TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1283
miRNA Sequence: UCUACAAAGGAAAGCGCUUUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX76979 5951 4274 2551 2336 1050 888 --26292 5486 12448
NM_000112chr595202 4926 4799 4472 3929 655 498 176 150 14913 --14085
NM_000138chr15102488 2415 1953 1885 1772 932 669 363 140 118 ------
NM_000176chr5103875 3717 3572 3300 3014 1470 1266 1232 1019 783 12725 22880 2819 --
NM_000216chrX104085 4017 3966 3844 3489 3100 2963 1094 948 21 ------
NM_000217chr1254843 4534 3834 3668 1297 12137 --23255 97
NM_000252chrX71474 1393 1353 1275 1208 1159 70 --1315 1367
NM_000259chr1575848 5469 4981 2130 2062 606 542 --26320 5819 15266
NM_000264chr983146 2580 2438 2313 1293 876 425 294 --12645 12998
NM_000267chr1753401 3139 3061 830 816 --22871 1325 12581
NM_000332chr6105601 5315 5278 5232 5045 5030 4358 1592 771 46 --47009 6591 2692 1993 --
NM_000337chr555909 5166 4821 1735 477 --54930 2213 2011 1655 632 15284
NM_000461chr3104583 4547 4437 3526 2948 1653 1575 1068 559 89 1237 14066 --
NM_000555chrX96854 6712 6426 5647 2939 2553 1539 385 53 --36967 5925 2065 25952 1971
NM_000719chr1276515 5854 5443 4551 1945 1722 907 25538 367 45298 4982 2476 713 --
NM_000875chr1566909 5766 5668 2465 1920 1374 --15699 11301
NM_001001323chr1243168 2848 2526 2174 1917 12893 1750
NM_001001419chr5115067 4974 4643 4538 3787 1515 949 658 171 150 143 15095 1985 14754
NM_001001420chr5115067 4974 4643 4538 3787 1515 949 658 171 150 143 15095 1985 14754
NM_001003652chr18188602 8369 8265 8182 7432 6899 6793 6668 2771 2729 2496 2342 2184 1770 1690 1381 1148 467 23436 148 1653 --
NM_001003674chr18126808 6488 5681 5139 5110 4983 4728 1838 1446 1334 556 419 16357 ----
NM_001003675chr18126808 6488 5681 5139 5110 4983 4728 1838 1446 1334 556 419 16357 ----
NM_001003712chr1283956 3848 2819 2786 2647 1230 322 237 --11012 23081 658
NM_001005463chr10112454 2369 2292 1724 923 905 877 620 609 350 287 1897 21964 469 --
NM_001005473chr596628 6393 4661 4460 4368 2312 2236 439 279 15906 24434 476 --
NM_001007559chr1892094 2011 1788 1571 776 419 373 323 261 1122 1157 1708
NM_001009899chr3106501 6303 6209 5695 5418 4809 2373 952 756 53 1808 ----
NM_001010853chr693246 3064 2912 2720 2549 2259 989 678 346 12443 1432 --
NM_001010888chrX124669 4534 4317 4239 4014 3961 3501 3402 3360 3058 582 89 --34356 3472 2853 11663
NM_001010891chr5126593 6193 6103 5614 5406 5251 4803 4717 4481 4250 2271 1559 --21308 746 14300
NM_001010922chr194113 3682 2953 2924 2883 1699 1339 1274 655 11079 ----
NM_001011666chr7136561 6553 6431 6343 6325 6307 6301 5434 5096 4703 1666 950 448 25408 4415 ----
NM_001013620chr12188400 7508 7501 7331 6537 5924 5868 2694 2167 2148 1763 1530 1394 1144 912 433 389 293 12513 --12113
NM_001014380chr13185866 5826 5468 5333 5003 4965 4447 4429 4373 3938 2169 1961 1871 1845 1383 771 419 206 15504 ----
NM_001014797chr10108259 8227 8199 6436 5904 5286 3186 2729 1090 884 16417 56812 5236 2421 2066 758 11898
NM_001015877chrX83057 2266 1957 1202 1030 1010 931 94 --13064 1431
NM_001018067chr1115195 4945 4677 4501 3326 2076 1122 362 278 204 34 ------
NM_001018068chr1115195 4945 4677 4501 3326 2076 1122 362 278 204 34 ------
NM_001018069chr1115195 4945 4677 4501 3326 2076 1122 362 278 204 34 ------
NM_001018074chr5103875 3717 3572 3300 3014 1470 1266 1232 1019 783 12725 22880 2819 --
NM_001018075chr5103875 3717 3572 3300 3014 1470 1266 1232 1019 783 12725 22880 2819 --
NM_001018076chr5103875 3717 3572 3300 3014 1470 1266 1232 1019 783 12725 22880 2819 --
NM_001018077chr5103875 3717 3572 3300 3014 1470 1266 1232 1019 783 12725 22880 2819 --
NM_001024094chr5103875 3717 3572 3300 3014 1470 1266 1232 1019 783 12725 22880 2819 --
