TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1284
miRNA Sequence: UCUAUACAGACCCUGGCUUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr5113674 3617 3574 3504 2778 1472 1247 1021 785 474 58 1845 23620 416 --
NM_000242chr1072276 2103 1757 1072 809 760 750 12398 32599 2200 730 --
NM_000264chr953148 1027 384 371 199 32135 1299 940 --12442
NM_000806chr531351 767 376 --1519 21962 1949
NM_000809chr4108204 7430 6731 6616 2939 1920 1912 1498 657 107 --28069 6678 --
NM_000813chr585610 5005 3958 3432 3424 1994 1832 1388 ----14521
NM_000814chr1561034 992 228 188 176 132 1870 1754 1232
NM_000950chrX93517 2547 2280 1315 747 414 296 276 266 --1279 --
NM_000959chr173945 2963 2910 2719 1392 1304 1202 --1467 12942
NM_001003652chr18118617 7892 7791 7434 5324 2296 1724 1702 1694 910 306 ------
NM_001003674chr1896945 6678 6171 5895 4995 4730 4655 1345 639 ----15073
NM_001003675chr1896945 6678 6171 5895 4995 4730 4655 1345 639 ----15073
NM_001004317chr684340 3910 3735 2982 724 330 263 62 --34267 1672 1555 1334
NM_001005473chr5114500 4485 4462 4402 2401 2362 2253 2004 1985 1934 441 25963 5055 2736 406 16568
NM_001007024chr17--13486 --34390 2826 1452
NM_001007025chr17--13486 --34390 2826 1452
NM_001009899chr3116328 5749 5483 5334 4868 4059 1207 1187 1173 1064 110 --11454 26505 4535
NM_001010888chrX94671 4319 3952 3660 3060 2982 1019 1009 977 1752 24271 1082 --
NM_001013620chr12127452 6124 5893 5883 5870 5554 2643 1765 1478 1292 672 295 17742 16127 --
NM_001014380chr1385612 4695 4404 4341 4276 3891 2171 389 --44956 3941 3738 808 15007
NM_001018067chr1104902 4876 4798 4503 4443 3738 1456 911 855 334 --23860 3329 --
NM_001018068chr1104902 4876 4798 4503 4443 3738 1456 911 855 334 --23860 3329 --
NM_001018069chr1104902 4876 4798 4503 4443 3738 1456 911 855 334 --23860 3329 --
NM_001018074chr5113674 3617 3574 3504 2778 1472 1247 1021 785 474 58 1845 23620 416 --
NM_001018075chr5113674 3617 3574 3504 2778 1472 1247 1021 785 474 58 1845 23620 416 --
NM_001018076chr5113674 3617 3574 3504 2778 1472 1247 1021 785 474 58 1845 23620 416 --
NM_001018077chr5113674 3617 3574 3504 2778 1472 1247 1021 785 474 58 1845 23620 416 --
NM_001024094chr5113674 3617 3574 3504 2778 1472 1247 1021 785 474 58 1845 23620 416 --
NM_001030055chr1484584 3371 3186 3150 1570 1394 857 741 31875 863 452 11326 --
NM_001039585chr174202 3220 3167 2976 1649 1561 1459 --1724 13199
NM_001039618chr1185049 4943 3999 3795 1994 1980 1240 1036 12325 34969 4822 4541 13870
NM_001039840chrX115497 5382 4533 3828 2350 2226 2071 1819 1736 1381 755 ----14335
NM_001040142chr281716 826 810 798 790 782 535 122 ------
NM_001040143chr281716 826 810 798 790 782 535 122 ------
NM_001040159chr41121 --21508 973 21250 1172
NM_001040402chr462935 2254 640 284 278 255 ----12948
NM_001040450chr1542422 1994 1767 522 ----22273 804
NM_001040453chr1542422 1994 1767 522 ----22273 804
NM_001042555chr1284112 3913 3834 3771 3750 3256 1915 924 --13246 --
NM_001044385chr2103885 3722 3156 2907 2723 1315 951 546 87 79 --13888 --
NM_001099678chr3105542 5260 4699 4434 2275 1631 1539 810 504 412 --22317 1258 14612
