TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-129-2-3p
miRNA Sequence: AAGCCCUUACCCCAAAAAGCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr51127 ------
NM_000051chr1132737 1157 1108 ------
NM_000080chr173852 821 806 --1199 1768
NM_000084chrX96776 6296 5785 5689 5606 5571 5553 5238 4669 11563 26238 442 26897 1948
NM_000104chr221077 230 ------
NM_000109chrX1193 ------
NM_000138chr1532497 961 665 ------
NM_000192chr1211175 ------
NM_000208chr1964426 4265 3715 734 603 211 13977 ----
NM_000217chr1234735 3512 2006 --11737 --
NM_000245chr72559 334 ----11707
NM_000248chr332230 2164 1859 ----12513
NM_000271chr18140 ------
NM_000314chr1052978 2721 2302 2220 167 --1468 --
NM_000321chr1311189 --11594 --
NM_000332chr686752 2210 1940 377 358 270 237 216 --15256 --
NM_000333chr31127 ------
NM_000346chr1711232 ------
NM_000353chr1641246 1103 912 99 --1123 --
NM_000368chr953731 3638 1090 1051 252 --11124 --
NM_000406chr431051 415 36 --11929 12051
NM_000430chr1743381 1047 414 222 ------
NM_000462chr1511863 ----1325
NM_000480chr1121124 634 ----1460
NM_000489chrX1763 22954 564 ----
NM_000523chr21233 --1354 --
NM_000555chrX77679 7452 6200 5366 2828 2036 353 187 ----
NM_000578chr2101822 1619 1526 1358 1155 1143 459 348 333 124 --11258 --
NM_000609chr1072528 2414 1050 541 477 300 67 1551 22590 117 --
NM_000610chr1132363 862 536 1364 1652 --
NM_000663chr1682562 2556 2082 1994 670 340 266 116 1834 42366 2314 1231 175 --
NM_000721chr12958 814 1259 1625 --
NM_000725chr123749 375 141 1904 1635 --
NM_000782chr202327 87 ------
NM_000806chr51414 --11516 --
NM_000831chr1165935 4836 4777 4683 4381 3952 3830 1985 1933 1710 1554 1349 1239 531 334 35 35084 1860 1532 35381 4984 1690 14205
NM_000868chrX31673 566 177 ------
NM_000875chr1595585 5260 5111 2530 2135 2050 1568 938 542 ------
NM_000901chr411930 --1363 --
NM_000924chr1251316 1076 917 338 160 --21069 481 --
NM_000935chr3--11002 ----
NM_000945chr231935 1435 761 ------
NM_000958chr511202 ----197
NM_001001323chr1212343 ------
NM_001001344chrX72084 2013 1618 527 461 418 180 ------
NM_001001389chr1132363 862 536 1364 1652 --
NM_001001390chr1132363 862 536 1364 1652 --
NM_001001391chr1132363 862 536 1364 1652 --
NM_001001392chr1132409 908 582 1410 1698 --
NM_001001396chr163617 3528 3134 2940 1011 673 ------
NM_001001502chr52210 71 ------
NM_001001664chr232986 1493 398 ------
NM_001001668chr1923638 964 13831 ----
NM_001001701chr442120 2090 939 355 11513 1266 --
NM_001001709chr931903 852 344 1190 ----
NM_001001890chr2141342 1147 1092 130 ------
NM_001001936chr1021077 87 ------
NM_001001995chrX--11285 21801 1269 --
NM_001002269chr91415 ------
NM_001002906chrY1413 ------
NM_001003406chr2272641 2630 894 849 782 498 364 --23006 2151 1934
NM_001003681chr2241809 567 311 304 11598 ----
NM_001003760chr612358 ------
NM_001003800chr943049 1102 892 367 13088 22927 930 --
NM_001003940chr1563765 3479 3094 1200 639 482 11452 33450 495 269 13664
NM_001003942chr1563765 3479 3094 1200 639 482 11452 33450 495 269 13664
NM_001003943chr1563769 3483 3098 1204 643 486 11456 33454 499 273 13668
NM_001004023chr1------1166
NM_001004304chr1233267 2625 2104 12972 22146 652 --
NM_001004346chr4158 --1278 --
NM_001004360chr2196 --1226 --
