TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1289
miRNA Sequence: UGGAGUCCAGGAAUCUGCAUUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51920 1873 ----
NM_000021chr143166 118 107 ------
NM_000024chr51387 --1433 --
NM_000032chrX121 ------
NM_000037chr8112453 2262 2160 2153 1657 886 844 722 704 595 411 --1170 --
NM_000053chr1321471 33 11456 1109 1249
NM_000081chr11487 2337 61 ----
NM_000084chrX76124 5947 5481 4926 2113 1206 780 16303 ----
NM_000088chr1761317 1215 1040 865 126 25 11094 ----
NM_000092chr284605 3864 3069 2874 2848 945 846 58 --1101 --
NM_000109chrX31000 589 108 12617 ----
NM_000115chr1332232 1867 1778 --1369 --
NM_000125chr653231 2785 2762 434 309 --1267 1206
NM_000129chr641042 420 379 321 1373 --1129
NM_000141chr1021125 281 --1940 --
NM_000158chr31243 ------
NM_000163chr531609 729 122 1563 ----
NM_000165chr631425 549 237 128 ----
NM_000167chrX----122 --
NM_000179chr2132 ------
NM_000208chr1964427 4226 3232 1475 155 83 23256 94 ----
NM_000210chr232290 355 31 ------
NM_000216chrX23734 3684 13363 1112 --
NM_000217chr1233796 3421 1613 23851 1594 --25026 419
NM_000223chr17--1385 1132 --
NM_000245chr741693 728 144 118 ------
NM_000248chr332586 2500 353 ------
NM_000259chr1555800 5714 5523 4416 975 16157 15131 --
NM_000262chr2251589 1557 585 482 327 --1558 1303
NM_000266chrX1752 1146 1121 --
NM_000267chr1742942 623 499 43 11356 ----
NM_000276chrX52212 2067 2047 1403 508 1623 --149
NM_000282chr131226 ------
NM_000301chr61166 ------
NM_000314chr101911 --1548 --
NM_000319chr1221030 62 ----11159
NM_000332chr666118 5635 2567 2353 1749 323 46643 4673 1063 908 --1240
NM_000340chr3169 --11012 --
NM_000346chr172374 291 ------
NM_000367chr642279 1925 1737 1502 ------
NM_000378chr11170 ------
NM_000379chr2----1364 --
NM_000386chr171559 ------
NM_000393chr242017 674 563 93 ------
NM_000408chr223435 2481 ------
NM_000411chr2132147 528 270 --23065 2482 --
NM_000423chr12242 27 ------
NM_000430chr1732610 1297 818 ------
NM_000451chrX51837 804 722 535 157 --4665 507 41 33 --
NM_000452chr1341922 1683 1537 559 --1801 --
NM_000459chr9--1180 --1278
NM_000461chr311163 ------
NM_000474chr72228 89 ------
NM_000489chrX2882 424 --1521 --
NM_000492chr721484 1382 ------
NM_000509chr4139 ------
NM_000533chrX1254 --1172 --
NM_000544chr6_cox_hap113060 13113 12848 --
NM_000555chrX57332 4802 2952 997 781 12164 --27701 768
NM_000599chr294475 4172 4162 3971 3759 3139 1226 944 166 23075 54 23664 3122 1965
NM_000615chr1142394 2185 662 594 --11093 --
NM_000618chr1266495 4526 2381 1821 1737 1225 1587 26082 2611 --
NM_000618chr1266495 4526 2381 1821 1737 1225 1587 26082 2611 --
NM_000719chr12106190 5778 5616 4824 4762 2287 2253 1679 663 358 26478 6470 1455 --
NM_000783chr102425 215 ------
NM_000788chr41496 11413 ----
NM_000793chr1474627 4479 3780 3774 3459 2063 1443 13970 13647 --
NM_000794chr53772 691 96 ------
NM_000806chr51200 ------
NM_000808chrX3772 390 95 1411 174 --
NM_000813chr562102 1845 1156 656 71 36 14657 ----
NM_000814chr1553926 3729 3047 1393 1255 130 ----
NM_000816chr51664 ------
NM_000818chr10--195 ----
NM_000826chr4--3736 679 87 ----
NM_000827chr552519 2259 1800 1019 554 --2740 42 --
NM_000831chr185909 4234 3806 1744 1589 1162 959 680 75811 5513 5057 3885 3857 866 518 ----
NM_000834chr1221153 799 ------
NM_000838chr662244 1780 712 583 215 209 12297 ----
NM_000844chr31944 --174 --
NM_000855chr11124 1301 ----
NM_000868chrX32616 975 853 ------
NM_000870chr5--1162 ----
NM_000872chr1021076 143 --11361 --
NM_000875chr1566958 5586 4744 1099 1017 632 16410 11144 --
NM_000876chr621284 68 ------
NM_000891chr1773547 3056 2965 2929 2904 2274 368 ------
NM_000899chr1254134 3232 1668 905 263 2720 343 --1243
NM_000901chr41492 --1206 --
NM_000919chr5152 ------
NM_000921chr122129 52 ------
NM_000922chr112814 94 ------
NM_000926chr1198648 7930 7335 6759 6146 3266 2193 1528 1225 17556 28148 7364 16559
NM_000944chr41141 --22371 336 --
NM_000950chrX--13462 1106 --
NM_000959chr153788 2666 2608 1602 1334 ----12843
NM_000961chr2031519 986 649 --1782 23633 889
NM_000966chr124986 976 297 189 --1670 1263
NM_000984chr171135 ----1470
NM_001001132chr2131261 388 111 ------
NM_001001323chr12------1394
NM_001001331chr32433 274 ----12182
NM_001001395chr1222793 2001 ------
NM_001001419chr564503 3807 1621 1567 912 39 1640 ----
NM_001001420chr564503 3807 1621 1567 912 39 1640 ----
NM_001001433chr2052935 2694 2444 2343 2089 1929 1145 11184
NM_001001436chr16----172 --
NM_001001481chr843196 2960 518 325 ------
NM_001001549chr762204 2099 1902 677 573 163 ------
NM_001001550chr762204 2099 1902 677 573 163 ------
NM_001001555chr762204 2099 1902 677 573 163 ------
NM_001001556chr152326 57 ------
NM_001001664chr221050 62 ------
NM_001001701chr411825 --32306 520 90 --
NM_001001706chr6--11146 1212 --
NM_001001875chr91288 ------
NM_001001890chr2143601 662 624 311 ------
NM_001001924chr82202 25 ------
NM_001001925chr82202 25 ------
NM_001001931chr82202 25 ------
NM_001001936chr102784 25 ------
NM_001001995chrX31441 665 349 ------
NM_001002032chr17174 ------
NM_001002233chr83642 99 69 140 ----
NM_001002814chr8103866 3427 3197 2960 2529 1322 1287 642 99 69 140 ----
NM_001002843chr1511212 --1196 --
NM_001003406chr2272516 2349 989 783 588 386 318 43170 2410 2242 963 12784 --
NM_001003674chr18126421 2760 2660 2536 2379 2368 2167 1794 1415 1196 1114 145 36261 2425 1787 ----
NM_001003675chr18126421 2760 2660 2536 2379 2368 2167 1794 1415 1196 1114 145 36261 2425 1787 ----
NM_001003681chr2232013 249 75 ------
NM_001003688chr42264 133 ------
NM_001003694chr33586 429 41 ------
NM_001003698chr621489 282 21787 216 ----
NM_001003699chr621489 282 21787 216 ----
NM_001003712chr1211168 1920 ----
NM_001003800chr911019 21366 1123 13385 --
NM_001003810chr42740 79 ----1807
NM_001003940chr1573491 3451 3273 2927 589 400 270 12597 33406 2906 598 --
NM_001003942chr1573491 3451 3273 2927 589 400 270 12597 33406 2906 598 --
NM_001003943chr1573495 3455 3277 2931 593 404 274 12601 33410 2910 602 --
NM_001004065chr92218 187 1550 22856 1036 --
NM_001004196chr341259 270 221 31 --1314 --
NM_001004304chr1242683 873 308 276 ----1325
NM_001004329chr1251476 1017 957 506 447 ----159
NM_001004419chr1243963 880 501 424 --1488 --
NM_001005266chr151206 1598 1233 --
NM_001005267chr151206 1598 1233 --
NM_001005268chr151206 1598 1233 --
NM_001005269chr151206 1598 1233 --
NM_001005290chr12483 28 155 1414 --
NM_001005366chr12--1643 1109 --
NM_001005375chrY1223 11415 ----
NM_001005404chr1743389 2829 1220 714 ----13879
NM_001005408chr171457 --153 --
NM_001005463chr1032175 848 303 ----150
NM_001005473chr576375 4287 2258 1337 1315 481 336 ------
NM_001005474chr31295 ------
NM_001005526chr2--187 ----
NM_001005609chrX83643 3566 2437 1475 1054 736 374 275 1149 23629 58 --
NM_001005739chr21159 ------
NM_001005845chr8--1517 124 --
NM_001006657chr242987 2370 2081 1159 12380 ----
NM_001007023chr1474627 4479 3780 3774 3459 2063 1443 13970 13647 --
NM_001007024chr1744096 3191 2700 348 --33654 140 21 --
NM_001007025chr1744096 3191 2700 348 --33654 140 21 --
NM_001007027chr111225 ------
NM_001007097chr954849 4096 3396 1948 586 24297 4144 24415 73 11375
NM_001007102chr6--11339 21463 1174 --
NM_001007156chr1521262 1255 11849 11473 11652
NM_001007226chr1731244 257 23 ----1458
NM_001007227chr1731244 257 23 ----1458
NM_001007228chr1731244 257 23 ----1458
NM_001007229chr1731244 257 23 ----1458
NM_001007230chr1731244 257 23 ----1458
NM_001007246chr2131791 1646 1335 ------
NM_001007466chr634989 4454 25 ------
NM_001007471chr91153 ------
NM_001007538chr134514 407 103 56 ------
NM_001007544chr13425 98 41 --1180 --
NM_001007794chr11270 ------
NM_001008225chr7270 31 ------
NM_001008239chr1843606 3255 591 119 11305 ----
NM_001008388chr4--1190 ----
NM_001008408chr765485 5318 4830 4048 2387 1370 34013 314 160 --12166
NM_001008539chr875322 5230 4793 4049 1017 987 798 24831 464 24857 1579 --
NM_001008541chr1031911 1468 593 ----1647
NM_001008541chr1031911 1468 593 ----1647
NM_001008566chr221437 126 ----
NM_001008660chr1111554 --1394 --
NM_001008701chr1972762 2251 1947 779 701 314 61 --11059 1158
NM_001008738chr53753 187 100 --12324 --
NM_001008801chr1932182 2126 1792 31708 503 148 ----
NM_001008925chr431237 860 337 32744 2420 2289 ----
NM_001009880chr2274695 4202 3563 1484 1273 742 138 1158 ----
NM_001009899chr345836 4577 4459 1898 ------
NM_001009909chr1112841 1154 ----
NM_001009959chr22465 120 --22394 1870 11939
NM_001009993chr263850 3794 1653 1636 178 93 13465 --23843 54
NM_001010000chr1832842 1347 537 --12145 --
NM_001010861chr142593 2086 2055 446 1888 1708 --
NM_001010862chrX42114 2098 1146 1119 137 --1335
NM_001010888chrX33957 1792 1388 --11502 1364
NM_001010891chr535547 4569 4512 21597 109 ----
NM_001010895chr92704 696 ------
NM_001010986chrX11007 ------
NM_001010989chr162461 383 161 ----
NM_001010990chr162461 383 161 ----
NM_001011513chr463977 3512 3497 3171 1407 797 ------
NM_001011537chr32255 35 ------
NM_001011553chr7----1344 --
NM_001011666chr766288 5138 1079 659 635 99 ------
NM_001011713chr1411019 ------
NM_001012329chr171884 1755 694 679 292 214 59 12380 11771 --
NM_001012393chr1144560 4488 1857 1833 11479 23199 1140 13620
NM_001012421chr91638 ------
NM_001012643chr192535 237 --1369 --
NM_001012751chr101535 11728 --11716
NM_001012753chr1951020 936 498 230 146 ------
NM_001012755chrX21277 418 11528 ----
NM_001012989chrX151 ------
NM_001013031chr1032999 1408 104 11246 ----
NM_001013399chr621125 740 ------
NM_001013620chr1288218 7794 6721 6380 2536 2008 1871 34 48158 7816 7084 2049 ----
NM_001013635chr124362 234 166 135 --2803 263 --
NM_001013674chr11319 ------
NM_001014283chr1331960 1613 1449 2667 91 ----
NM_001014336chr12188 ------
NM_001014797chr10127616 7368 7164 5643 5213 3279 2746 2202 1044 963 483 134 25320 100 27428 2495 12926
NM_001015508chr8--1198 ----
NM_001015877chrX1588 --1684 1787
NM_001015887chr32511 223 ------
NM_001017368chr1761803 1772 1090 712 687 58 ------
NM_001017424chr1----145 --
NM_001017425chr1----145 --
NM_001017440chr776841 6419 3035 2985 2105 423 66 46978 2926 2737 462 36513 5779 2488 --
NM_001017995chr5104810 4289 3575 1354 1205 727 604 315 128 112 34250 4089 1031 ----
NM_001018025chrX2746 251 ------
NM_001018050chr2263205 2546 2423 2106 321 265 11087 1985 --
NM_001018052chr2263205 2546 2423 2106 321 265 11087 1985 --
NM_001018064chr951711 1526 528 191 132 ------
NM_001018065chr935601 5453 25 11291 ----
NM_001018066chr935601 5453 25 11291 ----
NM_001018067chr124971 4607 --11286 174
NM_001018068chr124971 4607 --11286 174
NM_001018069chr124971 4607 --11286 174
NM_001018108chr1551708 652 488 301 241 ------
NM_001020818chr1931749 559 306 11347 ----
NM_001020819chr1931749 559 306 11347 ----
NM_001020820chr1931749 559 306 11347 ----
NM_001020821chr1931749 559 306 11347 ----
NM_001023587chr321064 344 --1960 --
NM_001024401chr1641891 835 695 383 11955 ----
NM_001024455chrX3945 729 716 1824 11730 2410 99
NM_001024460chr63981 276 145 ------
NM_001024666chrX1501 ------
NM_001024688chr812120 1644 ----
NM_001024736chr1531501 1047 179 11418 41482 1036 976 116 --
NM_001024808chr1272633 2164 1939 1123 693 400 83 --12523 2555 285
NM_001024858chr1462595 2182 1063 836 567 209 12300 2653 229 --
NM_001024937chr171509 ------
NM_001025076chr1045731 5117 4885 4606 14073 26109 5738 --
NM_001025077chr1067089 6475 6243 5964 1293 1222 15431 27467 7096 --
NM_001025105chr52575 156 1551 ----
NM_001025108chr284159 4051 3191 2953 2812 2788 385 29 1657 ----
NM_001025266chr364833 4634 1535 739 607 384 ------
NM_001025356chr122503 310 ------
NM_001025366chr661502 558 495 259 204 169 --1328 --
NM_001025366chr661502 558 495 259 204 169 --1328 --
NM_001025367chr661502 558 495 259 204 169 --1328 --
NM_001025367chr661502 558 495 259 204 169 --1328 --
NM_001025368chr661502 558 495 259 204 169 --1328 --
NM_001025368chr661502 558 495 259 204 169 --1328 --
NM_001025369chr661518 574 511 275 220 185 --1344 --
NM_001025369chr661518 574 511 275 220 185 --1344 --
NM_001025370chr661502 558 495 259 204 169 --1328 --
NM_001025370chr661502 558 495 259 204 169 --1328 --
NM_001025596chr11144 1369 ----
NM_001025780chr921556 1269 ------
NM_001029858chr623224 1286 12482 ----
NM_001029859chr113836 134 128 12125 1669 1322
NM_001029863chr612490 1240 22642 2373 --
NM_001029875chr521843 1024 ------
NM_001029997chr191543 ------
NM_001030006chr1742564 2505 1991 1690 11651 ----
NM_001030007chr1663564 2975 1446 989 828 572 12594 ----
NM_001030055chr1434713 1430 1074 14021 --1970
NM_001030272chr11--1114 ----
NM_001030273chr11--1114 ----
NM_001031679chr1213148 12293 12268 12544
NM_001031695chr2274605 4371 4126 3668 3297 1976 1607 ----14421
NM_001031709chr101284 ------
NM_001031732chr433606 1128 724 ------
NM_001031746chr1021042 249 11284 ----
NM_001031804chr1634405 3544 352 13628 13179 --
NM_001031812chr522064 100 ------
NM_001032283chr121888 182 --1164
NM_001032284chr121888 182 --1164
NM_001032288chr201282 ------
NM_001032290chr12515 60 287 28 1446 --
NM_001032291chr12515 60 287 28 1446 --
NM_001032296chr1321042 948 21131 92 ----
NM_001033025chr121520 291 ------
NM_001033044chr121683 401 ------
NM_001033045chr244002 3996 3517 2711 23330 622 1291 --
NM_001033047chr41427 1704 12290 --
NM_001033056chr121683 401 ------
NM_001033059chr622022 1778 1579 ----
NM_001033081chr171625 1268 1192 767 732 690 464 ----1349
NM_001033082chr171625 1268 1192 767 732 690 464 ----1349
NM_001033117chr354372 4024 3525 663 576 11467 23959 3697 11943
NM_001033518chr762765 2594 1135 718 608 57 1489 12604 --
NM_001033519chr762765 2594 1135 718 608 57 1489 12604 --
NM_001033520chr762765 2594 1135 718 608 57 1489 12604 --
