TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1285-3p
miRNA Sequence: UCUGGGCAACAAAGUGAGACCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr54326 203 164 39 11070 ----
NM_000020chr1261852 1687 1576 696 347 200 11601 2884 425 --
NM_000021chr1431071 182 85 1285 ----
NM_000024chr51457 ------
NM_000035chr9122 ------
NM_000037chr872155 2039 1876 1691 1575 975 544 12003 --12359
NM_000053chr1321428 1341 --21478 129 --
NM_000074chrX2846 91 ------
NM_000080chr174779 287 177 143 --1635 --
NM_000081chr121235 1195 --11469 --
NM_000084chrX126168 6084 6069 5282 5194 4868 4711 2660 2076 1687 1648 1587 11779 36910 4262 2600 26480 1929
NM_000092chr253221 2894 2856 732 90 1219 13229 --
NM_000093chr921967 260 1167 32444 1726 994 --
NM_000109chrX42005 1884 1657 627 ------
NM_000114chr2041258 809 175 150 --1863 1213
NM_000115chr1332491 1062 994 ------
NM_000118chr98782 735 725 696 645 601 259 37 2749 651 ----
NM_000125chr632764 1300 1213 1312 33029 1118 154 --
NM_000134chr411094 11712 2535 473 --
NM_000135chr167823 814 767 416 339 322 28 ------
NM_000138chr1531914 1634 400 ------
NM_000147chr1134 ------
NM_000151chr1741837 656 560 380 --21346 1254 --
NM_000165chr611261 ------
NM_000167chrX1735 ------
NM_000168chr763277 3263 3210 2919 2522 379 --1457 --
NM_000170chr91447 ------
NM_000176chr572960 2623 2393 1217 858 559 320 ------
NM_000183chr21403 ------
NM_000202chrX33448 2680 2568 ------
NM_000208chr1951779 1593 651 625 103 14347 11637 --
NM_000214chr20--1443 21270 280 --
NM_000216chrX33391 2633 1499 1108 --1100
NM_000217chr1264696 3672 3284 2115 2039 1330 --24662 1277 --
NM_000222chr442108 1510 761 317 ------
NM_000232chr432685 1294 817 ------
NM_000244chr112686 283 1174 ----
NM_000245chr732173 792 40 --1375 --
NM_000248chr342652 2436 305 135 ------
NM_000259chr1546327 895 600 42 13994 14361 --
NM_000262chr2241198 393 292 166 146 169 --
NM_000264chr933374 2085 803 --1992 --
NM_000267chr1733378 2518 170 --12788 12696
NM_000276chrX--1339 --1862
NM_000278chr1082183 2074 1728 778 704 426 298 219 11996 1763 --
NM_000304chr171313 ------
NM_000314chr1023220 2006 --1185 1522
NM_000319chr123398 255 30 ------
NM_000321chr1321468 478 ------
NM_000332chr646527 6414 5820 1655 --22443 1488 --
NM_000335chr352008 1963 1907 1790 687 --1503 --
NM_000337chr596330 5850 5467 5442 5239 4302 1403 1241 678 21913 1571 --15765
NM_000358chr5----1505 --
NM_000362chr2232810 790 652 11305 22967 2930 --
NM_000367chr682197 2162 2129 1621 1436 528 409 247 --12137 --
NM_000369chr1431533 695 439 1280 ----
NM_000378chr112908 192 ------
NM_000389chr631509 1109 572 ------
NM_000390chrX33066 854 201 12363 --12952
NM_000391chr1141738 1605 1221 468 ----11688
NM_000393chr211989 ------
NM_000399chr102968 55 1239 ----
NM_000408chr222960 415 ------
NM_000430chr1763805 3470 3275 2847 2779 945 --13259 12934
NM_000442chr1711222 ------
NM_000445chr86801 763 716 192 106 37 ----1159
NM_000448chr1142385 2305 1265 238 ------
NM_000449chr11548 --150 --
NM_000450chr13515 168 102 ------
NM_000459chr92931 615 ------
NM_000461chr353196 3115 3046 1463 1301 31602 804 703 23814 65 22835 1345
NM_000476chr961416 1338 1180 586 320 228 129 ----
NM_000480chr1151302 1219 368 170 149 ------
NM_000482chr11----1111 --
NM_000484chr212438 66 ------
NM_000486chr1253262 2214 1114 484 139 --21080 910 12376
NM_000495chrX--1247 1295 --
NM_000503chr811835 ----11215
NM_000522chr71236 --1453 165
NM_000523chr21172 --1229 --
NM_000526chr17126 ------
NM_000533chrX3545 535 241 --1382 --
NM_000536chr112524 104 ------
NM_000539chr321433 1095 ------
NM_000544chr6_cox_hap123098 1228 --43356 3066 2587 193 --
NM_000555chrX76054 5164 2032 528 329 78 70 32967 1823 27 25214 541 15971
NM_000598chr751387 1297 368 308 164 11240 ----
NM_000599chr2104182 4058 3436 3274 3169 3157 3103 2942 462 415 23672 3377 ----
NM_000609chr1083014 1121 819 812 674 639 440 41 --22494 2176 --
NM_000612chr1173578 3443 3193 3130 3058 2920 28 22436 385 13604 --
NM_000615chr1142399 2340 2139 1934 1346 ----
NM_000618chr1255907 5749 5588 5534 5134 34809 2140 1121 15450 12039
NM_000618chr1255907 5749 5588 5534 5134 34809 2140 1121 15450 12039
NM_000633chr1813482 23868 1105 ----
NM_000663chr1692870 2797 2762 971 871 807 569 296 67 32654 229 34 12672 --
NM_000678chr202777 684 ----1217
NM_000684chr1021198 1190 ------
NM_000723chr1761572 1166 1083 633 128 42 1641 21682 1159 --
NM_000724chr1021408 703 --11726 --
NM_000767chr1911461 --2513 260 --
NM_000793chr1444400 3136 1720 427 ------
NM_000794chr52974 31 ------
NM_000795chr114716 682 238 162 21061 362 148 --
NM_000806chr521883 655 ----21672 1581
NM_000813chr585195 5064 4336 4315 3754 3625 1914 1404 12091 ----
NM_000814chr1533581 3405 222 --13786 --
NM_000816chr52470 123 1476 1163 --
NM_000826chr4------1946
NM_000827chr522153 960 --1870 1760
NM_000829chr111175 ----1355
NM_000831chr1105507 4359 4254 4027 3937 2023 1657 846 819 386 ----11327
NM_000832chr93899 106 36 1626 127 --
NM_000833chr165988 568 394 279 78 ------
NM_000838chr632563 496 365 ----1552
NM_000840chr7154 ------
NM_000844chr311090 ------
NM_000860chr41667 --11474 --
NM_000861chr332175 1771 45 12540 ----
NM_000868chrX31765 471 157 ------
NM_000875chr15166598 6077 5596 5328 2805 2187 2057 2032 1348 872 734 622 582 376 216 135 ------
NM_000878chr2231538 1456 206 1290 1105 --
NM_000899chr1244103 3546 3297 626 11661 ----
NM_000908chr51151 ------
NM_000912chr852707 2464 2451 2184 961 --1475 --
NM_000921chr121187 ------
NM_000922chr1121055 809 143 276 56 --
NM_000927chr71398 ------
NM_000944chr421687 927 ------
NM_000945chr2272 62 ------
NM_000949chr5175 ------
NM_000958chr5--1351 11240 190
NM_001001132chr2131271 1199 466 --1504 174
NM_001001323chr121891 11971 ----
NM_001001331chr351896 990 554 308 23 11920 ----
NM_001001342chr1011476 --11393 --
NM_001001349chr1761574 1542 1483 1358 1246 609 11311 31649 1253 436 --
NM_001001395chr1232688 2476 1118 ----1956
NM_001001396chr144503 4220 1768 1137 1270 11730 --
NM_001001481chr831327 925 183 ------
NM_001001520chr193140 38 21 ------
NM_001001549chr722342 1777 12555 --1720
NM_001001550chr722342 1777 12555 --1720
NM_001001555chr722342 1777 12555 --1720
NM_001001557chr831556 753 618 2196 29 ----
NM_001001563chr194779 418 80 36 --1867 --
NM_001001664chr243735 3713 636 107 2591 55 ----
NM_001001669chr542546 1887 1865 213 1418 --22475 1754
NM_001001701chr432094 1995 733 ----11979
NM_001001790chr9--182 --1365
NM_001001852chr223602 300 196 --1726 --
NM_001001890chr2184132 3560 3046 2935 2673 1450 1209 108 1186 24195 1198 --
NM_001001924chr821775 1379 --22065 615 --
NM_001001925chr821775 1379 --22065 615 --
NM_001001931chr821775 1379 --22065 615 --
NM_001001995chrX41615 1471 1461 561 --1375 --
NM_001002257chr232630 2494 1160 2366 70 2448 392 --
NM_001002265chr101270 --2621 337 --
NM_001002266chr101270 --2621 337 --
NM_001002838chrX1290 --11601 --
NM_001002843chr15170 ------
NM_001002860chr1442974 894 633 558 14408 1696 --
NM_001002914chr1731116 285 245 2182 128 2815 795 --
NM_001003406chr2253260 2834 1280 1176 991 53316 3037 2952 2459 2142 11194 --
NM_001003652chr1867485 7133 5682 3490 2581 881 13156 23358 2350 --
NM_001003674chr1876089 6062 5611 5118 2597 2396 1388 24356 2539 25389 1181 --
NM_001003675chr1876089 6062 5611 5118 2597 2396 1388 24356 2539 25389 1181 --
NM_001003678chr111126 ------
NM_001003792chr3--11209 ----
NM_001003793chr3--11209 ----
NM_001003800chr933705 1460 969 21411 584 ----
NM_001003810chr42529 293 --1629 --
NM_001003945chr931865 136 118 1439 --11886
NM_001004051chrX------1214
NM_001004065chr953539 3497 3175 2481 390 --13224 1531
NM_001004106chr541053 748 404 91 1656 1829 --
NM_001004196chr321122 808 ------
NM_001004303chr13729 693 636 ------
NM_001004303chr13729 693 636 ------
NM_001004317chr654466 4290 3530 1130 783 11576 --12939
NM_001004360chr211833 1132 ----
NM_001004419chr1244264 1586 729 187 13966 11559 --
NM_001005266chr152699 688 ------
NM_001005267chr152699 688 ------
NM_001005268chr152699 688 ------
NM_001005269chr152699 688 ------
NM_001005375chrY31575 1454 728 ------
NM_001005404chr1764509 2817 1677 1314 1292 30 24170 914 13772 --
NM_001005473chr586644 6363 4709 4129 2041 1549 1250 429 ------
NM_001005505chr341515 1443 1418 339 11316 ----
NM_001005732chr21278 41 ------
NM_001005733chr21278 41 ------
NM_001005739chr21855 ------
NM_001005743chr142134 29 1141 2511 445 --
NM_001005744chr142134 29 1141 2511 445 --
NM_001005745chr142134 29 1141 2511 445 --
NM_001005782chr22818 142 ------
NM_001005862chr173590 241 184 ------
NM_001005920chr163151 100 56 2948 184 1265 --
NM_001006115chr392775 2430 2165 1088 1034 998 903 703 441 1789 22225 237 --
NM_001006600chr51812 1355 ----
NM_001006612chrX179 ------
NM_001006613chrX179 ------
NM_001006614chrX179 ------
NM_001006623chr242282 1954 1737 625 --12040 --
NM_001006665chr12795 196 1132 ----
NM_001006932chr6113236 2471 2090 1278 995 885 737 543 520 262 101 1651 1859 --
NM_001006943chr13219 195 77 147 ----
NM_001007023chr1444400 3136 1720 427 ------
NM_001007102chr631149 1113 548 ------
NM_001007156chr1531753 1316 376 --11595 --
NM_001007214chr131592 698 282 ------
NM_001007226chr1711216 1954 1962 --
NM_001007227chr1711216 1954 1962 --
NM_001007228chr1711216 1954 1962 --
NM_001007229chr1711216 1954 1962 --
NM_001007230chr1711216 1954 1962 --
NM_001007466chr6105113 4382 4286 4141 3821 3410 3140 712 233 224 --25195 4130 14874
NM_001007471chr91807 ------
NM_001007553chr111083 ------
NM_001007559chr1831658 1386 593 --11393 --
NM_001008220chr583538 3525 3145 2743 900 755 577 488 23405 2810 31092 764 375 --
NM_001008222chrX31090 910 526 1406 11259 --
NM_001008225chr71132 --1692 1493
NM_001008391chr111191 ------
NM_001008392chr342274 1078 1061 137 1357 --11069
NM_001008407chr751667 1168 472 244 148 --1382 --
NM_001008495chr821574 33 ------
NM_001008541chr1031951 1875 341 ------
NM_001008541chr1031951 1875 341 ------
NM_001008567chr9130 ------
NM_001008701chr1972922 2656 2632 2398 1011 1001 33 1256 22486 1213 --
NM_001008738chr512801 1371 22095 915 --
NM_001008783chr61737 ------
NM_001008925chr432480 915 144 ------
NM_001008938chr112298 85 ------
NM_001009554chr421661 805 --23644 346 13329
NM_001009554chr421661 805 --23644 346 13329
NM_001009555chr421338 574 ------
NM_001009566chr131378 1006 373 ------
NM_001009899chr324461 1625 1327 11368 --
NM_001009909chr1113711 --22538 2420 13422
NM_001009993chr284131 3555 2885 1712 1700 1489 325 144 14502 --13582
NM_001010853chr632562 2074 1219 --2666 548 --
NM_001010861chr142511 1794 1765 228 ------
NM_001010862chrX53048 2441 555 179 171 1838 --1921
NM_001010867chr1125641 5381 4933 4879 2051 2033 1605 1489 1365 1037 688 612 45235 4740 4323 977 75356 5178 2223 2138 414 172 66 --
NM_001010888chrX84073 4059 3766 2881 1715 1586 705 482 11362 21835 570 --
NM_001010891chr565325 5239 4551 1346 845 465 --55888 2706 2656 2538 1254 --
NM_001010898chr1123673 3526 3275 2967 2956 1131 576 553 110 93 48 21 43125 2323 561 482 33076 476 57 --
NM_001010908chr102758 246 ------
NM_001010917chr1021807 1654 11587 52042 1572 1558 1446 120 --
NM_001010922chr182691 2648 2594 1325 1144 776 642 433 ------
NM_001010924chr1021086 100 ----1240
NM_001010942chr122858 50 ------
NM_001010984chr121029 121 11612 22546 1657 1367
NM_001010986chrX22195 1600 11955 ----
NM_001011513chr433253 2769 224 --13236 --
NM_001011538chr41731 ------
NM_001011546chr202535 258 ------
NM_001011657chrX2850 317 ------
NM_001011663chr102932 217 ------
NM_001011666chr786193 6148 5380 4893 4615 1676 1035 541 16136 32136 1546 601 11371
NM_001011708chr222462 2003 12544 ----
NM_001011713chr14----11583 --
NM_001011724chr131107 ------
NM_001011725chr131107 ------
NM_001012329chr132101 969 865 1873 11699 --
NM_001012393chr1134915 2077 240 11278 ----
NM_001012398chr162416 51 ------
NM_001012415chr93300 250 39 ------
NM_001012420chr1532893 1168 410 ------
NM_001012423chr1552893 2134 1168 410 27 ------
NM_001012426chr683271 2924 2140 1216 954 831 128 106 --22189 1258 12582
NM_001012427chr683271 2924 2140 1216 954 831 128 106 --22189 1258 12582
NM_001012478chr192621 554 ------
NM_001012751chr1031970 208 98 ------
NM_001012755chrX53470 1656 1478 1103 87 11109 21649 1222 1755
NM_001012761chr511082 21048 941 1250 --
NM_001013398chr751387 1297 368 308 164 11240 ----
NM_001013415chr4125 ------
NM_001013438chr31839 ------
NM_001013439chr31685 ------
NM_001013635chr123884 738 194 1779 1767 --
NM_001013690chr1272282 2232 1875 1779 628 438 254 ------
NM_001013693chr1122303 2108 1836 1157 1103 1075 968 956 884 752 685 359 --42558 1892 930 602 --
NM_001013693chr1122303 2108 1836 1157 1103 1075 968 956 884 752 685 359 --42558 1892 930 602 --
NM_001013699chr12----1184 --
NM_001013739chr72289 112 ----1121
NM_001013839chr1792451 1703 1597 983 903 679 578 359 302 32006 415 397 21827 1798 --
NM_001014794chr11--1180 ----
NM_001014795chr11--1180 ----
NM_001014797chr1087864 7034 6289 5991 2846 1938 1801 1750 25810 5356 ----
NM_001014809chr42973 50 ------
NM_001014812chr152436 393 ------
NM_001014972chr2145 ------
NM_001014987chr161378 ------
NM_001014988chr161378 ------
NM_001014989chr161378 ------
NM_001015045chr43849 608 415 22385 2259 1687 --
NM_001015877chrX2137 109 ----12753
NM_001015881chrX2912 218 ----11151
NM_001015887chr321202 325 1304 --11221
NM_001017368chr1762685 2051 1992 495 381 60 ------
NM_001017395chr343155 2847 2645 1407 ----12235
NM_001017396chr271677 1664 1502 1364 842 639 83 11904 11811 --
NM_001017424chr11638 1384 1695 1258
NM_001017425chr11638 1384 1695 1258
NM_001017440chr786500 6308 6077 3060 2950 2636 1880 1445 26401 2747 37704 5931 1620 --
NM_001017916chr1741655 799 582 464 --11681 11580
NM_001017917chr1741655 799 582 464 --11681 11580
NM_001017923chr14139 --1531 --
NM_001017926chr82351 71 ------
NM_001017963chr142907 313 ------
NM_001018025chrX1127 --1600 --
NM_001018050chr2293359 3207 3117 2962 2497 2147 1307 953 135 1996 13246 --
NM_001018052chr2293359 3207 3117 2962 2497 2147 1307 953 135 1996 13246 --
NM_001018054chr111153 ----1952
NM_001018056chr91184 ------
NM_001018057chr11----1546 1251
NM_001018064chr91406 ----11654
NM_001018065chr975936 5841 4596 3683 2269 1389 281 --33921 1526 743 --
NM_001018066chr975936 5841 4596 3683 2269 1389 281 --33921 1526 743 --
NM_001018067chr155318 5012 4839 3904 2154 13300 11469 --
NM_001018068chr155318 5012 4839 3904 2154 13300 11469 --
NM_001018069chr155318 5012 4839 3904 2154 13300 11469 --
NM_001018074chr572960 2623 2393 1217 858 559 320 ------
NM_001018075chr572960 2623 2393 1217 858 559 320 ------
NM_001018076chr572960 2623 2393 1217 858 559 320 ------
NM_001018077chr572960 2623 2393 1217 858 559 320 ------
NM_001018090chr1542844 1996 698 140 ----11844
NM_001018091chr1542954 2106 808 250 ----11954
NM_001018102chr1542844 1996 698 140 ----11844
NM_001018108chr1531398 644 89 --22249 838 --
NM_001018111chr772605 1415 1244 822 538 343 220 21226 438 23878 993 1182
NM_001020825chr52435 98 ------
NM_001023567chr1542285 1599 1560 27 ------
NM_001023587chr31723 ------
NM_001024024chr14195 ------
NM_001024070chr14191 ------
NM_001024094chr572960 2623 2393 1217 858 559 320 ------
NM_001024218chr14136 ------
NM_001024226chr11471 1816 ----
NM_001024227chr11471 1816 ----
NM_001024228chr11471 1816 ----
NM_001024401chr1662741 2170 940 732 135 37 2983 217 160 --
NM_001024455chrX3846 603 185 --1249 --
NM_001024649chr552702 2486 2174 2054 687 12540 ----
NM_001024858chr14102958 2848 2717 2684 2232 2082 1036 875 409 56 ------
NM_001024912chr1941538 682 151 55 ------
NM_001024934chr61593 ------
NM_001024935chr61593 ------
NM_001024936chr61593 ------
NM_001024948chr152623 2372 2246 2183 1140 ------
NM_001025068chr331196 598 188 11285 --1310
NM_001025069chr331196 598 188 11285 --1310
NM_001025076chr1065254 5077 2263 2061 1323 59 --55700 5015 4848 426 79 --
NM_001025077chr1076612 6435 2681 1417 913 502 475 --67058 6373 6206 1784 1437 449 --
NM_001025079chr331646 1480 222 ------
NM_001025108chr243778 3353 3161 817 --12930 --
NM_001025158chr52233 21 --1571 --
NM_001025202chr73289 249 112 1121 ----
NM_001025205chr32445 53 ------
NM_001025242chrX91319 1231 1219 1014 1002 435 387 362 117 ------
NM_001025243chrX91319 1231 1219 1014 1002 435 387 362 117 ------
NM_001025266chr384740 4146 4005 3858 3211 1869 668 572 --11620 --
NM_001025389chr1151302 1219 368 170 149 ------
NM_001025390chr1151302 1219 368 170 149 ------
NM_001025579chr172744 169 --2248 94 --
NM_001025580chrX43453 3300 1364 577 12916 13322 --
NM_001025596chr11169 ------
NM_001025603chr11548 --150 --
NM_001029858chr663326 2168 1350 1232 563 53 --1209 --
NM_001029863chr642857 2840 2192 1002 ------
NM_001029864chr202352 54 --4923 872 764 642 --
NM_001029875chr543021 2493 2000 1095 1892 ----
NM_001029989chr153797 666 647 ------
NM_001030007chr1613058 ------
NM_001030019chr7------136
NM_001030055chr1434598 4437 467 ------
NM_001031680chr151590 955 626 465 213 1233 22076 320 --
NM_001031690chr753034 2205 2125 1969 336 --12199 1680
NM_001031694chr12894 205 ------
NM_001031694chr12894 205 ------
NM_001031695chr2254588 4320 4158 3893 887 --25133 2016 --
NM_001031702chr34783 706 225 215 ------
NM_001031732chr443103 2901 2855 101 --11172 --
NM_001031804chr1633468 1508 548 ------
NM_001031812chr52450 236 ----1588
NM_001032280chr6------11348
NM_001032288chr202236 178 ------
NM_001032293chr171662 ------
NM_001032296chr1342527 2461 2397 142 --11169 12536
NM_001032393chrX1272 ------
NM_001032394chr652269 2100 572 69 30 --12657 --
NM_001032999chr20104766 4122 4093 3961 3879 3873 1520 962 779 343 --74924 3655 3291 1651 1402 353 34 14648
NM_001033025chr131486 1106 548 ------
NM_001033047chr4192 ------
NM_001033057chr32801 672 --11314 --
NM_001033081chr111516 --21407 281 --
NM_001033082chr111516 --21407 281 --
NM_001033117chr363998 3408 1228 173 149 52 11652 34594 4351 4231 --
NM_001033503chr52400 61 ------
NM_001033521chr201117 1521 ----
NM_001033522chr201117 1521 ----
NM_001033551chr17173934 3804 3698 3424 3343 2884 2633 1604 1346 1254 640 617 390 374 358 282 246 34027 3273 1455 11393 11300
NM_001033602chr1342567 945 464 306 --21699 105 --
NM_001033723chr852400 2058 709 660 25 --12088 --
NM_001034837chr54727 586 256 176 1756 2689 670 --
NM_001034838chr54727 586 256 176 1756 2689 670 --
NM_001034845chr41525 --1898 --
NM_001034852chr1471477 1378 778 455 118 80 35 1700 31465 1431 645 --
NM_001034954chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_001034955chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_001034956chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_001034957chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_001035chr111033 ------
NM_001035003chr411104 --192 --
NM_001035004chr411104 --192 --