NM_001024948chr183437 3348 2794 2727 2646 2535 732 263 --2447 176 --
NM_001024956chr11115893 5843 4898 4580 4520 1426 1175 1164 1067 898 272 --21961 1653 14628
NM_001025076chr10105893 3883 2466 2404 1303 1177 1029 969 808 668 11010 11861 1615
NM_001025077chr10127251 5241 4810 2661 2535 2387 2327 2166 2026 1085 1062 845 12368 14862 24597 1973
NM_001025079chr353941 3526 1519 1358 1274 --11542 11262
NM_001025108chr243695 1484 584 160 --11354 24047 2904
NM_001025595chr461664 1571 1043 548 381 241 1541 --11435
NM_001029858chr662211 1363 801 577 353 299 11005 1592 12320
NM_001030055chr14114492 4326 3642 3568 3553 3095 1591 1323 1101 739 655 1933 13590 14132
NM_001039547chr3117877 6951 6921 6867 6815 5375 5171 4939 2974 2943 2783 --32560 2481 234 11794
NM_001039580chr465077 4844 4413 3136 1681 492 --14201 1387
NM_001039618chr11134966 3793 3666 2263 2004 1992 1978 1894 1679 1347 1291 363 252 14018 35347 4767 4040 --
NM_001039693chr294111 3996 3712 3385 2777 2639 1210 945 126 ----1822
NM_001039840chrX75283 4963 3976 2409 1404 774 138 160 21839 1392 --
NM_001040402chr483240 2861 1230 1158 925 276 203 75 --1348 11188
NM_001042355chr1664766 3944 3847 1998 214 162 33315 1113 317 43856 1177 405 110 --
NM_001042412chr1664766 3944 3847 1998 214 162 33315 1113 317 43856 1177 405 110 --
NM_001042481chr1472633 2519 2385 2028 664 549 131 ----1749
NM_001042492chr1753401 3139 3061 830 816 --22871 1325 12581
NM_001042555chr1283832 3722 3236 1384 1304 922 822 34 14551 24197 3582 --
NM_001042599chr2137329 7251 7013 6347 6215 5606 5103 5069 4794 3137 2434 2120 1903 --25956 1995 27287 5212
NM_001042603chr1295155 4281 2077 1508 1435 1080 649 586 576 13783 11345 --
NM_001042604chr3124665 4072 4002 3712 3363 2975 1429 1199 990 847 618 585 13593 14752 --
NM_001071775chr1351698 1607 722 647 65 ----11747
NM_001099678chr3136184 6120 5540 5501 5174 5097 5051 4241 2424 1950 1629 208 142 ------
NM_001106chr3179783 9232 9181 8897 8886 7805 7673 7523 6831 6322 6187 6035 2682 2378 1708 1551 1519 26226 764 --19255
NM_001167chrX106639 5774 5649 4772 4238 1320 1308 1141 887 422 26732 1684 --11059
NM_001173chr14114492 4326 3642 3568 3553 3095 1591 1323 1101 739 655 1933 13590 14132
NM_001201chr483930 3337 1500 1289 855 666 312 246 13118 ----
NM_001204chr2117584 7495 7252 7110 6351 5719 5551 2314 2294 1979 1821 15575 36041 5174 2168 15804
NM_001219chr741815 395 265 233 ----21676 220
NM_001315chr682227 2047 1698 1582 1518 1510 705 606 1235 1178 --
NM_001682chr1252882 2562 2240 1888 1147 1631 12607 1464
NM_001695chr873473 1554 1390 904 652 544 41 --21600 1003 33412 3397 3349
NM_001777chr353941 3526 1519 1358 1274 --11542 11262
NM_001858chr664282 4212 4196 3890 3160 752 ----23524 346
NM_001918chr187970 5869 5789 1737 1398 1226 255 106 --28475 955 18451
NM_001949chr6113247 3167 3088 3027 2809 2760 2727 2705 2141 2018 750 1698 1770 1796
NM_002015chr13123346 3018 2602 2544 951 904 709 660 470 423 363 333 ----21221 862
NM_002025chrX138548 8497 8213 8171 8094 7908 6106 2957 2933 2303 534 468 259 --26272 2694 17210
NM_002137chr782229 2170 2109 1701 604 339 297 180 12388 ----
NM_002158chr293749 3245 3173 2918 2755 1276 1011 291 224 --1631 --
NM_002210chr2103507 3258 2979 2785 2767 2727 2289 1342 750 423 --13459 --
NM_002264chr3125052 4959 4656 4642 3515 3439 2026 1971 1372 777 748 321 163 1966 1706
NM_002270chr565648 5636 4749 4743 3602 984 21342 322 1226 25130 1043
NM_002285chr243695 1484 584 160 --11354 24047 2904
NM_002310chr575405 4075 1821 1713 1310 832 233 25580 1576 1352 15967
NM_002336chr12125079 4971 4027 3998 3597 1922 1546 1248 616 241 226 157 ------
NM_002380chr84870 717 388 259 --127 1745
NM_002387chr554960 4171 4112 1834 668 1183 1939 24669 3869
