TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1285-5p
miRNA Sequence: GAUCUCACUUUGUUGCCCAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000208chr1994286 3701 3641 3230 3098 2946 1242 1223 983 24757 1916 24159 2932 --
NM_000337chr5125168 4905 4106 4014 2365 1988 1811 1796 1772 1031 1023 220 15499 12443 --
NM_001003652chr18127998 7799 7755 7372 6504 5789 5513 2005 1921 1411 379 123 37713 1194 838 28236 8231 --
NM_001004317chr6104501 4063 4019 3942 3818 1772 874 581 236 99 1693 ----
NM_001005473chr564664 1373 1303 1119 478 129 25959 5590 36155 5661 1575 14721
NM_001007094chr10124365 4353 3990 3391 3310 1545 1497 1380 1362 568 405 39 ----14064
NM_001007278chr13115300 5166 4560 4349 4259 1080 767 646 496 381 273 24024 3463 ----
NM_001010862chrX72811 2733 2590 1067 452 348 223 2964 366 32186 2043 1048 --
NM_001037165chr7168781 8230 7249 7113 6997 6574 6301 6242 5940 5587 2728 2348 2095 2004 1177 27 --11934 18733
NM_001039547chr3137643 7606 6119 5739 5545 5439 5378 3205 2746 2123 1881 1148 58 1574 16633 27863 6538
NM_001039618chr1195757 5697 5060 3938 3880 1085 969 405 76 22304 813 11208 --
NM_001040151chr11112818 1802 1573 1545 1373 1279 1266 1131 1016 972 24 11436 12782 --
NM_001042599chr2106962 6854 6689 6546 6508 6454 5588 4913 2394 1653 12179 12438 --
NM_001100108chr1138120 7541 7073 6662 6314 6277 6118 5889 5677 5314 5296 1892 426 27610 6009 58131 8074 6414 5875 2352 --
NM_001106chr3238398 8066 6836 6678 6622 6353 6306 6280 3823 3744 3528 3337 2752 2704 2125 1977 1818 1774 920 810 609 321 255 --39199 7529 6401 17809
NM_001918chr1108700 7376 7169 7034 6915 6144 2060 1680 526 361 1778 38877 8623 1584 --
NM_002025chrX128338 6791 6542 3579 3515 3474 2763 2726 2696 1325 863 497 26635 2533 ----
NM_003421chr10124365 4353 3990 3391 3310 1545 1497 1380 1362 568 405 39 ----14064
NM_004171chr11169506 8930 7837 7284 6419 5933 3267 2826 2641 2417 2207 1748 1650 1575 869 670 16458 19006 --
NM_004501chr1123845 3798 3662 3656 3538 3448 3016 1570 1407 1077 811 592 22619 2588 ----
NM_005188chr11147412 7377 7103 6819 6284 5752 2555 2507 2482 1957 1394 949 756 707 32067 1975 900 18054 23183 125
NM_005235chr2106962 6854 6689 6546 6508 6454 5588 4913 2394 1653 12179 12438 --
NM_005578chr395067 4597 4140 4114 4055 3191 1996 1431 146 15018 13518 1733
NM_005798chr13115300 5166 4560 4349 4259 1080 767 646 496 381 273 24024 3463 ----
NM_005901chr18127998 7799 7755 7372 6504 5789 5513 2005 1921 1411 379 123 37713 1194 838 28236 8231 --
NM_005909chr583299 3132 3019 2754 1385 997 355 345 11729 --1450
NM_006203chr565283 4462 2207 1558 1331 1056 45595 4868 2029 618 --15337
NM_006306chrX125467 5449 5351 4862 4704 4140 3810 2004 1993 1685 1235 118 --11286 14654
NM_007137chrX65005 4886 1399 1298 948 141 45113 4787 3558 3383 33800 2213 1035 11122
NM_007249chr1369169 8190 3500 3342 3185 2628 11139 11672 18235
NM_012316chr1155280 5192 5108 4992 4331 4229 4110 3968 1651 1253 1038 928 781 479 472 33976 1056 956 ----
NM_015313chr11101895 1849 831 821 722 530 417 202 158 128 24550 4190 11017 14331
NM_015375chr1104608 4182 3391 1558 1254 1240 1166 959 548 448 25008 4300 44451 4076 3219 3214 --
NM_017594chr962485 811 717 446 360 293 ----23224 2258
NM_017637chr9118777 8690 8576 8394 8099 7946 7849 6344 2997 2659 1632 38046 7740 167 1237 --
NM_018085chr1158211 7601 7366 5891 5765 5714 5029 4968 2577 2133 2004 1346 1235 1217 75 12897 ----
NM_018400chr11112818 1802 1573 1545 1373 1279 1266 1131 1016 972 24 11436 12782 --
NM_020917chr1983920 3756 3104 2844 1395 586 570 495 13211 23449 1186 --
NM_021116chr7238805 8226 8042 8033 7766 7188 6474 6430 6304 5734 3419 3204 3092 2499 2307 1549 1356 931 514 459 382 204 40 --12154 17675
NM_031844chr1123845 3798 3662 3656 3538 3448 3016 1570 1407 1077 811 592 22619 2588 ----
NM_033656chr21105568 5296 5242 4490 4438 3927 3909 1849 1706 1162 24804 1699 ----
NM_052811chr13115300 5166 4560 4349 4259 1080 767 646 496 381 273 24024 3463 ----
NM_144571chr486728 6696 5792 2798 2276 1782 1745 1033 25863 4280 11760 --
NM_145259chr257069 4671 1424 515 380 12529 34558 2058 548 14819
NM_152263chr196032 5692 4239 3897 2403 2268 2054 1828 1025 15378 22324 1631 1782
NM_152756chr553608 3540 1569 1476 1305 23030 343 23270 3252 13087
NM_173642chr1178991 8857 8677 8536 8203 7950 6693 6553 6491 6396 6162 3673 3545 2770 2615 1370 1183 --28669 588 --
NM_177538chr2207933 7561 7294 7100 6922 6590 6369 6115 6055 3152 2755 2509 2313 1568 1385 858 722 585 559 449 ----13183
NM_181521chr16196571 6429 6294 5973 5499 5483 5422 5315 5269 5248 5047 4922 4682 4483 2633 2263 854 454 245 --25133 1975 --
NM_182762chr776050 5521 4574 4236 1731 1669 757 33852 1925 40 --14274
NM_198859chr375101 4989 3471 1359 1082 835 608 34643 4254 3174 33145 1678 1624 13926
NM_199462chr1104608 4182 3391 1558 1254 1240 1166 959 548 448 25008 4300 44451 4076 3219 3214 --
NM_213590chr13115300 5166 4560 4349 4259 1080 767 646 496 381 273 24024 3463 ----