NM_001100108chr1118052 7832 7252 3100 3085 2929 2846 1042 979 267 191 --27669 7167 --
NM_001173chr1484584 3371 3186 3150 1570 1394 857 741 31875 863 452 11326 --
NM_001201chr493912 3699 3475 3339 3198 3083 2601 1161 558 13975 13531 --
NM_001204chr2117526 7497 7112 5969 5721 5636 2920 2794 2584 1834 272 ------
NM_001364chr1184653 4614 4292 4094 4070 807 243 149 --24077 537 2734 593
NM_001412chrX63449 2702 2336 782 734 391 13005 --1380
NM_002006chr4105756 5546 4946 4339 4318 3691 2300 506 191 90 --24323 93 --
NM_002128chr1352580 2369 2103 228 104 --1144 22229 1895
NM_002310chr596418 5256 4825 3991 2226 1624 605 366 184 --12481 12439
NM_002594chr2072088 1930 1905 1897 1877 1867 1816 ----1774
NM_002645chr1183072 2816 2778 2549 2257 1089 781 397 --1104 11052
NM_002655chr8115101 5066 5021 4958 4751 4345 3758 3352 407 111 35 --31046 787 40 --
NM_003298chr396136 4124 4115 4097 4086 1245 490 442 354 ----11249
NM_003468chr2114226 4166 3780 3764 3450 3302 3083 2784 1746 1416 1372 --23940 3756 --
NM_003489chr2162907 2864 2853 2709 231 65 ----12939
NM_003566chr1273417 3164 3090 2591 2530 1390 843 ----13128
NM_003677chr12101983 1820 240 220 198 172 158 144 122 104 --11708 --
NM_003913chr6104263 4181 4106 3225 1505 1244 948 438 250 75 ----11707
NM_003948chr482056 2019 630 437 429 355 326 304 --22243 2161 --
NM_004171chr11119654 9298 8978 8139 8015 6692 6660 1914 1361 853 660 17037 18070 38117 3454 2935
NM_004232chr1883900 3865 3746 3728 3256 730 351 120 --13556 12470
NM_004274chr1472419 2070 1074 884 860 852 642 ------
NM_004338chr1896945 6678 6171 5895 4995 4730 4655 1345 639 ----15073
NM_004744chr453889 3640 157 36 27 13402 --23708 3331
NM_004871chr17--13486 --34390 2826 1452
NM_005124chr61664 ----3419 402 315
NM_005359chr1896476 4131 1482 1265 1082 653 426 344 264 12517 --21493 1208
NM_005502chr973216 2814 2489 2428 1300 1129 332 11120 22764 212 --
NM_005668chr5114579 4069 4045 4033 3811 3798 3558 3542 3019 1660 245 11017 34582 4396 3814 --
NM_005840chrX117008 6937 6151 4870 4854 3030 2946 2185 1692 1002 813 12833 27125 2001 --
NM_005871chr1051072 1054 888 765 313 1774 1756 --
NM_005898chr1182541 2512 2399 2286 2206 2173 1987 645 ----12028
NM_005901chr18118617 7892 7791 7434 5324 2296 1724 1702 1694 910 306 ------
NM_006047chr2093238 3229 3072 2819 2667 2393 512 497 189 11040 12589 33119 2300 549
NM_006166chr1282610 2039 1696 277 268 257 105 49 131 ----
NM_006251chr573308 2786 2758 2308 1349 1234 215 1677 1821 11303
NM_006256chr172722 2622 2183 970 951 778 517 ----12626
NM_006306chrX115344 5167 4050 3927 3663 1869 1406 539 337 331 109 --15899 11738
NM_006599chr16128245 8092 7937 7256 7148 7079 6947 6192 6125 5347 2611 560 16969 15852 --
NM_006654chr1284112 3913 3834 3771 3750 3256 1915 924 --13246 --
NM_006717chr983184 2750 2515 1108 915 418 386 183 --13187 13289
NM_007005chr921309 486 31471 1293 455 --1471
NM_007006chr1693467 2963 2326 2247 1277 1197 1086 1078 839 167 ----
NM_007038chr21115762 5529 5384 5229 4396 4370 4191 4110 3993 2374 944 ------
NM_007249chr1379348 9338 9075 8309 8005 7446 6972 23128 2375 19069 29395 7286
NM_012081chr583449 2499 1502 763 659 569 541 363 --22803 1046 1549