NM_002514chr811163 1967 --2886 303
NM_002595chr12101820 1560 1534 1413 1399 1375 1335 758 273 194 ------
NM_002655chr895255 5095 5064 4956 4160 3756 418 180 109 1929 11743 33401 1854 1394
NM_002737chr17126666 6613 6398 5530 5431 4848 2005 1755 1362 957 706 129 26189 2131 ----
NM_002745chr22113744 3585 3574 3337 3276 3229 2877 1627 1100 797 154 1524 13736 --
NM_002838chr14790 287 242 183 ----2123 61
NM_003034chr1278129 6860 6525 1700 1452 1224 837 --16052 17871
NM_003099chr1596558 6542 4350 2467 2281 2168 1566 1200 517 --22486 2129 --
NM_003108chr2147138 6856 6588 5319 5279 5137 1540 1427 1184 1153 978 843 352 67 15031 36878 1471 1217 14608
NM_003112chr7103086 3058 2883 2555 2134 2122 2003 1990 916 233 --23234 1962 12084
NM_003199chr1885032 4245 3739 1885 1033 371 330 107 ----35275 4435 4093
NM_003203chr251800 963 750 664 622 ----21926 975
NM_003262chr365100 4578 4372 969 901 611 --35307 1304 90 1527
NM_003410chrX83105 2920 2722 2396 2344 2096 1979 1015 ----126
NM_003468chr274224 3350 3090 1755 844 633 270 --24240 3772 24016 2743
NM_003574chr18115663 5641 5576 5085 5044 4988 3540 2305 1679 626 111 --35377 4255 288 --
NM_003583chr1293910 3540 3417 3131 2842 2525 706 219 115 --11282 --
NM_003615chr373655 3649 2939 2802 1271 483 140 13887 --21006 760
NM_003873chr1072465 2362 2344 2237 2187 982 764 ----1323
NM_003966chr597790 7392 7144 6940 6896 6812 5757 3112 2066 17127 27730 2023 --
NM_004171chr1199652 8345 8302 8067 7001 6690 6658 6097 2112 18831 --16143
NM_004232chr1873818 3755 3625 3209 2466 1371 868 21166 1157 ----
NM_004338chr18126808 6488 5681 5139 5110 4983 4728 1838 1446 1334 556 419 16357 ----
NM_004392chr1392344 2291 1672 1039 547 468 390 217 115 ----11804
NM_004432chr9122410 2395 1929 1813 1624 957 894 844 525 425 357 90 --11524 --
NM_004501chr164121 3488 902 879 317 164 13170 23014 136 1683
NM_004612chr974735 4063 4015 3738 3637 1280 576 --44235 3219 1005 790 --
NM_004719chr1262822 2673 2067 1906 1140 650 ----22519 1083
NM_004815chr1104801 4369 3724 1858 1216 891 497 193 96 66 --148 23500 3179
NM_004866chr584810 4776 4479 3983 3326 3056 1687 658 15011 24836 513 14680
NM_004904chr7136561 6553 6431 6343 6325 6307 6301 5434 5096 4703 1666 950 448 25408 4415 ----
NM_004985chr1254485 4309 4279 3664 54 --24329 3622 23447 3317
NM_004992chrX108445 8378 8283 7117 7055 6205 5525 5293 3346 1106 --18354 12413
NM_004992chrX108445 8378 8283 7117 7055 6205 5525 5293 3346 1106 --18354 12413
NM_004999chr674337 1748 1633 1351 1067 997 862 23031 977 --12783
NM_005056chr1295399 4525 1752 1679 1324 893 830 820 92 14027 11589 --
NM_005065chr14125106 4722 4673 4164 3999 3908 3895 3628 1604 1322 1098 676 11497 ----
NM_005156chr9125373 5313 5146 5012 4693 4330 1883 1120 991 472 365 161 14266 14310 --
NM_005171chr1231251 1183 987 ----2210 28
NM_005188chr11108364 8011 7188 6813 6503 5702 5502 3042 2631 1494 16198 --13215
NM_005235chr2137329 7251 7013 6347 6215 5606 5103 5069 4794 3137 2434 2120 1903 --25956 1995 27287 5212
NM_005359chr1872550 1849 1204 1113 1035 852 424 --36465 6081 2250 14186
NM_005399chr164416 4262 4042 3058 3032 3014 33715 3117 1624 23930 660 21773 1376
NM_005400chr252958 2939 2777 1059 636 1645 --1663
NM_005436chr1093200 3069 3000 2605 1407 1236 882 340 174 11476 13289 --
NM_005497chr17114864 4667 2281 1555 1344 1108 653 353 347 296 236 --23762 1209 24875 1800
NM_005502chr983214 3048 2891 2807 2727 2441 1034 554 176 1196 11105
NM_005504chr12166651 6521 6335 6315 6078 5879 5344 4152 4128 2238 2195 817 690 632 372 293 --34852 1582 119 16451
NM_005596chr995854 5083 4508 4500 4382 4034 3981 2012 1622 25774 3969 26277 5935 --
NM_005637chr1892094 2011 1788 1571 776 419 373 323 261 1122 1157 1708