NM_001033723chr831724 493 23 2961 682 1300 --
NM_001033756chr661436 492 429 193 138 103 --1262 --
NM_001033756chr661436 492 429 193 138 103 --1262 --
NM_001034025chr12176 1908 1347 --
NM_001035chr11300 --11076 --
NM_001035254chr932451 1943 356 --1757 12169
NM_001037131chr22837 216 ----1432
NM_001037317chr142593 2086 2055 446 1888 1708 --
NM_001037339chr11510 ------
NM_001037340chr11510 ------
NM_001037341chr11510 ------
NM_001037341chr11510 ------
NM_001037967chrX121 ------
NM_001037969chrX121 ------
NM_001038633chr131028 1005 907 ------
NM_001038707chr122323 2143 --2929 161 --
NM_001038707chr122323 2143 --2929 161 --
NM_001039091chrX2990 40 1379 ----
NM_001039350chr721421 1118 1347 --11342
NM_001039538chr233407 679 63 11467 13527 --
NM_001039570chr22104216 3837 3680 2980 2957 1624 1033 335 90 23 33788 3695 3589 2515 189 --
NM_001039571chr22104216 3837 3680 2980 2957 1624 1033 335 90 23 33788 3695 3589 2515 189 --
NM_001039577chr1104241 3980 3285 3167 2754 1813 874 828 674 134 34375 4029 1558 43867 2811 1351 735 --
NM_001039585chr144045 2923 2865 1591 ----13100
NM_001039590chrX33928 3678 2514 ------
NM_001039591chrX33928 3678 2514 ------
NM_001039618chr1174667 4591 4006 3873 2071 892 245 ------
NM_001039693chr263943 3568 2789 1557 485 133 ------
NM_001039802chr131231 1218 332 1534 ----
NM_001039840chrX75944 5628 5480 5176 4915 4538 1439 14232 15810 13982
NM_001039937chr1333363 2853 271 ------
NM_001040057chr7--1370 122 --
NM_001040101chr441553 621 549 52 ------
NM_001040110chr731834 1735 607 1627 21252 253 --
NM_001040118chr111559 --132 1489
NM_001040152chr733130 1924 977 12012 24346 1866 --
NM_001040153chr13--11000 ----
NM_001040157chr432191 380 31 ----1119
NM_001040172chr5--1162 ----
NM_001040173chr5--1162 ----
NM_001040202chr43331 291 81 ------
NM_001040284chr1615007 44156 3966 2266 430 25629 70 --
NM_001040424chr2162705 2616 2600 2048 2031 949 1667 21950 929 1226
NM_001040429chr1323506 2381 ----12835
NM_001040446chr521924 335 ------
NM_001040450chr1532918 474 376 ------
NM_001040453chr1532918 474 376 ------
NM_001040610chr15121 ------
NM_001040624chr842576 2126 1838 222 --1454 12405
NM_001040625chr842576 2126 1838 222 --1454 12405
NM_001040626chr842576 2126 1838 222 --1454 12405
NM_001040627chr842576 2126 1838 222 --1454 12405
NM_001040628chr842576 2126 1838 222 --1454 12405
NM_001040629chr842576 2126 1838 222 --1454 12405
NM_001040630chr842576 2126 1838 222 --1454 12405
NM_001040633chr71733 ------
NM_001040709chr152272 1941 1607 853 651 22405 1616 22099 2085 --
NM_001040712chr922286 267 --1409 --
NM_001042353chr203546 404 176 1104 ----
NM_001042388chr181330 ----1122
NM_001042403chr12--1381 ----
NM_001042475chr6----1311 --
NM_001042479chrX193 21349 395 11975 --
NM_001042480chrX193 21349 395 11975 --
NM_001042490chr5----165 --
NM_001042492chr1742942 623 499 43 11356 ----
NM_001042537chrX22164 656 12462 ----
NM_001042543chr441319 1313 981 219 --11114 --
NM_001042555chr1222929 298 ------
NM_001042599chr242826 2523 2441 675 45620 5328 3123 2945 14806 --
NM_001042601chr322330 501 ------
NM_001042603chr1274927 4912 4637 4177 1446 1138 694 --1159 --
NM_001042632chr2051921 1877 1863 1778 58 1577 2989 248 --
NM_001042633chr2051921 1877 1863 1778 58 1577 2989 248 --
NM_001042681chr152606 2425 2061 791 61 --12053 11948
NM_001042682chr152606 2425 2061 791 61 --12053 11948
NM_001042682chr152606 2425 2061 791 61 --12053 11948
NM_001042683chr621202 27 11614 ----
NM_001042728chr124986 976 297 189 --1670 1263
NM_001043318chr1423616 571 --1224 2742 651
NM_001043351chr132130 485 49 1544 ----
NM_001044385chr232793 2670 1201 23954 3140 1751 --
NM_001044722chr522064 100 ------
NM_001044723chr522064 100 ------
NM_001046chr533036 866 175 ------
NM_001071775chr13--11689 11816 --
NM_001079874chr131736 1708 1522 ------
NM_001083620chr4--3735 678 87 ----
NM_001083621chr184627 3982 3391 3167 3095 1727 852 405 23043 1709 13535 --
NM_001100108chr1137996 7231 5877 5681 3275 3118 2967 2690 2481 2417 966 373 58 ------
NM_001106chr3129150 7998 6839 6408 6123 3896 3875 3413 3224 2755 685 323 28127 3199 ----
NM_001113490chrX3837 642 125 11262 12698 --
NM_001122631chr11----1491 --
NM_001122679chr51920 1873 ----
NM_001128chr1663564 2975 1446 989 828 572 12594 ----
NM_001148chr41150 ----1847
NM_001163chr91348 --21013 36 --
NM_001167chrX66283 5924 5008 2425 1192 501 ------
NM_001173chr1434713 1430 1074 14021 --1970
NM_001178chr11--1114 ----
NM_001189chr44262 146 45 31 1959 1979 --
NM_001198chr632216 2150 431 1539 ----
NM_001201chr443521 3426 645 484 --23142 59 --
NM_001204chr267060 5511 1931 1547 1180 725 15098 ----
NM_001206chr923110 1104 ------
NM_001222chr1021610 407 21485 30 ----
NM_001241chr221584 69 ------
NM_001241chr221584 69 ------
NM_001259chr726215 5812 --14820 --
NM_001265chr133673 386 70 --2752 60 1643
NM_001270chr52442 30 ------
NM_001271chr1553115 2996 2771 910 528 12025 12314 --
NM_001282chr1742564 2505 1991 1690 11651 ----
NM_001284chr5----1490 --
NM_001295chr341003 587 278 94 1517 --21453 387
NM_001304chr1733737 2721 88 13348 ----
NM_001310chr1222836 47 187 ----
NM_001315chr641872 1678 1541 1470 --11889 12115
NM_001326chr111496 --141 --
NM_001346chr352751 2474 1153 519 238 1703 ----
NM_001351chr321366 135 ------
NM_001358chr4--1429 ----
NM_001364chr1174344 3921 3845 3674 3381 1706 915 13091 24033 3050 1624
NM_001386chr841615 733 580 65 1622 ----
NM_001387chr51219 12503 12160 --
NM_001389chr211163 ------
NM_001390chr1822918 282 23273 670 12508 --
NM_001396chr2142653 2550 1034 850 --12476 --
NM_001399chrX83643 3566 2437 1475 1054 736 374 275 1149 23629 58 --
NM_001401chr931552 1299 268 1638 ----
NM_001408chr161481 1434 643 349 320 32 21110 313 1444 --
NM_001412chrX33649 3039 2995 --12877 --
NM_001419chr1964123 3683 3432 3030 1920 533 14502 ----
NM_001420chr1952922 2870 2575 2405 646 12691 22854 2770 1372
NM_001423chr1232078 1385 159 ------
NM_001429chr221843 ------
NM_001430chr24555 401 270 118 ------
NM_001431chr621109 455 ------
NM_001438chr143139 1258 829 158 ------
NM_001439chr121520 291 ------
NM_001449chrX31075 1067 261 ------
NM_001453chr61479 ------
NM_001463chr21208 --134 --
NM_001490chr942928 2362 1098 335 ----1119
NM_001508chr24660 183 163 149 --1326 --
NM_001518chr71775 ------
NM_001543chr554783 3918 1778 891 291 11656 24618 538 --
NM_001546chr611011 ------
NM_001584chr111220 ------
NM_001587chrX52212 2067 2047 1403 508 1623 --149
NM_001609chr1054014 3813 3344 2798 1442 13704 --13864
NM_001616chr2----138 --
NM_001634chr622022 1778 1579 ----
NM_001650chr1842946 2920 1652 33 13144 ----
NM_001654chrX----1413 1295
NM_001659chr1222197 716 12547 12570 12306
NM_001661chr17--1264 ----
NM_001677chr11266 ------
NM_001682chr12------1108
NM_001683chr32433 274 ----12182
NM_001699chr1931833 1370 1340 21325 266 11814 --
NM_001701chr911319 ------
NM_001706chr31909 1408 ----
NM_001709chr1112665 ------
NM_001714chr12--1396 ----
NM_001743chr2------1131
NM_001754chr2143601 662 624 311 ------
NM_001759chr1274971 4540 4423 4090 2128 1141 676 --14285 --
NM_001769chr12--1308 ----
NM_001788chr7----1344 --
NM_001791chr131231 1218 332 1534 ----
NM_001792chr1831094 787 149 ------
NM_001802chr16179 1251 ----
NM_001844chr121142 --182 --
NM_001845chr13--1974 ----
NM_001854chr11237 2540 459 ----
NM_001855chr92751 181 ------
NM_001859chr952966 1413 824 223 69 ------
NM_001880chr2--147 ----
NM_001892chr52575 156 1551 ----
NM_001893chr171277 1335 ----
NM_001894chr2231223 510 198 ------
NM_001895chr202974 358 --1224 --
NM_001901chr61130 1941 ----
NM_001923chr11--1229 ----
NM_001932chr174822 676 629 58 ------
NM_001935chr22929 304 1627 1171 --
NM_001936chr721421 1118 1347 --11342
NM_001938chr121421 106 ----11431
NM_001945chr53253 107 87 --1539 1904
NM_001946chr122880 274 --1283 --
NM_001950chr161202 --1704 --
NM_001969chr1443458 3429 3270 350 ------
NM_001977chr41682 --1213 --
NM_001981chr132074 1518 116 12081 ----
NM_001987chr1233785 1498 354 24143 3650 --1230
NM_001995chr431158 349 283 ------
NM_002006chr443849 3837 1842 726 11206 ----
NM_002009chr1552703 2260 1939 1867 146 ------
NM_002010chr131450 ------
NM_002015chr1332857 769 618 13173 ----
NM_002024chrX2736 384 ------
NM_002025chrX98736 8493 3426 2361 2021 1696 651 624 349 48028 7806 6550 246 26394 1074 18485
NM_002032chr113359 333 38 ------
NM_002035chr1843406 1202 606 393 12621 --23022 294
NM_002037chr61125 ------
NM_002040chr2113034 124 ----
NM_002044chr152326 57 ------
NM_002048chr93346 211 172 ------
NM_002052chr841265 1187 263 44 2513 111 176 --
NM_002065chr121683 401 ------
NM_002069chr72233 120 1718 ----
NM_002074chr131354 1289 1081 ------
NM_002076chr1243048 900 795 157 ------
NM_002086chr172898 513 11951 ----
NM_002092chr434888 4269 68 ------
NM_002106chr4--170 --135
NM_002107chr1--1409 ----
NM_002112chr15----146 --
NM_002126chr1732867 398 124 --21290 386 13341
NM_002130chr521126 245 21469 26 ----
NM_002138chr42740 79 ----1807
NM_002158chr222987 2896 12646 12912 172
NM_002182chr332610 845 590 1779 --22621 2212
NM_002193chr221389 1379 ------
NM_002199chr41882 ----1182
NM_002205chr122970 21 --1368 --
NM_002221chr111086 1642 42717 2622 2354 916 --
NM_002223chr1221294 657 13987 ----
NM_002232chr1--11077 ----
NM_002233chr111461 ------
NM_002235chr1241434 690 105 97 ------
NM_002242chr231920 1433 783 1424 ----
NM_002254chr221623 36 --2782 576 --
NM_002264chr364471 1438 1118 710 683 308 --1340 --
NM_002265chr171217 1975 ----
NM_002267chr1332145 2068 824 192 ----
NM_002271chr131702 ------
NM_002274chr172223 21 ------
NM_002285chr284159 4051 3191 2953 2812 2788 385 29 1657 ----
NM_002296chr111117 1646 ----
NM_002298chr1321480 1459 21541 117 ----
NM_002317chr51270 ------
NM_002334chr1132079 2038 284 ------
NM_002336chr1223697 1844 14289 ----
NM_002345chr121634 ------
NM_002349chr2------1210
NM_002353chr1182 ------
NM_002373chr1531031 922 131 ------
NM_002374chr233407 679 63 11467 13527 --
NM_002375chr321787 1466 11504 2576 204 --
NM_002382chr14199 11242 1226 --
NM_002384chr18129 1637 ----
NM_002397chr521823 834 ------
NM_002399chr1521122 555 --1967 --
NM_002408chr141534 ------
NM_002445chr84427 145 108 88 ------
NM_002449chr51480 124 ----
NM_002467chr82156 23 ------
NM_002470chr17188 ------
NM_002482chr13730 546 72 ------
NM_002485chr812120 1644 ----
NM_002494chr4160 ------
NM_002499chr1531993 1918 688 2154 25 ----
NM_002505chr61252 ----1604
NM_002507chr1731528 1472 1370 ----1428
NM_002508chr111981 --1176 --
NM_002515chr14----11666 --
NM_002519chr111342 ------
NM_002522chr1763147 2621 1544 1251 1109 584 13068 1223 11070
NM_002545chr1144560 4488 1857 1833 11479 23199 1140 13620
NM_002547chrX82966 2959 1271 1085 983 640 278 137 --1263 --
NM_002556chr1132033 1313 79 --21966 754 --
NM_002563chr321109 830 ------
NM_002577chr343235 775 758 437 ------
NM_002581chr934660 797 154 14226 1207 --
NM_002590chr131484 ------
NM_002599chr111182 --41161 1030 376 110 --
NM_002600chr11510 ------
NM_002605chr154912 881 819 465 --1316 --
NM_002628chr32922 121 ------
NM_002630chr62114 87 --2108 26 --
NM_002636chr61408 --1535 --
NM_002645chr1152866 2242 1215 1139 982 23122 2919 ----
NM_002646chr171761 1350 814 782 493 464 76 --161 --
NM_002648chr631048 434 193 --2460 267 --
NM_002649chr721153 278 11568 ----
NM_002651chr12645 262 1256 ----
NM_002655chr851979 1085 994 663 564 ------
NM_002657chr2043578 3392 1316 775 2468 176 11461 1229
NM_002660chr2041137 919 757 260 1353 --1126
NM_002670chr3161 ------
NM_002698chr1922790 2219 --22900 1865 --
NM_002699chr121066 586 --3440 383 72 --
NM_002710chr123746 179 31 ------
NM_002714chr61949 ------
NM_002715chr5----11122 --
NM_002717chr82241 170 ------
NM_002719chr1431916 178 50 12414 22139 1595 1668
NM_002736chr711720 ------
NM_002737chr1765538 5242 5213 2381 1988 1836 65512 2366 1811 1695 1032 107 15775 --
NM_002739chr194622 569 545 529 --2678 256 --
NM_002745chr2221320 116 --12829 --
NM_002755chr152630 364 ------
NM_002758chr17--1424 ----
NM_002761chr16--155 ----
NM_002765chrX2990 40 1379 ----
NM_002775chr103514 130 42 --167 123
NM_002791chr14------1137
NM_002796chr1175 ------
NM_002822chr12--1253 ----
NM_002828chr18----1167 --
NM_002835chr71500 ------
NM_002837chr1234532 4241 627 1722 ----
NM_002839chr922286 267 --1409 --
NM_002841chr3--179 ----
NM_002843chr1153046 2998 2321 768 694 13014 12105 23310 2509
NM_002844chr621255 1230 ------
NM_002845chr182573 86 ------
NM_002848chr1211050 --2817 193 --
NM_002867chr15587 494 282 269 251 ------
NM_002869chr1152044 1952 766 650 450 ------
NM_002874chr932501 1837 82 ------
NM_002886chr334801 651 57 14325 --25182 3541
NM_002890chr5131 ------
NM_002892chr14--11602 ----
NM_002911chr1931712 1358 413 --11416 --
NM_002912chr61132 ------
NM_002924chr1----1158 --
NM_002928chr14620 428 262 193 11495 ----
NM_002938chr411430 --21992 494 --
NM_002942chr32268 53 171 ----
NM_002955chr621489 282 21787 216 ----
NM_002956chr12--184 ----
NM_002959chr164458 3516 3463 3324 2995 428 169 13059 --
NM_002977chr233352 2705 1167 ------
NM_002994chr411672 --1150 --
NM_002998chr821950 785 ------
NM_002999chr202220 29 ------
NM_003010chr1731926 1845 365 123 ----
NM_003016chr17199 ----1470
NM_003017chr6--189 ----
NM_003034chr1227392 3248 36245 5399 62 ----
NM_003042chr321756 397 --1468 --
NM_003043chr364201 3954 2995 1733 1217 971 33885 3180 3013 --1484
NM_003045chr1364516 4196 4140 4051 3614 950 34178 3214 664 ----
NM_003046chr875322 5230 4793 4049 1017 987 798 24831 464 24857 1579 --
NM_003068chr81769 ------
NM_003077chr171329 --1155 --
NM_003081chr2031220 959 744 ------
NM_003087chr10--1251 ----
NM_003099chr1542197 1718 1374 105 25536 5436 25129 5101 --