NM_001035005chr182511 489 ------
NM_001035254chr9102385 2153 2132 1849 848 805 797 790 695 205 150 21709 901 21779 985
NM_001035260chr1011523 ------
NM_001035511chr141947 361 139 128 1152 11954 --
NM_001035512chr142054 468 246 235 1259 12061 --
NM_001035513chr142054 468 246 235 1259 12061 --
NM_001035521chr21292 1573 ----
NM_001037132chr742180 1803 1784 889 --11450 --
NM_001037133chr742180 1803 1784 889 --11450 --
NM_001037164chr71142 --1328 --
NM_001037172chr3----11380 --
NM_001037174chr211716 22008 1878 ----
NM_001037317chr142511 1794 1765 228 ------
NM_001037331chr183955 110 53 ------
NM_001037334chr181505 --1543 --
NM_001037339chr121447 171 --1643 --
NM_001037340chr121447 171 --1643 --
NM_001037341chr121447 171 --1643 --
NM_001037341chr121447 171 --1643 --
NM_001037553chr21145035 4642 4216 3945 3911 3721 3488 3221 1923 1279 1174 1141 1123 482 ----11691
NM_001037637chr5----1255 --
NM_001037738chr51301 ------
NM_001037954chr1172919 2871 2730 2632 684 592 193 1523 12999 --
NM_001038702chr5139 --21678 1072 --
NM_001039091chrX21153 419 --122 --
NM_001039348chr21926 ------
NM_001039349chr21926 ------
NM_001039459chr74424 374 362 180 ------
NM_001039479chr1431690 318 182 11766 1772 --
NM_001039538chr241100 722 399 357 ------
NM_001039547chr3137987 7318 6725 6610 6515 6479 5425 5406 5145 2771 1418 885 67 15252 32653 1819 1059 --
NM_001039550chr23772 716 317 1855 1237 --
NM_001039573chr17------146
NM_001039574chr13761 751 415 1159 1975 --
NM_001039577chr153963 3448 3287 1023 24 --23831 1472 --
NM_001039580chr474165 3571 3442 3370 1016 911 534 11205 ----
NM_001039590chrX12860 --33562 1583 1122 --
NM_001039591chrX12860 --33562 1583 1122 --
NM_001039618chr1145556 5384 1810 431 --14913 --
NM_001039690chr1691946 1852 732 693 618 468 414 372 366 ------
NM_001039693chr221070 577 ----1762
NM_001039709chr20104766 4122 4093 3961 3879 3873 1520 962 779 343 --74924 3655 3291 1651 1402 353 34 14648
NM_001039711chr111027 --11121 11075
NM_001039712chr111027 --11121 11075
NM_001039762chr102675 101 ------
NM_001039840chrX85934 5783 5393 5058 3671 2092 1570 1441 ------
NM_001039842chr17140 ------
NM_001039888chr12149 108 ------
NM_001039916chr121278 --1317 --
NM_001039917chr121278 --1317 --
NM_001039918chr121278 --1317 --
NM_001039919chr121278 --1317 --
NM_001039920chr121278 --1317 --
NM_001039937chr1311087 11166 --1752
NM_001040002chr171474 --2185 143 11157
NM_001040101chr41202 ------
NM_001040110chr751543 1290 1155 709 664 --11729 --
NM_001040134chr1951226 353 103 75 55 --31209 1202 457 --
NM_001040142chr21139 ------
NM_001040143chr21139 ------
NM_001040144chr1691946 1852 732 693 618 468 414 372 366 ------
NM_001040146chr1691946 1852 732 693 618 468 414 372 366 ------
NM_001040151chr1143692 3480 2966 1291 14149 1955 --
NM_001040152chr73262 255 175 14110 --23502 558
NM_001040157chr42771 466 --2843 725 --
NM_001040158chr51116 ------
NM_001040167chr741058 475 153 53 ------
NM_001040181chr33968 909 831 ------
NM_001040182chr33968 909 831 ------
NM_001040183chr33968 909 831 ------
NM_001040199chr33968 909 831 ------
NM_001040200chr33968 909 831 ------
NM_001040202chr432383 402 338 ------
NM_001040214chr651766 700 584 355 318 ------
NM_001040284chr1624440 2071 1425 24844 50 14791
NM_001040402chr411059 ------
NM_001040424chr212987 850 ----22155 869
NM_001040429chr134925 783 764 143 ------
NM_001040431chr17291 25 ------
NM_001040439chr1671206 997 961 421 295 279 62 1265 51129 988 515 491 459 --
NM_001040455chr1171200 1041 940 861 514 439 365 --3992 872 106 --
NM_001040458chr52467 305 --21178 492 --
NM_001040619chr131461 343 191 2379 298 ----
NM_001040624chr842655 2589 711 609 --12018 21025 186
NM_001040625chr842655 2589 711 609 --12018 21025 186
NM_001040626chr842655 2589 711 609 --12018 21025 186
NM_001040627chr842655 2589 711 609 --12018 21025 186
NM_001040628chr842655 2589 711 609 --12018 21025 186
NM_001040629chr842655 2589 711 609 --12018 21025 186
NM_001040630chr842655 2589 711 609 --12018 21025 186
NM_001040661chr771074 897 743 429 371 296 142 --1276 --
NM_001040665chr734354 1632 1098 13176 ----
NM_001040709chr162425 2093 1838 903 566 220 1609 1963 --
NM_001040712chr932547 948 443 ------
NM_001040715chr163888 846 94 11177 ----
NM_001042353chr201495 ------
NM_001042355chr1645052 4976 3753 656 11623 23404 542 --
NM_001042388chr182852 142 ------
NM_001042412chr1645052 4976 3753 656 11623 23404 542 --
NM_001042413chr954088 3968 3813 2736 477 ----22854 1043
NM_001042414chr131195 ------
NM_001042425chr6------11348
NM_001042430chr14176 ------
NM_001042453chrX31447 1163 1142 ------
NM_001042473chr101543 --1119 --
NM_001042481chr143645 414 305 12044 --1225
NM_001042486chr2051331 1278 969 595 299 1546 11168 --
NM_001042492chr1733378 2518 170 --12788 12696
NM_001042494chr1522807 228 --22858 2546 --
NM_001042495chr1522807 228 --22858 2546 --
NM_001042496chr1522807 228 --22858 2546 --
NM_001042497chr1522807 228 --22858 2546 --
NM_001042510chr822158 1395 --1438 --
NM_001042511chr822158 1395 --1438 --
NM_001042539chr162885 42 1893 ----
NM_001042555chr1294766 3883 3492 3225 1885 1265 1113 588 238 --11042 1683
NM_001042573chr1762097 1712 1597 879 844 93 --1785 --
NM_001042601chr343247 402 149 21 12461 ----
NM_001042603chr1213542 --34363 1853 349 --
NM_001042604chr334658 4037 1011 --24207 3697 --
NM_001042632chr2072593 1043 827 636 443 350 166 2373 36 12045 1668
NM_001042633chr2072593 1043 827 636 443 350 166 2373 36 12045 1668
NM_001042646chr341602 549 147 111 ------
NM_001042724chr192621 598 2558 171 1729 --
NM_001042729chr13512 493 385 1186 ----
NM_001042747chr13512 493 385 1186 ----
NM_001042749chrX11633 ------
NM_001042750chrX11633 ------
NM_001042751chrX11633 ------
NM_001043318chr1452645 1350 1171 481 120 ------
NM_001044305chr631197 261 216 --11355 --
NM_001044385chr273767 3620 3613 2602 1595 1474 715 --23599 2884 --
NM_001044722chr52450 236 ----1588
NM_001044723chr52450 236 ----1588
NM_001045556chr831407 259 29 --11180 1357
NM_001045557chr831407 259 29 --11180 1357
NM_001076778chr33631 264 30 --2853 339 --
NM_001079874chr121974 517 --2598 538 1200
NM_001083620chr4------1945
NM_001083621chr1113767 3314 3176 3100 3012 1693 1574 934 581 375 271 13998 14545 --
NM_001092chr1762238 1778 1621 1023 376 308 11992 42312 2293 1641 184 --
NM_001094chr175650 593 538 236 77 ----2294 146
NM_001095chr124769 743 493 329 21588 31 21508 1304 --
NM_001100108chr197718 7689 5936 3344 2892 2566 2497 2226 2033 27757 5641 ----
NM_001106chr3118310 7698 6937 6908 6754 6673 6389 6215 2839 2261 1039 26687 3227 23779 3689 126
NM_001113490chrX13651 ------
NM_001116chr1642085 1155 602 22 32616 2107 1161 1740 12983
NM_001122679chr54326 203 164 39 11070 ----
NM_001126chr12863 151 ------
NM_001128chr1613058 ------
NM_001146chr821591 206 ------
NM_001148chr41604 --1181 1571
NM_001156chr101478 ------
NM_001163chr94967 396 104 78 --2926 291 --
NM_001167chrX96382 6265 4374 2147 2009 1922 1644 1224 507 --25634 5548 --
NM_001173chr1434598 4437 467 ------
NM_001186chr2133154 2408 87 ------
NM_001191chr2051351 244 117 109 65 1136 11057 11311
NM_001204chr233067 2322 1810 --36502 6157 1962 --
NM_001206chr933150 2082 2029 --12166 --
NM_001207chr5----1255 --
NM_001222chr1011326 2643 530 --11288
NM_001227chr1031299 1028 317 --1906 --
NM_001241chr2184 --11833 --
NM_001241chr2184 --11833 --
NM_001248chr31345 ------
NM_001249chr142413 154 1107 ----
NM_001259chr786203 6119 5979 5296 4341 4237 1546 159 --11673 --
NM_001260chr13121 --1123 --
NM_001271chr1583043 2975 2969 2766 2491 2045 228 173 ----12261
NM_001278chr101467 ------
NM_001284chr5----1182 --
NM_001289chrX21656 164 1558 ----
NM_001290chr41349 --2367 360 --
NM_001292chr152968 60 --31075 821 41 --
NM_001304chr1773656 2763 2697 2596 2417 866 720 ----13569
NM_001310chr1212424 --1106 --
NM_001313chr42973 50 ------
NM_001319chr194892 404 150 94 --11005 --
NM_001324chr201117 1521 ----
NM_001326chr11----135 --
NM_001329chr1011461 ------
NM_001332chr511019 --11567 --
NM_001343chr511586 --11351 11419
NM_001346chr342131 1874 521 400 ------
NM_001349chr2------1534
NM_001351chr321814 1549 ------
NM_001356chrX41549 621 366 357 ----12141
NM_001364chr1163889 3256 1589 657 272 228 13463 14536 21655 314
NM_001386chr82631 198 1702 --1388
NM_001387chr512259 1986 2704 163 --
NM_001389chr211233 ------
NM_001396chr2132732 2437 194 21890 219 11872 --
NM_001397chr192485 2479 2436 2052 1998 1984 1629 1076 688 --182 --
NM_001401chr93997 435 278 ------
NM_001402chr622033 1568 --11246 --
NM_001406chr1751600 1525 678 639 267 ------
NM_001407chr331666 579 368 11129 --11088
NM_001417chr12--1556 1293 --
NM_001419chr19114328 4280 3387 3293 1952 1733 1274 777 658 571 518 11396 --11917
NM_001420chr19102924 2798 2736 2389 2263 1114 1095 993 748 502 --2402 200 --
NM_001423chr1231544 668 491 1232 ----
NM_001430chr23809 329 171 21644 1356 1137 --
NM_001438chr123535 2971 --13317 --
NM_001439chr131486 1106 548 ------
NM_001444chr8153 ------
NM_001447chr551317 1130 1053 389 121 --11007 --
NM_001448chrX11686 ----11271
NM_001454chr174326 195 173 36 150 ----
NM_001458chr74701 664 253 149 ------
NM_001478chr122876 251 1305 1151 1195
NM_001483chr7124 --1234 --
NM_001490chr942794 2681 1043 969 --1329 --
NM_001521chr21292 1573 ----
NM_001530chr142936 842 --1920 --
NM_001546chr611430 ------
NM_001552chr171840 1115 --11144
NM_001553chr4170 ------
NM_001554chr11128 ------
NM_001566chr2----159 --
NM_001567chr116672 211 158 127 111 57 ------
NM_001569chrX91319 1231 1219 1014 1002 435 387 362 117 ------
NM_001587chrX--1339 --1862
NM_001608chr22631 56 --1260 --
NM_001616chr211363 ----12634
NM_001626chr1943065 1291 452 240 --1532 1208
NM_001627chr312420 ----126
NM_001635chr73680 241 29 --2824 407 --
NM_001658chr11471 1816 ----
NM_001659chr1282680 2494 2128 1651 566 542 171 119 --22368 128 --
NM_001660chr3----1707 --
NM_001663chr1412170 --1409 --
NM_001664chr32355 171 ------
NM_001665chr11----1494 --
NM_001677chr13764 425 243 ------
NM_001678chr1721528 341 11338 ----
NM_001682chr121605 ------
NM_001683chr351896 990 554 308 23 11920 ----
NM_001684chr144220 3937 1485 854 --11447 --
NM_001699chr1921835 655 ------
NM_001701chr921152 577 ------
NM_001707chr71777 ------
NM_001709chr1141869 1800 747 170 ----1845
NM_001714chr123514 121 65 ------
NM_001717chr151324 ----127
NM_001718chr62514 172 1980 1898 --
NM_001723chr61146 ------
NM_001729chr4153 ------
NM_001730chr1321647 530 ------
NM_001730chr1321647 530 ------
NM_001742chr731751 678 133 --1654 --
NM_001746chr552702 2486 2174 2054 687 12540 ----
NM_001753chr721414 369 --11165 11257
NM_001754chr2184132 3560 3046 2935 2673 1450 1209 108 1186 24195 1198 --
NM_001759chr1224639 198 ------
NM_001762chr7177 ------
NM_001773chr141047 288 258 232 21353 1013 ----
NM_001777chr331646 1480 222 ------
NM_001789chr331672 1374 167 ------
NM_001792chr181197 1152 ----
NM_001800chr19193 ----1369
NM_001802chr16239 32 ------
NM_001810chr207797 759 751 578 243 165 146 1745 ----
NM_001825chr51112 ------
NM_001830chrX53399 2958 863 839 344 12967 ----
NM_001838chr17--1285 1105 --
NM_001839chr1121 ------
NM_001845chr132347 101 ------
NM_001852chr12548 87 ------
NM_001854chr131086 417 330 ------
NM_001858chr674295 4225 4072 3397 1552 1239 896 --13860 11165
NM_001859chr963332 2661 813 505 461 148 ----12479
NM_001880chr21249 ------
NM_001901chr61377 ----1803
NM_001904chr3162 ------
NM_001907chr16185 ------
NM_001915chr1741655 799 582 464 --11681 11580
NM_001918chr1107144 7008 6972 6652 6508 5810 3046 1996 889 341 17430 38636 6290 1353 18062
NM_001923chr11--1512 ----
NM_001931chr1121185 381 --1261 1126
NM_001937chr13975 844 58 ------
NM_001938chr111876 --1716 1527
NM_001939chrX73568 3072 2537 2510 1363 1138 276 ------
NM_001942chr1822066 1427 --1102 --
NM_001945chr5----1915 --
NM_001949chr632363 2029 780 ------
NM_001950chr164789 581 487 265 ------
NM_001962chr5173 ------
NM_001964chr541172 831 238 179 ------
NM_001967chr31109 ------
NM_001978chr8----1953 1977
NM_001981chr122342 2331 ----12120
NM_001991chr1731441 703 59 ----1153
NM_001995chr41126 ------
NM_002006chr4104652 4040 2329 2162 1986 1937 1864 580 377 98 ------
NM_002009chr151651 --11970 --
NM_002010chr13----1206 --
NM_002014chr122637 237 ------
NM_002017chr1111054 ------
NM_002019chr133756 630 576 ------
NM_002025chrX78912 7573 7192 6824 5905 988 889 ----16776
NM_002033chr1163620 3323 2904 1401 1189 178 --12813 --
NM_002045chr31104 ------
NM_002046chr122197 151 ------
NM_002061chr121571 323 --11705 --
NM_002063chrX2952 801 ------
NM_002069chr711317 ------
NM_002072chr92649 135 ----1711
NM_002077chr911503 1832 1404 --
NM_002078chr3199 ------
NM_002081chr241727 1606 552 229 11620 1275 --
NM_002082chr541016 711 367 54 1619 1792 --
NM_002084chr52205 26 --1839 --
NM_002086chr1731969 558 290 1538 11613 --
NM_002087chr17----161 --
NM_002092chr444863 4564 4083 675 1811 21225 242 23418 1526
NM_002094chr162287 87 ------
NM_002106chr4----156 --
NM_002111chr4103647 3395 2871 2817 2526 2416 1531 1260 1183 615 23406 1347 23688 1046 23461 992
NM_002129chr4----146 --
NM_002136chr121107 ------
NM_002138chr42529 293 --1629 --
NM_002139chrX1497 ------
NM_002141chr7----1203 --
NM_002158chr233714 1002 237 ------
NM_002167chr11120 --1166 --
NM_002181chr2--146 ----
NM_002192chr7--1212 --142
NM_002193chr251321 1201 1193 1181 382 ----11274
NM_002199chr41144 ------
NM_002202chr51760 ------
NM_002203chr542703 1436 690 520 1269 ----
NM_002205chr122933 736 1129 1376 --
NM_002211chr1021162 1061 ------
NM_002221chr132764 968 446 22688 932 42413 2332 599 236 --
NM_002222chr3----11130 --
NM_002223chr1233972 257 92 ------
NM_002226chr142857 829 ----1696
NM_002227chr12109 62 ------
NM_002232chr12465 63 --130 --
NM_002239chr211073 ------
NM_002247chr1022186 1820 ------
NM_002249chr11500 1362 ----
NM_002252chr21422 ------
NM_002254chr22667 23 ----1897
NM_002264chr354329 3647 3625 3243 1543 --14400 --
NM_002267chr131335 11801 ----
NM_002268chr351372 494 439 413 191 ------
NM_002270chr513960 --34685 4063 371 --
NM_002277chr173221 183 40 ------
NM_002285chr243778 3353 3161 817 --12930 --
NM_002290chr631354 926 22 ------
NM_002293chr11114 ------
NM_002309chr2282798 2356 2163 2155 372 300 88 70 42147 1256 888 54 12223 11945
NM_002310chr595363 4833 4221 4098 1377 1272 944 598 415 --12635 --
NM_002336chr1244947 4630 4537 958 ----24490 3550
NM_002351chrX----1561 --
NM_002355chr1221062 1043 ----11130
NM_002356chr632567 873 369 ------
NM_002359chr1793916 3250 3193 1646 1362 653 572 466 456 23098 282 34222 3995 3925 --
NM_002374chr241100 722 399 357 ------
NM_002375chr332260 744 236 11984 1311 --
NM_002381chr21942 ------
NM_002387chr584777 4696 4537 1807 1567 1423 202 29 --1257 --
NM_002395chr61233 ----21102 464
NM_002397chr521381 505 11415 --11446
NM_002398chr221487 72 --2318 144 --
NM_002399chr1531302 528 320 ------
NM_002401chr1782106 1686 868 819 511 239 119 66 2335 159 11780 --
NM_002402chr72994 78 ------
NM_002408chr142130 48 ------
NM_002427chr1111093 --1886 11168
NM_002430chr222948 381 --3854 775 693 --
NM_002442chr1251619 1311 710 282 154 ------
NM_002444chrX21994 1305 1278 ----
NM_002449chr521304 1172 ------
NM_002473chr2231212 251 245 1537 --1218
NM_002479chr11285 ------
NM_002481chr177419 7029 6033 5772 1373 325 283 36364 5075 1548 47518 5948 1734 313 --
NM_002499chr1542304 2014 1625 926 12370 22028 271 --
NM_002500chr2--11183 ----
NM_002501chr1963179 2996 1488 225 195 128 13515 13328 11439
NM_002505chr61144 ----1578
NM_002508chr14739 379 279 120 2110 70 ----
NM_002514chr82975 208 ------
NM_002515chr1421598 1331 --11291 --
NM_002519chr1111131 ----11201
NM_002522chr171950 2914 219 21480 791 11315
NM_002537chr156964 776 372 287 131 116 ----1305
NM_002544chr17166 ------
NM_002545chr1134915 2077 240 11278 ----
NM_002547chrX63991 2976 2807 976 718 325 --32752 1623 1199 --
NM_002552chr23431 126 68 ------
NM_002553chr73382 130 113 ------
NM_002556chr112547 371 --1357 --
NM_002568chr8--1347 ----
NM_002577chr322730 2718 1207 33144 2693 474 --
NM_002578chrX------1443
NM_002579chr1951226 353 103 75 55 --31209 1202 457 --
NM_002581chr963987 3748 2030 1582 325 80 21097 533 14243 --
NM_002588chr551629 1596 1224 562 51 --21318 156 --
NM_002594chr2022135 385 ------
NM_002600chr121447 171 --1643 --
NM_002613chr1684060 3977 3722 1820 1512 1483 962 806 24097 309 21425 1360 --
NM_002622chr52780 608 --1206 --
NM_002628chr321133 131 --1852 --
NM_002632chr141708 ------
NM_002633chr11458 ------
NM_002641chrX42020 1984 1363 710 ------
NM_002645chr1122851 961 11019 ----
NM_002651chr13799 618 35 1196 ----
NM_002655chr865193 4681 4055 3362 498 76 14317 ----
NM_002656chr6----1353 --
NM_002657chr2051570 1497 1016 385 24 13388 32970 2798 567 --
NM_002670chr331377 1036 104 ------
NM_002693chr151104 ------
NM_002697chr11210 ------
NM_002698chr1952820 1920 980 637 263 --1105 --
NM_002710chr1221030 348 --122 194
NM_002716chr1152971 2401 703 595 558 --23391 3063 --
NM_002717chr81258 ------
NM_002719chr1421974 1518 ------
NM_002731chr122914 1130 1472 22465 2158 --
NM_002733chr122223 40 ------
NM_002734chr1741892 921 540 182 --1376 --
NM_002742chr14----1707 --
NM_002747chr1851543 1373 569 491 148 1401 ----
NM_002748chr153867 824 782 ------
NM_002752chr5------1461
NM_002753chr42554 57 ------
NM_002763chr12223 57 ------
NM_002765chrX21153 419 --122 --
NM_002788chr14183 ------
NM_002819chr1931294 193 168 1986 ----
NM_002822chr12145 ------
NM_002823chr21648 ------
NM_002832chr161353 1106 497 310 32 25 31532 1463 1452 ----
NM_002834chr1243900 2685 1265 889 31271 1122 1066 12957 --
NM_002839chr932547 948 443 ------
NM_002840chr141159 231 203 85 1176 ----
NM_002841chr31248 ------
NM_002844chr621072 44 ------
NM_002846chr24510 475 201 30 --2164 112 --
NM_002849chr1211039 ------
NM_002855chr11143623 3612 3088 2848 2569 2531 2358 1327 925 866 684 155 116 66 13239 53406 3346 3014 1287 109 --
NM_002858chr11261 ------
NM_002865chr8126 --172 --
NM_002869chr1132195 1621 557 ------
NM_002890chr52889 41 ------
NM_002892chr1411709 --1526 --
NM_002902chr151637 ------
NM_002906chr113738 457 207 ------
NM_002918chr1931078 1045 413 --21033 239 --
NM_002942chr31330 ------
NM_002953chr12795 196 1132 ----
NM_002956chr12------134
NM_002959chr173674 3394 3368 3236 3110 2997 1011 --34084 3630 877 --
NM_002971chr31850 ------
NM_002972chr221277 ------
NM_002977chr233383 880 589 --12816 --
NM_002996chr1641698 1686 1632 396 11722 1316 --
NM_003000chr1--138 ----
NM_003001chr142054 468 246 235 1259 12061 --
NM_003009chr19123 ------
NM_003010chr1722315 1970 198 22026 580 --
NM_003011chr911435 1404 1109 --
NM_003016chr17--1637 11740 --
NM_003017chr611196 --2530 305 --
NM_003028chr963326 3112 2959 1228 1142 76 1922 13574 --
