 2037 1120 912 640 ------
NM_144578chr14115095 4787 4776 4313 4146 3890 2034 1591 1059 995 361 1444 ----
NM_144595chr131876 ------
NM_144643chr41316 ------
NM_144658chrX----165 --
NM_144726chr511203 --1958 --
NM_144728chr12743 701 ------
NM_144729chr12743 701 ------
NM_144778chr1342688 2166 1051 1016 --12274 --
NM_144949chr262283 1692 961 596 560 71 ------
NM_144963chr842305 2225 2169 1046 ------
NM_144973chr1253651 1108 1059 841 365 15069 ----
NM_144979chr42233 60 ------
NM_145011chr1052235 1939 1744 237 139 21694 385 1667 --
NM_145036chr17185 ------
NM_145049chr51100 ------
NM_145055chr1843652 3214 1461 893 ------
NM_145117chr1142182 2046 831 599 ------
NM_145185chr1922008 1302 ------
NM_145203chr131754 ------
NM_145206chr1062870 2541 1104 1095 955 469 --12672 --
NM_145259chr276475 6109 2771 1190 1172 510 407 --16115 11346
NM_145274chr172929 200 1238 ----
NM_145284chrX32541 1813 238 1846 1664 --
NM_145307chr1021631 1121 ------
NM_145320chr763401 3379 3131 2282 1069 177 ------
NM_145321chr763401 3379 3131 2282 1069 177 ------
NM_145322chr763401 3379 3131 2282 1069 177 ------
NM_145686chr253326 2461 1270 298 121 13282 12484 --
NM_145687chr253326 2461 1270 298 121 13282 12484 --
NM_145698chr1041934 1806 1519 428 3640 448 172 ----
NM_145731chr221209 ------
NM_145738chr221209 ------
NM_145753chr34632 460 450 114 11127 134 21243 1042
NM_145803chr112634 78 1160 ----
NM_145808chr753143 2710 2315 2184 423 ------
NM_145859chr31374 ------
NM_145860chr31374 ------
NM_147150chr953117 936 701 298 102 ------
NM_147156chr10----1430 --
NM_147166chr72552 320 ------
NM_147175chrX12125 ------
NM_147181chr451411 1027 1014 119 35 ------
NM_147182chr451411 1027 1014 119 35 ------
NM_147183chr451411 1027 1014 119 35 ------
NM_147190chr121134 ------
NM_148174chr832119 1941 404 ------
NM_148898chr74823 798 714 177 --1364 --
NM_148899chr74823 798 714 177 --1364 --
NM_148955chr1555758 4334 4310 1363 288 --25980 2172 --
NM_152237chr2211378 --11178 --
NM_152267chr2262416 2209 2080 1518 380 202 ------
NM_152271chr821084 468 --1986 1154
NM_152277chr51586 ------
NM_152283chr54455 261 159 36 ------
NM_152300chr1751721 1646 1546 1378 413 ------
NM_152330chr1452152 2089 1704 1036 554 ------
NM_152355chr192360 224 ------
NM_152381chr261931 1797 1652 410 83 35 ------
NM_152409chr532193 526 416 --12678 13213
NM_152414chr831182 155 113 ------
NM_152424chrX53731 3201 1872 1780 835 11374 ----
NM_152444chr1451190 1181 1172 801 791 ------
NM_152446chr142924 172 ------
NM_152470chr1874142 4090 4051 3378 1194 324 116 --23703 3484 --
NM_152546chr541067 1021 581 21 ------
NM_152574chr91346 ------
NM_152588chr1251765 1580 396 238 57 ------
NM_152589chr121201 ------
NM_152594chr1541564 864 503 81 ------
NM_152621chr4------1128
NM_152622chr553173 3106 1407 666 43 ------
NM_152624chr576650 6371 5377 5358 2356 724 693 ----25760 2752
NM_152636chr1132364 950 791 --127 --
NM_152641chr12----11017 --
NM_152699chr373653 2677 2496 950 917 582 254 1832 13078 --
NM_152725chr101281 --1433 --
NM_152742chr71606 ------
NM_152744chr753485 2400 1000 351 180 11325 1499 --
NM_152754chr743863 3346 1495 311 ------
NM_152756chr564239 3983 3975 3283 2656 1238 ------
NM_152758chr862384 2023 1958 1179 934 518 1563 ----
NM_152787chrX83981 3127 3003 2783 889 519 404 384 ------