NM_005668chr594612 4577 4393 4334 4082 3906 3768 2840 828 13788 --24507 1318
NM_005759chr284586 4531 4427 4304 3038 1810 1125 200 --11396 34117 3643 629
NM_005813chr262587 2424 2323 2236 2195 251 ----176
NM_005832chr381297 1174 945 937 905 585 201 82 ----11350
NM_005901chr18188602 8369 8265 8182 7432 6899 6793 6668 2771 2729 2496 2342 2184 1770 1690 1381 1148 467 23436 148 1653 --
NM_005903chr5115067 4974 4643 4538 3787 1515 949 658 171 150 143 15095 1985 14754
NM_005955chr195450 5401 4073 3629 3503 2192 2012 851 556 ----24131 380
NM_005966chr252359 2132 1754 413 317 22006 560 --21936 1594
NM_005986chr136817 632 585 352 256 95 --1487 1995
NM_006047chr20112991 2840 2634 2604 2586 2391 2296 906 662 600 256 12350 ----
NM_006252chr197400 6785 5261 2263 1803 1770 1368 1247 546 26985 182 ----
NM_006256chr182557 2356 2210 1091 1038 1001 896 515 --12103 --
NM_006275chr2032508 638 251 --1133 31532 554 202
NM_006282chr20104622 4581 4530 4411 4360 3565 3205 3032 966 118 --24515 1907 --
NM_006393chr1084420 4204 4161 3859 3124 3097 614 213 --23565 2888 23686 296
NM_006403chr62263 73 ----31695 291 94
NM_006482chr1293910 3540 3417 3131 2842 2525 706 219 115 --11282 --
NM_006538chr284065 2731 986 743 659 381 368 278 43447 2854 2802 115 ----
NM_006544chr14145586 5365 4472 4000 3988 3888 3743 2399 2258 1745 1730 1256 760 119 ------
NM_006561chr10105893 3883 2466 2404 1303 1177 1029 969 808 668 11010 11861 1615
NM_006599chr16148243 8090 6945 6849 6116 3249 2485 2097 2003 1970 1691 1643 1339 57 --37610 3065 2087 --
NM_006614chr3103613 3601 3595 3472 3167 3002 2699 1069 982 685 --11280 --
NM_006628chr15104418 3604 1730 1675 851 721 710 491 411 344 1144 12946 --
NM_006654chr1283832 3722 3236 1384 1304 922 822 34 14551 24197 3582 --
NM_006717chr983148 3015 2116 1325 1214 978 718 181 ----3501 55 31
NM_006731chr995805 5625 4947 4453 3566 1603 1172 1163 610 1468 25760 5399 --
NM_006750chr1688092 7937 7385 6519 5697 4976 2117 385 --32789 1321 1156 --
NM_006885chr1693361 2593 1496 1429 1349 1304 949 931 787 14192 13241 --
NM_006918chr11115893 5843 4898 4580 4520 1426 1175 1164 1067 898 272 --21961 1653 14628
NM_006924chr1764256 4243 3392 2827 651 279 34123 3106 413 33599 676 307 125
NM_007007chr12114705 4691 4481 4212 3826 3791 3705 3304 3104 1639 1111 12926 23333 333 --
NM_007038chr21106042 5938 5566 5527 5394 5008 3910 1090 1039 388 --46096 4810 4677 2120 --
NM_007175chr873553 3393 3321 3291 3285 602 231 1906 12743 12665
NM_007249chr1399391 9346 8387 7981 7678 6970 2381 2183 1947 17168 1288 --
NM_012164chr997447 7134 7029 6976 6386 5327 4921 1573 233 15166 12625 --
NM_012193chr1165435 5093 4382 1891 1025 776 12148 --34743 1752 557
NM_012214chr255709 2540 2412 1100 484 35658 4867 837 34979 4441 3888 --
NM_012262chr175035 4690 3201 1516 789 468 110 --34521 4124 4003 13462
NM_012287chr384537 4424 4293 3879 3728 3504 3177 1047 ----24007 3358
NM_012309chr11103931 3535 3444 3309 3265 3184 3097 1807 1765 348 --24459 4151 14368
NM_013255chr7108783 7612 7103 7048 5530 3356 2582 1983 1181 1108 28824 1019 11050 11817
NM_013943chr162698 2586 2517 1325 875 453 ----22369 604
NM_013995chrX82502 2432 2411 2344 821 606 425 401 --22421 1736 --
NM_014021chr193261 2820 2708 2623 2377 2320 968 762 493 --11364 --
NM_014048chr16145303 5258 5239 5109 4347 4140 3611 1583 1548 1529 811 785 604 593 ------
NM_014155chr11177276 7171 7159 6929 6793 6281 6204 6161 5430 5170 4959 4601 2439 1898 1823 717 279 --16148 11431
NM_014421chr432092 1851 526 --12062 21639 246
NM_014423chr595600 5559 5187 4999 4931 4172 3859 1885 1795 1568 35447 3723 458 11714
NM_014447chr461663 1570 1042 548 381 241 1541 --11434
NM_014586chr2154570 4543 3467 3081 1757 --24477 4347 23090 1268
NM_014682chr892259 2205 2138 2122 2103 2090 2061 560 273 ------