NM_012082chr83969 619 390 --4652 322 299 288 --
NM_012214chr2116389 6203 5988 5264 4885 4728 3943 3881 1005 805 759 --34960 769 762 --
NM_012287chr3114539 4380 3506 3365 3304 3209 3044 1090 1049 621 50 --1740 --
NM_013255chr798837 7083 6368 3468 3054 2475 1284 1147 543 16571 47106 1674 1451 520 18703
NM_013943chr152777 2361 1178 324 146 ----21130 328
NM_014021chr193337 3009 2809 951 938 764 559 486 387 12924 --1242
NM_014155chr11107293 7286 7060 6956 5842 4743 2054 1825 1299 707 11682 17305 11939
NM_014319chr12131903 1393 723 709 699 693 683 584 576 553 541 392 90 ------
NM_014423chr5105496 5001 3987 3825 3683 3534 2241 1322 1196 648 15462 15426 --
NM_014572chr1331603 1335 1325 11319 ----
NM_014721chr687277 7096 7007 6616 5770 4842 2274 591 --12680 14740
NM_014877chr17147071 6904 6490 5671 2819 2647 2285 1871 1766 879 652 582 444 247 --12809 --
NM_014962chr2042893 2233 1089 914 ----22237 930
NM_014982chr1474551 3983 3934 3431 2087 1515 724 1439 11187 13470
NM_014992chr148653 258 235 210 172 154 148 136 ------
NM_015026chr1293805 3499 3178 2983 1565 1117 526 502 313 13215 ----
NM_015032chr1352696 2530 2455 884 525 --1306 22321 888
NM_015076chr674245 4036 3891 3471 1532 1167 935 --1406 14132
NM_015115chr462935 2254 640 284 278 255 ----12948
NM_015137chr84994 918 350 84 1694 --22315 1845
NM_015265chr23418 412 404 ----11861
NM_015271chr464297 4194 3975 3764 1689 1124 ----24068 2804
NM_015310chr8118384 8243 8135 6307 6267 5242 3218 2932 2170 2155 136 ----18211
NM_015317chr292841 2804 2795 1821 1759 690 430 260 165 --11027 --
NM_015375chr1105032 4996 3195 3086 1848 1021 1013 995 321 246 ----14788
NM_015387chr291936 1734 1495 1482 526 177 122 111 54 --11489 --
NM_015560chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_015569chr1134244 4226 3936 3291 3265 3245 3232 3155 3113 3080 1699 1471 997 13007 44149 3272 1498 245 --
NM_015640chr1104902 4876 4798 4503 4443 3738 1456 911 855 334 --23860 3329 --
NM_015886chr8125691 5672 4914 4887 3591 1615 1307 364 342 233 135 54 --24016 3606 1372
NM_016083chr693768 3756 3414 3275 3267 2969 1092 914 451 12433 --11509
NM_016248chr13103817 3571 3336 3085 2782 1389 1377 1359 723 163 11598 1227 --
NM_016260chr2197619 7440 7434 7408 7395 7387 7374 7144 5986 5797 5765 5568 5122 5106 5095 4752 2796 1506 1447 11486 ----
NM_016950chr41121 --21508 973 21250 1172
NM_016953chr265757 5745 5642 5612 4898 4792 --1375 26018 2073
NM_017633chr683259 2917 2811 1077 1043 1022 1014 970 --12920 --
NM_017637chr9109222 8196 8104 7411 6991 2963 948 927 848 127 --38635 2966 1369 --
NM_017650chr795729 5558 5342 5140 4932 4861 4722 2289 2184 15782 --24865 4772
NM_017769chr1483059 2414 2373 1160 1085 1006 913 293 --12208 1277
NM_017813chr8135636 5461 5103 4751 4302 4102 3903 3833 2337 1504 1033 999 646 --11266 1387
NM_017925chr961344 1330 1222 763 737 727 --2754 744 --
NM_018227chr483187 3143 2765 2553 494 311 272 260 ----12769
NM_018247chr692923 2339 2072 1181 1044 491 403 368 362 12060 ----
NM_018440chr8117961 7720 7574 7327 3118 3093 2913 2884 2754 1126 957 18067 --1322
NM_018557chr251267 671 59 35 27 --1187 --
NM_019044chr284594 4554 4460 4319 4304 1890 1431 23 ----24548 315