NM_152793chr794791 4683 4433 4027 3973 1896 1453 898 511 14575 13225 --
NM_152826chr1555758 4334 4310 1363 288 --25980 2172 --
NM_152835chr11188 32510 1001 681 11185 --
NM_152836chr841817 1732 364 58 ------
NM_152837chr841817 1732 364 58 ------
NM_152838chr2063484 3130 2843 2835 2815 2637 1268 ----
NM_152855chr221380 ------
NM_152890chr121273 953 ------
NM_152910chr131590 ------
NM_152924chr1575288 4793 4388 2599 2093 736 516 --26375 4986 --
NM_152994chr22186 125 ------
NM_152996chr132069 1387 669 ------
NM_152999chr754150 3729 2009 336 170 13898 ----
NM_153020chr621671 337 11349 ----
NM_153029chr1633897 3169 338 --22938 114 13296
NM_153047chr61336 ------
NM_153048chr61336 ------
NM_153188chr565241 5143 4308 2195 2084 113 1680 ----
NM_153201chr11171 ------
NM_153207chr1283216 2645 2552 1058 598 257 161 28 ------
NM_153235chr651738 816 782 260 99 ------
NM_153240chr31262 --128 --
NM_153261chr163346 329 241 ------
NM_153262chr133047 2829 601 13014 ----
NM_153267chr92714 267 ----173
NM_153333chrX1574 ------
NM_153354chr52804 92 ------
NM_153365chr43977 443 125 12757 --12229
NM_153426chr43664 652 247 ------
NM_153427chr43664 652 247 ------
NM_153453chr61193 ------
NM_153607chr573163 2826 2453 940 923 563 100 12019 ----
NM_153616chr1532354 2034 423 21548 688 12249 11747
NM_153617chr1532354 2034 423 21548 688 12249 11747
NM_153618chr1532354 2034 423 21548 688 12249 11747
NM_153619chr1543592 3272 972 513 22786 848 13487 12985
NM_153645chr2273352 3154 2970 2054 985 764 535 2822 471 ----
NM_153649chr111769 --11721 --
NM_153686chr462253 1954 913 898 625 410 --1201 --
NM_153689chr241606 945 566 494 ------
NM_153712chr243077 1250 1126 850 ------
NM_153715chr71369 --11155 --
NM_153748chr12------21116 883
NM_153809chr91624 ------
NM_153828chr21827 ------
NM_170606chr741579 1162 217 78 --11236 --
NM_170665chr1274385 3163 3079 1640 332 319 237 23599 1152 ----
NM_170740chr683466 3166 2498 2234 2120 1345 211 150 12580 13157 --
NM_171998chrX81967 1830 1684 993 870 797 727 689 ------
NM_172037chr811286 ----11255
NM_172058chr851783 1734 1288 684 360 --1305 --
NM_172059chr851783 1734 1288 684 360 --1305 --
NM_172060chr851783 1734 1288 684 360 --1305 --
NM_172071chr196986 6939 5744 4934 4900 4568 1524 553 230 12294 11157 --
NM_172103chr632670 2011 627 1264 ----
NM_172105chr632670 2011 627 1264 ----
NM_172365chr14128 ------
NM_172373chr1341217 927 419 62 ------
NM_173060chr551966 1861 1703 1296 756 ------
NM_173061chr551966 1861 1703 1296 756 ------
NM_173063chr551966 1861 1703 1296 756 ------
NM_173078chrX2339 285 ------
NM_173198chr972281 2071 1841 1104 999 534 485 11849 --1701
NM_173199chr9194 ------
NM_173200chr972281 2071 1841 1104 999 534 485 11849 --1701
NM_173214chr16138268 7360 7348 6864 6783 5776 2926 2715 2345 1126 554 299 118 12201 ----
NM_173463chr464207 3443 3232 920 815 632 --13157 --
NM_173468chr425886 22 2841 36 14916 --
NM_173469chr1541550 1458 1210 64 ------
NM_173473chr1041748 819 690 564 1472 ----
NM_173495chrX62068 1966 1867 1651 809 562 ------
NM_173500chr1521385 1109 ----11264
NM_173508chr121206 955 ------
NM_173510chr2232596 1864 31 ------
NM_173511chr223584 465 ------
NM_173552chr322039 193 ------
NM_173602chr1242372 1022 705 476 182 --1183