NM_014701chr1563367 3086 2729 2101 1224 231 --1131 1648
NM_014733chr572202 1997 1875 1534 775 508 389 ----11775
NM_014739chr653013 1197 791 773 224 13293 23937 962 11122
NM_014746chr2124417 4310 4277 4217 4191 3988 3663 3564 3282 1495 1378 628 ------
NM_014751chr842073 421 298 199 --1100 21328 411
NM_014787chr172285 2257 2226 2185 1909 968 957 ----11815
NM_014877chr17117554 6566 6073 5669 3077 2958 1730 889 650 245 47 --16241 15533
NM_014904chr1073806 3389 3341 1626 1602 1278 973 12462 --1392
NM_014912chr10113411 3320 3141 2974 2965 2739 2679 2614 2325 780 360 ----11139
NM_014936chr6102614 2443 2262 1082 787 492 438 429 396 230 ------
NM_014946chr283054 2945 2848 2700 1213 1173 312 126 1804 ----
NM_015026chr1284072 3995 3480 3176 2991 2927 1062 822 13674 1307 --
NM_015032chr1372317 2164 2026 1066 523 420 414 12203 1158 --
NM_015040chr263185 2880 2868 2602 717 426 --22730 2234 1406
NM_015115chr483240 2861 1230 1158 925 276 203 75 --1348 11188
NM_015137chr852204 1841 971 916 33 ----12267
NM_015208chr1883764 3526 3397 3076 2600 2548 659 653 ------
NM_015247chr1664766 3944 3847 1998 214 162 33315 1113 317 43856 1177 405 110 --
NM_015271chr444192 4025 644 401 ----23755 3366
NM_015310chr8108048 7671 6124 5687 5240 3280 3143 2420 1787 1417 38185 7762 6541 38016 5662 1939 --
NM_015317chr292793 2349 1819 1795 1138 826 304 143 56 12561 ----
NM_015329chr1962872 2809 2800 1833 1822 776 ----12928
NM_015336chr1232679 2217 1975 1945 42303 2203 2102 641 --
NM_015458chr8115111 5081 4799 4629 4622 4487 1763 1525 953 471 282 --23251 1209 --
NM_015554chr1572907 2784 2679 2184 832 800 455 ----1110
NM_015565chr2162299 888 663 318 267 186 --12119 1486
NM_015569chr1134537 4224 4204 3959 3507 3442 2992 1775 1469 1332 954 941 242 ------
NM_015640chr1115195 4945 4677 4501 3326 2076 1122 362 278 204 34 ------
NM_015678chr1391472 1360 1216 468 431 286 165 143 107 1518 11557 --
NM_015902chr84892 759 693 639 ----2333 50
NM_015906chr1114401 4249 3826 3751 3281 3097 2928 1507 1426 1080 978 24777 3180 11585 --
NM_016045chr2081581 1493 1451 1200 672 665 631 471 ------
NM_016206chr3129011 7879 7557 6400 6334 6118 5883 2628 2443 2181 1891 1816 18590 38684 6243 380 1405
NM_016260chr2107505 7478 7468 6986 6882 5093 2733 1710 1308 546 11832 22636 245 22657 145
NM_016374chr171621 1463 1406 1256 1163 1152 431 21344 1172 ----
NM_016374chr171621 1463 1406 1256 1163 1152 431 21344 1172 ----
NM_016530chr1572847 2529 1655 811 730 381 356 --12542 11358
NM_016531chr484128 3702 2739 2569 1235 1157 1043 591 12627 --1848
NM_016953chr2106014 5710 5640 4835 4503 4494 1718 472 443 372 22026 1109 ----
NM_017447chr2184366 4131 3246 3131 3025 1503 954 84 --33593 3533 3098 --
NM_017563chr3106372 6313 6050 5590 4688 4643 3963 1443 405 283 14218 16228 --
NM_017594chr953075 2980 2610 2372 1210 --1983 13009
NM_017637chr9109439 8168 7548 6989 3662 3125 2546 2032 1567 472 ------
NM_017644chr3125095 5069 4348 3834 2057 2007 1827 1557 843 260 250 90 --13981 13370
NM_017658chr14104634 4621 4495 4438 3953 2895 1668 1254 1042 681 24470 1772 14416 --
NM_017664chr132983 166 ----2906 737
NM_017736chr16103068 2773 2702 1177 1168 1083 511 464 456 101 12263 ----
NM_017813chr8135623 5516 4553 2259 2112 1502 1241 997 796 690 383 264 190 --14537 14681
NM_018084chr273354 2831 2814 2795 2670 2600 1046 --12313 1480
NM_018155chr3113255 2723 2597 2269 2155 2104 1378 1247 1077 947 138 13224 1743 12684
NM_018181chr18111730 1532 1340 1299 1269 1250 470 368 302 245 199 ------
NM_018323chr451793 1294 613 578 232 --11225 1223
NM_018362chr11104066 3911 3670 3340 2495 1448 1398 1298 812 525 --13970 --
NM_018364chr164069 3996 3413 3120 1489 609 --24030 804 12705