NM_019072chr573964 3879 3820 3063 2628 297 143 ----1656
NM_020673chr2087538 6745 5826 2826 1910 1691 1051 464 11061 14908 26284 272
NM_020734chr12102969 2751 2718 2703 2671 2285 1306 1120 1096 273 22204 223 ----
NM_020772chr17138170 7799 7775 6457 6104 3192 3134 2937 2255 1925 1452 1308 871 11602 11311 17820
NM_020774chr1856074 5396 5203 4747 1112 --36215 5981 4555 11215
NM_020935chr264653 4146 3756 3621 285 277 --13316 24546 4055
NM_020951chr19132448 2357 878 831 750 735 717 686 675 666 649 454 135 ------
NM_021007chr281716 826 810 798 790 782 535 122 ------
NM_021629chr384373 3880 1676 1481 441 433 358 259 ----1285
NM_021911chr585610 5005 3958 3432 3424 1994 1832 1388 ----14521
NM_021912chr1561034 992 228 188 176 132 1870 1754 1232
NM_021964chr374603 4478 2432 1845 1403 861 71 --24801 4708 15145
NM_022048chr1546168 5857 5767 519 --14625 22364 2334
NM_022763chr373180 2726 2584 803 641 575 422 ----13129
NM_022894chr211264 ----31384 544 405
NM_024408chr163688 3090 3053 2976 868 632 122 1871 33651 2626 1057
NM_024744chr272306 1997 1843 395 389 381 203 --12694 --
NM_024947chr3149336 9218 8595 7605 6985 6576 6491 3711 3672 3625 3001 1825 1742 1373 --22992 1847 --
NM_024989chr298100 7976 7964 7495 7478 6574 2687 2665 974 25161 82 38152 7941 5054 11292
NM_025090chr1791455 378 298 257 228 131 120 111 76 --2274 83 --
NM_030647chr786305 4019 1713 1384 1217 788 592 100 --25909 103 11184
NM_032116chr1385612 4695 4404 4341 4276 3891 2171 389 --44956 3941 3738 808 15007
NM_032373chr1055837 5004 760 676 624 11082 1830 23785 455
NM_032505chr392459 2216 2038 1970 1832 1743 878 744 493 ----22734 2136
NM_032968chrX153934 3501 3259 3179 2804 2797 2761 1636 1602 1415 872 653 627 195 40 --14177 --
NM_032969chrX153934 3501 3259 3179 2804 2797 2761 1636 1602 1415 872 653 627 195 40 --14177 --
NM_032973chrY143926 3497 3254 3174 2799 2792 2756 1601 1415 872 653 627 195 40 --14169 --
NM_033181chr693768 3756 3414 3275 3267 2969 1092 914 451 12433 --11509
NM_033285chr894390 3990 3865 3828 2842 561 445 168 61 --33137 1776 564 153
NM_033427chr76612 339 331 323 315 308 ------
NM_033430chr4104093 3951 3754 3592 2562 1600 1204 289 190 150 --21105 83 --
NM_033437chr4104093 3951 3754 3592 2562 1600 1204 289 190 150 --21105 83 --
NM_053053chr141010 983 203 100 --194 2975 940
NM_080546chr992283 836 419 123 117 107 101 95 85 ------
NM_080737chrX81505 1379 1159 249 133 107 99 91 --11286 --
NM_080867chr1474975 4899 4720 4042 356 244 236 ----13079
NM_130831chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_130832chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_130833chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_130834chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_130835chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_130836chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_130837chr372597 2540 733 467 434 253 141 22846 2707 --22899 2186
NM_138459chr663104 2767 2695 2591 1116 202 ----22669 208
NM_138713chr16128245 8092 7937 7256 7148 7079 6947 6192 6125 5347 2611 560 16969 15852 --
NM_138714chr16128245 8092 7937 7256 7148 7079 6947 6192 6125 5347 2611 560 16969 15852 --