NM_003100chr5------159
NM_003106chr3----1248 --
NM_003107chr652066 924 565 389 330 1626 ----
NM_003108chr266309 6176 5690 4794 1366 1305 17314 36678 5059 2878 --
NM_003128chr22439 432 11767 --11866
NM_003146chr112102 50 ------
NM_003155chr832116 2072 1728 --1782 --
NM_003157chr3------1971
NM_003161chr171235 12369 ----
NM_003173chrX2280 265 1173 11224 --
NM_003178chr312247 1230 12015 --
NM_003184chr81101 ------
NM_003188chr6--1765 ----
NM_003189chr143341 2413 2063 112 11048 ----
NM_003199chr1843730 3719 1964 946 ------
NM_003200chr1942357 2330 1887 1849 ------
NM_003201chr10----1144 --
NM_003204chr1741660 1481 1300 91 ----1474
NM_003215chr441124 412 30 22 ------
NM_003216chr2293125 3028 2393 2343 1330 1216 934 716 642 --32151 337 60 --
NM_003217chr12132 1680 ----
NM_003221chr653938 2599 1288 1039 645 13866 23318 2564 11658
NM_003234chr322202 1844 ------
NM_003236chr21684 --1262 1344
NM_003246chr1531307 390 353 --2660 138 --
NM_003255chr1732468 1646 549 --22040 947 --
NM_003262chr311862 --24383 3524 11133
NM_003269chr61995 11127 ----
NM_003286chr201330 ------
NM_003288chr203598 385 304 11035 ----
NM_003297chr121205 ------
NM_003298chr345656 4586 1084 776 12482 15816 --
NM_003326chr12595 72 ----12605
NM_003337chr551710 1406 1346 649 100 ------
NM_003342chr1752689 2311 2086 1212 657 --2429 99 --
NM_003347chr2231686 812 431 1537 21993 79 --
NM_003348chr1231062 590 51 --1400 --
NM_003349chr201282 ------
NM_003369chr1142041 1864 1836 152 --22000 1947 --
NM_003373chr102595 376 ----1281
NM_003374chr51573 --1712 --
NM_003376chr661502 558 495 259 204 169 --1328 --
NM_003376chr661502 558 495 259 204 169 --1328 --
NM_003379chr61975 1959 1362 11131
NM_003387chr232023 1075 452 --21117 1068 --
NM_003390chr112958 123 --1810 --
NM_003392chr343494 3292 1046 256 ----1772
NM_003400chr2--1574 ----
NM_003403chr14----1326 --
NM_003405chr221756 ------
NM_003455chr112467 423 11518 11678 --
NM_003458chr374049 3081 2636 2612 1559 1298 830 --42553 1205 517 94 13494
NM_003466chr262319 2166 1971 1556 205 43 1394 12377 12132
NM_003468chr243644 2757 1254 21 13734 1994 12858
NM_003469chr2179 ------
NM_003471chr32724 132 ------
NM_003478chr1131319 1283 95 ------
NM_003483chr1212947 ------
NM_003489chr21----1926 --
NM_003557chr12449 343 --1386 --
NM_003559chr1763831 3249 3110 759 616 329 12819 12708 --
NM_003563chr1731244 257 23 ----1458
NM_003576chr1321042 948 21131 92 ----
NM_003583chr12--13322 13023 --
NM_003595chr221437 126 ----
NM_003607chr164328 4275 3687 1607 157 134 11709 11421 --
NM_003615chr31804 ------
NM_003633chr51578 --22164 523 --
NM_003637chr151263 1029 345 334 78 --1500 --
NM_003644chr17106050 4800 4541 4498 2541 1135 590 407 366 240 1133 45557 5527 167 51 12016
NM_003668chr121139 --1360 --
NM_003671chr932908 2602 2526 33181 705 36 12294 --
NM_003690chr21516 1120 ----
NM_003709chr2------177
NM_003711chr51109 ------
NM_003722chr31574 --12161 --
NM_003743chr221703 1574 21895 1582 ----
NM_003749chr131681 --1145 1594
NM_003750chr10195 1884 ----
NM_003763chr2052935 2694 2444 2343 2089 1929 1145 11184
NM_003766chr171526 --1238 --
NM_003791chr164237 211 187 167 1500 ----
NM_003794chr3--1224 ----
NM_003797chr11--1184 ----
NM_003800chr642029 1824 789 206 12337 ----
NM_003812chr2142 ------
NM_003819chr1167 ------
NM_003822chr133041 2603 2526 --1421 1245
NM_003850chr131663 ------
NM_003861chr1452113 1802 865 712 238 ------
NM_003864chr4--1131 ----
NM_003884chr31429 ------
NM_003885chr173432 400 32 11679 --11883
NM_003887chr212035 ------
NM_003893chr101384 --1140 --
NM_003897chr62571 460 --196 --
NM_003901chr1021949 147 --11853 133
NM_003908chr2051368 1117 1001 388 251 1554 ----
NM_003916chrX2190 24 ----11459
NM_003927chr183910 741 213 1390 ----
NM_003932chr22----11859 --
NM_003934chr91235 ------
NM_003941chr7169 ------
NM_003947chr33342 183 99 1977 1197 175
NM_003948chr452409 2365 683 641 170 ----22096 915
NM_003955chr172546 274 11469 ----
NM_003956chr101390 1398 ----
NM_003958chr6103694 2984 2926 2794 1297 930 245 208 84 67 22764 602 ----
NM_003983chr1674104 3898 1408 650 620 125 67 --11291 --
NM_003994chr1254134 3232 1668 905 263 2720 343 --1243
NM_004006chrX31000 589 108 12617 ----
NM_004007chrX31000 589 108 12617 ----
NM_004009chrX31000 589 108 12617 ----
NM_004010chrX31000 589 108 12617 ----
NM_004011chrX31000 589 108 12617 ----
NM_004012chrX31000 589 108 12617 ----
NM_004013chrX31000 589 108 12617 ----
NM_004014chrX31000 589 108 12617 ----
NM_004015chrX31000 589 108 12617 ----
NM_004016chrX3914 503 22 12531 ----
NM_004017chrX31000 589 108 12617 ----
NM_004018chrX3914 503 22 12531 ----
NM_004020chrX31000 589 108 12617 ----
NM_004021chrX3914 503 22 12531 ----
NM_004022chrX3914 503 22 12531 ----
NM_004023chrX3914 503 22 12531 ----
NM_004028chr1842946 2920 1652 33 13144 ----
NM_004035chr1744931 3291 1985 247 13579 ----
NM_004050chr1452496 2284 796 672 332 11980 32309 2199 533 --
NM_004055chr1162033 1871 1818 1428 793 463 21383 720 31585 1552 456 1265
NM_004056chr81258 21071 867 ----
NM_004061chr53522 456 143 ------
NM_004081chrY1223 11415 ----
NM_004093chr132522 435 ----1890
NM_004098chr104883 488 223 160 ------
NM_004113chr321958 1632 11310 ----
NM_004124chr1432580 1199 241 11277 ----
NM_004134chr5161 ------
NM_004162chr3191 ------
NM_004171chr1189278 8551 8524 3653 2461 1702 1510 371 21752 1543 --13391
NM_004172chr511660 --1628 --
NM_004193chr101528 ------
NM_004200chr1172547 2215 1290 909 209 143 119 --23015 2681 --
NM_004229chrX32191 1961 90 ------
NM_004232chr1822627 977 ------
NM_004242chr6------1102
NM_004272chr511453 21428 690 ----
NM_004274chr1422028 140 --1269 --
NM_004277chr621049 176 ------
NM_004296chr14103934 3833 3804 3499 3423 3168 1084 893 768 219 --23236 2742 --
NM_004302chr1262732 2725 2455 2235 1079 219 ------
NM_004308chr1131891 1629 238 11545 152 11344
NM_004326chr12364 242 145 ----
NM_004329chr1031254 1189 106 1278 1552 --
NM_004337chr821440 91 21782 314 ----
NM_004338chr18126421 2760 2660 2536 2379 2368 2167 1794 1415 1196 1114 145 36261 2425 1787 ----
NM_004342chr721870 1554 ------
NM_004349chr811301 ------
NM_004364chr1961254 1117 1084 443 176 116 ------
NM_004370chr61164 ------
NM_004380chr1662661 1722 549 429 285 102 ------
NM_004384chr522064 100 ------
NM_004385chr51715 ----1649
NM_004392chr1352189 1942 1867 484 385 ------
NM_004393chr351945 1921 1679 469 201 --12273 1859
NM_004397chr1154206 2668 1124 408 381 13876 23851 3675 --
NM_004412chr1034550 2312 1245 25027 1205 ----
NM_004414chr2121111 80 ------
NM_004416chr12--1813 1676 --
NM_004419chr10--1783 1929 --
NM_004430chr821990 584 ----11933
NM_004432chr912404 ------
NM_004433chr11165 11627 1617 2448 396
NM_004438chr252527 2014 1126 716 457 --1570 --
NM_004443chr33607 76 60 --2143 69 --
NM_004449chr211152 ------
NM_004454chr332107 1574 393 --11809 --
NM_004459chr172684 509 ------
NM_004475chr17193 ------
NM_004482chr21908 ------
NM_004485chr133759 1074 271 ----14177
NM_004500chr14----11477 --
NM_004501chr153776 2951 2684 1079 460 11608 ----
NM_004504chr222232 723 --12003 1172
NM_004505chr17149 11372 ----
NM_004506chr61240 ------
NM_004514chr1742943 2416 1195 781 ----32139 1896 104
NM_004525chr241340 1180 571 558 ------
NM_004537chr12--11513 ----
NM_004543chr2269 34 ------
NM_004554chr1461737 730 593 520 511 109 1363 ----
NM_004566chr1062457 2136 1946 1843 766 432 --191 --
NM_004569chr142713 48 --1735 --
NM_004571chr2143166 2958 1243 153 13103 22172 1364 1923
NM_004575chr4----11007 --
NM_004586chrX34512 3534 1755 11250 --13838
NM_004588chr1152956 2782 1522 669 142 11394 33397 659 244 1800
NM_004598chr53958 587 161 179 ----
NM_004602chr2021028 954 11468 ----
NM_004612chr954719 4071 3012 1672 423 33425 3409 2974 13573 --
NM_004630chr114869 347 210 166 2928 467 1812 --
NM_004634chr33586 429 41 ------
NM_004654chrY--11233 ----
NM_004660chrY31630 1480 934 ------
NM_004663chr15----1241 --
NM_004673chr111522 ------
NM_004705chr111743 ----1105
NM_004709chrX21813 350 --11545 --
NM_004711chr2293625 3043 2831 2647 2563 2457 1361 1151 891 13447 12640 1950
NM_004717chr71566 --11514 --
NM_004723chr11813 ----170
NM_004724chr113469 75 42 1358 ----
NM_004725chr1021065 557 ------
NM_004726chrX25022 1437 ----23626 459
NM_004734chr132875 152 12113 12397 --
NM_004739chr112617 475 ------
NM_004745chr876761 6075 5636 1340 1240 572 192 11275 ----
NM_004772chr51571 --1117 --
NM_004774chr1762669 2485 2227 2089 1107 504 ------
NM_004781chr131695 507 465 ------
NM_004781chr131695 507 465 ------
NM_004788chr1142262 1029 552 173 ------
NM_004798chr2093580 3504 3179 3119 2938 2406 2308 1145 81 --1372 --
NM_004808chr1022835 986 13178 ----
NM_004838chr19129 ------
NM_004841chr11173 11083 ----
NM_004845chrX53922 1266 1156 308 205 31350 715 498 ----
NM_004850chr211780 --1180 1395
NM_004856chr151390 ------
NM_004859chr1712022 1739 1124 --
NM_004863chr1444930 3245 1404 388 --11304 --
NM_004865chr62106 64 ------
NM_004866chr523877 663 14373 ----
NM_004871chr1744096 3191 2700 348 --33654 140 21 --
NM_004874chr8----1480 --
NM_004887chr52933 59 1251 ----
NM_004898chr411947 ------
NM_004904chr766288 5138 1079 659 635 99 ------
NM_004926chr1411620 ----11672
NM_004932chr5--21647 654 11224 --
NM_004952chr12698 311 1628 1283 --
NM_004956chr724419 3080 34456 3369 3027 24246 683 --
NM_004973chr631411 627 81 11693 ----
NM_004976chr1174125 4082 1843 1626 1067 408 280 2689 34 23228 3167 --
NM_004985chr121696 12784 21796 1551 --
NM_004992chrX147759 7446 5910 5257 3245 3046 2638 2564 2430 1431 1137 503 263 78 58165 6152 5742 5530 1346 47951 6931 1201 860 11673
NM_004992chrX147759 7446 5910 5257 3245 3046 2638 2564 2430 1431 1137 503 263 78 58165 6152 5742 5530 1346 47951 6931 1201 860 11673
NM_004994chr201182 ------
NM_005011chr731834 1735 607 1627 21252 253 --
NM_005016chr12--188 ----
NM_005020chr7--1514 ----
NM_005028chr10--2564 340 ----
NM_005032chrX2350 111 ------
NM_005054chr2----131 --
NM_005056chr1275171 5156 4881 4421 1690 1382 938 --1403 --
NM_005065chr1434400 3888 731 14032 13683 --
NM_005067chr31388 ------
NM_005068chr641290 1224 529 450 --11458 --
NM_005073chr13--1105 ----
NM_005076chr184196 4020 3862 3573 3448 3363 1636 970 --42936 1315 557 362 --
NM_005097chr10176 ------
NM_005105chr131525 1361 357 139 12144 --
NM_005109chr332541 2473 2134 137 ----
NM_005110chr51246 145 ----
NM_005114chr41525 ------
NM_005116chr2074226 3886 3814 1484 1427 1335 561 13055 ----
NM_005121chr1732592 1491 1476 21302 184 ----
NM_005124chr61845 --1111 --
NM_005126chr341721 1456 444 354 ------
NM_005134chr181330 ----1122
NM_005140chrX2752 163 ------
NM_005153chr161271 1179 ----
NM_005168chr2--11512 ----
NM_005180chr101524 ------
NM_005188chr1197232 7025 6207 5250 2966 2697 490 343 335 57382 5875 5297 2358 96 27580 5649 --
NM_005190chr621125 740 ------
NM_005197chr14106052 5426 5415 4752 4545 4399 4287 4142 4111 3994 --11259 --
NM_005201chr321139 237 1360 ----
NM_005227chr11153 --1472 --
NM_005235chr242826 2523 2441 675 45620 5328 3123 2945 14806 --
NM_005238chr115904 889 775 685 189 --22888 66 1534
NM_005239chr2121427 794 ------
NM_005241chr31224 ------
NM_005252chr143665 181 159 ------
NM_005254chr152971 128 ------
NM_005259chr211208 11332 ----
NM_005261chr81233 ------
NM_005277chr41487 ------
NM_005308chr101501 ------
NM_005311chr762204 2099 1902 677 573 163 ------
NM_005313chr15----135 --
NM_005327chr41312 1704 ----
NM_005339chr441516 601 464 74 --13333 --
NM_005347chr921737 42 11363 ----
NM_005359chr1816148 --11465 14191
NM_005375chr61840 ------
NM_005381chr2----146 --
NM_005382chr82381 178 ----198
NM_005399chr163750 3451 1619 1512 1443 28 13499 14369 11638
NM_005400chr242773 372 57 21 --1300 --
NM_005402chr71330 ------
NM_005406chr1841468 1072 583 353 ------
NM_005433chr183954 879 284 ----12069
NM_005435chr71201 --1214 --
NM_005442chr33647 543 48 ------
NM_005453chr62473 123 ------
NM_005465chr1157 21587 683 ----
NM_005475chr1263174 3014 1298 1073 894 601 --22990 973 --
NM_005486chr172178 64 1570 ----
NM_005487chr2232013 249 75 ------
NM_005493chr61644 ------
NM_005497chr1733986 1385 69 --46116 5933 708 141 --
NM_005502chr931077 774 639 ------
NM_005504chr1246589 6042 5242 1735 26225 4025 ----
NM_005517chr151332 1094 456 258 247 --1274 1995
NM_005520chr51144 ------
NM_005523chr73512 204 187 21527 575 1157 --
NM_005524chr3197 ----162
NM_005529chr12880 244 --2803 26 --
NM_005539chr101514 1306 ----
NM_005544chr22952 288 180 ----
NM_005550chr161542 ------
NM_005573chr5------1572
NM_005578chr324757 3462 24499 3497 23637 227 --
NM_005581chr19----1388 --
NM_005584chr131227 ------
NM_005595chr11284 ----1891
NM_005596chr944782 4522 4201 4123 ----1941
NM_005603chr1861402 1241 478 184 69 61 ------
NM_005604chr612180 11591 2458 35 --
NM_005611chr162262 148 ------
NM_005613chr1--31898 402 40 ----
NM_005614chr711017 ------
NM_005652chr1641117 1039 813 179 ------
NM_005654chr51197 ----169
NM_005665chr113656 --11140 --
NM_005668chr511372 24339 4171 1483 --
NM_005707chr1531163 462 207 ------
NM_005721chr21866 ------
NM_005725chr122426 859 11897 ----
NM_005730chr1263521 2579 1064 977 322 42 1401 11003 --
NM_005731chr21106 ------
NM_005739chr1541942 1504 485 152 ------
NM_005746chr712468 ------
NM_005748chr1233453 3274 1296 --23438 3423 --
NM_005751chr7--1500 ----
NM_005754chr531105 1061 236 ------
NM_005756chrX1262 1358 11026 --
NM_005760chr21103 188 ----
NM_005765chrX1879 1204 ----
NM_005776chr142129 63 ------
NM_005789chr1722097 678 --126 --
NM_005813chr232017 622 500 1609 --1850
NM_005819chr143313 1033 313 157 22416 323 ----
NM_005822chr652408 2196 1841 1791 114 12386 ----
NM_005839chr1----1656 --