NM_018374chr7115278 5246 5220 4376 4233 4223 3417 1787 693 682 189 ------
NM_018437chr93559 512 24 ----2365 123
NM_018440chr8107994 7498 6766 5581 5458 3091 2911 2179 1934 822 11881 --17804
NM_018566chr1104766 4506 4311 4128 4037 3789 1936 1734 1081 1044 2432 325 ----
NM_018638chr1295218 5158 4972 4817 4665 4347 4317 2094 1651 11966 ----
NM_019001chr3124665 4072 4002 3712 3363 2975 1429 1199 990 847 618 585 13593 14752 --
NM_019593chr2093083 3010 2947 2704 2425 2230 958 909 474 12200 2946 884 11234
NM_020119chr794000 3948 3827 3028 2704 1409 1227 1072 423 ------
NM_020228chr1172590 2292 2193 2008 1577 794 85 11905 1429 1313
NM_020390chr394873 4487 3291 3218 3148 1839 1591 1089 745 ----1205
NM_020673chr20117311 7133 6360 6136 5851 5206 1607 1482 888 328 303 25579 383 27377 352 --
NM_020727chr21114048 3982 3548 3498 3165 1528 1458 1377 1310 571 200 12625 33466 2885 549 12794
NM_020772chr17147797 7660 7211 6102 3428 3400 3235 2935 2813 2378 2130 1849 1498 1333 --27896 663 18647
NM_020774chr18105378 5329 4365 3886 2249 2158 2142 1300 349 314 --21614 1437 --
NM_020782chr1284826 4023 3892 1707 1661 1279 1026 973 23200 1833 --1995
NM_020783chr18112419 2405 2383 1987 1606 1485 915 793 700 540 468 ------
NM_020841chr1283956 3848 2819 2786 2647 1230 322 237 --11012 23081 658
NM_020909chr2114154 4020 3560 3534 3517 3491 3474 3448 2890 2689 1436 --197 13304
NM_020935chr2114649 4542 4482 4105 3909 3619 3421 3409 1376 663 514 ------
NM_021033chr1363476 3426 2300 1006 595 577 ----12923
NM_021148chr752244 2119 1833 357 329 12090 21001 315 --
NM_021255chr1494142 4014 3176 3021 1411 601 312 241 81 13391 13639 --
NM_021629chr385065 4896 4565 4017 1433 389 356 281 11657 32046 1108 827 --
NM_021961chr11197469 7370 7262 7231 6875 6739 6262 6189 5965 5246 4975 4777 4574 1811 1615 656 512 337 196 15695 27451 4612 25957 5060
NM_022080chr2072681 2143 2105 1902 668 532 192 --12503 22653 286
NM_024408chr183686 3647 3624 3088 2888 534 500 41 ----1226
NM_024665chr364471 4313 4130 3746 3341 417 1659 44255 3234 1336 930 13775
NM_024947chr3148773 8593 8221 7470 6983 6897 2946 2317 1945 1844 1740 1371 643 99 19599 23822 1217 36127 1834 1462
NM_024989chr2147972 7931 6422 5831 5718 5552 5359 5222 5051 3026 2347 2150 905 148 --25697 189 --
NM_030583chr84870 717 388 259 --127 1745
NM_030627chr584136 3996 3919 3375 3014 2956 1066 1049 --1102 1164
NM_030650chr283548 3337 2631 1166 1119 1090 813 801 13402 13747 --
NM_030806chr1108750 8095 6297 6228 3251 3048 2501 2486 1324 1020 26912 2867 ----
NM_030920chr132099 2028 1490 21645 221 11949 21997 587
NM_031216chr1861969 1525 1435 749 548 181 --1630 1502
NM_031243chr782229 2170 2109 1701 604 339 297 180 12388 ----
NM_031296chr472340 2329 2247 2057 953 145 138 12730 ----
NM_031371chr171621 1463 1406 1256 1163 1152 431 21344 1172 ----
NM_031371chr171621 1463 1406 1256 1163 1152 431 21344 1172 ----
NM_031427chr1466003 5965 4980 3992 2145 1198 11020 15893 24444 296
NM_031844chr164121 3488 902 879 317 164 13170 23014 136 1683
NM_032116chr13185866 5826 5468 5333 5003 4965 4447 4429 4373 3938 2169 1961 1871 1845 1383 771 419 206 15504 ----
NM_032199chr1083866 3776 3654 2790 1527 1438 737 283 --21105 168 1872
NM_032352chr1431443 422 384 --1125 1588
NM_032373chr1075786 5686 4590 919 513 451 223 35705 1015 600 25589 360 --
NM_032440chr1062918 2579 2436 2273 1914 896 --11103 12351
NM_032458chrX83387 2596 2287 1360 1340 1261 424 186 --23394 147 1761
NM_032838chr192955 441 ----31076 321 113
NM_032968chrX104075 4069 3177 2956 1645 1595 870 625 566 93 ----1957
NM_032969chrX104075 4069 3177 2956 1645 1595 870 625 566 93 ----1957
NM_032973chrY104067 4061 3172 2951 1639 1594 870 625 566 93 --1489 1957
NM_033020chr1114401 4249 3826 3751 3281 3097 2928 1507 1426 1080 978 24777 3180 11585 --