NM_138731chr1494157 4079 4054 3181 2769 684 570 515 70 --1494 --
NM_144571chr4136982 6398 6006 5312 5093 2520 2465 2432 2318 2285 2128 1556 83 15951 26947 4334 --
NM_145259chr257034 6630 5032 2803 2753 14678 --26839 4313
NM_152374chr191705 1095 471 410 326 198 165 113 37 --3351 266 142 1304
NM_152388chr2103885 3722 3156 2907 2723 1315 951 546 87 79 --13888 --
NM_152624chr5105584 4922 2895 2634 2387 1991 1575 1288 1062 843 14808 11385 21579 855
NM_152754chr783834 2634 1179 1143 797 532 331 64 ------
NM_152756chr594295 4288 4211 4147 2969 1372 1245 1188 258 --24298 1642 --
NM_152774chr792673 2643 2635 2260 2005 1000 950 756 728 12276 32210 2008 1057 --
NM_152838chr2093238 3229 3072 2819 2667 2393 512 497 189 11040 12589 33119 2300 549
NM_153235chr662354 2160 1840 548 482 467 ----1500
NM_170665chr1263994 1393 1259 1108 1098 295 11077 1987 11166
NM_172071chr1116539 5949 5842 5611 2710 2109 1995 1801 414 405 353 ------
NM_173214chr16128245 8092 7937 7256 7148 7079 6947 6192 6125 5347 2611 560 16969 15852 --
NM_173468chr4106006 5994 5014 4844 4675 4357 2212 2204 931 897 22020 1585 15297 --
NM_173582chr1176079 2307 2219 2098 1833 621 351 11203 36148 6038 354 24728 2192
NM_181358chr194155 3385 3167 2752 1457 1371 1360 1112 1077 --21339 1080 --
NM_181443chr2042893 2233 1089 914 ----22237 930
NM_181481chr1896945 6678 6171 5895 4995 4730 4655 1345 639 ----15073
NM_181482chr1896945 6678 6171 5895 4995 4730 4655 1345 639 ----15073
NM_181483chr1896945 6678 6171 5895 4995 4730 4655 1345 639 ----15073
NM_181504chr5133953 3887 3873 3859 3841 3793 3155 3035 3027 2858 2691 583 185 --23485 3158 --
NM_181523chr5133953 3887 3873 3859 3841 3793 3155 3035 3027 2858 2691 583 185 --23485 3158 --
NM_181524chr5133953 3887 3873 3859 3841 3793 3155 3035 3027 2858 2691 583 185 --23485 3158 --
NM_182485chr462964 2812 924 755 621 473 11079 12448 23402 2816
NM_182493chr16115353 5317 5283 5269 4576 4096 2027 2019 1474 1428 268 --25320 1477 14387
NM_182646chr462964 2812 924 755 621 473 11079 12448 23402 2816
NM_182767chr1252100 1856 1302 655 646 ----1554
NM_198268chr194155 3385 3167 2752 1457 1371 1360 1112 1077 --21339 1080 --
NM_198269chr194155 3385 3167 2752 1457 1371 1360 1112 1077 --21339 1080 --
NM_198581chr2147530 7084 6916 6369 6357 5518 3022 1281 1248 1142 967 756 609 562 12475 ----
NM_199324chr483700 3457 3114 2659 1412 983 643 458 12498 12735 11040
NM_199421chr1474975 4899 4720 4042 356 244 236 ----13079
NM_199462chr1105032 4996 3195 3086 1848 1021 1013 995 321 246 ----14788
NM_199482chr291936 1734 1495 1482 526 177 122 111 54 --11489 --
NM_206853chr673987 3777 3069 2573 1633 1317 1250 13921 32924 2898 208 --
NM_206854chr6115248 5038 4330 3834 3569 3398 1241 718 397 307 129 15182 34185 4159 1469 --
NM_206855chr6156213 6003 5295 4799 4534 4363 3859 2206 1683 1362 1272 1094 612 358 220 26147 782 35150 5124 2434 --
NM_206907chr573308 2786 2758 2308 1349 1234 215 1677 1821 11303
NM_206909chr8118384 8243 8135 6307 6267 5242 3218 2932 2170 2155 136 ----18211
NM_213589chr2135316 3976 3938 3481 1203 1163 667 426 199 187 177 142 130 --23789 405 --