NM_005840chrX106822 5907 5852 2492 1787 1710 1359 1346 1301 1237 21927 953 1325 --
NM_005842chr131525 ----1544
NM_005851chr111377 ------
NM_005859chr511224 ------
NM_005862chr32930 243 ------
NM_005875chr3296 79 ------
NM_005895chr1243869 3559 1489 1287 11115 33625 3214 1274 --
NM_005898chr111250 ------
NM_005899chr1721388 1222 1590 ----
NM_005900chr42264 133 ------
NM_005903chr564503 3807 1621 1567 912 39 1640 ----
NM_005907chr621408 1053 ------
NM_005909chr543134 3041 1603 291 23841 780 ----
NM_005910chr1743279 2742 1023 992 23730 3328 --1171
NM_005911chr211197 ------
NM_005920chr163702 3583 3405 3040 264 192 --32988 976 80 --
NM_005923chr61704 1549 2216 203 --
NM_005933chr1132350 2207 437 --22239 553 --
NM_005934chr1992291 2185 1063 936 916 857 501 231 156 --52223 2042 1702 781 241 --
NM_005937chr1783877 3574 3453 3349 3073 1466 709 500 --14006 --
NM_005941chr823320 1430 ----13273
NM_005944chr341259 270 221 31 --1314 --
NM_005955chr122152 1847 11323 15315 --
NM_005962chr1031911 1468 593 ----1647
NM_005962chr1031911 1468 593 ----1647
NM_005964chr1721029 430 --196 1468
NM_005969chr11----1330 1114
NM_005977chr131651 ------
NM_005984chr22--172 ----
NM_006007chr943946 3658 3615 989 1925 --11055
NM_006010chr3----2173 95 1207
NM_006011chr1573723 2950 1449 424 364 292 21 22936 508 ----
NM_006023chr101166 ------
NM_006040chr162564 46 11154 2962 490 --
NM_006047chr2012695 ------
NM_006067chr161771 1956 2222 25 --
NM_006080chr71436 22258 1876 ----
NM_006090chr11270 ------
NM_006095chr433003 1497 777 --1403 --
NM_006096chr831252 1228 539 --131 --
NM_006107chr172542 350 ------
NM_006113chr131736 1708 1522 ------
NM_006122chr154829 653 482 124 2901 447 ----
NM_006134chr2111558 ------
NM_006135chr131176 560 44 ------
NM_006145chr192387 326 1174 1804 --
NM_006154chr1532517 2120 1910 ------
NM_006166chr1222304 262 12446 --12459
NM_006177chr1441011 735 695 49 ------
NM_006180chr951711 1526 528 191 132 ------
NM_006190chr22901 247 ------
NM_006191chr123867 180 65 --1948 --
NM_006196chr2--179 ----
NM_006197chr821489 301 ------
NM_006203chr544940 3863 817 328 ------
NM_006206chr4197 --1414 --
NM_006210chr19140 1173 ----
NM_006224chr1742313 2179 551 133 --22406 1963 --
NM_006226chr221386 437 --144 --
NM_006246chr1411120 --1207 1178
NM_006251chr522224 1163 --1425 --
NM_006257chr10--21015 749 ----
NM_006265chr81235 11229 ----
NM_006267chr211778 --1347 --
NM_006268chr1111026 ------
NM_006282chr2053575 1373 400 268 150 11592 1832 --
NM_006283chr844195 4010 1302 481 13930 1844 --
NM_006298chr653082 2884 2547 837 830 1657 ----
NM_006306chrX54865 4572 4338 1892 72 1434 14566 25129 3844
NM_006312chr123731 185 86 ------
NM_006315chr464451 4212 952 645 404 103 ------
NM_006320chr4----21117 411 --
NM_006325chr121230 ------
NM_006335chr11412 --1327 --
NM_006341chr11203 189 ----
NM_006350chr5--159 ----
NM_006353chr65514 494 375 257 248 140 ----
NM_006357chr21145 --187 --
NM_006359chrX22164 656 12462 ----
NM_006371chr334635 3709 23 45130 4654 2093 440 14763 --
NM_006377chr911173 --31163 1099 1011 --
NM_006380chr1723583 2751 ----141
NM_006382chr172251 54 --141 --
NM_006386chr22--125 12266 --
NM_006391chr111264 ------
NM_006393chr1023776 3655 24127 1541 ----
NM_006419chr41748 1592 1724 --
NM_006420chr2022221 1170 ------
NM_006421chr821207 836 ------
NM_006449chr242111 1979 1457 428 ----21894 733
NM_006457chr463977 3512 3497 3171 1407 797 ------
NM_006459chr102644 631 --176 --
NM_006460chr17137 ----11632
NM_006475chr131686 185 ----
NM_006482chr12--13322 13023 --
NM_006489chr14----11666 --
NM_006510chr64851 843 834 812 --1408 --
NM_006546chr17105458 4967 4808 4044 2314 2091 2016 1114 988 873 15979 --14084
NM_006547chr711740 ------
NM_006548chr311196 --1145 --
NM_006549chr1252490 1924 1809 454 180 21178 187 ----
NM_006559chr1----171 --
NM_006560chr11144 1369 ----
NM_006561chr1045731 5117 4885 4606 14073 26109 5738 --
NM_006565chr162445 403 11149 130 --
NM_006579chrX1257 ------
NM_006587chr41290 --11353 --
NM_006591chr1121597 1186 ------
NM_006595chr11--31438 309 51 ----
NM_006599chr1687727 7476 6377 5972 5862 5562 2892 1020 27791 36 ----
NM_006601chr122882 400 ------
NM_006602chr201141 1290 --1131
NM_006608chr1----122 --
NM_006609chr231970 1959 984 --12016 --
NM_006618chr121302 987 --1154 147
NM_006620chr634880 3564 1499 11461 ----
NM_006624chr1011710 ------
NM_006625chr1193 ------
NM_006625chr1193 ------
NM_006625chr1193 ------
NM_006629chr181517 22044 169 ----
NM_006633chr52619 26 ------
NM_006644chr131205 2437 63 ----
NM_006654chr1222929 298 ------
NM_006662chr162270 64 ------
NM_006695chr17------132
NM_006703chr61525 ------
NM_006711chr162202 105 ------
NM_006717chr932485 1255 1075 ------
NM_006722chr332586 2500 353 ------
NM_006726chr4--11096 ----
NM_006729chrX84954 4666 3901 1551 957 882 588 167 14797 14434 --
NM_006732chr1941877 728 637 122 11317 1175 --
NM_006750chr1637719 6952 641 67537 6856 6008 2411 1941 211 --16416
NM_006751chr22202 169 ------
NM_006754chr711152 ------
NM_006766chr8------1685
NM_006769chr1------1201
NM_006775chr623100 392 ------
NM_006777chrX22236 1783 1926 ----
NM_006783chr13141 --1263 --
NM_006790chr51156 ------
NM_006805chr52411 205 ----1250
NM_006813chr62729 655 --155 --
NM_006822chr171245 --1165 --
NM_006827chr1412249 1418 1188 --
NM_006852chr173939 498 372 11911 ----
NM_006856chr121963 --11128 --
NM_006873chr222746 94 23338 831 23061 726 --
NM_006874chr41463 ----125
NM_006885chr1631676 1207 783 ------
NM_006888chr1412334 --32286 719 259 1784
NM_006889chr331536 1126 460 --1131 1124
NM_006895chr221509 1421 --1153 --
NM_006920chr241954 1794 408 177 --178 --
NM_006922chr211789 ----177
NM_006924chr1754026 1741 1506 1461 1424 1494 11548 --
NM_006948chr2131743 354 283 ------
NM_006950chrX2891 166 1120 ----
NM_006981chr912786 ------
NM_006990chr121910 296 1966 1211 12541
NM_006997chr10124 --1367 --
NM_007005chr921184 1048 --21030 28 --
NM_007007chr1233882 3457 109 44643 4552 4541 3096 ----
NM_007011chr1566487 5654 5014 2146 1002 903 11579 15030 1974
NM_007013chr81704 ------
NM_007017chr51735 ------
NM_007023chr21847 ------
NM_007026chr172494 94 ------
NM_007030chr585110 4999 4402 3292 2068 1944 1733 1480 --21523 51 --
NM_007036chr5--1902 ----
NM_007038chr2133839 3710 42 ------
NM_007039chr1421654 216 --11720 --
NM_007050chr20106270 5990 3228 2589 2317 1502 369 291 153 82 33036 2798 115 26502 6371 --
NM_007054chr542743 2472 466 83 12982 ----
NM_007068chr223935 424 347 ------
NM_007107chr32942 926 11763 ----
NM_007111chr13--1595 ----
NM_007114chr3----169 --
NM_007126chr91144 ------
NM_007137chrX21699 752 --21995 1951 --
NM_007144chr17--21177 427 ----
NM_007145chr1931392 1320 397 11164 --11123
NM_007146chr1722745 2000 22368 2355 1839 --
NM_007166chr1111554 --1394 --
NM_007184chr31540 ------
NM_007197chr121861 ------
NM_007203chr92218 187 1550 22856 1036 --
NM_007207chr1165 ------
NM_007214chr6--1838 1907 --
NM_007238chr2094809 4753 4714 4264 4032 3799 1178 454 237 197 23504 364 13859
NM_007249chr1387331 6684 6677 6173 6161 1382 1051 1025 13356 27705 3287 --
NM_007255chr51576 ----1446
NM_007286chr551612 1433 831 572 442 --11729 --
NM_007292chr1744931 3291 1985 247 13579 ----
NM_007294chr17----1150 --
NM_007295chr17----1150 --
NM_007296chr17----1150 --
NM_007297chr17----1150 --
NM_007298chr17----1150 --
NM_007299chr17----1150 --
NM_007300chr17----1150 --
NM_007302chr17----1150 --
NM_007303chr17----1150 --
NM_007304chr17----1150 --
NM_007305chr17----1150 --
NM_007345chr182680 651 --21653 527 --
NM_007349chr7131 ----1298
NM_007350chr1233436 1170 39 13775 14278 --
NM_007358chr1--1556 ----
NM_007363chrX----192 --
NM_007371chr9151 ------
NM_012064chr1231171 994 936 ------
NM_012081chr512844 --13667 --
NM_012096chr312381 ----1717
NM_012098chr92591 126 11141 ----
NM_012102chr152606 2425 2061 791 61 --12053 11948
NM_012104chr112990 30 ----13600
NM_012104chr112990 30 ----13600
NM_012115chr61147 --122 --
NM_012137chr122193 56 --12259 --
NM_012141chr1333363 2853 271 ------
NM_012154chr8140 ------
NM_012156chr204801 718 612 78 12543 21340 1093 --
NM_012157chr31132 175 ----
NM_012164chr955437 5281 1926 1250 159 31805 1036 227 16161 --
NM_012166chr941204 528 341 79 ------
NM_012180chr4157 1511 --123
NM_012193chr1175249 5148 3689 3345 1771 1284 913 32049 2037 305 14324 --
NM_012199chr134070 1678 936 11431 ----
NM_012214chr296434 6241 5734 4517 4052 2405 2371 1646 1530 --14383 --
NM_012215chr1041634 1482 1268 115 1473 ----
NM_012218chr1932879 2502 757 23082 751 21924 195 22942 2002
NM_012234chr31672 11497 ----
NM_012243chr1----175 --
NM_012250chr1121133 222 ------
NM_012262chr12818 24 1832 ----
NM_012290chr221464 1380 ------
NM_012297chr431676 424 184 ------
NM_012300chr552216 2152 1701 876 179 ------
NM_012316chr175241 4436 3906 3766 1328 712 374 24884 3760 ----
NM_012329chr1711622 --1233 --
NM_012347chr61233 12742 ----
NM_012382chr523769 2912 24295 3995 ----
NM_012412chr71754 1777 ----
NM_012417chr172483 161 1570 ----
NM_012419chr6----1605 --
NM_012428chr1511014 ------
NM_012448chr1732473 849 375 ------
NM_012464chr431089 1037 840 1259 ----
NM_012465chr1032656 2360 367 1801 22246 883 --
NM_012470chr71496 1161 ----
NM_012471chrX2364 82 11401 11639 --
NM_012479chr7--1747 ----
NM_013231chr1453116 2740 787 402 42 ------
NM_013235chr5--1704 ----
NM_013238chr132593 542 --2421 42 --
NM_013242chr16142 ------
NM_013255chr7118706 8634 8199 7695 7162 5890 2267 1875 1753 1158 872 --58536 6965 5997 1562 906 --
NM_013261chr413277 ----12933
NM_013262chr6123 --11459 --
NM_013269chr1243890 807 428 351 --1415 --
NM_013277chr1211031 ------
NM_013279chr1162256 1574 629 541 437 217 --21686 576 --
NM_013281chr201978 ------
NM_013283chr51107 ------
NM_013293chr7188 ------
NM_013302chr1643264 1557 895 147 1191 --11621
NM_013309chr1512543 1244 22393 1816 --
NM_013313chr2252388 2355 1154 793 320 --13039 --
NM_013320chr121186 ------
NM_013348chr1971130 1009 892 413 290 232 69 11046 --11139
NM_013354chr8--1452 ----
NM_013355chr92285 120 ------
NM_013363chr31134 --1111 --
NM_013377chr121107 ------
NM_013397chr61691 --1722 --
NM_013399chr1631842 346 164 --122 --
NM_013411chr13599 453 127 22531 2088 1725 --
NM_013438chr921403 88 ------
NM_013444chrX1985 11125 ----
NM_013446chr721346 308 ------
NM_013449chr1252886 2701 2456 1979 465 --12800 --
NM_013951chr262319 2166 1971 1556 205 43 1394 12377 12132
NM_013952chr262396 2243 2048 1633 282 120 1471 12454 12209
NM_013953chr262396 2243 2048 1633 282 120 1471 12454 12209
NM_013958chr8--154 ----
NM_013959chr8--154 ----
NM_013961chr8--154 ----
NM_013962chr8--154 ----
NM_013989chr1474627 4479 3780 3774 3459 2063 1443 13970 13647 --
NM_013992chr262396 2243 2048 1633 282 120 1471 12454 12209
NM_014000chr102595 376 ----1281
NM_014010chr9135 1240 1505 --
NM_014016chr31452 2544 40 ----
NM_014034chr611310 ------
NM_014042chr11--134 ----
NM_014043chr31249 ------
NM_014109chr81471 ------
NM_014112chr854415 4361 4305 3623 1150 13438 ----
NM_014117chr161642 ------
NM_014155chr1156739 5993 5486 2320 1341 16586 ----
NM_014178chr14124 ------
NM_014181chr212579 ------
NM_014213chr2----2185 114 --
NM_014217chr1----145 --
NM_014223chr12662 618 ----1739
NM_014230chr17138 ------
NM_014243chr411567 11821 ----
NM_014250chr2232013 249 75 ------
NM_014253chrX11657 ------
NM_014263chr1011086 11496 ----
NM_014282chr93355 337 283 3904 327 85 ----
NM_014289chrX31064 1038 445 ------
NM_014293chr2283897 3572 3254 2978 2562 1179 788 49 11118 13791 --
NM_014299chr1941592 630 413 47 --12039 1103
NM_014305chr131254 ------
NM_014309chr2274595 4361 4116 3658 3287 1966 1597 ----14411
NM_014322chr1156 11009 --1423
NM_014331chr437513 2936 2602 36331 4785 1617 ----
NM_014332chrX152 1118 ----
NM_014333chr111431 1992 2847 422 --
NM_014338chr2221063 134 ------
NM_014360chr143628 622 584 --1640 --
NM_014382chr31453 ------
NM_014392chr441553 621 549 52 ------
NM_014405chr1731523 552 448 12327 1935 1765
NM_014408chr12507 91 ------
NM_014423chr535324 4869 3774 11449 24642 2128 --
NM_014431chr1031657 314 110 2678 607 1576 --
NM_014445chr3----12384 --
NM_014454chr62354 124 ------
NM_014470chr121745 ------
NM_014491chr71160 ------
NM_014494chr1632218 288 66 22125 1903 ----
NM_014515chr123939 863 29 ------
NM_014554chr1221953 525 --11824 1294
NM_014572chr1331597 1397 182 ------
NM_014574chr141481 11145 1364 1216
NM_014575chr31524 ------
NM_014577chr221701 ------
NM_014612chr92243 120 ------
NM_014613chr552949 2378 2193 427 294 --1639 --
NM_014614chr211502 ------
NM_014615chr1633049 2916 1455 2301 144 --1137
NM_014616chr322946 383 --1272 --
NM_014620chr12165 ------
NM_014629chr83969 928 49 11349 ----
NM_014636chr964174 3493 1054 647 199 121 127 --23784 3642
NM_014637chr821025 26 ------
NM_014647chr1641948 1912 1749 1474 1119 --11718
NM_014653chr1272003 1731 1662 1648 1545 323 59 --1262 1871
NM_014660chr731070 438 408 ------
NM_014661chr1073466 3330 1306 1203 1172 741 213 --12605 11019
NM_014662chr222461 344 ----170
NM_014665chr832649 1383 501 --33358 3199 861 1320
NM_014667chr3--1723 22300 1533 2794 312
NM_014682chr81181 12045 ----
NM_014683chr173655 260 248 ------
NM_014685chr162461 383 161 ----
NM_014701chr15--22850 2164 1895 21291 367
NM_014702chr633238 2936 2510 12157 ----
NM_014707chr722140 89 ------
NM_014711chr16--11314 166 --
NM_014721chr687489 5427 4620 1764 1372 691 308 210 1181 1536 --
NM_014729chr811585 ------
NM_014730chr1274832 4759 4180 3376 1740 748 226 1446 1317 --
NM_014730chr1274832 4759 4180 3376 1740 748 226 1446 1317 --
NM_014733chr51678 ----12116
NM_014735chrX1403 ----1755
NM_014743chr463144 2884 2612 2080 2061 1105 1393 --11986