NM_001004419chr1264383 3962 3025 2845 855 486 --1734 --
NM_001004720chr21885 ------
NM_001004722chr211054 ------
NM_001005367chr192406 143 --1318 --
NM_001005375chrY138 ------
NM_001005404chr1763876 633 427 400 306 106 --1881 --
NM_001005463chr102568 484 --12381 --
NM_001005609chrX63641 2693 1145 589 403 220 --11004 --
NM_001005785chrY138 ------
NM_001005786chrY138 ------
NM_001005861chr3147 --1220 --
NM_001006115chr372396 882 610 519 454 429 178 1569 1890 1101
NM_001006605chr1------1857
NM_001006605chr1------1857
NM_001007024chr1763989 3593 3396 3150 2940 1600 11586 13652 --
NM_001007025chr1763989 3593 3396 3150 2940 1600 11586 13652 --
NM_001007097chr964207 1854 1784 1180 562 519 1795 132 --
NM_001007102chr631029 573 285 ------
NM_001007156chr1531649 1361 189 --11485 --
NM_001007246chr2131924 1778 1284 ------
NM_001007466chr674592 3800 3769 3160 741 629 241 1833 13175 --
NM_001007471chr9----1327 1266
NM_001007794chr11214 ------
NM_001008220chr5113559 3520 3141 2929 2870 2558 2501 1226 581 541 429 --2774 136 --
NM_001008392chr353536 3265 2330 2310 1180 --11379 --
NM_001008541chr1021604 141 ------
NM_001008541chr1021604 141 ------
NM_001008564chr131863 ------
NM_001008701chr19122727 2613 2450 2430 2260 2041 380 355 294 197 184 60 --21946 23 --
NM_001008726chr1411192 --11589 --
NM_001008860chr152830 555 ------
NM_001008892chr152830 555 ------
NM_001008894chr152830 555 ------
NM_001008895chr1331035 500 466 ------
NM_001008938chr111405 ------
NM_001009554chr464178 3501 1626 1299 583 188 --24764 43 --
NM_001009554chr464178 3501 1626 1299 583 188 --24764 43 --
NM_001009571chr711137 11462 ----
NM_001009880chr2294356 4246 3612 1924 1415 1383 1299 818 798 ------
NM_001009881chr1169 ------
NM_001009882chr1169 ------
NM_001009899chr3105309 5043 5029 4880 4743 4458 4366 2365 1319 784 14166 12311 --
NM_001009993chr2104207 4074 3839 3784 2967 1652 1398 1364 1328 1048 --13849 --
NM_001010862chrX53076 2580 2329 1299 228 ------
NM_001010917chr10111978 1939 1777 1649 1620 1457 1418 706 243 224 45 --11451 --
NM_001010935chr111043 ------
NM_001011663chr101880 ------
NM_001011666chr746112 4186 1248 66 1989 11078 --
NM_001012393chr1155094 4423 1618 519 203 1657 ----
NM_001012398chr161155 ------
NM_001012426chr6102884 2356 2156 1358 1213 703 366 235 170 24 --13260 --
NM_001012427chr6102884 2356 2156 1358 1213 703 366 235 170 24 --13260 --
NM_001013629chr1042130 1463 531 96 290 81 ----
NM_001013690chr1262386 2325 2274 1959 1846 1554 1647 2633 96 --
NM_001013693chr182705 2671 2562 2230 2073 1117 1111 792 --31162 758 541 --
NM_001013693chr182705 2671 2562 2230 2073 1117 1111 792 --31162 758 541 --
NM_001014797chr1097474 7012 6012 5543 5194 2923 2744 1133 880 13239 38195 3161 2493 15332
NM_001015048chr1412975 ------
NM_001015049chr1412975 ------
NM_001015877chrX11034 --190 1768
NM_001017368chr1732149 108 64 ------
NM_001017395chr342945 875 368 301 --11132 --
NM_001017440chr797303 6418 6303 5535 2117 1719 485 467 409 12386 26223 202 --
NM_001017923chr1411622 --160 --
NM_001017969chr91233 ------
NM_001017995chr5103884 3002 1401 1352 1339 742 684 399 366 25 --24288 3861 --
NM_001018025chrX1150 ------
NM_001018057chr1111138 1218 ----
NM_001018065chr985930 5517 5467 4862 3771 658 552 401 1748 15535 --