NM_033083chr382996 2906 2768 2607 1127 1104 1091 645 --21291 707 12281
NM_033224chr778085 6490 6484 2976 2138 1799 1638 --27594 1847 27494 4984
NM_033285chr8104441 4429 4348 3826 3439 3151 1261 359 207 39 24153 687 ----
NM_033360chr1264606 4430 4400 3785 175 133 --24450 3743 23568 3438
NM_033389chr1763543 1690 1225 1169 418 42 11646 14578 13646
NM_033430chr4104175 3870 3582 3258 2560 882 611 349 263 188 ------
NM_033437chr4104175 3870 3582 3258 2560 882 611 349 263 188 ------
NM_033505chr292414 2071 1745 1729 1445 1274 1143 770 397 25682 4968 35671 5405 4371 --
NM_033656chr2145974 5331 3925 1284 23743 972 41725 1608 1160 180 15761
NM_052879chr1294067 3035 2632 2605 2546 1517 1365 947 525 ------
NM_080759chr1392344 2291 1672 1039 547 468 390 217 115 ----11804
NM_080760chr1392344 2291 1672 1039 547 468 390 217 115 ----11804
NM_080867chr1464138 3731 1862 1392 867 543 --14562 11874
NM_080921chr14790 287 242 183 ----2123 61
NM_130809chr583125 2502 2455 1152 966 894 772 441 --12979 --
NM_133334chr495281 5101 4688 4504 4350 4044 2214 1156 353 25927 476 --1373
NM_133445chr9123611 2756 2734 2656 2406 2390 2354 2334 864 430 76 63 ------
NM_133496chr1113836 3435 3296 3071 2912 2812 1074 608 557 383 221 --1155 11200
NM_138286chr1993664 3353 3087 1277 713 428 390 348 149 --24124 1734 --
NM_138426chr742483 2384 1850 1706 ----21986 180
NM_138621chr284065 2731 986 743 659 381 368 278 43447 2854 2802 115 ----
NM_138713chr16148243 8090 6945 6849 6116 3249 2485 2097 2003 1970 1691 1643 1339 57 --37610 3065 2087 --
NM_138714chr16148243 8090 6945 6849 6116 3249 2485 2097 2003 1970 1691 1643 1339 57 --37610 3065 2087 --
NM_138959chr1106397 5833 5627 2310 2262 1646 1609 1545 1336 439 35880 5661 371 ----
NM_139012chr682227 2047 1698 1582 1518 1510 705 606 1235 1178 --
NM_139014chr692307 2127 1778 1662 1598 1590 785 686 44 1315 1258 --
NM_144571chr4166845 6527 6454 6259 5054 4902 4502 4396 2691 2430 2283 2113 1880 1533 152 142 --25467 4451 12096
NM_144578chr14125123 4871 4773 4712 4424 4132 4008 3556 3485 1165 1077 736 11286 ----
NM_144664chr1192614 2562 2132 1896 884 768 727 648 137 1874 ----
NM_144722chr571195 1049 341 288 127 119 47 --21128 955 --
NM_144778chr1322704 1867 ----32032 1803 799
NM_144973chr12115184 4089 4080 4071 2128 1413 1357 1029 706 477 162 1484 11125 --
NM_144979chr46704 647 629 533 500 32 1169 143 --
NM_145259chr267061 6563 5146 4758 4309 1051 25435 4598 22440 830 --
NM_145735chr1372444 2284 2171 1908 1725 645 367 1460 22781 2383 1145
NM_148955chr1596558 6542 4350 2467 2281 2168 1566 1200 517 --22486 2129 --
NM_152330chr1472633 2519 2385 2028 664 549 131 ----1749
NM_152442chr1261375 1284 1202 465 407 383 --1391 --
NM_152622chr583468 3434 2953 2396 2313 1241 412 309 --21322 975 --
NM_152624chr5147436 7176 7073 6764 5993 5938 5725 5054 2931 2885 2675 2039 487 280 21367 817 12619 --
NM_152641chr1262212 1065 1059 888 786 625 22029 904 --1838
NM_152756chr5114286 3727 3280 3264 1456 1370 1243 1186 1142 1012 540 1427 14108 153
NM_152758chr892929 2520 2190 1865 1189 1166 513 405 260 ------
NM_152826chr1596558 6542 4350 2467 2281 2168 1566 1200 517 --22486 2129 --
NM_152838chr20112991 2840 2634 2604 2586 2391 2296 906 662 600 256 12350 ----
NM_153188chr565648 5636 4749 4743 3602 984 21342 322 1226 25130 1043
NM_153607chr5103024 2617 2156 1951 1282 1195 910 642 600 323 ------
NM_153810chr1065112 4615 3759 1517 612 152 --23296 3105 33213 1600 380
NM_170606chr781554 1500 1445 1398 759 658 623 306 11457 --11857
NM_172071chr1107261 7252 6861 5947 5185 5088 4645 2364 2107 412 --26342 2493 --
NM_172373chr1341353 1308 328 106 ----11245
NM_173214chr16148243 8090 6945 6849 6116 3249 2485 2097 2003 1970 1691 1643 1339 57 --37610 3065 2087 --