NM_014747chr1125113 4928 4861 4617 4251 2096 1936 1164 1061 938 482 130 --11171 21151 1091
NM_014751chr841473 776 759 753 ------
NM_014752chr1121332 376 ------
NM_014755chr231509 1399 902 13690 13980 --
NM_014766chr751252 840 590 454 37 13565 2822 609 --
NM_014772chr1853328 1136 837 437 348 12358 22229 1127 --
NM_014774chr162927 2837 2710 2388 907 705 1680 ----
NM_014779chr31813 ------
NM_014795chr21469 ------
NM_014802chr12--1732 ----
NM_014803chr1031145 527 320 ------
NM_014810chr133399 2813 705 32343 2309 1327 ----
NM_014820chr321657 350 ------
NM_014826chr164328 4275 3687 1607 157 134 11709 11421 --
NM_014827chr141262 1184 315 50 11552 1156 --
NM_014828chr1421615 325 ------
NM_014830chr1223504 1425 33191 3065 969 13535 --
NM_014841chr6--159 --1292
NM_014850chr354372 4024 3525 663 576 11467 23959 3697 11943
NM_014870chr184627 3982 3391 3167 3095 1727 852 405 23043 1709 13535 --
NM_014872chr951996 1783 1745 1672 1637 ------
NM_014873chr153761 3669 1724 1173 677 ----13927
NM_014877chr1736943 6613 2476 --16156 175
NM_014897chr1763151 2807 903 594 335 95 13285 ----
NM_014901chr532115 1424 196 11681 ----
NM_014903chr1232356 1787 312 ------
NM_014904chr101252 31501 1027 809 ----
NM_014905chr232060 1563 516 1420 11372 --
NM_014909chr1483523 3375 3369 3086 2855 2688 1378 772 ------
NM_014912chr1013286 1828 ----
NM_014914chr22837 216 ----1432
NM_014917chr11374 2939 202 ----
NM_014921chr1972762 2251 1947 779 701 314 61 --11059 1158
NM_014925chr12----2807 171 --
NM_014926chr31834 ------
NM_014932chr321435 62 ------
NM_014935chr162959 2758 1471 1093 644 94 1345 ----
NM_014939chr18--11167 ----
NM_014941chr22------171
NM_014946chr222733 104 --12999 --
NM_014948chr2082487 2425 2302 2047 1975 1610 682 127 1933 1732 --
NM_014949chr13823 76 37 ------
NM_014950chr14--1221 ----
NM_014961chr421476 137 11440 ----
NM_014974chr1041809 1305 216 26 --21410 148 --
NM_014982chr1435211 4933 171 11855 ----
NM_014988chr411760 ------
NM_014989chr631944 1741 1667 ------
NM_014991chr443096 2954 461 399 --12614 --
NM_014996chr3--2812 136 1800 --
NM_014997chr73858 315 51 12009 ----
NM_015000chr121945 12496 ----
NM_015001chr14377 239 163 42 1107 ----
NM_015025chr252276 2017 1974 1672 481 1131 ----
NM_015035chr2066135 4885 1818 1151 1064 75 11677 16202 15022
NM_015039chr124145 1657 ------
NM_015042chr1544108 3010 1616 605 --24123 737 --
NM_015044chr1632916 2671 2133 ------
NM_015045chr101858 21487 501 ----
NM_015064chr1263333 3003 2646 892 743 149 33663 3514 506 12304 --
NM_015068chr731474 1382 776 1864 33198 1242 718 1944
NM_015071chr524029 111 55139 4566 2359 1507 60 ----
NM_015074chr133674 1343 88 23437 1860 24113 874 24189 797
NM_015076chr634472 3868 237 147 13560 1395
NM_015077chr17124637 4156 3839 3703 3376 3113 1612 1061 792 659 104 34 11507 21668 1043 24289 4227
NM_015079chr1553174 2789 2729 2226 103 12683 129 1929
NM_015082chr51823 --12008 --
NM_015090chr1136158 6125 5721 5677 5091 4075 3925 1779 1317 1210 805 652 458 25557 3864 1352 2954 851
NM_015092chr1634067 3812 1786 ------
NM_015100chr111762 --11987 --
NM_015107chrX52370 1872 654 160 130 ------
NM_015129chrX11095 ----130
NM_015137chr822152 961 1797 12121 --
NM_015138chr1552456 2132 1982 1765 233 1119 --12081
NM_015144chr1653425 3108 2511 1300 1006 1579 31163 966 406 --
NM_015149chr122210 321 --1893 --
NM_015158chr91833 --1768 --
NM_015170chr812146 ------
NM_015176chr1----1532 --
NM_015178chr842703 2513 1072 438 11051 12278 21986 1707
NM_015185chrX42948 2047 277 262 --1792 12351
NM_015187chr41325 ------
NM_015193chr861515 1148 430 136 83 64 ----1208
NM_015199chr322338 2310 12114 ----
NM_015200chr452240 1932 1027 922 72 150 ----
NM_015205chr1355212 3783 3658 1329 1124 21838 1503 34413 3931 1600 --
NM_015215chr112584 12246 ----
NM_015225chr933082 2627 2220 1451 ----
NM_015231chr112720 49 ------
NM_015236chr41977 1247 ----
NM_015242chr111559 --132 1489
NM_015252chr21770 ------
NM_015264chr2274695 4202 3563 1484 1273 742 138 1158 ----
NM_015265chr21306 ------
NM_015267chr1231972 1966 1488 1636 ----
NM_015270chr1231690 1638 839 --156 --
NM_015271chr434290 1006 870 13371 ----
NM_015272chr1632016 1480 216 ------
NM_015275chr1232059 1730 226 ------
NM_015284chr1----11904 21514 223
NM_015288chr543613 1432 808 214 1845 3736 281 202 1322
NM_015296chr132386 152 ----174
NM_015299chr1443711 1584 1283 1152 1304 13082 --
NM_015310chr837443 6004 2352 1662 33000 2796 2316 --
NM_015313chr11--41269 1147 353 75 ----
NM_015315chr522856 220 --12154 12386
NM_015326chr11317 --12568 188
NM_015328chr742732 2535 1904 936 22402 1943 21187 614 1351
NM_015335chr1251022 705 452 183 132 1552 ----
NM_015336chr1212708 ------
NM_015338chr2041447 1336 314 303 21656 1388 ----
NM_015339chr201944 --1692 --
NM_015344chr821892 1452 --134 --
NM_015349chr632421 2080 1095 --11224 --
NM_015355chr1721762 1514 ------
NM_015358chr211229 ------
NM_015374chr2241204 1122 1003 92 1189 1472 --
NM_015378chr132950 2444 1911 12824 23016 2142 --
NM_015387chr211888 ------
NM_015396chr331350 200 77 --1242 --
NM_015401chr125817 334 325 319 238 1395 ----
NM_015443chr1721095 296 --1418 --
NM_015446chr1--1203 ----
NM_015457chr111339 1122 184 --
NM_015458chr844892 4570 2097 1917 14177 ----
NM_015460chr342065 1688 1583 215 1179 ----
NM_015470chr211220 --1170 --
NM_015475chr23366 174 114 ------
NM_015481chr123944 825 416 --3410 402 65 --
NM_015484chr11809 ------
NM_015508chr331486 1021 390 ------
NM_015520chr352570 1874 481 441 407 --1166 --
NM_015526chr1961467 1075 548 265 212 89 1528 ----
NM_015531chr11153 --136 --
NM_015534chr11420 ------
NM_015541chr31142 ----1511
NM_015553chr644786 3147 1316 272 13173 23381 172 --
NM_015557chr183547 2940 2908 2729 2587 1057 464 291 13392 1772 --
NM_015564chr521363 642 23315 2308 ----
NM_015565chr2112042 --11790 --
NM_015568chr2053837 3240 2849 409 109 23818 3476 21321 42 13023
NM_015569chr114325 --34755 1916 541 --
NM_015575chr263370 3271 2754 2695 2504 691 13716 ----
NM_015576chr33960 916 423 ----11079
NM_015602chr11729 --1660 --
NM_015607chr1129 ------
NM_015609chr14864 690 291 92 --22945 1042 --
NM_015610chr762765 2594 1135 718 608 57 1489 12604 --
NM_015635chr932134 1607 186 --1334 --
NM_015640chr124971 4607 --11286 174
NM_015686chrX42317 2075 1917 1017 --176 11966
NM_015697chr4----1341 --
NM_015716chr171509 ------
NM_015719chr191121 1772 1521 --
NM_015844chr18129 1637 ----
NM_015846chr18129 1637 ----
NM_015847chr18129 1637 ----
NM_015855chr11--1213 1599 --
NM_015878chr811680 21423 426 ----
NM_015879chr18108181 6066 6044 5932 5556 2405 2338 2093 674 413 35835 5447 2313 22464 663 17752
NM_015904chr21107 ------
NM_015906chr133039 1279 1154 ------
NM_015926chr3265 53 ------
NM_015955chr21100 ------
NM_015981chr553010 2370 1177 1014 868 22883 2343 12314 --
NM_015986chr1731353 1208 131 1163 ----
NM_016003chr762765 2594 1135 718 608 57 1489 12604 --
NM_016025chr161303 1334 ----
NM_016040chr112021 12681 ----
NM_016045chr2011437 1575 ----
NM_016061chr231623 1557 1429 ------
NM_016072chr1221930 1637 ------
NM_016076chr152771 2573 2184 1952 1046 12859 1317 --
NM_016083chr633635 3596 1194 21248 697 ----
NM_016100chr201437 1119 ----
NM_016125chr171128 ------
NM_016144chr5192 ------
NM_016201chr34812 267 255 209 1896 123 --
NM_016203chr71733 ------
NM_016210chr32990 211 1169 2197 25 --
NM_016258chr12163 83 1106 ----
NM_016260chr227324 396 --21302 845 --
NM_016287chr131959 598 230 1461 --1135
NM_016322chr911967 1849 --1306
NM_016358chr52433 58 1451 1143 --
NM_016374chr1--11107 ----
NM_016374chr1--11107 ----
NM_016376chr1743359 2840 2716 462 2826 167 ----
NM_016382chr151037 993 881 386 314 ------
NM_016395chr15----1191 --
NM_016396chr151353 1879 ----
NM_016401chr11128 163 ----
NM_016410chr91199 ------
NM_016418chr2232923 993 340 1963 1333 12616
NM_016423chr141404 ------
NM_016424chr1732047 1855 686 ------
NM_016436chr2032701 1985 220 32422 580 115 2546 229 12043
NM_016451chr11------161
NM_016463chr5169 ------
NM_016507chr1743092 2057 956 30 ------
NM_016516chr21159 ------
NM_016526chr1132420 895 247 --32411 542 374 22253 239
NM_016529chr1321061 487 1455 1953 --
NM_016530chr1533288 2994 184 ----1154
NM_016531chr434184 1315 31 1561 --1952
NM_016544chr231032 521 31 12905 --11376
NM_016559chr3--1545 ----
NM_016577chr334450 652 587 13945 24070 2925 14222
NM_016592chr203520 332 40 ------
NM_016596chr125817 334 325 319 238 1395 ----
NM_016603chr511471 ----1734
NM_016604chr531117 824 74 2941 214 1982 --
NM_016620chr111254 ------
NM_016623chr81159 ------
NM_016631chr211343 ------
NM_016654chr152971 128 ------
NM_016734chr931642 788 651 --2185 156 --
NM_016823chr171881 ------
NM_016834chr1743279 2742 1023 992 23730 3328 --1171
NM_016835chr1743279 2742 1023 992 23730 3328 --1171
NM_016841chr1743279 2742 1023 992 23730 3328 --1171
NM_016929chr684484 3777 1573 1548 505 253 74 39 160 ----
NM_016931chr111288 ----127
NM_016936chr1631436 1429 664 --31751 1599 406 --
NM_017409chr121137 ------
NM_017413chrX22512 193 1487 --1405
NM_017415chr554092 3387 902 83 55 1772 11645 --
NM_017420chr1433513 2868 1458 1285 ----
NM_017443chr931182 1070 243 ------
NM_017447chr2111276 22750 1071 1208 --
NM_017450chr1751043 588 496 426 152 --1466 11357
NM_017452chr2021028 954 11468 ----
NM_017453chr2021028 954 11468 ----
NM_017454chr2021028 954 11468 ----
NM_017455chr1511014 ------
NM_017548chr341825 1385 589 444 --11668 1365
NM_017551chr102585 119 1823 11055 --
NM_017553chr1531173 1153 21 1338 ----
NM_017563chr332553 1371 54 35261 4472 346 ----
NM_017583chr1131502 1472 612 --11120 --
NM_017628chr475021 4570 3318 1892 999 619 495 24293 573 ----
NM_017629chr11286 196 11376 11355
NM_017633chr632948 2572 232 ------
NM_017634chr82557 547 ------
NM_017636chr191305 ------
NM_017637chr958943 7826 6406 2530 2184 --17352 --
NM_017641chr121475 ------
NM_017643chr1742504 2277 1182 826 ------
NM_017644chr333768 2021 1524 15039 --12090
NM_017649chr1041294 1213 447 243 2803 75 ----
NM_017650chr734702 4064 1022 24620 1386 ----
NM_017658chr1424403 3707 --13770 --
NM_017660chr1943425 3071 3033 456 13305 131 21370 817
NM_017661chr1511212 --1196 --
NM_017666chrX11932 ------
NM_017693chr1331355 1165 566 ------
NM_017700chr4122 ------
NM_017709chr173579 3549 2781 1090 844 416 51 --24205 2770 --
NM_017715chr74286 227 202 112 ------
NM_017736chr1652635 2272 728 267 42 ----22932 65
NM_017737chr11500 ------
NM_017740chr1631561 365 38 --1391 --
NM_017745chrX1150 ------
NM_017749chr112316 307 1798 1850 --
NM_017753chr91776 ------
NM_017754chr634544 3878 3171 23544 420 1565 --
NM_017770chr621862 574 11069 ----
NM_017778chr81157 ------
NM_017811chr953077 2946 2603 601 137 ------
NM_017812chr71138 ------
NM_017813chr834939 4342 1689 25385 1332 --15088
NM_017816chr4141 ------
NM_017848chrX53538 3280 3134 824 669 24468 4147 11681 1172
NM_017849chr283167 2830 2794 2717 2605 1223 966 141 --1535 11237
NM_017856chrX193 21349 395 11975 --
NM_017860chr11597 ------
NM_017864chr8--1167 ----
NM_017880chr22286 150 ------
NM_017902chr1055179 3889 3779 2276 2178 179 45437 3798 467 119 34323 582 194
NM_017915chr121390 ------
NM_017919chr932133 1916 304 14895 ----
NM_017938chrX2262 93 ------
NM_017944chr111481 ------
NM_017952chr264372 3924 3399 3390 1320 898 --23277 364 14330
NM_017966chr111114 ----11479
NM_017969chr2----153 --
NM_017982chr131223 203 25 31040 860 149 --1427
NM_017988chr121798 --1164 --
NM_018003chr15--11804 --12043
NM_018011chr131246 ------
NM_018015chrX1269 21007 953 11134 --
NM_018017chr10--22716 2278 ----
NM_018018chr121617 1114 ----
NM_018027chr1063162 2798 2171 2093 1278 465 12076 133 13085
NM_018060chr12359 272 ------
NM_018078chr4160 ------
NM_018079chr2------1470
NM_018084chr22248 215 ------
NM_018086chr2--21338 316 ----
NM_018092chr1611220 ------
NM_018107chr141311 --1193 --
NM_018111chr19169 ------
NM_018121chr1042322 2157 2081 1285 12102 ----
NM_018156chr132950 2444 1911 12824 23016 2142 --
NM_018159chrX31162 206 168 ----11360
NM_018182chr171691 --12172 --
NM_018184chr311777 ------
NM_018195chr113811 716 76 ------
NM_018200chr1522216 1828 22055 587 ----
NM_018201chr962015 1893 1722 876 698 59 11948 22100 1565 1360
NM_018243chr412844 1898 1218 --
NM_018247chr632247 434 165 ------
NM_018287chr10199 ----141
NM_018293chr311097 1184 ----
NM_018299chr843196 2960 518 325 ------
NM_018302chr4--1809 ----
NM_018325chr91583 ------
NM_018330chr101473 ------
NM_018332chr162939 148 ------
NM_018351chr1244380 4111 3768 3516 33738 1547 31 ----
NM_018362chr1113713 11084 ----
NM_018363chr101288 --1141 --
NM_018364chr113292 11056 ----
NM_018370chr121124 --11635 --
NM_018373chr1465706 5376 4137 2559 1915 250 24750 1556 ----
NM_018388chrX----11250 --
NM_018403chr373817 3710 3407 2715 2659 1017 341 13019 12591 --
NM_018416chr1222271 1049 32217 869 376 ----
NM_018433chr22216 69 --160 --
NM_018440chr81462 27583 6413 ----
NM_018445chr15------2539 148
NM_018452chr6_random12787 ------
NM_018464chr10199 ------
NM_018466chrX2669 654 ------
NM_018482chr821946 360 ------
NM_018509chr1721437 1324 11693 3649 154 47 1552
NM_018553chr1731624 1348 221 ------
NM_018557chr21486 ----1651
NM_018566chr111907 ----14670
NM_018593chr62208 30 ------
NM_018638chr12--23998 3862 ----
NM_018640chr1222793 2001 ------
NM_018660chr842843 2742 2471 121 ------
NM_018697chr762172 1529 932 717 299 198 1834 ----
NM_018710chr8--11227 --195
NM_018715chr151889 1490 786 731 131 126 ----
NM_018718chr721937 1925 1428 1919 --
NM_018834chr52967 250 ------
NM_018836chr121228 367 --165 --
NM_018840chr201311 ------
NM_018847chr921380 1249 1324 ----
NM_018898chr522345 1708 --1312 --
NM_018899chr522345 1708 --1312 --
NM_018900chr522345 1708 --1312 --
NM_018901chr522345 1708 --1312 --