NM_173642chr1118379 7799 7058 6785 6344 6055 5666 2105 1868 1495 1071 --36194 621 154 1384
NM_173653chr31416 ----1199
NM_173808chr144093 1307 1246 466 34279 4262 3878 ----
NM_173809chr1041106 521 423 148 1307 ----
NM_173824chr31263 ------
NM_173825chr322062 32 --1578 12244
NM_173827chr442824 2555 2464 2426 ------
NM_173829chr576168 4866 2305 2142 1357 1064 790 ------
NM_173851chr843471 2925 978 923 --13792 --
NM_173872chr42842 88 ------
NM_174890chr101291 ------
NM_174911chr863121 3093 2698 631 583 271 ------
NM_174916chr1541985 1955 756 174 133 ----
NM_175056chr321356 756 --12121 --
NM_175061chr721574 614 ------
NM_175566chr11----1194 --
NM_175607chr351346 1286 525 446 171 ------
NM_175612chr351346 1286 525 446 171 ------
NM_175623chr1245804 4866 1068 121 17249 ----
NM_175733chr1142052 1845 614 112 2273 96 ----
NM_175767chr51152 1108 1399 11523
NM_175854chr1342119 780 531 54 ------
NM_175863chr61342 ------
NM_175873chr511353 --11148 --
NM_175921chr554289 3802 1369 1237 179 ------
NM_176812chr201268 ------
NM_177398chr142012 1830 1231 283 ------
NM_177399chr142012 1830 1231 283 ------
NM_177424chr132023 1382 801 1312 ----
NM_177524chr72818 225 --11069 --
NM_177525chr72818 225 --11069 --
NM_177947chrX141 ------
NM_177948chrX141 ------
NM_177990chr2032051 1691 263 ------
NM_178006chr1332417 2108 1973 --1698 11500
NM_178007chr1332417 2108 1973 --1698 11500
NM_178009chr132553 223 ------
NM_178011chr1062907 2251 2174 2150 2104 1265 ------
NM_178120chr211158 --1951 --
NM_178140chr562746 2500 2059 892 408 47 --12110 --
NM_178151chrX87615 7465 7076 4848 2673 2343 985 663 11933 ----
NM_178152chrX87615 7465 7076 4848 2673 2343 985 663 11933 ----
NM_178153chrX87615 7465 7076 4848 2673 2343 985 663 11933 ----
NM_178335chr33272 160 43 ------
NM_178423chr72229 198 --1829 --
NM_178425chr72229 198 --1829 --
NM_178426chr14882 830 176 164 ------
NM_178427chr15890 782 730 76 64 ------
NM_178505chr1042819 1254 668 319 1454 13226 13304
NM_178549chr12368 179 ------
NM_178812chr841239 519 452 36 11456 ----
NM_178839chr21340 ------
NM_178868chr31302 ------
NM_181358chr153597 3114 1693 1334 1124 ------
NM_181361chr341463 1431 910 159 ------
NM_181443chr2052913 2026 986 280 80 ------
NM_181481chr1865853 2493 1685 211 168 124 26231 118 15155 --
NM_181482chr1865853 2493 1685 211 168 124 26231 118 15155 --
NM_181483chr1865853 2493 1685 211 168 124 26231 118 15155 --
NM_181521chr16106961 6676 5807 5431 5387 4719 2772 2525 2478 1425 1633 --16697
NM_181598chr142131 72 ------
NM_181659chr2053038 2820 2499 686 634 23186 44 ----
NM_181659chr2053038 2820 2499 686 634 23186 44 ----
NM_181704chr2161103 945 895 338 181 42 ----1454
NM_181705chr575444 5236 5063 4945 3670 1039 79 ----14294
NM_181706chr1122011 570 11666 ----
NM_181712chr172066 1929 1826 1731 525 488 327 ------
NM_181723chr831760 1751 197 1915 ----
NM_181794chr63837 354 275 ------
NM_181795chr63837 354 275 ------
NM_181836chr532474 2401 424 ----1740
NM_181838chr531574 1520 1441 ------
NM_181861chr1212587 21928 174 12169 1236
NM_181868chr1212587 21928 174 12169 1236
NM_181869chr1212672 22013 259 12254 1321
NM_181872chr91209 ------
NM_182314chrX41312 1262 1171 598 1542 ----
NM_182472chr4150 ------
NM_182484chr2161103 945 895 338 181 42 ----1454
NM_182485chr4103574 3465 2997 2982 1275 1208 1004 936 874 441 --1808 --