NM_003034chr1257857 6648 6598 5231 2874 25134 4970 16396 --
NM_003042chr32867 727 1115 11974 1742
NM_003043chr342744 1647 1446 1154 23723 974 1452 --
NM_003045chr1374206 3774 3245 1712 981 429 292 11778 24413 643 --
NM_003069chrX--1155 ----
NM_003071chr321401 525 ----11764
NM_003079chr173893 159 104 ------
NM_003081chr201310 ------
NM_003107chr611928 --1234 12028
NM_003108chr235752 4876 2790 1888 17238 12164
NM_003118chr552021 1563 616 498 257 ------
NM_003128chr251842 1018 451 361 91 166 31978 1815 1031 --
NM_003131chr621652 808 --11868 --
NM_003139chr113636 266 207 ----1936
NM_003142chr21101 ------
NM_003144chr61735 ------
NM_003155chr842157 1863 592 422 ----1671
NM_003156chr1131004 852 119 ------
NM_003161chr1723237 388 ------
NM_003170chr174490 174 90 57 --1527 --
NM_003173chrX31325 1154 1119 --1456 11258
NM_003178chr341842 422 280 198 ------
NM_003184chr8------136
NM_003185chr20--1977 ----
NM_003188chr62283 123 ------
NM_003189chr143207 3172 467 440 23315 2626 22533 2232 --
NM_003199chr1844623 4443 3514 334 1286 ----
NM_003202chr541704 1367 559 218 21248 329 ----
NM_003204chr1731677 1258 175 1506 11595 --
NM_003214chr671394 1384 1253 1215 211 117 79 1927 31141 568 264 21042 492
NM_003217chr1221931 559 ------
NM_003220chr6------11348
NM_003221chr673130 3115 2540 1640 1008 641 613 12619 14178 --
NM_003253chr2141305 1180 597 58 11698 ----
NM_003257chr151390 ------
NM_003262chr364241 4130 3598 3488 3313 1963 ------
NM_003292chr13374 339 187 --12050 2456 234
NM_003300chr14--188 ----
NM_003304chr311556 ----1329
NM_003305chr41394 ------
NM_003317chr144569 563 57 27 --1653 --
NM_003319chr22906 330 ------
NM_003320chr11104203 2956 1656 887 855 765 391 379 139 77 13712 131 34342 3191 1692
NM_003326chr152047 921 909 531 104 --1225 --
NM_003337chr51654 --11539 --
NM_003339chr511616 ------
NM_003340chr43485 238 155 --1385 --
NM_003341chr3----1627 --
NM_003344chr7----11415 --
NM_003348chr1211088 1114 ----
NM_003349chr202236 178 ------
NM_003352chr22818 142 ------
NM_003369chr1152683 2136 1965 1091 43 --12650 12117
NM_003371chr941548 354 329 122 --2720 428 --
NM_003373chr101413 1293 --179
NM_003383chr91184 ------
NM_003387chr22523 481 11078 1743 --
NM_003388chr7102085 1978 1967 1901 1623 1452 801 663 194 29 21569 818 2593 59 1320
NM_003389chr9--1353 ----
NM_003392chr343594 3008 2769 1556 ------
NM_003400chr22687 256 ------
NM_003403chr14----1783 --
NM_003404chr2051885 1669 673 580 133 --11917 11525
NM_003406chr821947 341 --11930 --
NM_003409chr18----2292 233 --
NM_003410chrX1701 --1165 --
NM_003411chrY1725 ------
NM_003413chrX11285 --1138 --
NM_003418chr3------1667
NM_003457chr171662 ------
NM_003458chr353263 3250 3188 2880 572 32465 1229 545 11035 --
NM_003463chr632716 2338 495 ------
NM_003468chr263946 3902 2676 587 518 185 ------
NM_003469chr21298 ------
NM_003471chr331694 738 107 --153 --
NM_003472chr62966 465 ----1500
NM_003478chr1122949 2239 --1567 --
NM_003489chr21----13326 --
NM_003498chr1652510 1894 921 512 201 --1152 --
NM_003507chr21285 1531 --1391
NM_003563chr1711216 1954 1962 --
NM_003564chr12625 513 ------
NM_003566chr1223327 778 ------
NM_003569chr61255 --1628 --
NM_003576chr1342527 2461 2397 142 --11169 12536
NM_003583chr1243503 953 554 96 178 1595 --
NM_003586chr163264 149 44 ----1258
NM_003590chr243566 3287 2807 2474 12785 13890 --
NM_003591chr101170 ------
NM_003592chr7----1169 --
NM_003597chr241729 702 404 113 ------
NM_003601chr4185 ------
NM_003603chr4----2486 344 --
NM_003607chr123798 1350 23876 3717 13103 --
NM_003615chr31504 11249 13175 13212
NM_003617chr173923 3778 3539 1762 694 283 153 11795 1101 13732
NM_003620chr171695 ------
NM_003624chr1971307 1094 1030 968 474 344 87 --1439 --
NM_003629chr133259 3142 1208 13104 ----
NM_003632chr173718 196 105 1768 ----
NM_003633chr51707 ------
NM_003644chr17114636 4625 4522 4436 2400 2086 2076 1778 1662 1334 156 1187 25383 5225 26397 1804
NM_003671chr953041 2813 774 206 144 ------
NM_003672chr111809 ------
NM_003677chr1242122 1460 591 363 ------
NM_003684chr141015 951 800 285 ------
NM_003713chr14585 440 176 107 --1523 --
NM_003716chr32193 104 ------
NM_003718chr71520 ------
NM_003728chr43168 156 60 ------
NM_003735chr551629 1596 1224 562 51 --21318 156 --
NM_003736chr551629 1596 1224 562 51 --21318 156 --
NM_003744chr142134 29 1141 2511 445 --
NM_003748chr14294 286 41 25 --1424 21386 528
NM_003749chr132634 66 1899 ----
NM_003759chr443792 3618 3299 1452 12905 ----
NM_003768chr131780 1450 566 ------
NM_003769chr12------160
NM_003779chr12459 424 ------
NM_003787chr181675 --1214 --
NM_003795chr6----1131 --
NM_003797chr11------1179
NM_003800chr631776 706 61 ----12378
NM_003811chr191700 1204 ----
NM_003818chr202355 66 --1296 --
NM_003827chr193220 165 25 ----148
NM_003831chr1831629 1207 168 1439 ----
NM_003846chr11807 ------
NM_003861chr1422513 2361 12690 1927 --
NM_003884chr331458 257 47 --11609 --
NM_003885chr1752627 903 839 358 292 --11049 --
NM_003888chr1551639 1565 1087 69 28 ------
NM_003908chr2041133 1112 182 158 --1542 --
NM_003922chr15146 ------
NM_003931chr61593 ------
NM_003936chr221139 98 ------
NM_003939chr1041118 522 464 183 23924 3397 3471 111 31 --
NM_003941chr732192 1748 234 ------
NM_003947chr321251 337 ----1137
NM_003949chr1791847 1629 1566 1515 1497 382 260 141 33 1782 31828 1773 461 --
NM_003954chr1761376 1137 954 479 116 83 --21369 926 --
NM_003958chr663886 3848 3696 1333 1190 938 --21146 485 12686
NM_003966chr597273 6388 5656 2434 1894 685 565 490 67 --24756 1191 16275
NM_003975chr1199 ------
NM_003980chr621386 1082 ------
NM_003981chr152708 348 ----143
NM_003983chr1684196 2868 1785 1663 798 792 139 127 34082 623 518 22904 1399 13444
NM_003985chr175654 578 481 254 42 1159 ----
NM_003987chr1082183 2074 1728 778 704 426 298 219 11996 1763 --
NM_003988chr1092260 2151 1805 855 781 503 375 296 64 12073 1840 --
NM_003989chr1082119 2010 1664 714 640 362 234 155 11932 1699 --
NM_003990chr1082119 2010 1664 714 640 362 234 155 11932 1699 --
NM_003993chr1----149 --
NM_003994chr1244103 3546 3297 626 11661 ----
NM_004004chr132893 79 --165 --
NM_004006chrX42005 1884 1657 627 ------
NM_004007chrX42005 1884 1657 627 ------
NM_004009chrX42005 1884 1657 627 ------
NM_004010chrX42005 1884 1657 627 ------
NM_004011chrX42005 1884 1657 627 ------
NM_004012chrX42005 1884 1657 627 ------
NM_004013chrX42005 1884 1657 627 ------
NM_004014chrX42005 1884 1657 627 ------
NM_004015chrX42005 1884 1657 627 ------
NM_004016chrX41919 1798 1571 541 ------
NM_004017chrX42005 1884 1657 627 ------
NM_004018chrX41919 1798 1571 541 ------
NM_004020chrX42005 1884 1657 627 ------
NM_004021chrX41919 1798 1571 541 ------
NM_004022chrX41919 1798 1571 541 ------
NM_004023chrX41919 1798 1571 541 ------
NM_004024chr121370 252 2288 207 ----
NM_004034chr101478 ------
NM_004035chr1714617 --1420 --
NM_004050chr141894 12773 11734 --
NM_004065chrX1308 ------
NM_004068chr32445 53 ------
NM_004076chr222116 95 ------
NM_004080chr72939 96 11247 ----
NM_004081chrY31575 1454 728 ------
NM_004085chrX2768 703 ------
NM_004089chrX2912 218 ----11151
NM_004090chr1731163 1074 342 1263 12639 --
NM_004093chr1313087 ------
NM_004097chr24854 686 647 143 ----1727
NM_004105chr21926 ------
NM_004111chr111203 ------
NM_004116chr23434 145 43 ----1342
NM_004124chr1423260 80 --12626 --
NM_004130chr31564 --1427 --
NM_004136chr1552142 1142 951 790 597 ------
NM_004157chr31708 --2878 632 --
NM_004162chr3182 --11325 --
NM_004164chr32145 44 ------
NM_004183chr113737 306 93 ------
NM_004185chr11558 ------
NM_004186chr36816 723 370 235 224 35 --1905 --
NM_004200chr1182136 1243 562 192 121 77 37 21 ----1814
NM_004209chr166936 888 850 329 309 91 21049 778 2363 240 --
NM_004227chr762842 2313 2040 2022 1253 138 22396 232 --1289
NM_004236chr15--1598 ----
NM_004253chr91883 ------
NM_004261chr12298 207 ------
NM_004267chr3--2438 81 ----
NM_004272chr5------11798
NM_004274chr1432820 2626 2427 12966 12927 --
NM_004279chr752410 1840 918 807 530 21723 511 ----
NM_004293chr933670 3521 3157 --164 1237
NM_004295chr17--1963 2310 107 --
NM_004298chr5161 ------
NM_004301chr31341 ------
NM_004302chr1252931 902 895 835 143 21975 425 2545 97 --
NM_004308chr1121582 41 1710 21232 138 --
NM_004311chr1062449 2262 1155 856 826 492 ------
NM_004316chr1211033 1242 ----
NM_004319chr171253 1237 1206 1126 496 370 316 12203 --12315
NM_004321chr293564 2798 2764 2583 2439 1379 145 80 34 13406 13034 11372
NM_004323chr931026 958 258 1465 22450 222 --
NM_004329chr101933 ------
NM_004330chr15----1844 --
NM_004338chr1876089 6062 5611 5118 2597 2396 1388 24356 2539 25389 1181 --
NM_004342chr7146 ------
NM_004349chr821180 73 ------
NM_004350chr151590 955 626 465 213 1233 22076 320 --
NM_004364chr1951224 445 320 258 87 --1867 --
NM_004370chr621523 1470 ------
NM_004376chr1011273 1416 ----
NM_004380chr1611711 ------
NM_004384chr52450 236 ----1588
NM_004389chr22772 551 ------
NM_004392chr1322588 2320 ------
NM_004393chr341923 1841 223 94 12153 ----
NM_004395chr53793 664 569 1283 1310 --
NM_004397chr1153856 3798 1588 1126 624 21218 129 12651 --
NM_004405chr22426 149 ------
NM_004411chr73697 86 52 ------
NM_004414chr2131497 427 348 ----1136
NM_004416chr122835 83 --1950 --
NM_004420chr1162296 848 786 735 592 470 1803 ----
NM_004423chr342426 2192 866 225 1616 1927 1603
NM_004426chr1231225 404 328 21823 489 2298 51 --
NM_004427chr131027 907 29 3940 390 82 ----
NM_004428chr11637 ----1656
NM_004432chr911829 ------
NM_004433chr1----1435 --
NM_004437chr193596 2908 2730 2380 1339 1158 778 314 302 23496 1016 22926 2522 --
NM_004438chr232481 1278 552 --1438 --
NM_004448chr173590 241 184 ------
NM_004451chr11--1667 2201 44 --
NM_004457chr211338 140 ----
NM_004458chrX32427 2158 609 ------
NM_004459chr1721611 168 ------
NM_004463chrX288 48 1528 ----
NM_004464chr444069 3909 952 678 13115 ----
NM_004475chr1741041 421 392 173 --11079 --
NM_004501chr143911 3415 765 470 --34149 4094 2806 --
NM_004504chr222365 530 11956 ----
NM_004505chr1711630 ----1291
NM_004514chr1742666 2437 2192 2098 ------
NM_004517chr11--1180 ----
NM_004520chr51182 ------
NM_004525chr21122 11085 ----
NM_004527chr171474 --2185 143 11157
NM_004543chr2199 ------
NM_004566chr1022189 2032 11967 1265 --
NM_004569chr141211 ------
NM_004577chr72512 84 --1260 --
NM_004586chrX75072 4505 4179 3780 3546 3470 1997 --23442 1396 --
NM_004588chr1152823 2510 1319 608 341 1476 22904 350 --
NM_004591chr21133 ------
NM_004593chr3----196 --
NM_004596chr19165 ------
NM_004598chr542992 2302 2223 926 --12975 1771
NM_004600chr131267 1013 408 ------
NM_004603chr721156 329 1104 11069 --
NM_004606chrX148 ------
NM_004612chr924126 3121 13469 24471 3981 --
NM_004631chr111153 ----1952
NM_004656chr341076 1057 421 117 1841 2856 201 --
NM_004657chr231369 1282 35 --1111 --
NM_004660chrY42064 617 364 355 ------
NM_004661chr521038 229 21236 1046 ----
NM_004663chr1531401 1057 1000 1321 ----
NM_004687chr1741641 567 496 22 21980 107 ----
NM_004705chr11195 ------
NM_004709chrX11821 2658 423 11554 11631
NM_004719chr12------22625 545
NM_004734chr1312366 12452 1986 1558
NM_004736chr142230 1390 1381 379 ------
NM_004740chr17148 ------
NM_004742chr31590 ------
NM_004745chr836077 5541 4276 14610 ----
NM_004747chr102203 185 11430 1385 1579
NM_004748chr1523599 420 ------
NM_004758chr173990 938 783 2303 292 ----
NM_004762chr1762038 1756 1659 1341 675 382 1311 31747 289 209 --
NM_004772chr5--1204 ----
NM_004774chr1712091 12697 12950 --
NM_004775chr1832384 2335 2099 ------
NM_004776chr2042773 1162 986 932 ------
NM_004781chr11410 ----11674
NM_004781chr11410 ----11674
NM_004788chr1142608 2286 1678 1099 ------
NM_004796chr1432116 939 196 ------
NM_004798chr2031434 1394 778 --1611 --
NM_004799chr11348 ----1340
NM_004800chr131103 ------
NM_004805chr231125 177 131 --1504 --
NM_004807chr252453 2324 771 595 201 1863 22239 1058 12197
NM_004808chr1032404 518 418 --12113 --
NM_004814chr1----181 --
NM_004824chr631182 1110 210 ------
NM_004834chr242361 1110 963 718 ------
NM_004836chr22277 70 ------
NM_004840chrX52347 2005 1582 560 80 --1834 --
NM_004845chrX84053 3788 3351 3256 1372 1268 513 110 11534 23962 3003 --
NM_004849chr611189 ------
NM_004854chr261275 1113 295 249 210 113 170 ----
NM_004859chr1732487 646 277 ------
NM_004863chr1434653 4026 3593 1988 44988 4962 4551 4544 11037
NM_004872chr1----1375 --
NM_004893chr51116 ------
NM_004896chr1011438 ------
NM_004902chr201168 ------
NM_004904chr786193 6148 5380 4893 4615 1676 1035 541 16136 32136 1546 601 11371
NM_004906chr6----1457 159
NM_004911chr71577 1196 ----
NM_004922chr104800 710 400 29 ------
NM_004926chr1431630 455 28 ------
NM_004929chr811279 --11304 --
NM_004943chr194895 754 390 379 2966 165 31115 837 811 --
NM_004947chr362302 956 602 538 370 356 --21018 631 --
NM_004949chr1822095 54 ------
NM_004956chr724600 2799 14628 --13193
NM_004958chr1121 1772 ----
NM_004961chrX41281 460 417 317 11336 1268 11382
NM_004968chr72578 256 ------
NM_004973chr611626 ------
NM_004976chr11134555 4459 4275 3972 3926 3869 3789 3178 1698 1660 1461 1290 117 34875 2063 1839 43743 3333 1261 552 --
NM_004978chr131424 1414 1078 --21638 639 --
NM_004981chr222418 29 ------
NM_004985chr1211684 ------
NM_004992chrX117439 7354 6920 5676 5263 3267 2449 2089 1327 1139 723 28099 1708 25214 2995 37320 6697 2804
NM_004992chrX117439 7354 6920 5676 5263 3267 2449 2089 1327 1139 723 28099 1708 25214 2995 37320 6697 2804
NM_004998chr151339 1350 --1300
NM_004999chr634310 877 743 --24226 3510 --
NM_005010chr742180 1803 1784 889 --11450 --
NM_005011chr751543 1290 1155 709 664 --11729 --
NM_005013chr11186 ------
NM_005023chr5----11205 --
NM_005028chr1011787 --1807 21707 729
NM_005032chrX1232 ----1875
NM_005045chr721016 190 ------
NM_005056chr1233786 179 173 --34607 2097 593 --
NM_005063chr1073573 3138 2933 2344 939 630 475 1330 2315 308 --
NM_005065chr1411408 14586 ----
NM_005072chr162418 388 ------
NM_005087chr31685 ------
NM_005088chrX1128 1826 ----
NM_005093chr20104766 4122 4093 3961 3879 3873 1520 962 779 343 --74924 3655 3291 1651 1402 353 34 14648
NM_005094chr93701 448 202 ------
NM_005096chrX51207 1003 429 252 76 1295 ----
NM_005109chr32332 284 1458 22188 1930 --
NM_005116chr20114306 4031 3880 3742 1705 1664 1148 494 431 364 227 11187 --1573
NM_005118chr92696 362 11072 ----
NM_005121chr1732446 1125 693 23391 1424 ----
NM_005124chr62806 103 ------
NM_005134chr182852 142 ------
NM_005135chr1522807 228 --22858 2546 --
NM_005140chrX4824 656 295 238 ------
NM_005144chr821065 375 11004 153 --
NM_005151chr181505 --1543 --
NM_005155chr61640 139 ----
NM_005156chr974414 4376 4298 3444 3314 1846 634 1331 ----
NM_005157chr961896 742 726 483 156 114 11359 1578 --
NM_005164chr1252587 2316 2230 1771 802 ------
NM_005180chr101603 ------
NM_005183chrX125 ------
NM_005197chr1475263 4914 2288 2165 936 914 449 34186 2412 2141 24213 4180 14430
NM_005202chr152024 1677 1639 1606 258 --11511 --
NM_005204chr102952 297 ------
NM_005215chr182680 82 ------
NM_005219chr53642 325 69 11441 ----
NM_005225chr2051153 1121 428 340 37 1912 ----
NM_005233chr321719 908 ------
NM_005238chr1133007 2666 299 ------
NM_005243chr22----1259 --
NM_005248chr13512 493 385 1186 ----
NM_005254chr1511098 ------
NM_005261chr8------1313
NM_005264chr101100 ------
NM_005295chr71239 ------
NM_005296chrX--126 1893 --
NM_005311chr722342 1777 12555 --1720
NM_005316chr11----1319 --
NM_005329chr161556 1521 --1760
NM_005334chrX11101 --1514 --
NM_005339chr41109 ------
NM_005342chrX1499 --11793 12099
NM_005347chr961513 1398 1331 1062 667 171 ------
NM_005348chr142907 313 ------
NM_005358chr13157 ----11710
NM_005359chr1856293 5809 5492 3970 2224 25114 211 24398 2119 11725
NM_005369chrX1432 1468 --1526
NM_005370chr19131 ------
NM_005374chr1782332 2057 1599 919 766 518 231 218 --2270 208 --
NM_005382chr82464 148 ------
NM_005387chr11----1267 --
NM_005389chr62283 95 ------
NM_005392chr961522 731 704 376 169 35 1518 1607 --
NM_005397chr772605 1415 1244 822 538 343 220 21226 438 23878 993 1182
NM_005398chr1021135 69 ------
NM_005399chr153464 1169 836 725 714 ----11525
NM_005400chr262329 2217 1907 942 828 122 ------
NM_005402chr721661 222 ------
NM_005406chr1831475 573 188 --11246 --
NM_005407chr1451312 568 496 397 361 --1429 --
NM_005417chr2061818 1701 1448 1365 1333 703 11958 21322 223 --
NM_005418chr114743 564 63 26 ------
NM_005436chr1053881 3572 3384 3148 524 1311 13546 --
NM_005437chr101124 ------
NM_005438chr113497 185 70 ------
NM_005442chr32587 492 --179 --
NM_005455chr11424 ------
NM_005475chr121471 21324 412 2273 258 --
NM_005477chr1562376 2227 2201 1955 914 502 11878 1675 --
NM_005477chr1562376 2227 2201 1955 914 502 11878 1675 --
NM_005497chr1774839 4735 2271 2189 943 416 133 21996 1918 46126 4988 2325 1912 14902
NM_005502chr92900 546 --22650 441 21193 572
NM_005503chr1541030 964 103 49 156 ----
NM_005509chr51194 ------
NM_005520chr51275 --194 --
NM_005522chr73431 423 29 ------
NM_005523chr71416 ----21424 469
NM_005524chr3--1247 ----
NM_005529chr12796 721 1276 1843 --
NM_005539chr101977 --2407 375 --
NM_005562chr111223 --2407 118 --
NM_005573chr51181 ------
NM_005575chr52136 31 ------
NM_005578chr313970 14570 --23983 1278
NM_005584chr132322 288 ------
NM_005585chr15------2407 79
NM_005587chr15--1692 ----
NM_005593chr121485 ------
NM_005596chr976383 4176 2404 2157 1864 1476 54 --16243 --
NM_005603chr1841376 588 295 222 ------
NM_005613chr122107 606 --11582 --
NM_005614chr74916 770 168 60 ------
NM_005619chr191365 ----1259
NM_005629chrX51218 1141 319 257 146 --11078 --
NM_005634chrX1576 ------
NM_005637chr1831658 1386 593 --11393 --
NM_005638chrX21348 303 1520 ----
NM_005665chr134779 3121 3021 --1388 --
NM_005667chr2----1366 --
NM_005668chr534260 2860 326 --23278 697 --
NM_005688chr341217 997 962 524 ------
NM_005707chr15127 1289 ----
NM_005715chr641942 1909 1048 545 --1150 --
NM_005721chr21922 ------
NM_005730chr1263387 2689 2441 2341 2256 2222 23016 110 1738 --
NM_005734chr111248 ------
NM_005736chr1021599 995 21328 164 ----
NM_005738chr71142 --1328 --
NM_005744chr15152 ------
NM_005746chr722290 499 ------
NM_005748chr1243255 2740 370 173 ------
NM_005751chr71380 ------
NM_005752chr1631233 463 122 --11000 --
NM_005756chrX21133 50 ------
NM_005759chr244535 4383 3746 424 11438 23941 3045 --
NM_005764chr12357 276 --154 --
NM_005776chr14284 26 ------
NM_005779chr543095 1470 1198 763 ------
NM_005783chr21637 ------
NM_005795chr212014 ----22837 502
NM_005797chr111247 ------
NM_005801chr172710 585 1281 ----
NM_005808chr342274 1078 1061 137 1357 --11069
NM_005813chr212213 ----1557
NM_005819chr143504 2988 873 344 1528 1253 2400 382
NM_005828chr1795064 4708 4129 3861 3481 1552 395 365 211 --2804 345 --
NM_005832chr31280 ------
NM_005839chr11170 1860 ----