NM_018902chr522345 1708 --1312 --
NM_018903chr522345 1708 --1312 --
NM_018904chr522345 1708 --1312 --
NM_018905chr522345 1708 --1312 --
NM_018906chr522345 1708 --1312 --
NM_018907chr522345 1708 --1312 --
NM_018908chr522345 1708 --1312 --
NM_018909chr522345 1708 --1312 --
NM_018910chr522345 1708 --1312 --
NM_018911chr522345 1708 --1312 --
NM_018945chr663414 3400 1272 818 758 116 ------
NM_018970chr722405 474 12379 ----
NM_018976chr121115 ------
NM_018979chr1231947 1842 441 --21817 916 --
NM_018994chr11453 ------
NM_019004chr712352 ------
NM_019006chr151153 ------
NM_019009chr1142451 857 611 86 1355 32421 204 125 --
NM_019022chr18------135
NM_019027chr462362 1779 1722 794 719 85 ------
NM_019050chr41579 ------
NM_019063chr2--11771 1763 --
NM_019071chr7159 ------
NM_019072chr543772 3090 1419 213 34175 4017 1283 ----
NM_019087chr541131 347 129 24 11479 --1417
NM_019091chr2----197 --
NM_019096chr631015 207 55 --1977 --
NM_019555chr31547 ------
NM_019556chrX121 ------
NM_019557chr12902 700 2327 172 ----
NM_019592chr92914 881 ------
NM_019593chr2023015 1989 1456 12087 --
NM_019600chr151101 --2675 140 --
NM_019604chr111257 ------
NM_019606chr71350 199 ----
NM_019613chr1741054 377 285 49 --1158 1314
NM_019845chr22208 123 ------
NM_019859chr1021107 174 --11392 --
NM_019860chr1021155 222 --11440 --
NM_019891chr121315 1142 194 ----
NM_020122chr275958 5688 5266 5149 4967 3765 1309 12149 ----
NM_020123chr1021160 967 ------
NM_020127chr141704 1549 682 90 --3314 128 121 --
NM_020130chr821189 380 2894 190 --1125
NM_020150chr1022159 231 ------
NM_020168chr1521288 74 ------
NM_020180chr182922 38 1164 ----
NM_020182chr2033533 2391 1109 23396 3376 12268 --
NM_020184chr252269 2244 2027 1669 748 ------
NM_020193chr111316 ------
NM_020214chr15--2227 202 ----
NM_020226chr4------1611
NM_020228chr111184 22227 1995 21570 386 --
NM_020239chr122323 2143 --2929 161 --
NM_020243chr221261 1639 ----
NM_020248chr171884 1755 694 679 292 214 59 12380 11771 --
NM_020310chr1792559 769 727 596 332 224 206 192 151 ------
NM_020336chr2042961 2837 1091 942 --21204 190 13454
NM_020341chr202616 274 ----11905
NM_020342chr221915 384 12215 --1231
NM_020348chr1032394 721 550 12346 --21873 953
NM_020362chr11715 2303 84 ----
NM_020383chr101287 ------
NM_020386chr32121 101 ------
NM_020416chr42852 348 --12600 1456
NM_020420chrY1223 11415 ----
NM_020423chr1----137 --
NM_020429chr732632 177 163 21090 483 ----
NM_020440chr11126 11132 32892 2485 1088 1884
NM_020443chr156455 2606 1986 1118 289 24395 4297 11932 15548
NM_020457chr163577 506 191 --2127 29 --
NM_020466chr621381 835 33577 1529 912 13625 --
NM_020474chr1821540 148 1629 ----
NM_020475chr8112390 2199 2097 2090 1594 823 781 659 641 532 348 --1107 --
NM_020476chr8112390 2199 2097 2090 1594 823 781 659 641 532 348 --1107 --
NM_020477chr8112390 2199 2097 2090 1594 823 781 659 641 532 348 --1107 --
NM_020478chr8112453 2262 2160 2153 1657 886 844 722 704 595 411 --1170 --
NM_020480chr8112390 2199 2097 2090 1594 823 781 659 641 532 348 --1107 --
NM_020482chr6--1772 ----
NM_020525chr12------1132
NM_020640chr31659 ----1808
NM_020644chr111781 ------
NM_020647chr81640 ------
NM_020655chr1641423 441 413 110 --21370 1330 --
NM_020666chr51952 ------
NM_020673chr2077415 6480 6442 5427 4730 1862 125 ------
NM_020703chr1----1104 --
NM_020711chr22465 120 --22394 1870 11939
NM_020718chr1675163 4773 1502 1009 892 752 419 1472 ----
NM_020727chr21--11451 ----
NM_020740chr171158 ------
NM_020749chr82202 25 ------
NM_020752chr1042764 2206 870 304 21107 782 ----
NM_020761chr1732042 1969 206 11775 2802 405 1697
NM_020768chr541198 734 666 515 2903 786 ----
NM_020772chr1788503 6709 6088 2794 2283 1673 756 200 12204 ----
NM_020773chr452668 2416 927 526 117 12433 11649 1653
NM_020778chr15134409 4121 3892 3870 1781 1600 1521 931 861 577 492 466 312 33831 3192 1810 31175 769 228 --
NM_020779chr242987 2370 2081 1159 12380 ----
NM_020791chr171552 ------
NM_020795chr1721527 71 --1140 11930
NM_020796chr532555 2036 208 1273 1740 --
NM_020801chr532430 526 409 --11969 --
NM_020803chr411494 1834 11502 --
NM_020804chr632426 2162 238 12537 22054 1884 12115
NM_020805chr181220 2497 413 ----
NM_020807chr16--21762 236 ----
NM_020808chr12276 161 ------
NM_020810chr1443305 3107 3096 994 11441 --13507
NM_020819chr6----1814 --
NM_020834chr1431633 496 384 1404 ----
NM_020839chr321125 100 11240 ----
NM_020841chr1211168 1920 ----
NM_020856chr1921551 611 ------
NM_020860chr45873 828 789 340 322 ------
NM_020870chr43650 201 129 --188 --
NM_020935chr234421 4116 3775 23975 1645 1937 --
NM_020940chr1032530 951 383 11908 ----
NM_020946chr951720 1472 1176 355 69 11550 1504 --
NM_020947chr1621941 1636 --140 --
NM_020951chr1921737 524 1120 ----
NM_020952chr91153 ------
NM_020956chr1994574 1601 1548 1379 1307 1044 1030 638 524 1230 13020 14549
NM_020975chr1051398 729 658 568 27 1685 ----
NM_020977chr41150 ----1847
NM_020981chr22255 170 ------
NM_020983chr1231690 1638 839 --156 --
NM_020993chr1272633 2164 1939 1123 693 400 83 --12523 2555 285
NM_021032chr321958 1632 11310 ----
NM_021072chr531630 683 353 ------
NM_021078chr17150 ------
NM_021096chr2272516 2349 989 783 588 386 318 43170 2410 2242 963 12784 --
NM_021097chr221930 725 ------
NM_021115chr222123 27 ------
NM_021116chr7106947 6515 5736 5480 3500 3243 2808 2743 2538 1519 3936 480 75 22255 2146 --
NM_021132chr101388 --122 --
NM_021136chr141692 --1705 --
NM_021140chrX----1183 --
NM_021155chr1962999 2113 998 983 383 225 1477 21126 914 --
NM_021159chr411485 21494 629 ----
NM_021180chr12746 526 ------
NM_021183chrX32374 1743 931 ------
NM_021188chr142514 117 ------
NM_021192chr21124 ------
NM_021202chr2052574 2280 2123 555 64 --21198 55 --
NM_021215chr201139 --12072 1838
NM_021224chr91356 ------
NM_021229chr1221206 864 ------
NM_021239chr142317 59 ------
NM_021240chr9------1702
NM_021242chrX1795 ------
NM_021252chr101679 1460 ----
NM_021253chr641377 1365 571 198 ------
NM_021255chr1423569 378 23687 2646 --23113 669
NM_021627chr32813 767 ------
NM_021629chr345005 3453 1330 792 21988 1188 ----
NM_021635chr621481 1452 1533 ----
NM_021637chrX1170 1459 --1281
NM_021638chr4103661 3187 1964 1579 1565 1510 896 503 449 382 3323 119 110 13145 --
NM_021639chr11817 ------
NM_021643chr221588 399 ----11526
NM_021648chr622602 933 ------
NM_021705chr61252 ----1604
NM_021809chr2062385 2026 1927 832 326 194 2467 31 ----
NM_021813chr645006 3638 1248 1154 35188 4158 1608 ----
NM_021831chr21329 189 ----
NM_021911chr562102 1845 1156 656 71 36 14657 ----
NM_021912chr1553926 3729 3047 1393 1255 130 ----
NM_021913chr1931833 1370 1340 21325 266 11814 --
NM_021914chr1422067 1562 ------
NM_021956chr61140 ------
NM_021960chr142594 1093 541 265 ----22055 76
NM_021961chr1176855 5906 5560 2953 2900 2274 2065 46413 6403 5021 2001 26432 5312 --
NM_021964chr386266 5322 2231 1970 1932 1631 1493 1102 34221 4012 620 ----
NM_021967chr511141 ------
NM_021977chr642476 814 785 693 --13458 --
NM_021988chr201282 ------
NM_022048chr1556305 6147 4517 1781 267 14481 54561 1583 1192 87 38 --
NM_022062chr113703 335 282 2746 587 21239 225 --
NM_022080chr2052699 2686 1044 335 178 ------
NM_022114chr144398 4122 1167 1085 13284 ----
NM_022130chr52161 66 1462 11432 --
NM_022143chr711099 ------
NM_022152chr231019 966 35 1364 ----
NM_022166chr1632466 2158 508 45618 2510 2297 2242 21371 610 24410 1919
NM_022336chr242206 498 311 55 ----12254
NM_022340chr363552 3363 2937 2404 1046 286 1462 ----
NM_022367chr13695 585 526 --1193 --
NM_022373chr7--140 ----
NM_022442chr201282 ------
NM_022465chr1222911 1146 1422 31167 1040 538 --
NM_022474chr142233 32 2663 414 ----
NM_022574chr752148 1994 1866 1764 81 1276 1785 --
NM_022648chr244196 1865 1242 96 --33388 1043 229 33578 1551 1521
NM_022650chr5131 ------
NM_022652chr122880 274 --1283 --
NM_022658chr121424 --2241 175 --
NM_022662chr2138 ------
NM_022719chr2223712 21 22957 1157 33104 2481 815 174
NM_022726chr631655 1195 265 ------
NM_022733chr11340 ------
NM_022735chr12198 164 ------
NM_022739chr171764 --1746 129
NM_022755chr972365 2232 2167 1805 411 364 294 --11667 --
NM_022758chr633037 2175 883 1554 1508 --
NM_022776chr321554 483 ------
NM_022780chr221416 1221 1529 195 --
NM_022781chr932462 1123 1088 11216 ----
NM_022818chr1621535 585 ------
NM_022841chr152983 523 --12283 --
NM_022842chr393219 2687 2660 2056 1333 678 552 315 158 11097 ----
NM_022843chr131220 ------
NM_022902chr51275 ------
NM_022903chr3----1100 184
NM_022912chr242675 1166 846 544 ------
NM_022913chr52215 131 ------
NM_022970chr1021125 281 --1940 --
NM_022978chr511141 ------
NM_023000chr14--11602 ----
NM_023001chr14--11602 ----
NM_023009chr11165 ------
NM_023010chrX1698 ----1297
NM_023012chr12239 30 ------
NM_023037chr131286 1212 ----
NM_023071chr122442 59 ------
NM_023074chr1931220 897 75 --11159 --
NM_023929chr822084 657 ------
NM_024007chr5143 3990 873 364 ----
NM_024034chr203744 379 55 ------
NM_024038chr19196 --135 --
NM_024076chr1962345 1841 1723 1521 616 65 12154 22295 477 --
NM_024294chr633037 2175 883 1554 1508 --
NM_024295chr811993 --12040 --
NM_024315chr7----132 --
NM_024424chr11170 ------
NM_024425chr11170 ------
NM_024426chr11170 ------
NM_024429chr71733 ------
NM_024491chr31634 ------
NM_024511chr422802 856 13554 1811 --
NM_024513chr342532 2360 204 150 1359 --32925 2893 1528
NM_024522chr15569 174 168 162 150 --3559 448 208 --
NM_024557chr114616 518 386 322 1417 ----
NM_024580chr15121 ------
NM_024582chr41840 ------
NM_024586chr11136 1207 ----
NM_024595chr121247 417 ------
NM_024621chr31159 1200 ----
NM_024624chr211137 --167 --
NM_024639chr662255 2130 2024 2007 860 265 ------
NM_024670chr101659 --181 --
NM_024702chr17--1235 ----
NM_024721chr81809 ------
NM_024740chr1133953 748 64 151 12535 --
NM_024744chr222292 40 ------
NM_024749chr11120 1795 --11560
NM_024759chr8----2744 233 --
NM_024761chr954645 4555 1459 406 135 ------
NM_024769chr111816 11143 154 --
NM_024770chr245757 4513 1759 395 36605 5315 4547 ----
NM_024771chr1171734 727 626 605 592 327 280 12489 41897 1789 1559 943 --
NM_024811chr114684 368 226 42 ------
NM_024828chr931138 472 119 ------
NM_024866chr2232997 2438 995 2614 569 11058 1812
NM_024877chr1941219 818 413 21 1347 184 1340
NM_024881chr19135 23412 1316 ----
NM_024885chrX4844 662 302 36 ------
NM_024887chr141477 1317 856 183 1718 --151
NM_024896chr952126 1712 1673 1562 444 --12421 --
NM_024906chr4--1989 --168
NM_024909chr621091 442 ------
NM_024911chr11186 ------
NM_024920chr43486 240 156 ------
NM_024922chr1661945 1820 1660 1427 1305 275 --21642 1478 --
NM_024930chr542674 2518 620 394 --12054 --
NM_024939chr1621582 395 ------
NM_024946chr1641708 1445 1120 1107 ------
NM_024947chr358988 8674 8266 7132 2836 17183 ----
NM_024949chr454616 4164 4102 3507 700 14644 --1279
NM_024953chr1242460 510 126 31 21945 1128 ----
NM_024971chr91153 ------
NM_024989chr285623 5395 5059 4965 2768 2004 1111 813 33282 1369 1336 1264 11460
NM_025073chr134350 3768 3080 14089 ----
NM_025074chr413033 1471 12871 --
NM_025083chr1531911 1370 1280 --21268 25 --
NM_025104chr1751800 1193 1102 537 250 --11228 --
NM_025133chr21755 ------
NM_025146chr332094 169 65 ------
NM_025151chr83642 99 69 140 ----
NM_025154chr741447 1007 600 380 ------
NM_025160chr144117 2874 523 25 31614 1491 713 13125 12735
NM_025176chr204547 118 72 23 ------
NM_025179chr174382 4003 3276 1937 1426 1415 1386 11493 1143 11866
NM_025182chr92934 848 1731 --1724
NM_025191chr132506 1253 1172 ------
NM_025195chr831709 603 536 2764 723 11802 --
NM_025201chr153726 385 152 ------
NM_025235chr10--21422 561 ----
NM_030594chr152918 249 ------
NM_030647chr752481 2348 1979 1629 751 --1521 --
NM_030648chr454894 4645 4255 1957 1444 ----14612
NM_030667chr1211050 --2817 193 --
NM_030668chr1211050 --2817 193 --
NM_030669chr1211050 --2817 193 --
NM_030751chr1031905 1849 101 ------
NM_030751chr1031905 1849 101 ------
NM_030753chr17147 ------
NM_030763chrX1573 ------
NM_030786chr11212 ------
NM_030806chr1169439 7217 6994 6907 6839 6812 6416 3728 3493 3306 2648 2284 2061 1970 1633 593 15763 23736 875 --
NM_030809chr1242350 1960 1822 821 11985 1629 --
NM_030881chr22--125 12266 --
NM_030884chr321787 1466 11504 2576 204 --
NM_030885chr331495 1468 736 --22321 706 12299
NM_030918chr185007 4176 4084 1917 1617 1471 1413 467 1149 14710 13720
NM_030937chr141205 944 249 131 21339 993 ----
NM_030940chr92360 58 ----1138
NM_031216chr18--12074 11634 --
NM_031231chr205516 259 127 108 92 ------
NM_031232chr205516 259 127 108 92 ------
NM_031289chr122968 154 --2942 403 --
NM_031314chr14----11477 --
NM_031369chr42740 79 ----1807
NM_031370chr42740 79 ----1807
NM_031371chr1--11107 ----
NM_031371chr1--11107 ----
NM_031372chr411518 ------
NM_031411chr522345 1708 --1312 --
NM_031412chr124921 432 88 37 ------
NM_031419chr31295 ------
NM_031422chr181495 ------
NM_031424chr203546 404 176 1104 ----
NM_031427chr1435197 4086 2331 21796 514 15349 --
NM_031442chrX------1396
NM_031459chr141320 1102 582 187 11282 21196 46 --
NM_031461chr821694 608 1398 ----
NM_031468chr776841 6419 3035 2985 2105 423 66 46978 2926 2737 462 36513 5779 2488 --
NM_031483chr2033304 708 566 1637 ----
NM_031492chr11----1411 --
NM_031844chr153776 2951 2684 1079 460 11608 ----
NM_031845chr233407 679 63 11467 13527 --
NM_031847chr233407 679 63 11467 13527 --
NM_031849chr522345 1708 --1312 --
NM_031857chr522345 1708 --1312 --
NM_031858chr1721388 1222 1590 ----
NM_031860chr522345 1708 --1312 --
NM_031862chr1721388 1222 1590 ----
NM_031866chr102397 158 --1286 --
NM_031899chr3----190 --
NM_031900chr51444 ------
NM_031935chr1--1908 1995 --
NM_031989chr12--188 ----