NM_182503chr641691 1552 900 187 ------
NM_182515chr1965646 5105 4944 2466 421 255 25861 1814 11268 15001
NM_182540chrX1265 ------
NM_182546chr7157 ------
NM_182553chr111608 ------
NM_182565chr171162 ------
NM_182641chr1732016 1283 774 ------
NM_182643chr842181 2023 757 729 ------
NM_182644chr35780 770 524 189 71 1557 ----
NM_182645chr61193 ------
NM_182646chr4103574 3465 2997 2982 1275 1208 1004 936 874 441 --1808 --
NM_182688chr2121448 105 ----12083
NM_182700chr731854 1535 1430 --1506 --
NM_182728chr141155 ------
NM_182765chr1051917 1795 1670 760 398 --1474 --
NM_182797chr2031241 119 30 11616 11532 --
NM_182830chr1451773 1689 1651 692 438 22176 379 ----
NM_182898chr776608 6567 6310 4622 4193 2564 738 --12232 1879
NM_182899chr776608 6567 6310 4622 4193 2564 738 --12232 1879
NM_182907chr622408 2109 --1115 --
NM_182915chr252293 2199 897 141 105 --1720 --
NM_182948chr173024 2274 2259 2001 949 721 192 12995 ----
NM_182964chr1142182 2046 831 599 ------
NM_182977chr53443 401 61 ------
NM_183004chr1432809 460 42 13758 12883 13103
NM_183237chr3------162
NM_183376chr151322 --22503 1663 --
NM_194247chr263881 3713 3000 1582 1014 93 1720 ----
NM_194250chr21162 ------
NM_194259chr16173 ------
NM_194260chr16173 ------
NM_194261chr16173 ------
NM_194282chr443045 2058 797 414 21042 457 ----
NM_194283chr523661 678 --13787 --
NM_194285chr1143239 1370 1356 967 12459 ----
NM_194286chr1275115 4978 4929 4393 3774 2481 2070 ------
NM_194291chr842651 679 481 32 ----1770
NM_194298chr1061610 691 538 467 393 75 ------
NM_194314chr144075 3753 1459 703 14591 ----
NM_194442chr141751 1541 1269 539 ------
NM_197941chr532601 2013 1034 --21123 99 --
NM_198123chr821812 1512 11629 ----
NM_198124chr821812 1512 11629 ----
NM_198128chr181375 ------
NM_198158chr352432 2074 537 368 199 12913 ----
NM_198159chr352432 2074 537 368 199 12913 ----
NM_198177chr352432 2074 537 368 199 12913 ----
NM_198178chr352432 2074 537 368 199 12913 ----
NM_198181chr1512791 ------
NM_198217chr1321000 937 1693 ----
NM_198218chr1321000 937 1693 ----
NM_198219chr1321000 937 1693 ----
NM_198225chr1031685 774 538 ------
NM_198256chr221643 768 --11996 12044
NM_198268chr153597 3114 1693 1334 1124 ------
NM_198269chr153597 3114 1693 1334 1124 ------
NM_198270chrX73511 3085 2827 1014 644 602 156 --12323 --
NM_198273chr553070 2495 2287 793 21 ------
NM_198281chr452305 1179 1069 1014 610 ------
NM_198321chr573036 2542 2048 2037 1067 113 51 ------
NM_198391chr2051504 1480 610 269 22 ------
NM_198400chr1562717 2584 2486 2078 706 482 11933 ----
NM_198401chr82657 501 ------
NM_198450chrX42256 889 195 56 ------
NM_198465chrX62827 2721 1961 670 408 191 ------
NM_198467chr72191 75 --1599 --
NM_198503chr131808 732 697 1753 ----
NM_198569chr642648 867 59 50 ------
NM_198581chr267273 6819 6549 2260 2051 1858 36645 1713 805 ----
NM_198700chr111506 ------
NM_198793chr344021 1650 1416 1151 ------
NM_198794chr1421475 1257 124 --1123
NM_198859chr375158 4868 4171 3517 2026 2014 1018 --1784 23314 1065
NM_198889chr44379 351 324 309 ------
NM_198935chr2072733 2161 2081 2025 989 683 383 ------
NM_198947chr114823 383 190 154 ----1104
NM_198956chr731854 1535 1430 --1506 --
NM_198995chr182401 166 ------
NM_199000chr751941 1647 1597 471 357 151 ----