NM_001018066chr985930 5517 5467 4862 3771 658 552 401 1748 15535 --
NM_001018067chr124349 1050 ----15093
NM_001018068chr124349 1050 ----15093
NM_001018069chr124349 1050 ----15093
NM_001018108chr1582193 1961 1858 1634 1479 871 842 240 12206 ----
NM_001024226chr11954 ------
NM_001024227chr11954 ------
NM_001024228chr11954 ------
NM_001024372chr82870 128 --21963 1820 --
NM_001024666chrX2201 188 ------
NM_001024858chr1492919 2092 2024 835 785 708 665 576 512 12374 32181 566 227 --
NM_001024948chr133196 1299 98 13023 12230 --
NM_001025076chr1045281 5129 5090 3788 12459 14605 14459
NM_001025077chr1076639 6487 6448 5146 724 594 471 --15963 15817
NM_001025105chr51450 --11223 --
NM_001025366chr631291 196 33 ------
NM_001025366chr631291 196 33 ------
NM_001025367chr631291 196 33 ------
NM_001025367chr631291 196 33 ------
NM_001025368chr631291 196 33 ------
NM_001025368chr631291 196 33 ------
NM_001025369chr631307 212 49 ------
NM_001025369chr631307 212 49 ------
NM_001025370chr631291 196 33 ------
NM_001025370chr631291 196 33 ------
NM_001025389chr1121124 634 ----1460
NM_001025390chr1121124 634 ----1460
NM_001025580chrX22655 675 --23680 3088 --
NM_001025595chr43341 252 172 ------
NM_001025780chr911103 ------
NM_001029859chr1162466 2159 844 685 654 66 --11741 --
NM_001029883chr282997 2745 2311 2204 2184 2162 1949 324 --13030 --
NM_001030001chr143167 149 113 ------
NM_001030007chr1633497 3430 2813 ------
NM_001030055chr1424712 68 ------
NM_001030287chr12460 137 ----1794
NM_001031679chr1282776 2580 1314 1279 587 534 324 103 ------
NM_001031690chr7113017 2619 2522 2318 1092 1080 1026 933 796 542 42 --22560 498 --
NM_001031695chr2295175 4807 4787 3457 2038 1931 1838 1416 1169 ----13307
NM_001031812chr511986 ------
NM_001032280chr6------11163
NM_001032289chrX1130 ------
NM_001032380chr1011410 1487 1744 --
NM_001032394chr611853 ----157
NM_001033044chr131229 1150 96 ------
NM_001033049chr2141911 1665 321 33 1893 ----
NM_001033056chr131229 1150 96 ------
NM_001033087chr2042977 846 646 557 --12687 --
NM_001033564chr631417 319 41 21846 1840 ----
NM_001033659chr1711195 1664 2454 371 --
NM_001034954chr1021068 1002 ------
NM_001034955chr1021068 1002 ------
NM_001034956chr1021068 1002 ------
NM_001034957chr1021068 1002 ------
NM_001037132chr712076 ------
NM_001037133chr712076 ------
NM_001038633chr121331 977 1552 --11067
NM_001038707chr121787 154 --1495 12113
NM_001038707chr121787 154 --1495 12113
NM_001039465chr141465 ------
NM_001039538chr21918 --11117 --
NM_001039547chr312803 --17773 --
NM_001039570chr2284606 4356 4230 2916 1655 1351 542 334 --13230 --
NM_001039571chr2284606 4356 4230 2916 1655 1351 542 334 --13230 --
NM_001039762chr1022308 1998 ------
NM_001040057chr741412 1060 491 162 ------
NM_001040102chr1062103 1743 1650 139 59 45 --1295 --
NM_001040103chr1062103 1743 1650 139 59 45 --1295 --
NM_001040153chr13150 ------
NM_001040181chr3--1750 ----
NM_001040182chr3--1750 ----
NM_001040183chr3--1750 ----
NM_001040199chr3--1750 ----
NM_001040200chr3--1750 ----
NM_001040202chr411964 --2630 330 --
NM_001040214chr6------12293
NM_001040273chr10102027 1964 1809 1626 1495 1408 793 629 564 292 ------
NM_001040409chr2----11003 --
NM_001040424chr2142010 1948 312 223 --22704 927 --
NM_001040429chr1312602 ------