NM_005840chrX97434 7312 2794 2478 1113 990 835 691 228 26928 5678 22400 1416 --
NM_005841chr41844 ------
NM_005842chr132745 149 ------
NM_005845chr1311356 ------
NM_005853chr161597 ------
NM_005857chr121149 406 1119 --11181
NM_005859chr51217 ------
NM_005862chr31709 ------
NM_005864chr142293 132 1527 1611 --
NM_005866chr93869 711 603 ------
NM_005876chr22767 229 --1629 --
NM_005899chr1721537 1120 ----21020 38
NM_005901chr1867485 7133 5682 3490 2581 881 13156 23358 2350 --
NM_005906chr62366 194 --1628 --
NM_005907chr61473 ------
NM_005909chr534065 3762 826 --13625 --
NM_005911chr2------1255
NM_005920chr162748 2693 2628 2506 1527 1328 ------
NM_005924chr711029 ------
NM_005930chr14191 ------
NM_005933chr1162845 2431 2323 2187 1959 799 --11128 --
NM_005934chr1982453 2175 1952 832 589 307 163 90 --12270 --
NM_005937chr1793760 3442 3075 2546 1628 1437 743 259 130 43259 3065 232 90 23217 1340 13686
NM_005938chrX11442 ------
NM_005941chr811475 13533 1274 --
NM_005943chr661327 1104 483 468 250 168 11110 21376 426 --
NM_005944chr321122 808 ------
NM_005955chr135443 3817 355 25162 1433 31644 1105 577 23679 3523
NM_005962chr1031951 1875 341 ------
NM_005962chr1031951 1875 341 ------
NM_005964chr171605 ------
NM_005966chr222349 1694 ------
NM_005996chr1241418 1173 313 35 1223 --1277
NM_006007chr943988 3741 3667 495 ------
NM_006011chr1554315 3952 2706 1288 597 1444 ----
NM_006015chr11269 --1120 --
NM_006022chr13----2940 288 --
NM_006030chr341515 1443 1418 339 11316 ----
NM_006034chr1182310 2114 1859 1592 641 445 354 28 --12091 --
NM_006036chr231699 719 196 --12351 1858
NM_006037chr2104860 4718 3548 3274 3266 3017 1862 878 160 54 --24739 1958 --
NM_006038chr2052007 1797 632 596 145 ------
NM_006041chr17----1134 --
NM_006043chr166743 699 264 233 149 40 ------
NM_006047chr2012616 13421 ----
NM_006051chr52241 45 ------
NM_006062chr231248 1134 505 1211 ----
NM_006079chr61309 ------
NM_006080chr732858 2577 2381 ----146
NM_006094chr832121 1648 627 ----12334
NM_006095chr423454 506 --13382 1578
NM_006106chr1153385 3233 2255 160 121 --53182 2531 1158 428 318 --
NM_006107chr171148 ------
NM_006108chr113863 451 126 ------
NM_006113chr121974 517 --2598 538 1200
NM_006129chr82541 144 153 ----
NM_006133chr1181807 1703 1582 918 708 548 428 30 12219 ----
NM_006134chr2111430 ------
NM_006135chr1----11316 --
NM_006141chr1632711 724 426 --22128 704 --
NM_006145chr1931065 773 101 ----11073
NM_006151chr171421 --1149 --
NM_006154chr1521948 236 ----1554
NM_006164chr2181 ------
NM_006178chr1731572 1012 60 --1263 --
NM_006180chr91406 ----11654
NM_006191chr1211016 ------
NM_006195chr92908 479 ------
NM_006197chr842183 1812 1553 879 ----1382
NM_006201chrX6939 874 369 146 124 97 1359 11008 --
NM_006202chr1931932 1413 403 ------
NM_006203chr565375 5058 4593 1224 153 146 --14212 --
NM_006206chr432773 2330 1809 --1878 --
NM_006210chr192978 299 --11157 --
NM_006224chr173721 609 110 11826 1787 --
NM_006228chr82295 55 --182 --
NM_006237chr1322091 868 ------
NM_006241chr32960 172 --22057 198 --
NM_006245chr6------1242
NM_006251chr513160 --33025 2110 700 1384
NM_006256chr142527 2199 1918 346 --1802 11692
NM_006279chr14709 694 248 31 1776 2239 154 --
NM_006282chr2064312 4175 3965 3193 770 648 14155 23074 795 --
NM_006283chr854136 3902 3436 3078 130 34555 4346 1013 11543 --
NM_006292chr11------174
NM_006300chr192764 463 --1814 --
NM_006301chr123570 533 513 ------
NM_006306chrX54689 3933 1358 418 310 ------
NM_006310chr172429 150 ------
NM_006320chr411010 ------
NM_006321chr322222 451 1649 11965 12009
NM_006328chr111452 ------
NM_006336chr951436 605 345 70 60 --2375 364 1944
NM_006354chr3136 ------
NM_006357chr2--1488 ----
NM_006364chr141352 --1990 --
NM_006369chr11170 ----171
NM_006371chr374846 4809 4161 3847 1134 369 74 13702 33911 503 251 --
NM_006373chr1741334 484 432 404 ------
NM_006375chrX21640 1616 ------
NM_006378chr911094 1915 146 21065 444
NM_006380chr1764307 3668 3242 2835 1099 113 --23479 3013 1536
NM_006384chr15135 ------
NM_006386chr222780 194 ------
NM_006387chr1961025 874 807 507 492 93 --1156 --
NM_006389chr1121114 486 ------
NM_006393chr1084280 3744 3522 3161 3035 3003 1440 470 --1668 --
NM_006401chr9153 ------
NM_006409chr71302 ------
NM_006420chr2063347 3256 1354 1303 1141 817 --11118 --
NM_006421chr81244 ------
NM_006434chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_006454chr4163051 2516 2435 2366 2253 1962 1135 997 818 701 611 452 436 225 150 34 1369 1989 11973
NM_006457chr433253 2769 224 --13236 --
NM_006465chr1582239 1850 1685 1666 860 523 299 216 --3690 263 145 --
NM_006467chr51273 ------
NM_006469chr121561 499 ------
NM_006482chr1243503 953 554 96 178 1595 --
NM_006485chr222678 191 1487 ----
NM_006489chr1421598 1331 --11291 --
NM_006495chr17------1133
NM_006496chr121840 624 ------
NM_006516chr151527 1034 288 203 23 --11164 1147
NM_006517chrX42114 1849 1773 1457 --160 --
NM_006521chrX21083 208 --3535 314 105 --
NM_006526chr2021970 1713 ------
NM_006532chr1961683 1674 1450 1287 631 96 ----1679
NM_006534chr203860 796 630 --23073 482 --
NM_006540chr82226 48 ------
NM_006544chr1445309 2310 1999 1477 22326 1415 14980 --
NM_006546chr1775384 5126 2112 2076 1956 130 29 21988 1973 2841 813 --
NM_006547chr721432 1411 --1820 --
NM_006555chr791954 1869 1662 1631 1594 1537 1276 1216 759 11649 11287 --
NM_006557chr941698 687 673 627 ------
NM_006559chr121180 911 ------
NM_006560chr11169 ------
NM_006561chr1065254 5077 2263 2061 1323 59 --55700 5015 4848 426 79 --
NM_006572chr1762576 2460 1288 1162 442 247 --1978 --
NM_006595chr111230 ------
NM_006599chr1636502 3234 2381 --27736 6767 --
NM_006601chr121115 1704 ----
NM_006603chrX11633 ------
NM_006614chr342649 2496 777 222 ----1589
NM_006620chr653874 3382 1817 1772 1631 14544 13772 --
NM_006621chr141851 1379 695 622 1251 1526 --
NM_006624chr10----12065 --
NM_006629chr1842090 1973 1760 138 1297 ----
NM_006634chr21213 ------
NM_006644chr131466 ------
NM_006650chr583538 3525 3145 2743 900 755 577 488 23405 2810 31092 764 375 --
NM_006654chr1294766 3883 3492 3225 1885 1265 1113 588 238 --11042 1683
NM_006675chr1293267 3189 3022 2226 2180 1131 480 366 22 --21245 669 --
NM_006682chr732114 2099 1073 ------
NM_006690chr20122277 2222 2170 2127 2006 1784 1620 1487 643 328 149 87 32176 2162 834 11875 --
NM_006695chr171324 --125 --
NM_006698chr201480 ------
NM_006711chr16150 ------
NM_006718chr6----1353 --
NM_006722chr342652 2436 305 135 ------
NM_006726chr4198 ------
NM_006729chrX65516 5166 4700 3910 3733 3560 13873 24239 4153 --
NM_006736chr251782 1726 1327 370 210 11865 21247 178 1718
NM_006741chr12--1768 --11018
NM_006748chr831407 259 29 --11180 1357
NM_006749chr8--1957 --1344
NM_006755chr111143 ------
NM_006761chr172616 606 ------
NM_006763chr131645 259 36 ----11312
NM_006766chr8------12570
NM_006771chr171111 1234 ----
NM_006775chr642727 1977 1249 857 --11927 --
NM_006777chrX12163 ------
NM_006782chr11130 ------
NM_006791chr15----1263 --
NM_006800chrX3407 141 112 ------
NM_006814chr2031766 995 110 11028 1494 --
NM_006823chr81129 --1518 --
NM_006826chr2----1875 --
NM_006827chr1432524 1236 631 --1358 --
NM_006846chr51259 ------
NM_006852chr174921 523 477 397 ------
NM_006870chr202535 258 ------
NM_006874chr41913 ------
NM_006875chrX2816 121 --1181 --
NM_006885chr1654246 3820 3304 957 383 ------
NM_006888chr1472966 2476 1362 984 976 604 151 ------
NM_006892chr203579 505 239 --1138 11416
NM_006892chr203579 505 239 --1138 11416
NM_006896chr721145 718 --11104 --
NM_006899chr202319 124 ------
NM_006906chr112816 358 1729 2616 38 --
NM_006908chr731295 567 57 ------
NM_006912chr132374 118 56 --11927 12315
NM_006920chr221532 138 ------
NM_006922chr22530 132 ------
NM_006924chr1724078 668 ------
NM_006930chr521720 440 11946 --11303
NM_006941chr226915 446 423 318 69 32 --2879 835 --
NM_006943chr2053233 2483 2366 385 131 --23285 1322 --
NM_006981chr911857 12595 1822 --
NM_006990chr152329 2043 914 737 619 1894 --12164
NM_006999chr551557 1325 786 269 187 ------
NM_007005chr911374 ------
NM_007006chr161218 1668 ----
NM_007007chr1224627 1912 --169 --
NM_007011chr1524572 1734 --25161 259 --
NM_007017chr5--1346 1253 --
NM_007024chr34556 429 389 228 1203 ----
NM_007039chr142206 68 --1838 --
NM_007050chr20226945 6796 6647 6460 6272 6228 6087 5262 5211 5177 2610 2420 2230 2216 2166 1990 1266 1144 668 641 209 84 27924 33 12956 12603
NM_007054chr543694 3115 3049 2680 --22423 776 --
NM_007067chr17----1291 --
NM_007106chr1312524 ------
NM_007107chr311904 --1620 --
NM_007118chr52348 207 --1143 --
NM_007122chr14493 437 208 47 ------
NM_007123chr131259 431 143 ------
NM_007125chrY11014 ------
NM_007146chr1742179 1835 987 830 --1672 --
NM_007158chr111083 ------
NM_007159chr31440 --1434 --
NM_007172chr2241277 1265 438 204 ------
NM_007174chr1241662 876 201 116 1127 1100 --
NM_007177chr33631 264 30 --2853 339 --
NM_007187chr132421 380 ------
NM_007189chr771466 1164 1064 612 313 221 71 11338 11132 --
NM_007203chr953539 3497 3175 2481 390 --13224 1531
NM_007222chr82351 71 ------
NM_007232chr208988 867 828 765 682 297 280 44 1907 1919 --
NM_007236chr1521844 781 --21767 940 --
NM_007238chr2064045 3776 3302 1824 600 463 1294 ----
NM_007249chr13108361 8323 8101 8066 7834 7468 7247 5864 2903 218 --1935 18824
NM_007279chr192621 554 ------
NM_007292chr1714617 --1420 --
NM_007313chr961896 742 726 483 156 114 11359 1578 --
NM_007320chr19187 ------
NM_007324chr11348 ----1340
NM_007353chr792272 1914 927 853 787 730 520 460 129 11995 2756 652 --
NM_007358chr11467 ------
NM_007359chr1711714 ----11602
NM_007363chrX3893 385 330 ------
NM_007365chr141989 1739 605 291 22075 66 1893 --
NM_012062chr123697 113 56 ------
NM_012069chrX4696 522 448 137 11659 11979 --
NM_012074chr1421104 883 ------
NM_012081chr543713 3420 837 346 ------
NM_012082chr8--162 ----
NM_012083chr102362 56 ------
NM_012097chr211716 22008 1878 ----
NM_012104chr1143666 2826 826 301 ----13701
NM_012104chr1143666 2826 826 301 ----13701
NM_012115chr6----1534 --
NM_012120chr6------1836
NM_012123chr62328 309 ------
NM_012127chr9--139 ----
NM_012134chr161303 1249 523 232 134 78 31865 1641 1213 2288 44 --
NM_012137chr141850 1012 426 63 ------
NM_012141chr1311087 11166 --1752
NM_012154chr8--1658 ----
NM_012164chr987287 5703 4841 4680 1391 1267 834 349 --14984 15891
NM_012193chr1194646 4166 4084 3324 2167 2110 1849 1429 315 --12013 1300
NM_012199chr1124460 4356 3921 3618 3248 3201 3147 3031 1425 1104 644 284 13139 14566 --
NM_012214chr265874 5054 2016 2010 1683 1129 --35864 2575 2443 --
NM_012215chr1021941 26 ------
NM_012223chr221019 375 ------
NM_012228chr1011128 ------
NM_012232chr1741528 569 426 255 21734 1658 ----
NM_012234chr3164 ----13449
NM_012236chr12894 205 ------
NM_012242chr101278 ------
NM_012244chr1441519 1511 1154 233 --11582 1562
NM_012249chr2132 --1351 --
NM_012250chr112424 372 ------
NM_012259chr621147 1141 ------
NM_012262chr144276 3701 3323 546 ------
NM_012264chr2281881 1830 1534 822 465 271 210 103 --41795 1648 476 224 --
NM_012264chr2281881 1830 1534 822 465 271 210 103 --41795 1648 476 224 --
NM_012278chrX1130 ------
NM_012281chr71664 ------
NM_012284chr121117 ------
NM_012286chrX1491 --1252 --
NM_012287chr313020 --2607 359 13371
NM_012288chr665255 5232 4909 4547 2177 62 14612 25209 4478 13715
NM_012293chr21126 --31853 1437 812 --
NM_012296chr11113778 3712 3397 3350 1462 1402 1215 564 210 198 24 12519 23169 2417 21367 601
NM_012297chr42794 284 ------
NM_012300chr532131 1986 71 --22448 448 --
NM_012302chr121102 1042 ------
NM_012304chr552501 2408 1768 714 306 --22300 1927 --
NM_012307chr18--1127 ----
NM_012308chr1131828 1582 1004 12260 2610 442 --
NM_012309chr1194623 4449 3810 3498 1563 834 480 275 151 --31091 682 541 --
NM_012316chr164445 3908 1973 1538 1289 290 25563 4365 24412 4040 23985 721
NM_012323chr2241288 1026 999 617 11424 21524 83 --
NM_012325chr2021275 563 ------
NM_012329chr1711161 ------
NM_012330chr101387 ------
NM_012333chr121096 674 11512 ----
NM_012334chr533485 1819 56 --2106 81 --
NM_012335chr192376 120 --1145 --
NM_012384chr202672 645 11724 2779 636 12387
NM_012402chr1141266 962 430 147 1183 ----
NM_012406chr1221207 313 ------
NM_012408chr201747 ------
NM_012412chr71785 ------
NM_012416chr921230 1047 ------
NM_012445chr42536 347 ------
NM_012471chrX2494 461 11466 ----
NM_012474chr12233 66 ------
NM_012479chr712173 --11949 --
NM_013233chr22263 80 ------
NM_013235chr52104 72 --137 --
NM_013245chr161241 ------
NM_013253chr11----1546 1251
NM_013261chr41901 ------
NM_013266chr10245 26 ------
NM_013267chr12127 ------
NM_013269chr1244191 1513 656 114 13893 11486 --
NM_013277chr121332 --1781 --
NM_013281chr2011132 --11487 --
NM_013282chr1931301 511 458 ----11314
NM_013335chr2175 ------
NM_013341chr222462 2003 12544 ----
NM_013372chr1553149 2374 1357 851 689 ------
NM_013374chr32979 21 13141 ----
NM_013380chr192262 92 ------
NM_013381chr1232239 972 400 ------
NM_013382chr1482125 2104 2001 383 318 121 95 31 --22186 790 --
NM_013396chr21--1193 ----
NM_013399chr1631202 628 600 1342 167 --
NM_013433chr1931970 768 209 ------
NM_013434chr261730 1527 1506 1241 472 228 --11762 --
NM_013434chr261730 1527 1506 1241 472 228 --11762 --
NM_013438chr911321 --1293 --
NM_013444chrX1426 ------
NM_013446chr711329 ------
NM_013448chr14------1276
NM_013943chr12624 313 ------
NM_013986chr22----1259 --
NM_013989chr1444400 3136 1720 427 ------
NM_013995chrX32606 825 99 ------
NM_014000chr101413 1293 --179
NM_014010chr92597 110 ----1578
NM_014011chr252106 1919 670 232 172 --1814 --
NM_014014chr22411 161 1452 ----
NM_014015chr161739 167 ----
NM_014016chr321708 385 ------
NM_014021chr153430 2879 2642 1237 1197 ------
NM_014023chr1062802 2587 2145 1907 834 785 --22222 144 22475 1822
NM_014028chr652997 2545 2278 2056 954 12665 --11114
NM_014034chr611418 ------
NM_014038chr71379 ------
NM_014048chr1674105 3371 3298 1698 1661 1557 703 --11740 --
NM_014057chr91285 --11585 --
NM_014112chr864162 3505 1792 739 487 434 --21614 1238 --
NM_014117chr1622298 1879 ----1628
NM_014141chr775289 4708 4694 4376 1846 1663 1596 --14480 --
NM_014154chr321424 523 ------
NM_014155chr1186711 6703 6624 6174 4699 2462 2193 1343 --35457 1456 1287 22887 1062
NM_014176chr1161 ------
NM_014181chr212518 ------
NM_014216chr1431461 1442 396 --21519 1357 --
NM_014217chr11638 1384 1695 1258
NM_014222chr91164 ----138
NM_014223chr12679 250 ------
NM_014231chr12101719 1625 1569 1540 1463 1417 594 376 110 28 --11358 1348
NM_014232chr171585 11363 21247 491 127
NM_014232chr171585 11363 21247 491 127
NM_014233chr1732140 173 38 ------
NM_014234chr6128 ------
NM_014235chrX31597 1155 27 ------
NM_014238chr1731441 483 207 --21555 420 --
NM_014239chr14------1348
NM_014240chr353504 1058 932 783 385 --23467 3298 --
NM_014241chr101297 ------
NM_014246chr2282153 1539 1505 1451 403 360 350 166 32181 299 90 12058 --
NM_014251chr73751 722 121 ----2369 217
NM_014271chrX155 ------
NM_014278chr4188 ------
NM_014283chr131259 501 283 11439 ----
NM_014296chr32616 610 --1554 --
NM_014299chr1972023 1922 1808 566 461 220 179 --41787 1423 258 165 11588
NM_014300chr151339 ------
NM_014309chr2254578 4310 4148 3883 877 --25123 2006 --
NM_014315chr14--1138 ----
NM_014317chr10147 ------
NM_014319chr1221370 216 ------
NM_014322chr13985 138 118 ------
NM_014323chr2221024 314 ------
NM_014325chr121344 12112 12101 --
NM_014331chr486977 6811 5919 4763 2167 1947 1867 33 ----11095
NM_014332chrX1292 ------
NM_014333chr1142222 799 633 30 ----1823
NM_014335chr1511221 ----1962
NM_014342chr1111469 ------
NM_014345chr6------161
NM_014351chr2241084 1025 948 27 ------
NM_014368chr941688 129 72 27 --11721 1623
NM_014382chr311750 21091 512 ----
NM_014388chr1105947 5703 5383 5262 4583 4379 4136 4048 2158 1309 1534 11954 --
NM_014390chr72407 109 ------
NM_014392chr41202 ------
NM_014399chr71256 ------
NM_014405chr1752251 1744 1561 1505 670 --32031 1876 1755 --
NM_014415chr311551 ------
NM_014418chr1441985 1880 1367 704 1190 ----
NM_014423chr521774 365 --13433 --
NM_014431chr1041628 1201 473 253 ------
NM_014445chr322365 520 ------
NM_014452chr6----21100 911 --
NM_014458chr1----1922 --
NM_014488chr111515 ------
NM_014489chr111563 ----142
NM_014494chr1641925 1884 1650 514 ------
NM_014496chrX1232 ------
NM_014497chr2145 ------
NM_014515chr122187 95 --1653 --
NM_014517chr311363 ------
NM_014548chr1521252 199 --11391 --
NM_014554chr1231989 798 535 ------
NM_014570chr221373 185 ----
NM_014572chr131462 ------
NM_014574chr141629 ------
NM_014575chr3----1133 --
NM_014588chr20178 ------
NM_014591chr10157 1151 ----
NM_014592chr54727 586 256 176 1756 2689 670 --
NM_014613chr531987 503 183 --12291 --
NM_014623chr6182 ------
NM_014630chr1543253 2918 2881 1499 --22438 491 1873
NM_014634chr22113299 3229 3065 2804 2735 2214 1354 412 299 272 102 1652 21125 494 --
NM_014644chr14841 831 797 247 1149 ----
NM_014646chr1883157 2733 2419 1134 1101 595 446 185 22792 1315 1163 --
NM_014655chr121578 470 2849 392 ----
NM_014663chr13996 704 319 ------
NM_014665chr893510 3336 3012 2716 1367 1344 902 572 383 12604 32695 2540 258 --
NM_014666chr51499 ------
NM_014673chr8----182 --
NM_014677chr821380 527 ------
NM_014680chr173247 202 46 ------
NM_014682chr812115 ----1680
NM_014686chr1952117 1813 779 509 39 2920 45 1269 --
NM_014690chr753034 2205 2125 1969 336 --12199 1680
NM_014694chr94620 564 484 466 ------
NM_014701chr1513297 --189 --
NM_014707chr721832 647 ------
NM_014709chr2----199 --
NM_014719chr72959 840 ------
NM_014720chr103627 469 382 ------
NM_014726chr174938 512 404 162 --1333 --
NM_014730chr1275279 4900 4888 3352 3247 1270 281 --24267 655 11229
NM_014730chr1275279 4900 4888 3352 3247 1270 281 --24267 655 11229
NM_014731chr2051637 1593 1165 678 400 --21176 567 --
NM_014735chrX52103 2084 1574 1377 244 --2593 257 1204
NM_014736chr153822 691 672 ------
NM_014742chr2041418 1285 598 479 ------
NM_014746chr294072 3355 3030 2970 2904 2797 2763 1463 800 ------
NM_014747chr144485 4376 1878 626 44550 4362 3742 1136 35037 3906 3667 25072 1449
NM_014754chr8------139
NM_014755chr251371 926 645 539 27 ------
NM_014756chr112298 85 ------
NM_014757chr521969 869 ----12079
NM_014759chr851487 628 330 304 62 --1117 --
NM_014761chr1621177 961 ------
NM_014762chr13279 215 167 --11903 --
NM_014764chr1221046 133 ------
NM_014765chr121773 712 21794 1707 22173 324 --
NM_014767chr1073629 2477 1158 855 813 648 413 --11320 11196
NM_014770chr1251138 835 505 366 324 --2984 518 --
NM_014772chr1873055 2772 1447 1377 1188 754 635 13203 12376 12569
NM_014774chr12603 34 11157 ----
NM_014779chr31411 --1191 --
NM_014781chr8160 ------
NM_014782chrX2305 94 ------
NM_014798chr1771812 1610 1333 316 164 79 49 ----11536
NM_014800chr74424 374 362 180 ------