NM_032041chr842576 2126 1838 222 --1454 12405
NM_032042chr511123 1447 179 --
NM_032102chr1122787 38 12662 ----
NM_032121chrX22711 870 11755 11795 --
NM_032144chr221808 618 ------
NM_032145chr621741 1359 ------
NM_032146chr3----1127 1153
NM_032147chr12--1381 ----
NM_032153chr332722 1864 963 1872 1840 --
NM_032160chr1834352 2943 2687 11437 ----
NM_032181chr21322 1782 ----
NM_032182chr1011038 ------
NM_032186chr111254 ------
NM_032199chr1021182 213 13615 ----
NM_032221chr201706 ------
NM_032228chr1143215 1112 917 870 ------
NM_032231chr151125 ------
NM_032233chr14--1767 ----
NM_032236chr1--1682 ----
NM_032256chr121153 ------
NM_032268chr1653103 2448 2124 134 24 22010 595 --11130
NM_032281chr1952922 2870 2575 2405 646 12691 22854 2770 1372
NM_032288chr32255 35 ------
NM_032295chr75549 185 122 97 90 ------
NM_032315chr11224 ------
NM_032328chr1----184 --
NM_032353chr17--198 --1118
NM_032368chr12562 229 1414 1239 --
NM_032373chr1025881 703 13795 ----
NM_032434chr241627 1217 272 172 ------
NM_032438chr6--11339 21463 1174 --
NM_032440chr1011969 --1281 --
NM_032442chr171457 --153 --
NM_032457chr433092 768 231 11117 ----
NM_032458chrX1918 --11014 11117
NM_032486chr1631652 912 528 --22084 1939 12176
NM_032505chr342647 2274 902 414 ------
NM_032511chr61364 1189 ----
NM_032521chr2042478 2222 580 45 ------
NM_032523chr21143 1455 1422 --
NM_032538chr632577 1959 1066 2661 510 22188 1734 22171 337
NM_032539chrX2734 118 ------
NM_032547chr41157 21181 70 ----
NM_032550chr102784 25 ------
NM_032560chr141134 ------
NM_032578chr101154 2616 206 ----
NM_032582chr17149 11395 ----
NM_032622chr411202 1171 ----
NM_032636chr12515 60 287 28 1446 --
NM_032682chr31242 ----1426
NM_032728chr91796 --1894 1226
NM_032737chr1942615 1876 1009 591 --12503 --
NM_032780chr111882 ------
NM_032802chr15151 ------
NM_032837chr1721355 218 --11802 --
NM_032842chr72121 82 ------
NM_032859chr131184 --11019 1124
NM_032873chr1111672 1876 24182 208 --
NM_032876chr1432013 366 267 ----1481
NM_032892chr151245 ------
NM_032900chr1053251 1527 1009 502 87 1317 ----
NM_032905chr1021187 109 1517 1121 --
NM_032918chr1221059 98 ------
NM_032924chr71918 --1334 --
NM_032936chr7----1158 --
NM_032947chr531064 278 163 ------
NM_032949chr131484 ------
NM_032968chrX14084 ------
NM_032969chrX14084 ------
NM_032973chrY14076 ------
NM_032975chr1822918 282 23273 670 12508 --
NM_032980chr1822918 282 23273 670 12508 --
NM_032999chr71775 ------
NM_033000chr71775 ------
NM_033001chr71775 ------
NM_033020chr133039 1279 1154 ------
NM_033081chr2021389 111 ------
NM_033089chr201183 ------
NM_033132chr1321781 242 ------
NM_033138chr721870 1554 ------
NM_033139chr721870 1554 ------
NM_033140chr721870 1554 ------
NM_033150chr121142 --182 --
NM_033157chr721870 1554 ------
NM_033161chr9166 ------
NM_033181chr633635 3596 1194 21248 697 ----
NM_033201chr1621026 377 ------
NM_033211chr52841 84 ------
NM_033222chr9--1981 ----
NM_033224chr766687 6588 5697 5599 5346 730 15078 27078 5493 --
NM_033225chr842606 1955 358 61 12266 ----
NM_033271chr141317 --1395 --
NM_033274chr582996 2977 2567 1368 1137 735 728 293 ------
NM_033281chr5--1603 2329 58 --
NM_033285chr842962 1708 1218 526 1879 --13309
NM_033290chrX52344 1309 824 151 136 23542 2891 --12823
NM_033331chr932908 2602 2526 33181 705 36 12294 --
NM_033360chr121817 12905 11672 --
NM_033387chr972656 2112 2089 912 576 345 294 1829 ----
NM_033389chr1784616 4583 4232 4003 3804 1430 1364 485 11613 ----
NM_033407chr1------1423
NM_033421chr2031265 1221 1207 --1333 1600
NM_033429chr1532141 910 828 --32123 2109 359 --
NM_033430chr454087 4044 2980 1542 934 ------
NM_033437chr454087 4044 2980 1542 934 ------
NM_033480chr61233 12742 ----
NM_033481chr61233 12742 ----
NM_033503chr1573491 3451 3273 2927 589 400 270 12597 33406 2906 598 --
NM_033505chr226627 2235 35831 5285 2423 --12323
NM_033515chr62127 88 --136 --
NM_033551chr522856 220 --12154 12386
NM_033626chrX1687 1587 2447 414 --
NM_033631chr163266 2380 1085 607 449 339 2819 808 13817 --
NM_033644chr552216 2152 1701 876 179 ------
NM_033645chr552216 2152 1701 876 179 ------
NM_033655chr9--11071 1112 --
NM_033656chr2144254 4098 1299 1126 ------
NM_044472chr12466 202 ------
NM_052855chr172518 480 ------
NM_052879chr1231192 1127 823 ----1201
NM_052885chr1231085 628 395 3293 121 69 --1575
NM_052897chr121337 ------
NM_052900chr831137 413 101 ------
NM_052906chr22105059 4871 4858 1984 1933 1833 1420 1128 962 703 14514 43609 1220 1068 282 --
NM_052907chr1223057 123 24257 1613 ----
NM_052910chr1331573 494 424 --1553 --
NM_052911chr18------1906
NM_052918chr1023198 303 11445 ----
NM_052925chr19281 61 ------
NM_052934chr131866 1676 336 1654 2487 52 --
NM_053002chr3--1899 ----
NM_053016chr937151 6862 5930 47951 5311 1282 663 24876 281 --
NM_053023chr1172836 1304 847 754 702 433 300 ------
NM_053024chr321244 443 ------
NM_053025chr331337 648 569 1434 ----
NM_053026chr331337 648 569 1434 ----
NM_053027chr331337 648 569 1434 ----
NM_053028chr331337 648 569 1434 ----
NM_053031chr331337 648 569 1434 ----
NM_053032chr331337 648 569 1434 ----
NM_053043chr765485 5318 4830 4048 2387 1370 34013 314 160 --12166
NM_053056chr1121978 1130 12683 12554 --
NM_053067chr9188 ------
NM_053281chrX--145 ----
NM_054016chr121565 758 ------
NM_054016chr121565 758 ------
NM_054016chr121565 758 ------
NM_054035chr173171 58 22 1359 1590 1749
NM_054111chr6124 1186 ----
NM_057157chr102425 215 ------
NM_057159chr931552 1299 268 1638 ----
NM_057175chr41412 ------
NM_057178chr1761803 1772 1090 712 687 58 ------
NM_057749chr821030 213 ------
NM_058191chr212871 661 ------
NM_058237chr142433 188 ------
NM_058241chr211484 ------
NM_058241chr211484 ------
NM_078469chr101454 1496 ----
NM_078625chr631044 339 208 ------
NM_080391chr11110 ------
NM_080415chr174694 608 206 33 1325 --1225
NM_080552chr201173 ------
NM_080594chr162202 105 ------
NM_080617chr202132 123 1382 --1209
NM_080629chr11237 2540 459 ----
NM_080630chr11237 2540 459 ----
NM_080632chrX1698 ----1297
NM_080645chr61164 ------
NM_080669chr1784677 4014 3682 3624 3175 1675 1316 983 11278 11310 --
NM_080672chr201533 ------
NM_080723chr651346 1114 1097 995 138 11021 ----
NM_080738chr12557 282 ------
NM_080759chr1352189 1942 1867 484 385 ------
NM_080760chr1352189 1942 1867 484 385 ------
NM_080836chr2064483 3851 3366 1302 736 46 1263 1573 --
NM_080867chr1434453 3993 3300 11043 13379 --
NM_080874chr431364 619 584 ------
NM_130391chr922286 267 --1409 --
NM_130392chr922286 267 --1409 --
NM_130393chr922286 267 --1409 --
NM_130436chr2142653 2550 1034 850 --12476 --
NM_130438chr2143230 3127 360 276 --13053 --
NM_130439chr1031911 1468 593 ----1647
NM_130439chr1031911 1468 593 ----1647
NM_130463chr62204 22 1290 ----
NM_130797chr721421 1118 1347 --11342
NM_130811chr2031220 959 744 ------
NM_133170chr20106270 5990 3228 2589 2317 1502 369 291 153 82 33036 2798 115 26502 6371 --
NM_133264chr1741433 1132 1081 437 33567 194 132 11406 11443
NM_133265chrX3837 642 125 11262 12698 --
NM_133370chr433606 1128 724 ------
NM_133372chr53753 187 100 --12324 --
NM_133433chr51762 ------
NM_133445chr923286 3159 1614 13538 --
NM_133452chr1931136 480 420 ------
NM_133468chr731980 1897 25 ------
NM_133478chr222354 999 1149 ----
NM_133496chr133893 248 203 --13123 --
NM_133499chrX2961 236 1190 ----
NM_133646chr231740 1094 275 45589 5086 4373 4059 12191 --
NM_134325chr121401 1211 1189 122 --
NM_138270chrX2882 424 --1521 --
NM_138282chr62204 22 1290 ----
NM_138328chr1783294 3174 2588 2280 2259 2136 739 117 13405 23063 2423 1494
NM_138338chr2263205 2546 2423 2106 321 265 11087 1985 --
NM_138357chr10--21446 367 ----
NM_138369chr5151 ------
NM_138373chr1931749 559 306 11347 ----
NM_138415chr2241496 1297 1274 765 --11334 --
NM_138426chr742047 1875 1823 40 ------
NM_138459chr622672 59 ------
NM_138473chr1255111 4683 4546 4228 1141 14921 1330 --
NM_138479chr151701 1508 1500 277 38 11979 1195 --
NM_138492chr53434 422 209 11513 ----
NM_138555chr151390 ------
NM_138638chr1422067 1562 ------
NM_138713chr1687727 7476 6377 5972 5862 5562 2892 1020 27791 36 ----
NM_138714chr1687727 7476 6377 5972 5862 5562 2892 1020 27791 36 ----
NM_138730chr6------1127
NM_138731chr1411605 23608 1551 --14024
NM_138766chr5152 ------
NM_138771chr72331 138 ------
NM_138775chr111282 --1562 --
NM_138821chr5152 ------
NM_138822chr5152 ------
NM_138931chr31909 1408 ----
NM_138971chr112990 30 ----13600
NM_138971chr112990 30 ----13600
NM_138972chr112990 30 ----13600
NM_138972chr112990 30 ----13600
NM_138973chr112990 30 ----13600
NM_138973chr112990 30 ----13600
NM_139012chr641872 1678 1541 1470 --11889 12115
NM_139014chr641952 1758 1621 1550 --11969 12195
NM_139015chr1231761 571 448 --11698 --
NM_139062chr171359 1417 136 --
NM_139078chr121139 --1360 --
NM_139136chr122984 123 ------
NM_139167chr81139 ------
NM_139168chr521246 517 ------
NM_139169chr101262 ------
NM_139181chr111559 --132 1489
NM_139242chr152396 79 ------
NM_139244chr61622 ------
NM_139286chr9--1204 ----
NM_139312chr1011086 11496 ----
NM_139315chr7----127 --
NM_139321chr2063983 2706 1331 1302 1236 1109 13715 13096 --
NM_144571chr415186 11109 --1476
NM_144578chr1424563 978 ------
NM_144582chr282519 2446 2382 2217 995 733 552 158 --21765 574 --
NM_144590chr1032754 2691 50 12073 ----
NM_144595chr13--11000 ----
NM_144599chr1555013 3970 696 538 330 14820 25109 3657 14906
NM_144600chr1621468 313 ------
NM_144617chr197876 715 691 615 127 70 46 ------
NM_144641chr341075 437 394 122 ------
NM_144660chr101268 ------
NM_144667chr123743 167 101 --11081 --
NM_144671chr1251839 1516 1510 760 172 --31396 659 631 --
NM_144728chr1165 ------
NM_144729chr1165 ------
NM_144736chr2--1757 ----
NM_144778chr13--1824 ----
NM_144963chr821977 1662 --1690 --
NM_144973chr1223418 67 34849 1892 1581 12070 --
NM_145000chr51570 ----1218
NM_145014chr11------1119
NM_145055chr1843606 3255 591 119 11305 ----
NM_145056chr193799 645 160 --2611 23 --
NM_145071chr3169 1989 ----
NM_145112chr14199 11242 1226 --
NM_145113chr142371 202 11514 1498 1210
NM_145117chr1162851 2616 2425 2393 2275 81 12463 ----
NM_145165chr142660 646 12113 1319 11122
NM_145176chr623115 80 --22869 2760 --
NM_145203chr131155 ------
NM_145234chrX----1850 --
NM_145251chr141275 --1171 --
NM_145253chr161497 --1629 1135
NM_145259chr246447 5748 2564 469 1183 ----
NM_145290chr41101 ------
NM_145307chr1012996 --11474 --
NM_145331chr6--1765 ----
NM_145332chr6--1913 ----
NM_145333chr6--1913 ----
NM_145349chr1731625 868 467 --1114 1339
NM_145351chr1742117 1790 959 222 --1606 1831
NM_145693chr242610 1615 919 882 11718 ----
NM_145714chr161372 ------
NM_145715chr4------185
NM_145739chr21143 1455 1422 --
NM_145753chr31547 11137 ----
NM_145805chr152606 242 --2401 213 --
NM_145808chr7137 --1217 --
NM_145861chr12557 282 ------
NM_146388chr1941018 972 354 193 11235 1805 --
NM_147150chr92218 187 1550 22856 1036 --
NM_147166chr71619 ------
NM_147171chr7--1500 ----
NM_147185chr7--1500 ----
NM_147190chr12136 ----122
NM_147223chr231886 1757 1502 22078 1765 ----
NM_147233chr221703 1574 21895 1582 ----
NM_148174chr811680 21423 426 ----
NM_148414chr161455 ------
NM_148415chr161395 ------
NM_148416chr161372 ------
NM_148571chr1742030 2018 364 79 11436 ----
NM_148898chr71160 ------
NM_148899chr71160 ------
NM_148904chr11136 1207 ----
NM_148905chr11136 1207 ----
NM_148906chr11136 1207 ----
NM_148907chr11136 1207 ----
NM_148908chr11136 1207 ----
NM_148909chr11136 1207 ----
NM_148955chr1542197 1718 1374 105 25536 5436 25129 5101 --
NM_152221chr2231223 510 198 ------
NM_152237chr2231485 1122 520 --11197 --
NM_152253chr2244268 4239 1703 991 24060 1481 21083 547 --
NM_152265chr121260 249 ------
NM_152280chr123209 1099 --12943 184
NM_152284chr8190 ------
NM_152298chr13730 546 72 ------
NM_152344chr1721237 220 --122 --
NM_152345chr175805 726 266 245 158 1902 ----
NM_152347chr173537 161 67 ------
NM_152349chr172530 508 ------
NM_152373chr12543 115 ------
NM_152388chr232793 2670 1201 23954 3140 1751 --
NM_152390chr22184 38 ------
NM_152398chr4129 ------
NM_152409chr511168 23480 2786 ----
NM_152410chr6288 21 ------
NM_152414chr81161 --11116 --
NM_152424chrX34374 2922 727 13392 24095 1253 --
NM_152450chr1511366 1450 11797 --
NM_152462chr171144 ----1304
NM_152470chr1883464 3219 2791 2605 1479 1354 962 907 --1892 --
NM_152499chr12363 285 ------
NM_152519chr221860 1814 ----12045
NM_152520chr22995 63 --11177 --
NM_152529chr244002 3996 3517 2711 23330 622 1291 --
NM_152536chr32103 22 11008 11184 --
NM_152538chr32511 223 ------
NM_152542chr42441 296 --11613 --
NM_152594chr151332 ------
NM_152613chr22--11227 ----
NM_152622chr512788 13315 11012 --
NM_152624chr556912 6113 4758 1760 1426 15093 ----
NM_152641chr1222522 31 ------
NM_152653chr31567 ------
NM_152666chr1157 ------
NM_152667chr2021292 1153 ------
NM_152671chr21171 ------
NM_152682chr4--11270 ----
NM_152686chr521505 600 31883 197 65 1249 12366
NM_152715chr112274 39 ------
NM_152716chr111130 11436 1361 --
NM_152733chr676198 6106 4721 1774 1714 1115 35 26327 3932 1997 12426
NM_152742chr71114 1451 ----
NM_152745chr72739 302 ------
NM_152754chr723564 2668 13573 ----
NM_152756chr533702 1352 600 --1799 --
NM_152758chr842591 309 138 49 ------
NM_152763chr1125 --1179 --
NM_152787chrX43954 1205 440 244 ----175
NM_152789chr7--1370 122 --
NM_152826chr1542197 1718 1374 105 25536 5436 25129 5101 --
NM_152838chr2012695 ------
NM_152862chr21106 ------
NM_152914chr1733934 1374 1293 34336 3070 1388 21030 38 1313
NM_152924chr1566487 5654 5014 2146 1002 903 11579 15030 1974
NM_152991chr111525 1714 ----
NM_153013chr561848 1009 892 785 152 117 12390 ----
NM_153020chr621660 1589 ------