NM_199003chr821430 1148 1253 ----
NM_199039chr42735 359 ------
NM_199040chr1252952 2702 2664 402 93 11335 ----
NM_199072chr742163 2074 949 265 1365 12620 --
NM_199132chr1942081 711 527 172 --11991 --
NM_199324chr472931 2863 2815 2783 2417 1464 1376 ------
NM_199421chr1454094 3958 3363 665 338 ------
NM_199436chr242839 2703 2311 685 1521 1183 --
NM_199437chr11------12135
NM_199438chr11------12135
NM_199439chr11------12135
NM_199454chr1134741 4653 4622 4385 4275 3986 3248 3107 3059 3025 1826 584 531 1410 1747 --
NM_199461chr1042658 1414 582 539 ------
NM_199462chr123778 1863 1283 23570 341 11473
NM_201278chr1142363 1569 1524 944 --1293 --
NM_201281chr1142363 1569 1524 944 --1293 --
NM_201453chr91149 ------
NM_201559chr664729 4453 1658 923 479 36 34850 4155 1008 ----
NM_201599chrX1276 ------
NM_203301chr1441473 1249 623 458 1482 ----
NM_203318chr171810 ------
NM_203329chr11126515 6409 6170 6000 4668 4451 2362 2256 2016 1086 468 94 26603 2454 ----
NM_203330chr11126515 6409 6170 6000 4668 4451 2362 2256 2016 1086 468 94 26603 2454 ----
NM_203331chr11126515 6409 6170 6000 4668 4451 2362 2256 2016 1086 468 94 26603 2454 ----
NM_203341chr13739 250 21 1119 --1349
NM_203372chr23465 171 88 ------
NM_203390chr82176 134 11227 ----
NM_203406chr52770 454 11867 1715 --
NM_203437chr21220 ------
NM_203446chr2192775 2629 2614 2353 2316 2293 2071 670 120 ------
NM_203458chr143814 2640 1185 1151 ------
NM_203463chr274372 3327 1784 1522 1217 1132 421 --170 --
NM_203487chr1341381 543 442 241 ------
NM_203504chr442202 1767 1729 702 ----11777
NM_203505chr442202 1767 1729 702 ----11777
NM_205768chr131729 1610 472 ------
NM_205860chr172985 2926 1990 1263 628 209 177 11274 1794 --
NM_206594chr111043 1996 23531 1466 --
NM_206595chr111043 1996 23531 1466 --
NM_206853chr662816 2518 1508 820 378 53 ------
NM_206854chr664077 3779 2081 1639 1314 1148 ------
NM_206855chr665042 4744 2279 2113 855 803 ------
NM_206860chr101386 ------
NM_206861chr101386 ------
NM_206862chr101386 ------
NM_206866chr2143237 2737 2705 231 22491 1311 12034 --
NM_206876chr242444 1320 658 425 ------
NM_206907chr532620 2409 62 ----12661
NM_206909chr857842 7323 7214 5798 3285 ------
NM_207015chr362434 2367 1989 1758 1523 662 --12267 --
NM_207171chr121372 1268 --1343 --
NM_207292chr353234 2976 2382 2233 2123 ------
NM_207293chr353234 2976 2382 2233 2123 ------
NM_207294chr353234 2976 2382 2233 2123 ------
NM_207295chr353234 2976 2382 2233 2123 ------
NM_207296chr353234 2976 2382 2233 2123 ------
NM_207297chr353259 3001 2407 2258 2148 ------
NM_207303chr1073838 1526 1060 955 593 399 133 13618 ----
NM_207304chr1342575 2053 938 903 --12161 --
NM_207322chr1552155 1928 1464 864 73 12002 1197 --
NM_207337chr121402 ------
NM_207371chr10154 11279 11481 --
NM_207372chr1032201 1963 282 12058 --12407
NM_207406chr496303 5688 4512 4437 4097 1709 718 567 410 --21750 1186 --
NM_207429chr1152475 2318 1671 1005 114 12035 --12077
NM_207481chr221279 483 1258 ----
NM_207520chr21827 ------
NM_207521chr21827 ------
NM_212460chr721992 1822 1531 ----
NM_212558chr984265 4047 3238 3130 2809 1610 883 66 34165 3073 363 13484 --
NM_213589chr275504 4781 4470 4417 1994 1772 1614 ------
NM_213593chr121055 140 ------
NM_213651chr11253 ------
NM_213662chr1722499 312 --1506 --