NM_014806chr91445 1310 2505 148 1191
NM_014810chr112980 ------
NM_014813chr1--171 1585 --
NM_014819chr512419 1804 1703 --
NM_014820chr311321 ------
NM_014822chr42102 61 --1160 --
NM_014824chr112423 272 ------
NM_014826chr123798 1350 23876 3717 13103 --
NM_014827chr131356 548 199 ------
NM_014828chr1441841 374 330 51 ------
NM_014829chr522372 2090 ------
NM_014830chr1273675 3253 2515 1288 775 288 223 1934 11372 --
NM_014832chr1331606 154 129 ------
NM_014838chr2262571 2072 1771 1133 730 83 ------
NM_014840chr1211083 13324 22974 264 --
NM_014841chr611211 ------
NM_014846chr8192 ------
NM_014850chr363998 3408 1228 173 149 52 11652 34594 4351 4231 --
NM_014859chr1731333 964 492 ------
NM_014860chr242467 773 460 415 --12168 129
NM_014869chr321114 437 --139 1403
NM_014870chr1113767 3314 3176 3100 3012 1693 1574 934 581 375 271 13998 14545 --
NM_014871chr12193 --1116 --
NM_014873chr183708 3699 3447 3014 1494 1444 630 582 2909 352 ----
NM_014874chr171905 1360 1352 566 515 497 417 1657 ----
NM_014876chr2252157 2101 812 486 423 --1611 --
NM_014877chr1787707 6796 6521 6433 6145 6061 5367 2193 ------
NM_014883chr43849 608 415 22385 2259 1687 --
NM_014891chr731621 577 425 --21562 546 --
NM_014900chr221066 991 ------
NM_014901chr571908 1866 740 220 146 91 66 --3911 423 22 --
NM_014902chr2051331 1278 969 595 299 1546 11168 --
NM_014903chr122700 423 ------
NM_014904chr1053440 3190 2956 2640 1426 1296 ----
NM_014906chr1753602 3505 1427 1403 398 11077 ----
NM_014912chr10----1183 11364
NM_014918chr1521539 1367 --1547 --
NM_014921chr1972922 2656 2632 2398 1011 1001 33 1256 22486 1213 --
NM_014923chr1312355 11805 ----
NM_014924chr1442761 2156 918 318 --22206 2020 11022
NM_014926chr31882 ------
NM_014931chr192487 464 ----1539
NM_014932chr311775 ------
NM_014933chr41162 ------
NM_014935chr143004 296 195 77 53243 3231 3201 2688 1454 2887 213 --
NM_014938chr1292561 2177 2114 763 465 418 390 94 53 12299 22122 152 --
NM_014942chr652370 2245 1878 251 72 2321 277 21616 162 1433
NM_014944chr131378 1006 373 ------
NM_014947chr152533 2525 2086 1210 1143 12803 1952 --
NM_014949chr11265 ------
NM_014961chr452058 1959 1868 1850 301 ------
NM_014962chr2022724 2162 ------
NM_014969chr11334 --192 --
NM_014970chr1177 ------
NM_014974chr1031595 1419 59 1209 ----
NM_014978chr103735 672 506 --1142 --
NM_014982chr1434572 703 301 --1969 13852
NM_014989chr621894 1861 ------
NM_014990chr1451158 1103 189 158 131 ------
NM_014991chr463268 2739 2154 732 650 614 ------
NM_015000chr1222288 279 ------
NM_015008chr343155 2847 2645 1407 ----12235
NM_015009chr31750 ------
NM_015015chr1982034 1755 1461 781 736 709 637 33 11487 ----
NM_015018chr61210 ------
NM_015020chr1633003 946 146 --3400 263 138 --
NM_015025chr222333 2144 ----12083
NM_015033chr952910 1114 769 416 175 23120 2056 ----
NM_015035chr20135748 5042 4638 4236 2502 2488 2451 2157 1667 1445 1189 1144 178 1152 1104 14129
NM_015037chr101180 ------
NM_015039chr153843 1238 539 353 314 13172 14019 13212
NM_015042chr1574097 3975 3818 3356 2697 1730 1149 31013 320 45 43783 3315 2677 1665 13753
NM_015051chr932373 2060 1084 ------
NM_015053chr12288 249 11624 12256 --
NM_015055chr1112877 --11949 --
NM_015056chr2152173 1994 922 708 135 12330 1569 --
NM_015057chr13----181 --
NM_015059chr1521488 834 2928 634 32922 2815 2704 --
NM_015063chr1951192 928 525 179 37 --11307 --
NM_015069chr16----1198 --
NM_015071chr596132 5576 5009 4753 4132 2040 2017 1756 705 ----25703 4441
NM_015074chr164558 3247 1966 1643 1634 880 --41943 1703 1614 132 34464 3201 1919
NM_015075chrX21698 467 21677 1616 1295 --
NM_015076chr641708 1271 495 29 135 14237 24379 630
NM_015080chr117901 873 667 654 349 258 50 ------
NM_015082chr532491 2259 2238 31750 1674 404 ----
NM_015086chr122448 161 ------
NM_015090chr195467 5031 4697 4051 3797 3787 1031 917 240 11925 45717 5099 4344 267 11013
NM_015091chr141273 --1744 --
NM_015092chr1634628 3330 2964 ------
NM_015093chr62240 233 ------
NM_015094chr2283813 3160 3007 2854 1284 805 139 101 --24601 4086 --
NM_015097chr312100 ------
NM_015100chr111511 ------
NM_015102chr12301 111 ------
NM_015103chr32306 283 31024 396 382 1263 --
NM_015107chrX61813 690 500 471 433 385 2614 568 11676 --
NM_015113chr1732188 2064 639 12147 2442 100 11782
NM_015115chr411059 ------
NM_015132chr731888 1321 1246 --137 --
NM_015133chr1671206 997 961 421 295 279 62 1265 51129 988 515 491 459 --
NM_015144chr1643150 3075 1333 214 ------
NM_015155chr1022285 755 --12507 12648
NM_015156chr1433185 3041 226 ------
NM_015162chr151388 ------
NM_015163chr142214 69 ------
NM_015170chr82522 201 2366 42 11549 --
NM_015173chr431836 1558 1256 1542 143 --
NM_015176chr1----1684 --
NM_015180chr143627 359 157 --155 --
NM_015185chrX----42344 2118 1923 691 --
NM_015192chr2012358 12178 3656 169 81 --
NM_015193chr881483 1265 1242 1115 963 105 55 29 --11100 --
NM_015194chr1771460 458 428 189 84 60 30 41601 253 233 24 --1474
NM_015197chr14132839 2768 2575 2296 798 769 460 412 379 363 213 135 50 1938 22477 2250 11313
NM_015200chr42554 310 --22011 846 --
NM_015206chr1522725 1026 ----1678
NM_015219chr1792451 1703 1597 983 903 679 578 359 302 32006 415 397 21827 1798 --
NM_015225chr932794 1255 526 --12285 13061
NM_015231chr111798 ------
NM_015233chr1342567 945 464 306 --21699 105 --
NM_015236chr41173 --11219 --
NM_015238chr52616 570 --1656 --
NM_015246chr1661686 1494 1431 638 471 300 ----22006 355
NM_015247chr1645052 4976 3753 656 11623 23404 542 --
NM_015250chr922007 551 ------
NM_015254chr872871 2560 2283 2050 821 242 86 --2881 38 12462
NM_015261chr11----124 --
NM_015265chr221632 939 --11930 --
NM_015270chr1242179 456 342 63 1866 --1741
NM_015271chr434151 3629 1244 ------
NM_015272chr163557 427 45 ------
NM_015277chr182566 65 ------
NM_015278chr652819 2101 973 633 402 ------
NM_015282chr222158 948 11057 187 --
NM_015284chr112045 --21972 1473 --
NM_015288chr5143803 3738 3679 3232 3158 1343 1223 1023 622 389 315 262 188 58 2898 811 22540 670 1792
NM_015292chr121704 --2713 501 --
NM_015299chr1483199 3151 2974 2749 2509 590 85 55 13454 1209 --
NM_015305chr1431761 659 411 --21623 1254 --
NM_015310chr886745 2781 2702 2458 2136 2027 1730 1070 17524 3806 455 306 22582 1745
NM_015313chr1154001 3777 1670 1562 1237 14478 2652 589 21724 152
NM_015315chr521109 352 22859 680 32115 456 70 12658
NM_015317chr222591 958 ------
NM_015326chr132465 2215 434 11871 ----
NM_015327chr141208 1054 156 128 --1944 1137
NM_015328chr762717 2149 887 584 343 117 1181 32512 736 325 --
NM_015331chr1130 --1571 --
NM_015332chr7153493 3263 3149 2959 2928 2754 2214 1251 1212 866 857 737 660 647 549 21274 667 33041 2363 2338 13188
NM_015335chr1231054 772 30 --12356 --
NM_015338chr2031221 488 216 1732 11839 11921
NM_015343chr172257 81 ------
NM_015344chr841692 1670 1352 581 ------
NM_015349chr622536 1937 ------
NM_015353chr1732582 2486 330 --42496 2411 1896 81 --
NM_015355chr171732 ------
NM_015359chr851813 773 637 517 49 ------
NM_015365chrX43453 3300 1364 577 12916 13322 --
NM_015382chr141784 ------
NM_015385chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_015396chr331030 902 290 --11209 --
NM_015397chr931339 567 125 ------
NM_015446chr141702 1225 327 173 ------
NM_015455chr551447 1144 947 894 611 13572 13302 --
NM_015457chr112967 772 ------
NM_015472chr31404 ------
NM_015472chr31404 ------
NM_015475chr21830 --1266 --
NM_015481chr121301 --1737 --
NM_015488chr241749 1305 433 23 --21761 136 --
NM_015493chr1932052 1601 528 1780 11995 --
NM_015496chr81278 ------
NM_015508chr321084 455 ------
NM_015520chr3143 --12012 --
NM_015530chr21371 ------
NM_015532chr1542844 1996 698 140 ----11844
NM_015534chr11852 ------
NM_015535chr293946 3694 3188 3175 1603 824 780 292 48 --32894 1082 990 22551 1291
NM_015537chr97986 863 459 426 418 281 21 --2240 140 --
NM_015553chr654176 3398 1842 1563 362 23341 3139 44534 4224 4074 1186 --
NM_015557chr1153529 3407 3401 2835 2589 2274 1015 1006 970 748 573 493 471 173 71 22235 195 1624 --
NM_015564chr543204 2711 1284 199 ------
NM_015569chr163495 3166 985 471 275 156 13996 ----
NM_015571chr631743 899 85 ------
NM_015575chr283679 3043 2853 2756 2480 2318 1091 155 11016 23347 2568 --
NM_015576chr322163 125 --12695 --
NM_015577chr53734 168 110 ----1258
NM_015589chr14155 ------
NM_015609chr1102916 2672 2556 2125 1955 1879 1857 1151 725 362 1675 32727 2687 1985 --
NM_015626chr1711211 ------
NM_015627chr131263 673 530 ----1241
NM_015638chr203526 256 229 ------
NM_015640chr155318 5012 4839 3904 2154 13300 11469 --
NM_015646chr122858 50 ------
NM_015676chr14--1386 ----
NM_015678chr131598 --1334 --
NM_015686chrX41821 451 345 304 12123 22144 2106 --
NM_015687chr6------1213
NM_015695chr61281 21937 672 1519 1299
NM_015711chr192547 118 ------
NM_015726chr111417 ------
NM_015850chr841803 936 603 121 ------
NM_015872chr151672 1649 1477 1443 688 --11494 --
NM_015878chr821603 671 21932 1806 ----
NM_015881chr11----1546 1251
NM_015888chr143350 1221 1033 1005 ------
NM_015891chr621596 704 1614 11784 11811
NM_015897chr19133 ------
NM_015902chr81614 ------
NM_015906chr144043 3700 1238 106 1486 --11435
NM_015912chr842557 2170 1902 513 11555 11909 --
NM_015955chr2163 ------
NM_015964chr162325 51 --1131 --
NM_015984chr1197 ------
NM_015994chr14----1213 1600
NM_015995chr15154476 4470 3400 1905 1867 1812 1802 1720 1532 1479 1430 938 531 442 392 13721 45030 2201 1881 502 13824
NM_016019chr71172 ------
NM_016021chr653030 2973 2265 986 501 --1848 --
NM_016022chr16301 85 73 62 49 42 --1262 --
NM_016025chr1621285 384 ------
NM_016026chr141448 --2465 140 1190
NM_016032chrX31090 910 526 1406 11259 --
NM_016040chr122733 1851 12473 ----
NM_016059chr61343 --1195 --
NM_016061chr221345 477 11075 1463 --
NM_016075chr1352752 2677 717 156 30 --11208 22776 682
NM_016076chr13631 579 134 12989 11069 --
NM_016078chr171818 ------
NM_016081chr421765 428 ------
NM_016083chr683941 3364 3210 3103 2872 576 389 108 ------
NM_016096chr822158 1395 --1438 --
NM_016097chr181991 --1245 --
NM_016103chr52400 61 ------
NM_016107chr52562 42 ------
NM_016131chr23916 277 75 --1245 --
NM_016140chr162325 51 --1131 --
NM_016147chr114405 367 215 98 --2989 282 --
NM_016169chr1092797 2690 798 752 628 368 189 140 38 1690 22583 2430 1554
NM_016188chr7--137 ----
NM_016190chr1----122 --
NM_016205chr421140 469 11146 11401 130
NM_016206chr357681 3590 2568 2549 2022 --18731 28242 858
NM_016210chr331460 595 50 1509 21357 530 1298
NM_016211chr41162 ------
NM_016217chr623419 475 1203 ----
NM_016227chr131259 501 283 11439 ----
NM_016248chr1323368 987 13183 13789 11185
NM_016250chr141651 ------
NM_016255chr643098 2775 2729 551 --1380 1174
NM_016257chr1102782 2707 2613 2523 2338 1288 685 399 248 131 --12829 --
NM_016260chr277571 2971 2591 2014 1575 1094 168 --12801 12929
NM_016269chr421113 976 --1116 --
NM_016272chr2272610 2105 1838 1799 1711 395 141 32513 725 329 ----
NM_016277chr621022 318 ------
NM_016289chr23893 792 150 ------
NM_016303chrX179 ------
NM_016308chr11219 ------
NM_016322chr942843 2563 2425 2194 13012 ----
NM_016337chr143470 370 65 --1403 --
NM_016352chr71202 --31446 1005 588 --
NM_016353chr832261 564 100 ------
NM_016356chr63935 495 141 --12516 --
NM_016358chr54405 164 40 22 ------
NM_016376chr1752704 1576 344 61 21 14341 23731 2850 --
NM_016396chr1542073 2022 888 133 --12610 --
NM_016399chr12--137 ----
NM_016424chr1711653 --11824 --
NM_016436chr2021050 801 ------
NM_016441chr231589 1479 446 1393 ----
NM_016442chr532141 1792 738 11615 ----
NM_016470chr201110 1413 ----
NM_016479chr31804 21108 937 1103 --
NM_016485chr632017 250 186 ------
NM_016505chr11503 ------
NM_016506chr11129 --1181 --
NM_016507chr1742832 899 361 144 --11980 --
NM_016516chr21855 ------
NM_016526chr1162422 2334 2038 1555 825 395 --1155 --
NM_016530chr1541284 673 551 168 ----13199
NM_016542chrX31447 1163 1142 ------
NM_016563chr1531108 526 23 11053 ----
NM_016569chr1241418 1173 313 35 1223 --1277
NM_016574chr114716 682 238 162 21061 362 148 --
NM_016575chr1285207 5170 4888 4111 3669 3638 1493 836 14822 33417 1291 1069 14897
NM_016591chr531053 119 76 ------
NM_016603chr532191 1872 724 ----1875
NM_016604chr5----1349 --
NM_016605chr542569 1844 1834 551 --32558 2547 814 --
NM_016607chrX------1229
NM_016618chr21125 ------
NM_016620chr121104 931 ------
NM_016621chr1184473 4375 3951 3644 3239 1672 807 789 13164 33334 836 708 1525
NM_016626chr183680 631 489 1624 ----
NM_016628chr103827 809 55 ------
NM_016644chr5----1526 --
NM_016651chr141846 1903 ----
NM_016654chr1511098 ------
NM_016734chr951991 1527 1228 591 292 1541 ----
NM_016830chr12181 ------
NM_016848chr9--1101 ----
NM_016931chr111321 ------
NM_016932chr2----168 --
NM_016936chr1671768 1532 1453 785 666 553 469 --2399 189 --
NM_016953chr245472 4956 537 60 21464 91 11588 --
NM_017410chr1231053 942 830 1130 2914 453 --
NM_017412chr841391 1013 377 124 ------
NM_017413chrX72193 1871 1659 1591 218 133 30 --1599 21764 905
NM_017420chr1423428 579 ------
NM_017436chr225682 586 234 149 83 1542 ----
NM_017456chr1762038 1756 1659 1341 675 382 1311 31747 289 209 --
NM_017482chr231582 993 146 --1282 --
NM_017488chr241501 593 528 505 --41405 1279 1140 622 --
NM_017522chr111153 ----1952
NM_017544chrX2157 30 ------
NM_017545chr201416 ------
NM_017548chr322126 1419 ------
NM_017551chr1032045 1820 24 12585 11083 12036
NM_017553chr1531161 923 467 --2313 122 --
NM_017563chr375662 4928 4877 4084 2463 1272 225 36030 5764 4421 ----
NM_017580chr1031915 842 554 ----11903
NM_017582chr121161 129 ------
NM_017590chr2231051 338 141 52410 2205 2045 915 727 22235 2147 --
NM_017595chr1761574 1542 1483 1358 1246 609 11311 31649 1253 436 --
NM_017596chr1164481 3743 3256 3221 3100 3072 3066 2940 2922 1723 1624 1542 1481 1412 993 909 1149 44514 3769 1585 350 13152
NM_017629chr131925 1387 66 11528 ----
NM_017633chr633197 2994 720 --13056 --
NM_017634chr821632 1331 ------
NM_017635chr1121586 516 ------
NM_017637chr979419 9349 8700 7789 6028 5834 3418 12986 28362 3139 --
NM_017641chr121268 ----11047
NM_017643chr1712147 11941 ----
NM_017644chr343705 2069 1054 933 ------
NM_017650chr775231 5180 3958 2312 1354 1024 966 25129 3945 ----
NM_017651chr611569 ----21319 423
NM_017658chr1444337 3793 3562 67 ------
NM_017661chr15170 ------
NM_017666chrX32112 1737 1459 ----11872
NM_017672chr151348 ------
NM_017679chr172706 680 1506 ----
NM_017680chr9123 ----1995
NM_017686chr111023 ------
NM_017700chr4----143 --
NM_017709chr133842 2637 386 21612 934 24189 3158 --
NM_017719chr361966 1005 872 501 494 457 ----140
NM_017724chr32651 66 ------
NM_017737chr12892 717 ------
NM_017739chr12450 432 ----1534
NM_017740chr16130 ------
NM_017742chr182643 151 ------
NM_017747chr52127 83 ------
NM_017749chr115757 693 411 309 220 ------
NM_017752chrX21643 80 ------
NM_017753chr9173 ------
NM_017754chr664097 3332 3198 3155 703 506 13187 24786 81 --
NM_017762chr1532414 2132 2117 ----11593
NM_017769chr1412403 --1593 --
NM_017772chr64640 298 219 130 ----1678
NM_017778chr821264 235 ------
NM_017779chr112101 --1983 --
NM_017780chr81351 ------
NM_017784chr31448 ------
NM_017798chr2011028 ----1143
NM_017799chr1431558 136 27 ------
NM_017802chr72686 139 ------
NM_017811chr923111 506 ------
NM_017813chr855546 4966 4792 3804 1516 ------
NM_017830chr42716 83 ------
NM_017831chr1833743 3591 126 13939 21819 1701 --
NM_017836chr3127 ------
NM_017848chrX73992 3847 3246 3211 772 291 137 11605 11748 --
NM_017849chr243076 1179 683 636 ----12434
NM_017851chr1541167 829 321 97 --182 --
NM_017857chr112544 222 ------
NM_017860chr12691 255 ------
NM_017893chr1041441 337 205 157 --1960 --
NM_017902chr1095013 4674 4316 2008 1684 1238 1130 969 132 12279 34496 2207 1177 --
NM_017917chr14------1111
NM_017921chr1752045 1972 1663 1570 35 --32173 761 594 1652
NM_017938chrX41753 599 535 242 ------
NM_017943chr141895 --1133 --
NM_017944chr1152354 1024 364 156 150 1658 ----
NM_017993chr13191 ------
NM_018013chr642793 2187 359 223 32560 1193 186 1559 --
NM_018014chr231136 153 45 11249 ----
NM_018027chr103320 115 92 11269 2507 63 --
NM_018028chr1941147 210 173 101 ----1399
NM_018031chr34514 177 80 43 --187 --
NM_018032chr16------1258
NM_018036chr1454050 3074 2875 193 100 33039 1617 52 ----
NM_018045chr152860 2624 2520 2415 2124 ----137
NM_018048chr1222033 1463 ------
NM_018061chr11688 ----11282
NM_018063chr10183 ------
NM_018067chr1------1353
NM_018078chr41359 ------
NM_018084chr212533 12504 ----
NM_018092chr161299 ------
NM_018094chrX2271 81 ------
NM_018095chr11129 --1181 --
NM_018103chr1159 ------
NM_018110chr1631342 856 378 ------
NM_018126chr421478 276 ------
NM_018133chr311410 --21625 473 1856
NM_018157chr1242769 1112 673 477 --12883 --
NM_018171chr12--2360 273 ----
NM_018176chr421334 197 193 1517 --
NM_018178chr121689 1456 ------
NM_018182chr171221 --1379 --
NM_018184chr321744 396 ----1731
NM_018191chr1321562 1513 --159 --
NM_018192chr32414 310 --11010 --
NM_018195chr112707 651 ------
NM_018199chr1411207 --1399 --
NM_018200chr1532395 2033 555 --32283 657 514 --
NM_018203chr13741 594 72 ------
NM_018207chr141727 662 334 273 11533 161 11449
NM_018208chr111196 11144 1203 11077
NM_018214chr61882 1444 ----
NM_018222chr1141734 1216 120 28 1263 ----
NM_018227chr412503 ----11264
NM_018240chr1184 ------
NM_018244chr202375 73 --2879 165 --
NM_018246chr821744 729 12684 ----
NM_018247chr632584 2130 620 --12766 --
NM_018252chr12685 31 --1504 --
NM_018254chr12879 57 --11955 --
NM_018270chr203257 229 128 1235 1763 --
NM_018273chr191731 --2324 23 --
NM_018293chr311971 ----12504
NM_018299chr831327 925 183 ------
NM_018312chr1111436 ------
NM_018313chr322061 871 ----11999
NM_018315chr4125 ------
NM_018323chr42386 163 ------
NM_018325chr931464 1024 58 ------
NM_018327chr2021785 1454 ----11229
NM_018362chr1143530 3119 1184 142 --23461 3203 --
NM_018364chr12628 103 ------
NM_018371chr821455 317 ------
NM_018374chr744931 3678 1429 582 ------
NM_018375chr1421647 26 1130 --11910
NM_018381chr193359 267 156 ------
NM_018383chr23704 315 202 --11373 --
NM_018400chr1143692 3480 2966 1291 14149 1955 --
NM_018403chr383409 3338 3330 2761 2746 1654 739 384 12500 ----
NM_018416chr1282413 2238 1710 1006 748 303 269 29 --11917 --
NM_018425chr1041979 1891 1860 1849 22110 235 22323 2069 1139
NM_018440chr8158259 8003 7426 6860 6516 5832 5733 5361 2681 1694 1609 1545 1522 1095 980 21597 848 26017 563 1458
NM_018444chr812362 1199 1193 11599
NM_018448chr121296 ------
NM_018460chr2147 ------
NM_018469chr171145 --1974 --
NM_018471chr22421 37 ------
NM_018482chr82663 27 11942 31877 1595 538 12425
NM_018489chr131713 543 188 ------
NM_018490chr112206 175 ------
NM_018509chr1761660 1647 1287 1187 443 240 --1616 --
NM_018534chr2186 ------
NM_018555chr194696 590 309 213 --21463 893 --
NM_018557chr221686 466 ------