NM_173468chr495891 5517 5294 4858 4277 1902 1850 566 342 ------
NM_173531chr1993276 2605 2500 2385 2371 932 614 561 289 ----13499
NM_173642chr1108666 7356 7196 6770 3524 3104 1910 1823 924 633 --1168 1579
NM_173698chrX61829 1697 1360 773 416 360 ----11761
NM_173829chr575884 5367 2002 1159 675 266 235 32047 1308 533 25754 980 --
NM_175861chr1285623 5123 4474 4260 3698 1776 1372 1017 --24910 4526 1515
NM_176814chr761240 1137 1102 1087 1024 534 ----146
NM_177538chr2158077 7465 6407 6267 5959 5800 3482 3040 2383 2250 1672 273 130 118 99 ------
NM_178151chrX96854 6712 6426 5647 2939 2553 1539 385 53 --36967 5925 2065 25952 1971
NM_178152chrX96854 6712 6426 5647 2939 2553 1539 385 53 --36967 5925 2065 25952 1971
NM_178153chrX96854 6712 6426 5647 2939 2553 1539 385 53 --36967 5925 2065 25952 1971
NM_178509chr1782986 2900 2689 1321 1179 930 299 150 ----2547 518
NM_181358chr1124056 3536 2923 2805 2750 1625 1326 1228 1110 397 233 190 ------
NM_181361chr381297 1174 945 937 905 585 201 82 ----11350
NM_181481chr18126808 6488 5681 5139 5110 4983 4728 1838 1446 1334 556 419 16357 ----
NM_181482chr18126808 6488 5681 5139 5110 4983 4728 1838 1446 1334 556 419 16357 ----
NM_181483chr18126808 6488 5681 5139 5110 4983 4728 1838 1446 1334 556 419 16357 ----
NM_181521chr16117214 6729 5792 5691 5127 4580 2281 2255 1339 864 307 16502 25917 5708 --
NM_181836chr552533 1673 1065 688 177 12683 32409 2149 621 --
NM_182485chr4133732 3360 3274 3129 3110 2962 2810 2674 1040 1021 969 241 207 ----12645
NM_182646chr4133732 3360 3274 3129 3110 2962 2810 2674 1040 1021 969 241 207 ----12645
NM_182898chr7136561 6553 6431 6343 6325 6307 6301 5434 5096 4703 1666 950 448 25408 4415 ----
NM_182899chr7136561 6553 6431 6343 6325 6307 6301 5434 5096 4703 1666 950 448 25408 4415 ----
NM_194071chr775456 5265 4243 4176 1464 1440 1202 --35400 4519 1330 --
NM_194247chr2134072 3998 3558 3033 2986 1168 754 688 632 505 394 341 284 --24408 2754 --
NM_194314chr1125634 4144 3928 3909 2199 1786 1450 1364 1010 967 801 213 --33682 634 74 14849
NM_194434chr18115663 5641 5576 5085 5044 4988 3540 2305 1679 626 111 --35377 4255 288 --
NM_197978chr93559 512 24 ----2365 123
NM_198268chr1124056 3536 2923 2805 2750 1625 1326 1228 1110 397 233 190 ------
NM_198269chr1124056 3536 2923 2805 2750 1625 1326 1228 1110 397 233 190 ------
NM_198270chrX73373 3334 3291 3282 3274 3080 2407 ------
NM_198715chr1104962 4896 4676 4359 3971 2164 1302 1204 1077 650 15694 ----
NM_198793chr353937 3522 1515 1354 1270 --11538 11258
NM_198859chr3115155 4011 3658 3325 3142 2011 1998 1916 1583 460 453 23809 1290 1647 --
NM_199188chr1294067 3035 2632 2605 2546 1517 1365 947 525 ------
NM_199190chr1294067 3035 2632 2605 2546 1517 1365 947 525 ------
NM_199324chr4103619 3527 2894 2604 2515 1456 1300 1268 1107 898 --13665 --
NM_199421chr1464138 3731 1862 1392 867 543 --14562 11874
NM_199436chr283054 2945 2848 2700 1213 1173 312 126 1804 ----
NM_199437chr1172590 2292 2193 2008 1577 794 85 11905 1429 1313
NM_199438chr1172590 2292 2193 2008 1577 794 85 11905 1429 1313
NM_199439chr1172590 2292 2193 2008 1577 794 85 11905 1429 1313
NM_203463chr261868 711 622 274 268 238 14701 1192 23794 1854
NM_206853chr664128 4096 3067 1624 958 599 --33846 3285 647 --
NM_206854chr645389 5357 4328 1860 --45107 4546 3722 1908 --
NM_206855chr676354 6322 5293 4083 3850 438 356 --36072 5511 4687 --
NM_206909chr8108048 7671 6124 5687 5240 3280 3143 2420 1787 1417 38185 7762 6541 38016 5662 1939 --
NM_207304chr1322591 1754 ----31919 1690 686
NM_207406chr4106338 5883 5789 5460 4509 2549 1532 1468 1008 23 16170 25798 731 11286
NM_212558chr984065 3676 1439 1341 1016 974 593 281 23847 3768 ----