NM_153029chr1693853 3475 3190 3053 3023 2866 2591 1366 779 11609 ----
NM_153047chr61125 ------
NM_153048chr61125 ------
NM_153186chr91833 --1768 --
NM_153207chr1233050 691 184 1828 ----
NM_153223chr511540 131 ----
NM_153235chr61332 ------
NM_153260chr1561365 1317 1190 1170 532 163 ------
NM_153261chr163512 388 27 --179 --
NM_153262chr152018 1280 1115 852 821 ------
NM_153347chr1142493 2098 1791 267 1353 22602 2242 21916 992
NM_153354chr5--1335 ----
NM_153362chr64761 331 320 96 ------
NM_153365chr422429 860 ------
NM_153374chr15----195 --
NM_153450chr113865 720 72 --2601 24 187
NM_153453chr61116 1110 ----
NM_153607chr512687 23198 2520 12858 --
NM_153619chr1522645 886 2642 147 ----
NM_153633chr12165 ------
NM_153649chr132130 485 49 1544 ----
NM_153685chr1241134 334 209 113 --3999 777 106 1859
NM_153686chr422059 932 --11689 12280
NM_153689chr211596 11554 --1755
NM_153748chr122984 123 ------
NM_153756chr131943 1907 1539 11888 --1584
NM_153757chr421181 78 ------
NM_153827chr171509 ------
NM_170606chr71545 1605 11354 --
NM_170663chr171509 ------
NM_170674chr1521122 555 --1967 --
NM_170675chr152798 231 ------
NM_170676chr152798 231 ------
NM_170677chr1521122 555 --1967 --
NM_170692chr11173 11083 ----
NM_170706chr124145 1657 ------
NM_170720chr1971130 1009 892 413 290 232 69 11046 --11139
NM_170731chr1112665 ------
NM_170732chr1112665 ------
NM_170733chr1112665 ------
NM_170734chr1112665 ------
NM_170735chr1112665 ------
NM_170750chrX1284 ------
NM_171825chr553010 2370 1177 1014 868 22883 2343 12314 --
NM_171998chrX12066 --1135 --
NM_172016chr641377 1365 571 198 ------
NM_172037chr8192 --11069 --
NM_172069chr231940 854 675 1360 ----
NM_172070chr231751 895 826 ------
NM_172071chr157366 6327 5432 4523 1725 ------
NM_172159chr32724 132 ------
NM_172160chr32724 132 ------
NM_172164chr13730 546 72 ------
NM_172169chr1021610 407 21485 30 ----
NM_172170chr1021610 407 21485 30 ----
NM_172171chr1021610 407 21485 30 ----
NM_172173chr1021610 407 21485 30 ----
NM_172208chr63995 875 807 --11165 --
NM_172216chr1252490 1924 1809 454 180 21178 187 ----
NM_172315chr1521122 555 --1967 --
NM_172316chr1521122 555 --1967 --
NM_172373chr1331092 981 411 ------
NM_173078chrX165 ------
NM_173082chr61606 11351 ----
NM_173156chr122053 809 2687 33 12067 --
NM_173198chr912786 ------
NM_173199chr9----1179 --
NM_173200chr912786 ------
NM_173214chr1687727 7476 6377 5972 5862 5562 2892 1020 27791 36 ----
NM_173354chr21135 21805 685 2701 638 --
NM_173359chr331666 1486 147 11807 ----
NM_173454chr154912 881 819 465 --1316 --
NM_173468chr432432 1250 1041 11978 ----
NM_173470chrX12458 --1441 --
NM_173491chr5199 1412 ----
NM_173495chrX12440 --11849 --
NM_173503chr171122 ------
NM_173510chr2232323 83 64 1170 1142 --
NM_173532chr11151 --1221 --
NM_173552chr3----1572 --
NM_173560chr6177 1520 ----
NM_173576chr102629 92 ------
NM_173595chr1244937 668 331 273 44028 3807 3554 290 23924 345 --
NM_173607chr1431677 630 83 ------
NM_173609chr151206 1598 1233 --
NM_173633chr192233 55 --165 --
NM_173642chr188063 6468 5574 2956 2405 2245 816 283 35602 3464 607 38754 6557 834 --
NM_173667chr532248 2215 1617 --1215 --
NM_173670chr51280 1973 ----
NM_173698chrX42054 544 384 67 ------
NM_173794chrX129 ------
NM_173807chr1142 ------
NM_173808chr123914 33 13883 12737 --
NM_173814chr15287 34 ------
NM_173822chr221813 1779 --2681 496 --
NM_173825chr353094 2964 2751 2145 970 22079 2004 12301 12520
NM_173832chr8103350 2835 1523 1083 728 373 292 245 66 21 12769 32520 1516 473 --
NM_173851chr853580 2683 1576 1273 454 11524 11044 --
NM_173854chr132124 1948 373 ----1109
NM_174890chr10136 190 ----
NM_174911chr843514 2601 719 280 --2535 115 --
NM_175056chr31255 ------
NM_175061chr721617 763 ------
NM_175607chr3121 11101 --11474
NM_175612chr3121 11101 --11474
NM_175634chr811301 ------
NM_175635chr811301 ------
NM_175636chr811301 ------
NM_175709chr2222173 1184 12936 21966 55 --
NM_175736chr12167742 6737 6462 6379 6047 5807 5713 5637 4942 4770 2518 2505 1326 1042 853 80 56097 5273 5236 1829 223 15706 --
NM_175747chr64387 364 223 113 1157 1890 --
NM_175748chr1432118 1524 222 1172 11624 --
NM_175767chr531863 642 36 ------
NM_175861chr1255427 5145 4533 1988 169 ------
NM_175862chr331536 1126 460 --1131 1124
NM_175884chr7------2561 341
NM_175907chr1852771 2376 757 578 378 --12666 --
NM_175921chr534103 3651 1591 1491 24054 895 12720
NM_176081chr1034550 2312 1245 25027 1205 ----
NM_176083chr1034550 2312 1245 25027 1205 ----
NM_176814chr71980 ------
NM_176863chr1722097 678 --126 --
NM_176871chr843270 3079 3012 2742 13103 23050 2490 1698
NM_176891chr9----121 --
NM_176895chr51109 ------
NM_177454chr21299 ------
NM_177559chr202974 358 --1224 --
NM_177560chr202974 358 --1224 --
NM_177968chr212167 --1102 --
NM_177976chr3----1127 1153
NM_177990chr202616 274 ----11905
NM_177996chr204801 718 612 78 12543 21340 1093 --
NM_178011chr1033273 2529 1314 1510 --185
NM_178037chr1263333 3003 2646 892 743 149 33663 3514 506 12304 --
NM_178038chr1263333 3003 2646 892 743 149 33663 3514 506 12304 --
NM_178135chr431420 1224 557 ------
NM_178151chrX57332 4802 2952 997 781 12164 --27701 768
NM_178152chrX57332 4802 2952 997 781 12164 --27701 768
NM_178153chrX57332 4802 2952 997 781 12164 --27701 768
NM_178423chr73913 191 171 ------
NM_178424chr51472 ------
NM_178425chr73913 191 171 ------
NM_178450chr51475 ------
NM_178509chr1743273 950 136 130 2792 694 ----
NM_178554chr333280 1034 61 11310 11208 13069
NM_178585chr443096 2954 461 399 --12614 --
NM_178586chr1431916 178 50 12414 22139 1595 1668
NM_178812chr81339 ------
NM_178864chr114615 199 121 91 --1468 --
NM_181093chr1----137 --
NM_181349chr732632 177 163 21090 483 ----
NM_181351chr1142394 2185 662 594 --11093 --
NM_181442chr201944 --1692 --
NM_181457chr21393 ------
NM_181459chr22468 292 ------
NM_181460chr22515 339 ------
NM_181481chr18126421 2760 2660 2536 2379 2368 2167 1794 1415 1196 1114 145 36261 2425 1787 ----
NM_181482chr18126421 2760 2660 2536 2379 2368 2167 1794 1415 1196 1114 145 36261 2425 1787 ----
NM_181483chr18126421 2760 2660 2536 2379 2368 2167 1794 1415 1196 1114 145 36261 2425 1787 ----
NM_181504chr532625 1207 682 --2381 68 --
NM_181521chr1686616 6464 6311 5505 2267 2212 555 281 ------
NM_181523chr532625 1207 682 --2381 68 --
NM_181524chr532625 1207 682 --2381 68 --
NM_181527chr201437 1119 ----
NM_181528chr201492 1174 ----
NM_181552chr7--1728 1748 --
NM_181671chr171794 1881 --1613
NM_181672chrX1513 1330 ----
NM_181673chrX1513 1330 ----
NM_181698chr102538 417 ------
NM_181702chr81233 ------
NM_181705chr544565 4551 3712 1707 13552 ----
NM_181782chr622326 1578 --11994 --
NM_181784chr241622 426 266 175 ------
NM_181828chr2232923 993 340 1963 1333 12616
NM_181829chr2232923 993 340 1963 1333 12616
NM_181830chr2232923 993 340 1963 1333 12616
NM_181832chr2232938 1008 355 1978 1348 12631
NM_181836chr51301 ------
NM_181869chr1222357 1043 126 12548 12792
NM_181876chr42852 348 --12600 1456
NM_182485chr4--1897 ----
NM_182503chr641312 473 318 216 14242 ----
NM_182507chr1261987 1550 383 359 320 52 --1550 --
NM_182509chr141326 --21665 601 21623 1152
NM_182511chr1821057 536 1369 151 --
NM_182641chr172684 509 ------
NM_182645chr61116 1110 ----
NM_182646chr4--1897 ----
NM_182678chr21145 --187 --
NM_182689chr1----1288 --
NM_182690chr1131 --1350 --
NM_182691chr72526 69 11190 ----
NM_182692chr72526 69 11190 ----
NM_182700chr7------175
NM_182715chr711152 ------
NM_182758chr1553447 3376 2917 2829 1438 12772 ----
NM_182763chr142583 1082 530 254 ----22044 65
NM_182765chr101708 ------
NM_182796chr51107 ------
NM_182811chr2041137 919 757 260 1353 --1126
NM_182898chr766288 5138 1079 659 635 99 ------
NM_182899chr766288 5138 1079 659 635 99 ------
NM_182907chr632216 2150 431 1539 ----
NM_182918chr211152 ------
NM_182964chr1162851 2616 2425 2393 2275 81 12463 ----
NM_182970chr2033175 1135 100 --33113 1618 22 23154 3053
NM_182972chr1--1109 ----
NM_182975chr111015 --1839 --
NM_183004chr1443458 3429 3270 350 ------
NM_183043chr131651 ------
NM_183044chr131651 ------
NM_183075chr452196 1862 912 897 116 12402 2666 169 --
NM_183078chr683600 2890 2832 2700 1203 836 151 114 22670 508 ----
NM_183244chr201533 ------
NM_183246chr201533 ------
NM_183397chr20115033 4977 4938 4488 4256 4023 3176 1402 678 461 191 1321 23728 588 14083
NM_194278chr1423616 571 --1224 2742 651
NM_194281chr18254 48 ------
NM_194285chr1111169 22978 940 ----
NM_194314chr154595 4428 3601 1164 578 13692 ----
NM_194317chr222685 2422 32047 783 463 ----
NM_194328chr932462 1123 1088 11216 ----
NM_194329chr932462 1123 1088 11216 ----
NM_194330chr932462 1123 1088 11216 ----
NM_194332chr932462 1123 1088 11216 ----
NM_194356chr1221458 368 11702 --11977
NM_194442chr111117 1646 ----
NM_198086chr1432013 366 267 ----1481
NM_198123chr831137 413 101 ------
NM_198124chr831137 413 101 ------
NM_198158chr332586 2500 353 ------
NM_198159chr332586 2500 353 ------
NM_198173chr12746 526 ------
NM_198174chr12746 526 ------
NM_198177chr332586 2500 353 ------
NM_198178chr332586 2500 353 ------
NM_198186chr9135 1240 1505 --
NM_198187chr9135 1240 1505 --
NM_198240chr12--184 ----
NM_198261chr12239 30 ------
NM_198262chr12239 30 ------
NM_198270chrX23260 76 ------
NM_198334chr111607 197 --1166
NM_198335chr111607 197 --1166
NM_198391chr201978 ------
NM_198392chr61275 31965 1911 245 12321 32353 2282 549
NM_198395chr531105 1061 236 ------
NM_198400chr1532517 2120 1910 ------
NM_198428chr72717 153 ------
NM_198446chr11237 ------
NM_198468chr643686 2919 956 338 11599 13342 --
NM_198513chr821747 585 1171 ----
NM_198549chr121063 106 ------
NM_198584chr822694 262 ------
NM_198595chr4103661 3187 1964 1579 1565 1510 896 503 449 382 3323 119 110 13145 --
NM_198700chr11144 1369 ----
NM_198859chr3105067 4446 4401 4164 3829 1450 1111 1100 502 491 33934 3775 228 14877 --
NM_198896chr1152044 1952 766 650 450 ------
NM_198900chr12167742 6737 6462 6379 6047 5807 5713 5637 4942 4770 2518 2505 1326 1042 853 80 56097 5273 5236 1829 223 15706 --
NM_198903chr51664 ------
NM_198904chr532129 1910 664 ------
NM_198956chr7------175
NM_198965chr12141 ------
NM_198966chr12141 ------
NM_198993chr1731720 322 211 ------
NM_199005chr92855 265 ------
NM_199054chr1941656 1383 1325 745 11636 2687 113 --
NM_199072chr722816 861 1705 21101 883 --
NM_199076chr1041294 1213 447 243 2803 75 ----
NM_199129chr2021143 246 ------
NM_199132chr1932182 2126 1792 31708 503 148 ----
NM_199144chr201282 ------
NM_199160chr91789 11327 ----
NM_199169chr2033533 2391 1109 23396 3376 12268 --
NM_199170chr2033533 2391 1109 23396 3376 12268 --
NM_199171chr2033533 2391 1109 23396 3376 12268 --
NM_199188chr1231192 1127 823 ----1201
NM_199189chr52967 250 ------
NM_199190chr1231192 1127 823 ----1201
NM_199203chr201282 ------
NM_199229chr221442 615 ------
NM_199320chr441961 1803 907 34 --1982 --
NM_199320chr441961 1803 907 34 --1982 --
NM_199324chr421061 494 22632 427 ----
NM_199351chr1--1594 ----
NM_199359chr203598 385 304 11035 ----
NM_199360chr203598 385 304 11035 ----
NM_199361chr203598 385 304 11035 ----
NM_199362chr203598 385 304 11035 ----
NM_199363chr203598 385 304 11035 ----
NM_199415chr2082487 2425 2302 2047 1975 1610 682 127 1933 1732 --
NM_199421chr1434453 3993 3300 11043 13379 --
NM_199436chr222733 104 --12999 --
NM_199437chr111184 22227 1995 21570 386 --
NM_199438chr111184 22227 1995 21570 386 --
NM_199439chr111184 22227 1995 21570 386 --
NM_199454chr144398 4122 1167 1085 13284 ----
NM_199478chrX1254 --1172 --
NM_199482chr211888 ------
NM_201263chr131948 1465 221 31923 1371 141 ----
NM_201269chr111254 ------
NM_201432chr17106050 4800 4541 4498 2541 1135 590 407 366 240 1133 45557 5527 167 51 12016
NM_201433chr17106050 4800 4541 4498 2541 1135 590 407 366 240 1133 45557 5527 167 51 12016
NM_201435chr122301 118 ------
NM_201436chr71754 1777 ----
NM_201516chr71810 1833 ----
NM_201517chr71754 1777 ----
NM_201568chr122053 809 2687 33 12067 --
NM_201569chr122053 809 2687 33 12067 --
NM_201591chr41487 ------
NM_201592chr41487 ------
NM_201995chr112156 110 2499 38 ----
NM_201998chr112221 175 2564 103 ----
NM_201999chr41463 ----125
NM_203301chr1421267 220 ------
NM_203305chr932451 1943 356 --1757 12169
NM_203327chr2074226 3886 3814 1484 1427 1335 561 13055 ----
NM_203365chr21569 --146 --
NM_203382chr551318 530 319 183 129 11355 ----
NM_203391chrX----122 --
NM_203394chr121203 ------
NM_203406chr5--1870 ----
NM_203417chr2121111 80 ------
NM_203418chr2121111 80 ------
NM_203434chr91190 1424 --11147
NM_203454chr1142 11032 ----
NM_203504chr431676 424 184 ------
NM_203505chr431676 424 184 ------
NM_203506chr172898 513 11951 ----
NM_205846chr53434 422 209 11513 ----
NM_205860chr133041 2603 2526 --1421 1245
NM_205861chr141477 1317 856 183 1718 --151
NM_206594chr143139 1258 829 158 ------
NM_206595chr143139 1258 829 158 ------
NM_206814chr621463 211 ------
NM_206852chr141692 --1705 --
NM_206857chr141692 --1705 --
NM_206860chr10124 --1367 --
NM_206861chr10124 --1367 --
NM_206862chr10124 --1367 --
NM_206907chr522224 1163 --1425 --
NM_206909chr837443 6004 2352 1662 33000 2796 2316 --
NM_206944chr91153 ------
NM_206945chr91153 ------
NM_206946chr91153 ------
NM_206947chr91153 ------
NM_206963chr3128 ------
NM_207015chr31234 ----1826
NM_207113chr74334 271 246 239 ------
NM_207121chr203546 404 176 1104 ----
NM_207170chr11809 ------
NM_207171chr111762 --11987 --
NM_207299chr91776 ------
NM_207304chr13--1711 ----
NM_207372chr1032473 1885 28 ------
NM_207381chr152948 23 --1362 --
NM_207406chr454889 4854 3986 3964 1235 34122 2421 462 ----
NM_207413chr81130 ------
NM_212467chr152598 473 ----21945 387
NM_212535chr16181 143 ----
NM_213609chr32802 767 ------