NM_018566chr144981 3268 3262 591 14536 11570 --
NM_018638chr1224869 1416 --11759 --
NM_018639chr1221427 251 --1406 --
NM_018640chr1232688 2476 1118 ----1956
NM_018644chr1141583 821 438 143 11549 1258 --
NM_018650chr1177 ----1427
NM_018653chr173377 338 102 ------
NM_018667chr16122545 2481 2418 2322 2054 1967 1055 745 592 411 344 219 22232 1826 52213 1876 1797 133 82 --
NM_018674chr25548 534 501 181 98 ------
NM_018693chr2------170
NM_018695chr51812 1355 ----
NM_018710chr831357 1119 153 ------
NM_018712chr1131536 1034 202 ------
NM_018715chr172168 1948 1769 1676 1624 545 235 --12113 --
NM_018718chr752167 1602 1488 384 332 --2822 552 --
NM_018837chr20------1731
NM_018841chr123957 936 --23780 2712 --
NM_018890chr731295 567 57 ------
NM_018898chr521681 779 ------
NM_018899chr521681 779 ------
NM_018900chr521681 779 ------
NM_018901chr521681 779 ------
NM_018902chr521681 779 ------
NM_018903chr521681 779 ------
NM_018904chr521681 779 ------
NM_018905chr521681 779 ------
NM_018906chr521681 779 ------
NM_018907chr521681 779 ------
NM_018908chr521681 779 ------
NM_018909chr521681 779 ------
NM_018910chr521681 779 ------
NM_018911chr521681 779 ------
NM_018912chr551629 1596 1224 562 51 --21318 156 --
NM_018913chr551629 1596 1224 562 51 --21318 156 --
NM_018914chr551629 1596 1224 562 51 --21318 156 --
NM_018915chr551629 1596 1224 562 51 --21318 156 --
NM_018916chr551629 1596 1224 562 51 --21318 156 --
NM_018917chr551629 1596 1224 562 51 --21318 156 --
NM_018918chr551629 1596 1224 562 51 --21318 156 --
NM_018919chr551629 1596 1224 562 51 --21318 156 --
NM_018920chr551629 1596 1224 562 51 --21318 156 --
NM_018921chr551629 1596 1224 562 51 --21318 156 --
NM_018922chr551629 1596 1224 562 51 --21318 156 --
NM_018923chr551629 1596 1224 562 51 --21318 156 --
NM_018924chr551629 1596 1224 562 51 --21318 156 --
NM_018925chr551629 1596 1224 562 51 --21318 156 --
NM_018926chr551629 1596 1224 562 51 --21318 156 --
NM_018927chr551629 1596 1224 562 51 --21318 156 --
NM_018928chr551629 1596 1224 562 51 --21318 156 --
NM_018929chr551629 1596 1224 562 51 --21318 156 --
NM_018945chr643661 3126 1000 88 ------
NM_018948chr121225 1061 ------
NM_018951chr71972 --2357 74 --
NM_018953chr124797 552 244 225 ------
NM_018970chr722988 2727 ------
NM_018976chr1232392 1076 354 --12146 11052
NM_018979chr1211011 12353 ----
NM_018983chr41238 ------
NM_018992chr1661661 1076 1031 611 178 171 --31284 409 69 --
NM_018999chr1023125 183 --11943 --
NM_019001chr334658 4037 1011 --24207 3697 --
NM_019005chr7--167 ----
NM_019008chr2263599 3120 1451 769 437 347 13708 1789 13271
NM_019022chr1833190 1976 788 --11040 22553 624
NM_019027chr441872 1034 824 194 ------
NM_019045chrX1696 ------
NM_019046chr10--2333 74 2901 837 --
NM_019072chr543531 3523 1483 944 13215 21650 677 12953
NM_019091chr221010 769 ------
NM_019094chr121302 --43844 3699 1525 778 --
NM_019096chr64741 686 440 235 ------
NM_019106chr2283294 3227 3191 2966 2877 2299 601 273 --21074 868 --
NM_019116chr1641078 868 517 23 1861 23218 700 --
NM_019593chr2053088 2852 2174 2100 863 ------
NM_019597chrX1272 ------
NM_019606chr7146 ------
NM_019609chr20195 ------
NM_019859chr1031085 473 302 ------
NM_019860chr1031133 521 350 ------
NM_019885chr282370 2132 1904 917 757 273 236 26 --1448 12572
NM_019895chr33968 909 831 ------
NM_020039chr124769 743 493 329 21588 31 21508 1304 --
NM_020119chr793194 2966 2892 1057 769 497 485 410 292 11027 63929 3510 547 460 188 102 --
NM_020122chr255746 4492 3747 1122 665 15478 ----
NM_020123chr1011066 ----11331
NM_020127chr131722 1524 455 ----1402
NM_020132chr21145035 4642 4216 3945 3911 3721 3488 3221 1923 1279 1174 1141 1123 482 ----11691
NM_020142chr124513 453 422 403 --2464 438 --
NM_020144chr71764 ------
NM_020150chr1022106 1672 1410 1152 --
NM_020152chr212948 780 ------
NM_020177chr523017 2880 ----13141
NM_020182chr2033095 3038 2630 13339 42651 2332 1083 821 --
NM_020184chr231627 858 26 183 1194 11579
NM_020205chr132350 2332 2229 12453 ----
NM_020209chr19--170 ----
NM_020211chr15111452 1369 1132 1091 1083 620 586 410 370 144 97 11105 ----
NM_020240chr5139 --21678 1072 --
NM_020243chr221607 ------
NM_020245chr695019 4288 4192 4047 3727 3316 618 139 130 --25101 4036 14780
NM_020248chr132101 969 865 1873 11699 --
NM_020307chr3143 ------
NM_020310chr1752154 1958 395 252 96 1485 --12091
NM_020336chr2043738 3482 3053 1233 13790 1784 23825 559
NM_020337chr443194 2120 483 153 ------
NM_020338chr10123734 2477 2374 2338 2283 2272 1365 1219 1152 1094 785 293 32437 775 421 21171 252 --
NM_020342chr22526 83 ------
NM_020346chr1111137 ------
NM_020348chr1032380 2131 2050 1443 22547 916 --
NM_020357chr311540 ------
NM_020374chr1231559 1298 736 11502 11247 194
NM_020416chr422300 996 --1759 --
NM_020420chrY31575 1454 728 ------
NM_020428chr1931161 1007 898 --151 --
NM_020431chr1472619 2579 2515 2174 1968 1919 1677 --21790 177 12533
NM_020432chr741804 1603 835 707 --1329 --
NM_020438chr921243 23 ----1491
NM_020440chr163282 2334 2322 1342 1003 401 --1784 12928
NM_020443chr176960 5892 2281 1649 927 866 655 32447 1081 511 34565 2508 1910 --
NM_020452chr131545 1476 863 --1495 --
NM_020455chr652269 2100 572 69 30 --12657 --
NM_020456chr1332063 1775 1499 12116 11836 --
NM_020463chr211149 ------
NM_020465chr1661864 603 552 399 256 181 --11442 --
NM_020473chrX42020 1984 1363 710 ------
NM_020474chr1821571 187 ----11853
NM_020475chr872092 1976 1813 1628 1512 912 481 11940 --12296
NM_020476chr872092 1976 1813 1628 1512 912 481 11940 --12296
NM_020477chr872092 1976 1813 1628 1512 912 481 11940 --12296
NM_020478chr872155 2039 1876 1691 1575 975 544 12003 --12359
NM_020480chr872092 1976 1813 1628 1512 912 481 11940 --12296
NM_020546chr593135 2998 2764 2658 2352 575 474 446 379 13145 --1174
NM_020640chr322025 630 ------
NM_020645chr111508 1553 ----
NM_020649chr17----121 --
NM_020651chr2173 ------
NM_020659chr191556 --1550 --
NM_020666chr51585 --1259 --
NM_020686chr1692870 2797 2762 971 871 807 569 296 67 32654 229 34 12672 --
NM_020689chr2071617 1445 1332 1193 196 147 26 --1469 --
NM_020697chr861076 461 413 333 301 67 --1102 --
NM_020699chr194311 3892 3731 3636 1797 1460 1256 1153 99 14550 14672 --
NM_020704chr74871 396 72 63 --1194 --
NM_020713chr20132845 2601 2566 2558 2463 2450 2090 1233 1010 850 618 385 124 12639 2669 223 --
NM_020717chrX34579 4188 749 31266 953 379 24000 35 --
NM_020718chr1696146 5879 5568 5302 5268 2004 1855 1362 114 --11953 11205
NM_020734chr1222910 279 --198 13290
NM_020737chr6----1196 --
NM_020739chr1523599 420 ------
NM_020742chrX144 --21879 480 --
NM_020748chr1711422 ----21386 827
NM_020749chr821775 1379 --22065 615 --
NM_020755chr611131 11184 11328 --
NM_020760chr221651 1280 --1203 --
NM_020762chr1241060 1046 993 326 ----1853
NM_020764chr167980 345 332 318 312 259 34 --11257 --
NM_020766chrX2791 75 11674 1835 --
NM_020768chr542629 1216 973 143 1593 ----
NM_020769chrX2285 185 ------
NM_020770chr13977 370 70 --1821 --
NM_020772chr1777715 6564 6552 2585 2312 1833 851 --48399 5237 2779 1580 --
NM_020773chr432056 1082 198 21063 882 22547 2453 --
NM_020778chr15113762 3343 3138 3074 1748 1642 869 783 711 579 362 44905 4690 4487 569 11801 --
NM_020781chr752657 859 232 224 37 --1591 --
NM_020783chr1822448 1544 ------
NM_020787chr173992 282 266 ------
NM_020791chr172985 56 ------
NM_020796chr562070 2018 1109 582 408 52 --12610 --
NM_020801chr531919 821 333 ----2550 116
NM_020806chr14136 ------
NM_020807chr1641185 647 72 53 11322 ----
NM_020809chr1131748 749 23 --2782 475 --
NM_020830chr253020 2922 870 379 203 12800 ----
NM_020836chr143656 511 193 ------
NM_020845chr12102357 2164 1842 949 913 679 650 415 331 265 --11899 --
NM_020850chr1692996 2571 2314 2076 799 648 509 182 169 22644 779 1533 11073
NM_020856chr1911066 ------
NM_020858chr152942 638 ------
NM_020860chr41259 ------
NM_020868chr211833 1132 ----
NM_020872chr31275 ------
NM_020873chr31310 ------
NM_020888chr131573 436 362 1387 1530 11619
NM_020899chr1752527 999 729 464 136 ------
NM_020920chr142261 107 ------
NM_020922chrX1290 --11601 --
NM_020927chr1632353 317 99 --1380 11955
NM_020933chr191127 --11493 --
NM_020935chr284434 4209 4155 1836 1361 370 120 53 11384 ----
NM_020940chr1021848 748 11948 ----
NM_020948chr112774 --12259 --
NM_020952chr91807 ------
NM_020956chr19294576 4556 4037 3950 3848 3799 3593 3526 3455 3383 3264 3207 3195 3182 2933 1697 1574 1517 1460 1388 1246 1178 1127 1118 823 814 759 534 133 24472 3719 14521 11143
NM_020960chr984323 4018 3840 3472 3098 1722 634 30 34702 1246 825 44770 3189 3180 1370 --
NM_020962chr1572371 2128 978 535 388 292 77 ------
NM_020964chr18104073 3738 3525 3205 3142 3122 1131 883 98 79 --24401 3107 13226
NM_020975chr1031721 570 289 --1263 --
NM_020977chr41604 --1181 1571
NM_020981chr21613 ------
NM_020983chr1242179 456 342 63 1866 --1741
NM_021003chr141310 1162 ----
NM_021005chr151800 ------
NM_021007chr21139 ------
NM_021013chr17189 ------
NM_021020chr8103303 3176 2724 2403 1302 1041 685 591 246 181 22563 2218 2883 75 --
NM_021033chr1333022 1271 36 --1536 --
NM_021038chr31200 ------
NM_021064chr641446 1194 360 299 1219 21312 432 --
NM_021069chr4----2486 344 --
NM_021072chr512611 ------
NM_021088chr271677 1664 1502 1364 842 639 83 11904 11811 --
NM_021096chr2253260 2834 1280 1176 991 53316 3037 2952 2459 2142 11194 --
NM_021097chr252486 2323 853 809 228 12624 --1721
NM_021120chrX2918 235 12110 11982 --
NM_021127chr1811233 11445 ----
NM_021132chr10--11058 ----
NM_021135chr6113236 2471 2090 1278 995 885 737 543 520 262 101 1651 1859 --
NM_021140chrX1383 --1889 --
NM_021145chr7----11135 --
NM_021148chr71170 --1873 --
NM_021149chr1651147 962 857 401 142 1782 2482 362 --
NM_021155chr1931847 813 609 ----22795 2753
NM_021158chr204847 664 261 22 ------
NM_021159chr421569 1084 ------
NM_021168chr1661175 1160 1109 1024 368 99 ----1501
NM_021183chrX1900 ------
NM_021189chr1----1965 --
NM_021190chr1--11154 ----
NM_021198chr241078 927 429 284 --21007 70 --
NM_021202chr2082032 2016 1985 1935 1192 1116 557 495 --11158 1788
NM_021248chr20242 33 1195 ----
NM_021252chr102635 530 --1841 --
NM_021253chr64971 342 100 89 ----11373
NM_021255chr1463332 1500 1481 1046 718 188 ------
NM_021259chr162394 77 1118 ----
NM_021260chr1411366 ------
NM_021627chr3----11209 1215
NM_021633chr121002 40 1390 ----
NM_021643chr21549 1733 ----
NM_021647chr421661 805 --23644 346 13329
NM_021648chr6--12028 ----
NM_021705chr61144 ----1578
NM_021727chr11133 ------
NM_021728chr141863 ----1106
NM_021783chrX21629 103 --140 1903
NM_021809chr2072204 2116 1628 824 549 328 219 --12171 1125
NM_021905chr661632 1619 1584 678 498 26 --1595 12005
NM_021907chr2129 ------
NM_021911chr585195 5064 4336 4315 3754 3625 1914 1404 12091 ----
NM_021912chr1533581 3405 222 --13786 --
NM_021913chr1921835 655 ------
NM_021914chr14154 21637 1617 ----
NM_021931chr203820 310 161 1753 ----
NM_021940chr631197 261 216 --11355 --
NM_021943chr642141 1933 1475 1383 12135 11745 --
NM_021949chrX32563 2035 1819 --11778 --
NM_021952chr11146 ------
NM_021956chr62354 292 ------
NM_021960chr142119 1914 628 595 ------
NM_021961chr1142593 2366 1928 1407 --11505 12432
NM_021962chr1762238 1778 1621 1023 376 308 11992 42312 2293 1641 184 --
NM_021964chr344093 2467 2054 1201 ------
NM_021967chr52512 424 11124 1394 1917
NM_021977chr653214 2800 2605 891 552 --13202 --
NM_021980chr1021255 1038 ------
NM_021984chrX41281 460 417 317 11336 1268 11382
NM_021987chrX41281 460 417 317 11336 1268 11382
NM_021988chr202236 178 ------
NM_021990chrX41281 460 417 317 11336 1268 11382
NM_022036chr173377 338 102 ------
NM_022041chr1652703 1718 501 480 470 ------
NM_022042chr471136 1103 1050 875 393 300 273 1866 31113 387 377 --
NM_022048chr1565894 5705 1740 246 199 171 1887 14743 --
NM_022066chr17157 1977 --1965
NM_022080chr2072665 2284 1785 1007 819 350 79 ------
NM_022090chr51503 --1196 --
NM_022114chr1114690 3623 3465 3036 2994 2888 1775 1292 793 387 347 --13377 --
NM_022130chr52986 376 ------
NM_022137chr1471477 1378 778 455 118 80 35 1700 31465 1431 645 --
NM_022140chr542312 1719 564 183 ----1691
NM_022166chr1695355 5343 4967 4681 4608 1120 769 445 210 --2796 470 1540
NM_022167chr172812 96 ------
NM_022169chr1141374 1262 1246 304 --21034 206 --
NM_022307chr72578 256 ------
NM_022340chr33619 335 31 --21417 384 --
NM_022351chr833467 2783 1034 11045 ----
NM_022356chr13439 426 347 1106 1146 --
NM_022361chr61397 ------
NM_022369chr153521 54 28 ------
NM_022442chr202236 178 ------
NM_022444chr731767 1461 240 ------
NM_022459chr1386367 6062 4394 4132 2507 2442 2385 504 --15280 12150
NM_022462chr1963259 2911 2318 609 205 131 --32823 1089 1041 --
NM_022465chr1242668 2326 934 331 12011 ----
NM_022469chr133374 39 23 1932 ----
NM_022476chr162416 51 ------
NM_022477chr2041612 1583 644 161 --11466 --
NM_022491chr1233106 2651 1025 12505 --1479
NM_022497chr383089 2995 2595 1031 663 565 520 75 ------
NM_022557chr172209 32 ------
NM_022572chr241749 1305 433 23 --21761 136 --
NM_022574chr7----11988 11389
NM_022640chr172207 32 ------
NM_022648chr2124516 4155 4072 4005 3934 3832 3672 3123 1867 1428 1001 697 --43596 3059 1233 1169 --
NM_022650chr52889 41 ------
NM_022658chr12----21287 1110 --
NM_022716chr12902 619 ------
NM_022719chr2273175 2756 2615 721 555 179 91 12706 12409 13423
NM_022737chr192858 204 --21046 341 --
NM_022739chr1711035 ------
NM_022744chr1691219 1031 976 859 469 454 375 287 27 --1841 --
NM_022745chr152099 1957 1053 909 85 --11188 --
NM_022748chr752633 2209 1105 1073 677 12488 1435 --
NM_022753chr12919 154 --12155 --
NM_022756chr131379 1198 1022 ------
NM_022757chr32999 908 ------
NM_022758chr653007 2454 2187 1277 356 23040 2022 43196 2542 2517 2082 --
NM_022763chr343199 2024 907 900 11188 ----
NM_022776chr321270 415 ------
NM_022777chr711411 11577 1283 --
NM_022778chr141466 1394 308 50 ------
NM_022781chr923300 2539 --12595 --
NM_022787chr1195 12341 ----
NM_022802chr1011461 ------
NM_022817chr261969 1777 1771 667 106 22 ------
NM_022818chr1611414 ------
NM_022824chr52566 347 ------
NM_022826chr231172 300 90 ------
NM_022831chr13490 332 167 --11526 --
NM_022832chr41667 ------
NM_022836chr141479 1393 736 178 --21345 1164 --
NM_022841chr1522756 1960 ------
NM_022845chr162890 29 --1686 --
NM_022894chr231451 664 630 --11171 --
NM_022896chr2041665 1331 517 34 --21177 312 --
NM_022898chr1434047 3314 119 11456 11275 --
NM_022910chr1661864 603 552 399 256 181 --11442 --
NM_022917chr911145 1255 --1415
NM_022918chr1142025 864 679 266 ------
NM_022977chrX32427 2158 609 ------
NM_022978chr52512 424 11124 1394 1917
NM_023000chr1411709 --1526 --
NM_023001chr1411709 --1526 --
NM_023004chr22----128 --
NM_023079chr1721687 372 11206 11364 --
NM_023105chr841803 936 603 121 ------
NM_023106chr841803 936 603 121 ------
NM_023110chr841803 936 603 121 ------
NM_023111chr841803 936 603 121 ------
NM_023927chr531139 274 147 ------
NM_023929chr832547 2344 396 --1993 --
NM_023931chr166612 436 371 79 50 42 11338 11056 --
NM_024007chr51888 1568 ----
NM_024034chr202849 787 1357 1419 --
NM_024045chr10247 37 ------
NM_024046chr341294 1058 883 800 --1997 --
NM_024052chr1763123 2303 1183 1010 996 304 --1375 12609
NM_024060chr11----1294 --
NM_024072chr1241289 1223 1185 506 1534 21326 633 --
NM_024076chr1932032 1843 554 21703 232 21878 1641 1575
NM_024085chr25996 332 278 193 30 1247 ----
NM_024090chr42726 31 ------
NM_024107chr173762 630 280 ------
NM_024294chr653007 2454 2187 1277 356 23040 2022 43196 2542 2517 2082 --
NM_024306chr164768 261 131 35 --1378 1255
NM_024312chr1221053 239 --11159 --
NM_024411chr2031314 378 134 1234 1102 --
NM_024416chr91285 --11585 --
NM_024423chr1842922 2759 2684 977 11171 ----
NM_024424chr112908 192 ------
NM_024425chr112908 192 ------
NM_024426chr112908 192 ------
NM_024494chr11558 ------
NM_024496chr14----1305 --
NM_024511chr483457 2932 2552 2382 1124 968 728 606 ----12762
NM_024513chr373744 3152 1447 1412 1105 814 206 13244 21120 159 --
NM_024522chr131641 360 119 31218 644 204 ----
NM_024523chr721354 855 1885 11025 --
NM_024539chrX161 ----1120
NM_024541chr1031825 712 594 21392 523 1501 --
NM_024554chr151740 605 578 458 71 --11199 --
NM_024594chr521610 298 --11846 --
NM_024607chr853913 3188 2976 56 47 ------
NM_024615chr51251 ------
NM_024631chr111194 ------
NM_024639chr612409 197 22360 325 3212 153 90
NM_024640chr12652 56 ------
NM_024643chr14148 ------
NM_024645chr811392 ------
NM_024656chr1951567 566 433 180 42 --2255 127 --
NM_024665chr321481 1072 14723 ----
NM_024666chr1541450 1269 1239 69 ------
NM_024676chr141287 867 299 278 --2151 127 --
NM_024680chr111368 ------
NM_024700chr1186 --1317 --
NM_024721chr812686 ------
NM_024742chr1641565 1537 1528 514 71929 1903 1885 1480 1239 581 446 --11689
NM_024744chr221662 555 --12633 --
NM_024745chr1641143 895 773 754 ------
NM_024761chr933392 1538 267 24463 195 ----
NM_024770chr296704 6199 5800 5505 2643 1715 1381 712 213 --46617 5604 5257 1573 --
NM_024784chr114919 834 444 224 154 3993 969 110 --
NM_024789chr102655 123 --3866 686 246 --
NM_024798chr1532707 2332 1117 1147 42190 618 500 118 --
NM_024811chr111304 11228 3668 437 269 --
NM_024824chr141133 ------
NM_024845chr1661487 1102 642 196 144 66 11605 21651 1245 --
NM_024874chr141369 1197 371 33 --145 1339
NM_024887chr141969 1491 592 508 ------
NM_024896chr922041 1550 --131 --
NM_024900chr43678 672 475 143 21940 773 12301
NM_024900chr43678 672 475 143 21940 773 12301
NM_024909chr61205 ----11452
NM_024915chr85484 331 281 275 257 1709 --12728
NM_024930chr522287 1813 --31951 1826 1708 --
NM_024939chr16--21252 65 21473 1465 --
NM_024942chr1031352 607 214 11157 ----
NM_024944chr212916 858 ------
NM_024946chr1631427 266 62 ------
NM_024947chr379281 8344 7445 6241 3659 2385 455 12466 17340 --
NM_024949chr484378 4355 4186 4112 3975 3171 1690 1481 34214 3989 1588 43144 1726 870 253 --
NM_024953chr1222571 1973 --12559 --
NM_024969chr21261 ------
NM_024971chr91807 ------
NM_024989chr297466 7165 5972 5702 2854 2469 2418 1305 368 --48138 6230 5765 1103 --
NM_024991chr1072408 1295 1223 1199 668 525 308 --1998 --
NM_025048chr6129 ------
NM_025054chr834216 3993 2585 --1184 --
NM_025057chr141488 ------
NM_025073chr174256 4006 2879 1558 658 159 74 --33589 1087 632 11191
NM_025074chr462689 2241 1144 1012 906 512 11976 --12989
NM_025076chr21158 ------
NM_025083chr1581992 1946 1811 1756 1580 772 754 471 11746 31333 812 507 --
NM_025106chr11501 11860 41207 773 471 457 --
NM_025113chr1311304 ------
NM_025126chr122591 216 ------
NM_025134chr1621746 280 --12218 --
NM_025140chr12130 ------
NM_025141chr151462 ------
NM_025146chr312270 ----12514
NM_025147chr2--1925 ----
NM_025179chr184710 4250 4050 3593 1455 1345 498 40 --21620 1521 --
NM_025181chr2122 --195 --
NM_025182chr92121 41 --1794 --
NM_025187chr1641333 439 189 141 1175 2884 57 --
NM_025191chr123151 540 ------
NM_025195chr8--1755 21481 573 11285
NM_025221chr411104 --192 --
NM_025222chr382701 2209 2036 1205 934 809 424 153 --12683 --
NM_025224chr2082285 1772 822 814 800 743 434 349 1383 12050 --
NM_025235chr102428 100 ------
NM_025237chr1741430 1127 411 361 11574 --21154 436
NM_025250chr7122515 2395 2091 1978 1937 1897 921 698 513 472 372 337 21961 1036 11852 --
NM_025257chr6146 ------
NM_025263chr61332 1156 ----
NM_030576chr1762586 2485 2155 691 292 217 --1119 --
NM_030594chr151361 ----1332
NM_030623chr231650 1457 187 1460 21530 1451 --
NM_030627chr513824 ------
NM_030630chr174692 307 287 24 1177 ----
NM_030634chr142264 716 502 421 ----11536
NM_030647chr736270 5842 118 14299 ----
NM_030648chr455166 1992 1844 1636 91 --14549 --
NM_030665chr1781176 1142 1089 1069 314 251 162 46 2170 117 ----
NM_030670chr1231796 1439 636 --149 11888
NM_030671chr1231796 1439 636 --149 11888
NM_030674chr12135652 1531 1520 1343 1330 963 944 858 849 623 615 566 489 --140 --
NM_030758chr2241342 975 587 297 ------
NM_030761chr192616 2599 2551 2246 1954 1947 782 252 42 1490 32448 2372 2077 --
NM_030763chrX2917 774 ------
NM_030766chr121198 ------
NM_030773chr2021781 1383 ------
NM_030792chr114638 251 180 52 --2668 660 --
NM_030799chr511424 ------
NM_030802chr173718 613 604 ------
NM_030805chr231204 460 327 ----11012
NM_030806chr1118139 8117 7105 6726 6362 3364 3174 2650 2131 1109 800 78590 7653 7570 7327 6773 3082 2581 48163 6871 2790 267 2682 544
NM_030809chr1211939 12339 ----
NM_030813chr113887 841 756 1352 1597 --
NM_030816chr122932 2374 11062 --12612
NM_030820chr641012 814 366 27 ------
NM_030881chr222780 194 ------
NM_030884chr332260 744 236 11984 1311 --
NM_030915chr242327 1537 483 319 ------
NM_030918chr144328 3296 1919 1743 34312 3688 1865 34484 4155 2034 --
NM_030920chr111311 1675 ----
NM_030923chr22545 205 --1141 --
NM_030925chr1371939 1501 634 551 421 393 104 --145 11405
NM_030937chr13927 412 251 ------
NM_030940chr921383 1131 ------
NM_030952chr161127 1014 863 403 248 26 21084 108 ----
NM_030962chr1121325 1035 --2490 125 --
NM_030963chr6260 27 ------
NM_030964chr583190 3171 2932 1452 1173 781 735 119 --22511 683 --
NM_030965chr12664 516 1637 ----
NM_030979chr131379 ------
NM_031157chr121107 ------
NM_031216chr1822033 1660 --11670 --
NM_031267chr71520 ------
NM_031268chr1684060 3977 3722 1820 1512 1483 962 806 24097 309 21425 1360 --
NM_031292chr1221536 1204 ------
NM_031306chr13912 757 689 ------
NM_031309chr862099 2036 1502 672 437 130 1430 21909 511 --
NM_031369chr42529 293 --1629 --
NM_031370chr42529 293 --1629 --
NM_031372chr421356 137 ------
NM_031411chr521681 779 ------
NM_031412chr123350 196 165 ------
NM_031417chr193903 465 439 22755 2295 ----
NM_031424chr201495 ------
NM_031427chr1433670 2279 1289 24632 451 ----
NM_031439chr83360 103 75 11823 ----
NM_031442chrX32938 1053 877 --1116 12952
NM_031444chr22122375 2253 2147 1943 1700 1596 918 527 279 78 63 23 1701 42402 2275 997 498 --
NM_031445chr2103272 2539 2422 2359 2337 2088 1279 871 774 87 --1638 --
NM_031450chr114528 477 420 26 ------
NM_031467chr5----153 --
NM_031468chr786500 6308 6077 3060 2950 2636 1880 1445 26401 2747 37704 5931 1620 --
NM_031475chr12484 213 ----1202
NM_031844chr143911 3415 765 470 --34149 4094 2806 --
NM_031845chr241100 722 399 357 ------
NM_031847chr241100 722 399 357 ------
NM_031849chr521681 779 ------
NM_031857chr521681 779 ------
NM_031858chr1721537 1120 ----21020 38
NM_031860chr521681 779 ------
NM_031862chr1721537 1120 ----21020 38
NM_031899chr351278 449 328 187 66 148 21036 289 1566
NM_031934chr171236 --3273 227 31 --
NM_031957chr17----130 --
NM_031990chr1931294 193 168 1986 ----
NM_031991chr1931294 193 168 1986 ----
NM_032012chr951633 1508 1489 225 61 24828 4477 193 --
NM_032013chr2041612 1583 644 161 --11466 --
NM_032017chr171848 1739 1587 1501 600 322 137 1225 11635 --
NM_032021chr1121045 188 ------
NM_032041chr842655 2589 711 609 --12018 21025 186
NM_032042chr52402 116 12302 ----
NM_032050chr2221024 314 ------
NM_032051chr22----4560 277 112 103 --
NM_032052chr2231409 1006 930 ------
NM_032088chr551629 1596 1224 562 51 --21318 156 --
NM_032092chr551629 1596 1224 562 51 --21318 156 --
NM_032102chr1143033 2171 585 100 --1721 --
NM_032121chrX11100 --1847 --
NM_032144chr2------1408
NM_032148chr123503 465 434 ------
NM_032153chr352140 936 756 400 196 --22189 1880 --
NM_032154chr102932 217 ------
NM_032160chr1823851 174 --23650 3096 --
NM_032186chr121104 931 ------
NM_032192chr174626 485 210 162 ------
NM_032199chr1043672 3473 2492 573 1139 21551 233 --
NM_032208chr232463 487 431 --22381 1226 --
NM_032211chr1031214 1098 346 --2244 129 --
NM_032213chr21303 ------
NM_032228chr111166 ------
NM_032231chr152312 269 ------
NM_032236chr111011 ------
NM_032256chr122188 133 ------
NM_032268chr1652695 2428 2306 2246 239 12064 1387 --
NM_032281chr19102924 2798 2736 2389 2263 1114 1095 993 748 502 --2402 200 --
NM_032283chr121172 711 ----11296
NM_032289chr51140 --1502 11617
NM_032294chr1791745 1733 1721 1417 1228 458 418 279 164 ------
NM_032312chr21712 ------
NM_032316chr362259 2155 1972 733 619 40 --1536 --
NM_032321chr233326 693 624 1393 ----
NM_032325chr113571 552 488 --41688 1466 1299 31 --
NM_032364chr123840 347 270 --2322 148 --
NM_032373chr1035790 5294 4986 ------
NM_032379chr11----1830 --
NM_032403chr551629 1596 1224 562 51 --21318 156 --
NM_032420chr55891 598 591 248 171 ------
NM_032421chr7102085 1978 1967 1901 1623 1452 801 663 194 29 21569 818 2593 59 1320
NM_032424chr1131623 278 150 21164 297 ----
NM_032434chr231262 1127 239 ------
NM_032435chr121576 319 --22435 612 --
NM_032438chr631149 1113 548 ------
NM_032439chr1021500 67 1448 --1250
NM_032440chr1052526 2234 1865 1077 648 --11071 --
NM_032441chrX2850 317 ------
NM_032445chr151147 ------
NM_032457chr412766 --1977 --
NM_032458chrX2467 439 ----13083
NM_032482chr1962120 2066 763 463 173 71 11047 22409 1792 --
NM_032505chr33988 781 701 --12691 --
NM_032509chr852369 2063 1728 955 239 ------
NM_032512chrX4814 208 32 26 ------
NM_032514chr203340 323 292 --1436 159
NM_032538chr6102788 2773 2496 1867 1128 969 530 411 376 315 --32615 1969 917 --
NM_032547chr41389 --11076 --
NM_032552chr9--1505 21721 1341 11607
NM_032560chr141140 ------
NM_032575chr1641810 1616 287 118 --1103 11467
NM_032582chr1711653 ----1303
NM_032588chr15487 421 185 84 63 ----1146
NM_032594chr142925 363 ------
NM_032626chr16189 ------
NM_032631chr193140 38 21 ------
NM_032632chr141164 ------
NM_032638chr371306 1187 553 138 112 102 65 --1209 --
NM_032689chr191462 ------
NM_032711chr1793916 3250 3193 1646 1362 653 572 466 456 23098 282 34222 3995 3925 --
NM_032737chr1992654 2553 2378 2254 1878 1040 917 453 260 --21930 480 11920
NM_032765chr51193 1158 ----
NM_032781chr112816 358 1729 2616 38 --
NM_032784chr61739 --157 --
NM_032808chr153937 846 68 1200 ----
NM_032810chr1021107 106 ------
NM_032812chr10162 ------
NM_032827chr241130 1100 241 83 --2278 120 --
NM_032828chr1964156 1424 1303 1089 1060 291 --33021 1441 1399 --
NM_032839chr3------168
NM_032840chr123162 136 36 1858 ----
NM_032842chr731514 673 538 ------
NM_032854chr175861 310 262 233 103 ------
NM_032873chr1113535 1103 1215 1374
NM_032875chr172543 269 1590 1723 1131
NM_032876chr141435 --1343 --
NM_032883chr202325 190 --2883 133 148
NM_032892chr152238 139 ------
NM_032900chr1063795 759 595 348 293 70 12658 31556 1365 972 11335
NM_032932chr1786200 5887 5602 5451 5164 4554 2399 60 1520 56359 6019 4693 2580 2475 16047
NM_032943chr11----1830 --
NM_032951chr72141 23 ------
NM_032953chr72141 23 ------
NM_032968chrX22960 2616 2884 374 --13924
NM_032969chrX22960 2616 2884 374 --13924
NM_032973chrY22955 2615 2884 374 --13916
NM_032982chr762612 2467 1016 678 470 141 ----1546
NM_032983chr7103426 3281 2297 2149 1284 955 630 533 373 59 1543 12162 11360
NM_032993chr41238 ------
NM_032995chr251537 1512 1122 593 310 11195 1551 --
NM_032998chr111027 --11121 11075
NM_033014chr91285 --11585 --
NM_033017chr741484 648 574 42 ------
NM_033018chrX6939 874 369 146 124 97 1359 11008 --
NM_033020chr144043 3700 1238 106 1486 --11435
NM_033055chr1----1968 --
NM_033081chr2021237 239 ----1573
NM_033082chr12294 74 ------
NM_033083chr323325 2473 ------
NM_033089chr201378 2952 920 ----
NM_033119chr162906 216 ------
NM_033121chr1221871 1291 ------
NM_033129chr2061817 1296 562 135 106 83 31353 141 27 31805 1579 627 --
NM_033131chr151791 1558 1530 1349 1313 --31213 1185 1107 11367
NM_033132chr132925 588 ------
NM_033133chr17103275 2984 2603 2464 2453 2415 1201 331 320 189 12328 22350 1285 1350
NM_033136chr521466 1455 --1329 --
NM_033137chr521466 1455 --1329 --
NM_033138chr7146 ------
NM_033139chr7146 ------
NM_033140chr7146 ------
NM_033143chr454400 4240 2912 1283 1009 13446 ----
NM_033147chr2129 ------
NM_033148chr2129 ------
NM_033157chr7146 ------
NM_033181chr683941 3364 3210 3103 2872 576 389 108 ------
NM_033224chr7106887 6837 6629 6177 5919 5616 2836 896 356 72 47847 7808 6140 1207 26751 2422 --
NM_033240chr1551716 1543 1266 608 143 11131 21342 424 1117
NM_033247chr151312 ------
NM_033259chr33574 98 34 2766 210 1697 --
NM_033274chr583529 3187 2713 2690 2553 1192 1092 322 22514 186 42633 2370 2324 525 --
NM_033280chr181126 ------
NM_033285chr82895 818 --23881 862 --
NM_033290chrX33382 2718 2588 21379 128 --12582
NM_033300chr111153 ----1952
NM_033326chr1132552 2065 1733 ------
NM_033331chr953041 2813 774 206 144 ------
NM_033338chr1031299 1028 317 --1906 --
NM_033339chr1031299 1028 317 --1906 --
NM_033340chr1041415 1144 433 90 --11022 --
NM_033342chr51105 ------
NM_033375chr1771286 1259 1075 1053 1018 522 141 --11450 --
NM_033380chrX--1247 1295 --
NM_033381chrX--1247 1295 --
NM_033389chr1754664 3395 1783 1602 1027 14609 --21540 759
NM_033425chr1172919 2871 2730 2632 684 592 193 1523 12999 --
NM_033429chr1553207 2130 2038 865 615 12152 ----
NM_033449chr531976 1855 1757 --1753 --
NM_033495chrX1378 1169 11040 --
NM_033515chr61547 ----1280
NM_033516chr921434 224 ------
NM_033540chr3----2979 808 --
NM_033542chr2031814 719 80 186 --161
NM_033549chr53762 216 189 --1280 --
NM_033551chr521109 352 22859 680 32115 456 70 12658
NM_033631chr153811 704 441 253 144 13537 23694 895 --
NM_033632chr4125 ------
NM_033637chr1041118 522 464 183 23924 3397 3471 111 31 --
NM_033644chr532131 1986 71 --22448 448 --
NM_033645chr532131 1986 71 --22448 448 --
NM_033656chr2145372 4198 4081 789 14511 ----
NM_044472chr1------1241
NM_048368chr183538 40 28 ------
NM_052820chr9--1353 ----
NM_052840chr151523 1303 1246 --
NM_052845chr122407 133 1602 11045 --
NM_052851chr1362038 842 757 559 280 118 11911 --11927
NM_052854chr114622 574 525 62 ------
NM_052864chr431717 1486 1381 ----21375 1348
NM_052879chr1244028 3325 2561 898 ------
NM_052885chr1243080 1310 885 106 13842 ----
NM_052896chr122034 104 1868 198 --
NM_052897chr12--1700 1773 --
NM_052900chr821442 1124 ------
NM_052905chr231760 183 51 1120 ----
NM_052906chr22204860 4376 4353 4288 4276 3584 3261 1979 1935 1640 1603 1436 1188 1104 1000 656 645 600 106 66 1533 33655 3083 275 24509 1405
NM_052907chr1233571 468 261 24131 3200 11038 13053
NM_052910chr1351842 1718 1523 558 268 11386 --11580
NM_052918chr1043206 2981 2844 1208 ----22655 2427
NM_052927chr531727 1654 1428 ----12207
NM_052934chr181964 1783 1772 1586 1447 618 281 27 --11687 --
NM_052937chr821797 25 1228 ----
NM_052954chr212470 168 --2695 490 --
NM_052978chr1421187 39 ----1332
NM_052996chr1631713 1644 1439 1169 ----
NM_053002chr31906 1948 ----
NM_053023chr1152810 2463 1080 682 307 135 ----
NM_053024chr331455 453 258 11066 11174 --
NM_053025chr32637 381 1387 ----
NM_053026chr32637 381 1387 ----
NM_053027chr32637 381 1387 ----
NM_053028chr32637 381 1387 ----
NM_053031chr32637 381 1387 ----
NM_053032chr32637 381 1387 ----
NM_053064chr1412757 12145 ----
NM_053067chr9----1293 --
NM_053281chrX1275 ------
NM_054016chr131476 485 182 ----1432
NM_054016chr131476 485 182 ----1432
NM_054016chr131476 485 182 ----1432
NM_054025chr1141583 821 438 143 11549 1258 --
NM_054033chr23563 172 118 ----1471
NM_054111chr61218 177 ----
NM_057159chr93997 435 278 ------
NM_057161chr62368 59 1532 ----
NM_057175chr4----11063 12279
NM_057178chr1762685 2051 1992 495 381 60 ------
NM_058167chr151162 941 927 511 426 1973 182 --
NM_058172chr421829 1783 --11692 --
NM_058191chr211887 ------
NM_058240chr1441644 1515 384 35 ------
NM_078467chr631509 1109 572 ------
NM_078470chr1052446 1919 1818 897 365 --1643 --
NM_078474chr151462 ------
NM_078629chrX3407 141 112 ------
NM_078630chrX3407 141 112 ------
NM_079421chr19193 ----1369
NM_080415chr172872 90 --1904 1954
NM_080476chr201118 ------
NM_080491chr11113778 3712 3397 3350 1462 1402 1215 564 210 198 24 12519 23169 2417 21367 601
NM_080588chr161353 1106 497 310 32 25 31532 1463 1452 ----
NM_080594chr16150 ------
NM_080604chr62567 69 ------
NM_080607chr204982 323 284 92 --21025 159 --
NM_080617chr202797 738 ------
NM_080629chr131086 417 330 ------
NM_080630chr131086 417 330 ------
NM_080645chr621523 1470 ------
NM_080653chr2----1182 --
NM_080654chr112513 239 ------
NM_080669chr17144874 4469 4197 4029 3875 3850 3684 3565 3285 3270 3164 1181 1084 79 14053 11548 13937
NM_080671chr231677 853 159 --21559 840 1418
NM_080679chr62646 25 --1939 --
NM_080680chr62646 25 --1939 --
NM_080681chr62646 25 --1939 --
NM_080738chr131948 1598 1542 --1625 --
NM_080743chr621854 860 ------
NM_080759chr1322588 2320 ------
NM_080760chr1322588 2320 ------
NM_080867chr1464064 3719 3602 1755 1063 104 --13853 --
NM_080872chr824068 1427 --181 --
NM_080881chr53793 664 569 1283 1310 --
NM_100264chr103827 809 55 ------
NM_100486chr103827 809 55 ------
NM_130385chr1182863 2805 2559 1990 830 653 608 284 --12396 --
NM_130391chr932547 948 443 ------
NM_130392chr932547 948 443 ------
NM_130393chr932547 948 443 ------
NM_130436chr2132732 2437 194 21890 219 11872 --
NM_130438chr2143309 3014 771 338 32467 2236 796 12449 --
NM_130439chr1031951 1875 341 ------
NM_130439chr1031951 1875 341 ------
NM_130440chr141159 231 203 85 1176 ----
NM_130442chr74424 374 362 180 ------
NM_130459chr951563 1050 1036 667 37 --11083 --
NM_130469chr141959 ------
NM_130799chr112686 283 1174 ----
NM_130800chr112686 283 1174 ----
NM_130801chr112686 283 1174 ----
NM_130802chr112686 283 1174 ----
NM_130803chr112686 283 1174 ----
NM_130804chr112686 283 1174 ----
NM_130811chr201310 ------
NM_130846chr1211039 ------
NM_133170chr20226945 6796 6647 6460 6272 6228 6087 5262 5211 5177 2610 2420 2230 2216 2166 1990 1266 1144 668 641 209 84 27924 33 12956 12603
NM_133172chr52241 45 ------
NM_133173chr52241 45 ------
NM_133174chr52241 45 ------
NM_133264chr171372 --22993 2945 11498
NM_133265chrX13651 ------
NM_133266chr113352 200 108 --1287 --
NM_133334chr445863 5793 1601 1225 --24801 4657 1290
NM_133369chr56831 650 636 264 230 161 --3947 759 189 --
NM_133370chr443103 2901 2855 101 --11172 --
NM_133372chr512801 1371 22095 915 --
NM_133378chr22906 330 ------
NM_133432chr22906 330 ------
NM_133437chr22906 330 ------
NM_133443chr1662283 1769 794 698 501 54 12049 1229 --
NM_133445chr942480 1473 1012 899 11381 --12960
NM_133476chr121278 --1317 --
NM_133478chr272326 2126 1643 981 815 796 317 --165 --
NM_133496chr164056 3697 3059 2941 966 339 13679 33194 2820 833 --
NM_133507chr123341 103 40 ------
NM_133509chr14135 1422 1228 1491
NM_133625chr32372 189 1155 ----
NM_133647chr1522807 228 --22858 2546 --
NM_134265chr1711211 ------
NM_134325chr151499 1318 1307 1121 153 2612 490 11222 --
NM_138300chr141528 371 277 181 ------
NM_138333chr941645 1020 799 400 ------
NM_138335chr42562 306 ------
NM_138338chr2293359 3207 3117 2962 2497 2147 1307 953 135 1996 13246 --
NM_138340chr18154 1122 ----
NM_138376chr14165 ------
NM_138381chr312240 12083 21834 1551 22491 2014
NM_138385chr451316 1274 997 897 887 11036 11086 --
NM_138415chr2241830 1665 1320 1269 1159 ----
NM_138426chr742102 1557 500 487 --1845 --
NM_138437chrX------1214
NM_138444chr1384811 3666 1920 1527 1404 393 49 34 --1855 --
NM_138457chr683271 2924 2140 1216 954 831 128 106 --22189 1258 12582
NM_138473chr1254816 1854 1609 1022 846 11435 --11090
NM_138559chr231126 143 35 11239 ----
NM_138576chr1434047 3314 119 11456 11275 --
NM_138578chr2051351 244 117 109 65 1136 11057 11311
NM_138609chr51116 ------
NM_138610chr51116 ------
NM_138638chr14154 21637 1617 ----
NM_138713chr1636502 3234 2381 --27736 6767 --
NM_138714chr1636502 3234 2381 --27736 6767 --
NM_138717chr61640 139 ----
NM_138732chr117901 873 667 654 349 258 50 ------
NM_138734chr117901 873 667 654 349 258 50 ------
NM_138736chr1684241 4115 3957 3712 3435 2793 2727 773 33413 677 302 22649 1565 13542
NM_138768chr112770 135 2729 115 135 --
NM_138782chr51796 --11562 --
NM_138923chrX148 ------
NM_138962chr171355 --150 --
NM_138967chr1572345 2205 1710 1532 971 635 380 1726 12081 --
NM_138970chr1432116 939 196 ------
NM_138971chr1143666 2826 826 301 ----13701
NM_138971chr1143666 2826 826 301 ----13701
NM_138972chr1143666 2826 826 301 ----13701
NM_138972chr1143666 2826 826 301 ----13701
NM_138973chr1143666 2826 826 301 ----13701
NM_138973chr1143666 2826 826 301 ----13701
NM_138981chr42554 57 ------
NM_139015chr1221456 615 11384 ----
NM_139035chrX--1155 ----
NM_139057chr1572430 2011 1026 1020 740 559 465 132 12178 --
NM_139068chr52487 57 ----1592
NM_139069chr52487 57 ----1592
NM_139070chr5------1461
NM_139072chr22642 100 ------
NM_139131chr11----1267 --
NM_139135chr11269 --1120 --
NM_139136chr121274 ------
NM_139157chr114743 564 63 26 ------
NM_139161chr193345 185 99 --136 --
NM_139167chr81175 191 ----
NM_139168chr51559 ------
NM_139242chr1531485 1237 327 ------
NM_139244chr61728 ------
NM_139280chr1721156 346 --125 --
NM_139283chr12--1811 ----
NM_139316chr73680 241 29 --2824 407 --
NM_139321chr2043791 3675 1284 237 ----1798
NM_139323chr2051885 1669 673 580 133 --11917 11525
NM_144499chr371132 930 874 462 391 323 229 1894 ----
NM_144568chr14----1642 --
NM_144571chr476933 6119 5825 5380 4633 2655 811 16854 46721 5254 1832 1237 --
NM_144575chr24405 189 183 30 --191 --
NM_144578chr1445117 4679 3819 3686 14980 12202 1906
NM_144582chr282532 2290 2021 1727 664 439 399 160 21908 171 ----
NM_144583chr241645 608 415 121 11241 ----
NM_144590chr1022658 1985 --1504 --
NM_144599chr1553533 2081 1205 172 153 14486 24743 3676 --
NM_144628chr2082950 2891 2863 2672 2560 2519 2341 134 43022 2391 651 596 23010 2824 1103
NM_144664chr1111679 ------
NM_144726chr51500 ------
NM_144778chr1321910 355 ----1809
NM_144949chr252106 1919 670 232 172 --1814 --
NM_144963chr82163 24 ------
NM_144997chr1741209 1001 41 21 11308 21014 896 --
NM_145021chr101270 --2621 337 --
NM_145065chr1161107 874 770 246 38 30 166 1444 --
NM_145071chr33697 131 21 1286 1939 --
NM_145159chr142857 829 ----1696
NM_145176chr642585 906 487 419 1851 12157 --
NM_145203chr131313 ------
NM_145207chr444796 4075 1273 1164 1657 22013 1926 --
NM_145259chr277013 6091 4984 2701 2192 1242 128 --14812 11598
NM_145277chr12147 95 ------
NM_145284chrX1176 ------
NM_145296chr193660 251 23 2237 198 ----
NM_145305chrX1429 ----11109
NM_145307chr1014314 --11468 --
NM_145313chr1021309 589 --1682 --
NM_145331chr62283 123 ------
NM_145349chr1771567 1537 720 648 554 514 40 1817 3295 87 60 1106
NM_145351chr1782059 2029 1766 1046 1006 532 319 54 --3787 579 552 1598
NM_145686chr242361 1110 963 718 ------
NM_145687chr242361 1110 963 718 ------
NM_145690chr821947 341 --11930 --
NM_145698chr101543 --1119 --
NM_145714chr161158 ------
NM_145725chr14--188 ----
NM_145726chr14--188 ----
NM_145727chr611074 1499 --2445 103
NM_145731chr224664 643 84 69 --1237 --
NM_145733chr2241083 1016 980 88 ------
NM_145738chr224664 643 84 69 --1237 --
NM_145793chr101100 ------
NM_145800chrX41025 929 803 711 --1223 --
NM_145802chrX4974 878 752 660 --1172 --
NM_145861chr131948 1598 1542 --1625 --
NM_145912chr22184561 4500 3696 3650 3475 3301 3268 3163 3151 3086 1856 1334 1179 1050 956 622 425 323 34093 3972 1557 34074 1402 215 23342 313
NM_145913chr12----1722 11063
NM_146388chr1951052 932 902 287 86 11248 ----
NM_147150chr953539 3497 3175 2481 390 --13224 1531
NM_147157chr93869 711 603 ------
NM_147161chr15365 340 315 232 27 --2461 159 --
NM_147171chr71380 ------
NM_147175chrX42134 1615 845 79 ------
NM_147181chr411104 --192 --
NM_147182chr411104 --192 --
NM_147183chr411104 --192 --
NM_147185chr71380 ------
NM_147189chr81406 ------
NM_147202chr962638 1745 1722 786 562 449 ------
NM_148174chr821603 671 21932 1806 ----
NM_148415chr161181 ------
NM_148416chr161158 ------
NM_148894chr421023 337 ------
NM_152132chr14183 ------
NM_152237chr2271750 1727 1507 1127 314 259 210 2539 32 ----
NM_152247chr222915 730 1799 1668 --
NM_152253chr2284301 4116 3879 2706 1711 1463 1381 524 24185 3866 34054 1413 94 --
NM_152261chr122849 416 ------
NM_152263chr185796 5717 3684 2428 1795 1583 1562 1463 --15599 --
NM_152264chr117961 898 810 746 450 404 223 --1824 --
NM_152265chr111171 ------
NM_152278chrX2394 212 ------
NM_152282chr3----11380 --
NM_152309chr1051808 1503 737 650 23 --11399 1715
NM_152330chr143645 414 305 12044 --1225
NM_152341chr1661166 1109 1008 606 463 21 1356 11303 1484
NM_152344chr1721378 1089 --11200 --
NM_152350chr171543 1475 2449 177 --
NM_152380chr121222 82 1483 11529 --
NM_152384chr2121618 1581 1569 1537 1442 1394 678 343 320 304 274 210 --71696 1659 1520 1483 1308 787 689 --
NM_152388chr273767 3620 3613 2602 1595 1474 715 --23599 2884 --
NM_152407chr532707 2584 554 --22366 1063 12725
NM_152409chr542979 1237 674 144 ------
NM_152414chr821307 659 1288 ----
NM_152420chr91316 2725 261 ----
NM_152424chrX94107 3908 3353 3124 2964 1848 1806 1235 298 --33715 3627 205 13184
NM_152437chr1222465 686 12131 21643 309 --
NM_152441chr123644 91 55 --2527 133 --
NM_152455chr1582615 1138 1077 1061 1009 756 405 258 --4959 583 465 92 --
NM_152470chr1843206 1322 902 277 --21494 251 13017
NM_152478chr192140 53 --2549 537 --
NM_152493chr131254 480 161 11082 ----
NM_152515chr22118 66 --1741 --
NM_152523chr2175 ------
NM_152538chr321202 325 1304 --11221
NM_152553chr61581 ------
NM_152556chr721651 30 ------
NM_152557chr741422 1147 482 114 11307 1463 1985
NM_152588chr121380 ------
NM_152594chr151165 ------
NM_152622chr53922 823 483 ----13147
NM_152624chr566505 6040 5107 1152 586 411 ----16831
NM_152629chr954088 3968 3813 2736 477 ----22854 1043
NM_152641chr1212068 11038 12746 --
NM_152660chr1----3915 337 46 --
NM_152665chr1------11081
NM_152686chr562194 2110 881 588 278 269 2889 638 52334 2062 1937 564 485 --
NM_152688chr62791 127 ------
NM_152694chrX2280 189 ------
NM_152695chrX32019 1646 1480 ------
NM_152699chr353602 2663 2340 1405 1202 --33509 3060 2722 --
NM_152721chr181678 ------
NM_152733chr6136358 5892 5884 5571 4964 4655 4110 2074 1436 967 827 531 286 --34094 2523 2041 24324 1962
NM_152739chr71760 ------
NM_152743chr7130 ------
NM_152744chr783424 3246 3015 2637 1396 1356 631 516 22951 1280 ----
NM_152753chr662060 1916 1870 1287 481 297 ------
NM_152755chr71577 ------
NM_152756chr514249 ------
NM_152758chr822420 60 ------
NM_152774chr741890 921 885 868 --11870 --
NM_152782chr7------136
NM_152787chrX53746 3538 2524 929 150 11425 ----
NM_152793chr775124 4423 4396 4380 3908 3320 1800 1570 --1181
NM_152832chr112389 215 144 ----
NM_152835chr142404 1955 1858 284 --12245 --
NM_152838chr2012616 13421 ----
NM_152857chr6----1138 --
NM_152858chr6----1138 --
NM_152868chr222418 29 ------
NM_152878chr2241288 1026 999 617 11424 21524 83 --
NM_152890chr111149 ------
NM_152924chr1524572 1734 --25161 259 --
NM_152988chr1981603 518 368 223 179 172 141 31 11276 21751 287 --
NM_152991chr111544 ----1709
NM_152996chr152041 1878 1654 580 196 ----1327
NM_152999chr734354 1632 1098 13176 ----
NM_153000chr181200 1257 ----
NM_153013chr532013 774 110 1120 11945 --
NM_153029chr16164172 4128 3919 3784 3571 3282 3121 2994 1532 1264 1155 900 733 708 460 31 13650 33261 2773 587 --
NM_153184chr31215 ------
NM_153188chr513960 --34685 4063 371 --
NM_153208chr164814 703 63 26 ------
NM_153247chr771074 897 743 429 371 296 142 --1276 --
NM_153251chr131174 ------
NM_153262chr122711 1219 12865 13042 --
NM_153273chr392775 2430 2165 1088 1034 998 903 703 441 1789 22225 237 --
NM_153321chr171313 ------
NM_153322chr171313 ------
NM_153332chr843183 2206 2007 540 ------
NM_153347chr1192230 2170 1863 1705 1074 903 805 697 603 149 2367 299 --
NM_153350chr1671543 1535 1137 605 453 268 118 1494 ----
NM_153354chr51392 ------
NM_153367chr1083865 3833 3818 3655 1582 823 810 548 --21594 286 --
NM_153374chr151106 ------
NM_153453chr6157 ------
NM_153456chr1375661 4599 4311 2090 1648 865 773 ----12367
NM_153485chr5161 ------
NM_153487chr6144857 4516 4309 3894 3401 2943 1859 1773 1486 1336 1278 567 226 54 24292 3469 44599 3631 1541 95 1612
NM_153607chr5--13118 ----
NM_153616chr152942 638 ------
NM_153617chr152942 638 ------
NM_153618chr152942 638 ------
NM_153619chr1551023 997 951 556 131 ------
NM_153645chr2241277 1265 438 204 ------
NM_153715chr71972 --2357 74 --
NM_153748chr121274 ------
NM_153757chr4190 11017 ----
NM_153810chr1034943 3370 3327 ------
NM_153812chr151609 819 340 147 126 --11819 --
NM_153816chr6----1334 --
NM_153836chr221759 707 --11916 --
NM_170600chr91296 ------
NM_170606chr72236 22 ------
NM_170662chr32502 438 --2496 167 --
NM_170665chr1293463 3422 3300 3193 3062 2914 909 793 199 1935 33222 2828 1546 12974
NM_170674chr1531302 528 320 ------
NM_170675chr152978 204 ------
NM_170676chr152978 204 ------
NM_170677chr1531302 528 320 ------
NM_170679chr511025 11251 2314 302 --
NM_170686chr752657 859 232 224 37 --1591 --
NM_170696chr1551639 1565 1087 69 28 ------
NM_170697chr1551639 1565 1087 69 28 ------
NM_170706chr153843 1238 539 353 314 13172 14019 13212
NM_170726chr1125 142 --1373
NM_170731chr1141869 1800 747 170 ----1845
NM_170732chr1141869 1800 747 170 ----1845
NM_170733chr1141869 1800 747 170 ----1845
NM_170734chr1141869 1800 747 170 ----1845
NM_170735chr1141869 1800 747 170 ----1845
NM_170739chr112183 105 ----183
NM_170751chr631182 1110 210 ------
NM_170752chr631182 1110 210 ------
NM_170782chr11500 1362 ----
NM_172016chr64971 342 100 89 ----11373
NM_172058chr811835 ----11215
NM_172059chr811835 ----11215
NM_172060chr811835 ----11215
NM_172070chr21837 ----1891
NM_172071chr1137286 5601 5044 4969 4860 4704 2947 2881 2352 2074 1567 1500 1145 --22234 1625 11084
NM_172159chr331694 738 107 --153 --
NM_172160chr331694 738 107 --153 --
NM_172169chr1011326 2643 530 --11288
NM_172170chr1011326 2643 530 --11288
NM_172171chr1011326 2643 530 --11288
NM_172173chr1011326 2643 530 --11288
NM_172206chr1791745 1733 1721 1417 1228 458 418 279 164 ------
NM_172315chr1531302 528 320 ------
NM_172316chr1531302 528 320 ------
NM_172337chr141863 ----1106
NM_172375chr14----21076 741 --
NM_173054chr721016 190 ------
NM_173163chr161145 ------
NM_173165chr16126 ------
NM_173172chr21171 ------
NM_173191chr10157 1151 ----
NM_173192chr10157 1151 ----
NM_173193chr10157 1151 ----
NM_173194chr10157 1151 ----
NM_173195chr10157 1151 ----
NM_173198chr911857 12595 1822 --
NM_173200chr911857 12595 1822 --
NM_173214chr1636502 3234 2381 --27736 6767 --
NM_173354chr2161546 1511 1383 1359 616 516 1754 ----
NM_173359chr321661 1330 11206 ----
NM_173469chr151179 ----11356
NM_173470chrX32927 1890 797 --12548 --
NM_173475chr161687 --11533 --
NM_173476chr16102078 1835 1553 836 763 582 522 514 257 53 11774 2325 154 --
NM_173500chr151338 ------
NM_173505chr1841139 182 117 49 ----1110
NM_173508chr11137 ------
NM_173511chr233496 2485 1195 --11441 --
NM_173543chr3153 ------
NM_173561chr64878 448 234 95 --11025 --
NM_173562chr683221 2957 2924 2569 1159 1088 551 465 --32182 909 846 --
NM_173582chr1195975 5915 5208 4773 4558 4212 2025 1129 329 --25531 5006 --
NM_173595chr12154525 4375 4044 3874 3734 3338 3273 1996 1812 1437 1385 1059 940 912 146 13688 11536 15067
NM_173602chr1232659 2573 777 --11282 13575
NM_173609chr152699 688 ------
NM_173642chr157431 6030 3276 1452 160 --29086 7900 --
NM_173670chr5140 ------
NM_173681chr761725 1718 1531 801 726 119 2520 354 3235 68 21 --
NM_173694chrX32261 1666 25 12021 ----
NM_173794chrX1400 ------
NM_173797chr511195 ------
NM_173808chr123091 142 --1953 --
NM_173809chr1011476 --11393 --
NM_173814chr15----1165 --
NM_173822chr211923 ------
NM_173830chr62715 152 ------
NM_173833chr831672 212 111 --1276 --
NM_173848chr8----1147 --
NM_173851chr813869 --13325 --
NM_174856chr202319 124 ------
NM_174911chr811559 --12479 13261
NM_174916chr15----1118 --
NM_174934chr1183524 2424 1177 914 837 715 599 161 12915 21123 153 1617
NM_174938chr91437 ------
NM_174963chr14709 694 248 31 1776 2239 154 --
NM_174964chr14709 694 248 31 1776 2239 154 --
NM_174965chr15728 713 267 50 29 1795 2258 173 --
NM_174966chr14709 694 248 31 1776 2239 154 --
NM_174967chr15728 713 267 50 29 1795 2258 173 --
NM_174968chr14709 694 248 31 1776 2239 154 --
NM_174969chr14709 694 248 31 1776 2239 154 --
NM_174970chr15728 713 267 50 29 1795 2258 173 --
NM_174971chr14709 694 248 31 1776 2239 154 --
NM_175058chr1151214 555 215 141 96 11193 ----
NM_175061chr731425 1385 775 ------
NM_175607chr321164 691 ------
NM_175610chr151390 ------
NM_175611chr211211 ------
NM_175612chr321164 691 ------
NM_175624chr12107572 6277 5846 5032 5014 3024 2831 2385 2344 2261 --26451 1586 --
NM_175625chr12107572 6277 5846 5032 5014 3024 2831 2385 2344 2261 --26451 1586 --
NM_175634chr821180 73 ------
NM_175635chr821180 73 ------
NM_175636chr821180 73 ------
NM_175709chr2242582 2488 2279 732 12479 32333 1986 265 --
NM_175733chr1151940 1702 1685 1646 180 11821 32113 1500 117 11972
NM_175734chr17167 ------
NM_175736chr12127450 6410 5870 5632 2999 2248 1794 1576 1437 555 254 82 45178 2508 1969 322 11107 --
NM_175747chr61923 ------
NM_175767chr521634 1565 21407 741 21359 1201 --
NM_175847chr1931294 193 168 1986 ----
NM_175848chr203579 505 239 --1138 11416
NM_175848chr203579 505 239 --1138 11416
NM_175849chr203579 505 239 --1138 11416
NM_175849chr203579 505 239 --1138 11416
NM_175850chr203579 505 239 --1138 11416
NM_175850chr203579 505 239 --1138 11416
NM_175852chr192964 2792 2678 2591 2390 2360 2233 459 44 2544 368 22573 1106 --
NM_175854chr13----12378 --
NM_175866chr11142 --1403 --
NM_175920chr52136 31 ------
NM_176812chr202519 150 127 ----
NM_176814chr731223 1016 194 ------
NM_177414chr14585 440 176 107 --1523 --
NM_177441chr173762 630 280 ------
NM_177524chr72994 78 ------
NM_177525chr72994 78 ------
NM_177539chr13654 293 285 2884 682 ----
NM_177947chrX------1229
NM_177948chrX------1229
NM_177949chrX2305 94 ------
NM_177952chr141310 1162 ----
NM_177968chr221605 572 1898 ----
NM_177972chr11104203 2956 1656 887 855 765 391 379 139 77 13712 131 34342 3191 1692
NM_177977chr1791847 1629 1566 1515 1497 382 260 141 33 1782 31828 1773 461 --
NM_177985chr211716 22008 1878 ----
NM_177989chr31341 ------
NM_177999chr993648 3594 3574 3025 2574 2449 604 504 327 33337 3036 2302 33248 2832 69 --
NM_178006chr1362038 842 757 559 280 118 11911 --11927
NM_178007chr1362038 842 757 559 280 118 11911 --11927
NM_178011chr101733 --12627 1497
NM_178014chr61259 --1273 --
NM_178026chr201563 ------
NM_178042chr31341 ------
NM_178151chrX76054 5164 2032 528 329 78 70 32967 1823 27 25214 541 15971
NM_178152chrX76054 5164 2032 528 329 78 70 32967 1823 27 25214 541 15971
NM_178153chrX76054 5164 2032 528 329 78 70 32967 1823 27 25214 541 15971
NM_178170chr173640 245 73 --1501 --
NM_178313chr242198 1801 711 170 --12033 --
NM_178314chr123662 208 176 ----1771
NM_178424chr5--183 ----
NM_178426chr121605 23 --1858 --
NM_178441chr1411366 ------
NM_178496chr321412 290 198 ----
NM_178500chr171539 1163 ----
NM_178505chr1013241 --2554 516 --
NM_178554chr353474 3059 1202 728 404 --42456 1249 1220 357 --
NM_178557chr410640 631 468 334 325 304 287 68 60 52 11730 11662 21420 515
NM_178565chr82320 232 --2519 107 --
NM_178568chr1761686 1382 1364 1310 253 39 11633 11564 --
NM_178578chr2031766 995 110 11028 1494 --
NM_178585chr463268 2739 2154 732 650 614 ------
NM_178586chr1421974 1518 ------
NM_178812chr81361 --11207 --
NM_178835chr43707 229 45 1626 ----
NM_178857chr81100 1176 ----
NM_178860chr174921 201 170 60 ------
NM_178864chr111703 ----1648
NM_180976chr6------1242
NM_180977chr6------1242
NM_180989chr1332268 924 401 ------
NM_181054chr1421082 988 --11066 --
NM_181077chr1541597 1558 383 27 ------
NM_181332chrX144 --21879 480 --
NM_181351chr1142399 2340 2139 1934 1346 ----
NM_181358chr163544 3179 997 954 502 270 --23466 3065 --
NM_181361chr31280 ------
NM_181443chr2022724 2162 ------
NM_181458chr21491 156 ----
NM_181461chr2--152 ----
NM_181481chr1876089 6062 5611 5118 2597 2396 1388 24356 2539 25389 1181 --
NM_181482chr1876089 6062 5611 5118 2597 2396 1388 24356 2539 25389 1181 --
NM_181483chr1876089 6062 5611 5118 2597 2396 1388 24356 2539 25389 1181 --
NM_181491chr9123134 2766 2700 2575 2542 1269 974 901 834 813 511 35 --1423 --
NM_181504chr532699 2668 436 --13733 --
NM_181505chr174626 485 210 162 ------
NM_181509chr203340 323 292 --1436 159
NM_181521chr1676951 6199 2013 1864 825 720 153 --26182 232 14782
NM_181523chr532699 2668 436 --13733 --
NM_181524chr532699 2668 436 --13733 --
NM_181571chr101435 1455 ----
NM_181655chr172508 205 1255 1271 --
NM_181659chr203860 796 630 --23073 482 --
NM_181659chr203860 796 630 --23073 482 --
NM_181670chr122389 91 ------
NM_181702chr8------1313
NM_181713chr22904 879 ------
NM_181715chr1----2315 160 --
NM_181741chr23431 126 68 ------
NM_181742chr23431 126 68 ------
NM_181776chr541468 676 213 22 --11217 1105
NM_181782chr622245 88 --11869 --
NM_181784chr232419 1832 1667 ----12388
NM_181825chr221835 --3809 630 316 --
NM_181838chr511616 ------
NM_181839chr81129 --1518 --
NM_181873chr1--149 ----
NM_181876chr422300 996 --1759 --
NM_181886chr43485 238 155 --1385 --
NM_181887chr43485 238 155 --1385 --
NM_181888chr43485 238 155 --1385 --
NM_181889chr43485 238 155 --1385 --
NM_181890chr43485 238 155 --1385 --
NM_181891chr43485 238 155 --1385 --
NM_181892chr43532 285 202 --1432 --
NM_181893chr43485 238 155 --1385 --
NM_182314chrX21640 1616 ------
NM_182487chr9113962 3096 2702 1611 1480 1159 1114 749 626 313 106 42875 1459 1346 293 34131 3668 1302 --
NM_182488chr132720 106 --1193 --
NM_182524chr41251 ------
NM_182527chr2292040 1834 1709 1659 831 797 776 648 39 2819 812 21487 433 --
NM_182543chr101253 ------
NM_182551chr232630 2494 1160 2366 70 2448 392 --
NM_182616chr151211 --1309 --
NM_182623chr14153 86 62 22 ------
NM_182641chr1721611 168 ------
NM_182643chr832121 1648 627 ----12334
NM_182645chr6157 ------
NM_182648chr14------1276
NM_182666chr3----1627 --
NM_182678chr2--1488 ----
NM_182685chr11637 ----1656
NM_182691chr711332 ------
NM_182692chr711332 ------
NM_182697chr7----11415 --
NM_182700chr741864 1746 1551 499 --11359 --
NM_182701chr61102 --1872 --
NM_182717chr1011002 1340 ----
NM_182718chr101435 1455 ----
NM_182719chr101435 1455 ----
NM_182720chr1011002 1340 ----
NM_182721chr1011002 1340 ----
NM_182722chr1011002 1340 ----
NM_182723chr1011002 1340 ----
NM_182724chr101435 1455 ----
NM_182725chr101435 1455 ----
NM_182728chr1441519 1511 1154 233 --11582 1562
NM_182757chr633145 1084 214 --12784 1121
NM_182758chr1533686 2454 973 --23420 2845 1236
NM_182763chr142108 1903 617 584 ------
NM_182769chr101435 1455 ----
NM_182770chr101435 1455 ----
NM_182771chr101435 1455 ----
NM_182772chr101435 1455 ----
NM_182798chr53312 243 92 ------
NM_182799chr53312 243 92 ------
NM_182801chr53312 243 92 ------
NM_182847chr25548 534 501 181 98 ------
NM_182850chr101435 1455 ----
NM_182853chr1011002 1340 ----
NM_182898chr786193 6148 5380 4893 4615 1676 1035 541 16136 32136 1546 601 11371
NM_182899chr786193 6148 5380 4893 4615 1676 1035 541 16136 32136 1546 601 11371
NM_182910chr143627 359 157 --155 --
NM_182913chr143627 359 157 --155 --
NM_182914chr143627 359 157 --155 --
NM_182936chr1441644 1515 384 35 ------
NM_182948chr122914 1130 1472 22465 2158 --
NM_182970chr20104216 4021 3870 3240 2888 1325 1173 550 316 72 53663 2988 1470 506 262 --2370 358
NM_182972chr151901 938 838 708 584 ------
NM_183002chr1441644 1515 384 35 ------
NM_183006chr2051331 1278 969 595 299 1546 11168 --
NM_183011chr1011002 1340 ----
NM_183012chr1011002 1340 ----
NM_183013chr1011002 1340 ----
NM_183047chr201747 ------
NM_183048chr201747 ------
NM_183058chr10159 ------
NM_183060chr101435 1455 ----
NM_183078chr663792 3754 3602 1239 1096 844 --21052 391 12592
NM_183227chr621022 318 ------
NM_183360chr2129 ------
NM_183361chr2129 ------
NM_183373chr65847 779 373 274 58 --1885 --
NM_183377chr175650 593 538 236 77 ----2294 146
NM_183393chr32193 104 ------
NM_183394chr32193 104 ------
NM_183416chr152060 2004 1890 330 262 ----11489
NM_183422chr13----2940 288 --
NM_184234chr201168 ------
NM_194071chr764929 4890 4170 3521 3337 315 33558 1972 976 13394 --
NM_194247chr233205 3086 1220 ------
NM_194271chr122591 216 ------
NM_194278chr1452645 1350 1171 481 120 ------
NM_194282chr432699 2680 980 --22525 1100 --
NM_194285chr1121032 212 --12612 --
NM_194292chr11355 ------
NM_194301chr142986 931 ------
NM_194313chr961592 1541 1238 748 446 121 1375 --1268
NM_194314chr144325 1476 1014 671 ----14485
NM_194315chr151162 941 927 511 426 1973 182 --
NM_194317chr242720 2502 947 692 ----1804
NM_194328chr923300 2539 --12595 --
NM_194329chr923300 2539 --12595 --
NM_194330chr923300 2539 --1