NM_001040633chr71107 ------
NM_001040653chr341922 1913 1804 450 --12542 --
NM_001040876chr4----21476 361 --
NM_001042425chr6------11163
NM_001042476chr1662121 1912 1864 796 312 99 --1820 --
NM_001042555chr1233106 1030 674 ----14517
NM_001042599chr257321 6691 5090 2522 2500 --26491 2430 --
NM_001043318chr1493615 3308 3080 2803 1610 1317 979 222 135 21229 1127 2648 456 11158
NM_001044722chr511986 ------
NM_001044723chr511986 ------
NM_001076chr4168 ------
NM_001076chr4168 ------
NM_001079874chr11812 --1632 1867
NM_001100108chr1137452 5883 5455 2688 2545 2528 2514 2386 1754 477 372 330 234 15066 12416 --
NM_001106chr396243 3844 3693 3564 2730 2316 2180 2128 662 18505 57496 6299 3700 3319 2090 --
NM_001113490chrX21279 550 --21438 95 --
NM_001123chr101144 ------
NM_001128chr1633497 3430 2813 ------
NM_001135chr153800 711 645 ------
NM_001167chrX55669 4694 1648 820 798 --16509 --
NM_001173chr1424712 68 ------
NM_001186chr212635 550 --12190 --
NM_001191chr2071385 1013 1001 964 511 292 127 --1271 --
NM_001200chr20----2927 827 --
NM_001244chr941007 762 744 344 1165 ----
NM_001248chr31342 --1800 --
NM_001271chr1583039 3005 2770 2698 2219 2201 2163 637 --12667 --
NM_001280chr191222 ------
NM_001299chr19--1135 ----
NM_001331chr11----12041 12740
NM_001399chrX63641 2693 1145 589 403 220 --11004 --
NM_001400chr11205 --1303 --
NM_001408chr141251 570 557 509 ----11521
NM_001412chrX33138 2850 1234 ------
NM_001417chr1211718 --11656 --
NM_001419chr1933815 3176 1404 --11769 --
NM_001420chr19102921 2900 2876 2852 2574 759 541 369 125 82 1938 12655 1768
NM_001421chrX61699 1486 1383 481 453 295 ------
NM_001430chr231841 591 529 ----11784
NM_001438chr112695 ------
NM_001523chr192237 30 ------
NM_001543chr5174781 4669 4615 4576 4461 4262 4029 3917 3830 1757 1669 1351 1203 1182 889 476 140 11234 ----
NM_001546chr61946 ------
NM_001564chr4------128
NM_001616chr21419 ------
NM_001650chr1832543 1184 695 --11514 --
NM_001658chr11954 ------
NM_001668chr152085 1797 1731 1477 451 ------
NM_001674chr12460 137 ----1794
NM_001681chr12135 ------
NM_001684chr173334 3245 2851 2657 1627 728 390 ------
NM_001754chr2141342 1147 1092 130 ------
NM_001755chr1621483 413 --11960 --
NM_001759chr12104141 4102 3890 3693 3240 2122 1640 1616 864 820 11563 13752 --
NM_001798chr124883 867 828 264 1422 ----
NM_001892chr51450 --11223 --
NM_001923chr111444 1436 ----
NM_001924chr1----1122 1397
NM_001935chr21710 ------
NM_001955chr61828 ------
NM_001967chr31550 ------
NM_001981chr1----22392 1625 --
NM_001995chr411322 ----1561
NM_002025chrX48792 2801 686 180 --13038 --
NM_002032chr11----1350 --
NM_002040chr2112952 ------
NM_002048chr91904 --2423 392 --
NM_002065chr131229 1150 96 ------
NM_002090chr41153 ------
NM_002092chr42764 28 15073 1981 11450
NM_002128chr1312039 11803 ----
NM_002136chr12----1247 --
NM_002140chr92232 217 ------
NM_002146chr171260 --21420 897 --
NM_002214chr721230 382 ------
NM_002223chr1244002 1418 1406 273 12849 32742 1084 796 --
NM_002234chr121187 ------
NM_002249chr11388 ------
NM_002264chr355067 4334 4110 733 208 --24205 928 --
NM_002267chr131656 ------
NM_002268chr32636 531 ----1295
NM_002270chr553833 2272 1469 155 109 --14404 --
NM_002293chr1----1194 --
NM_002309chr2272274 1263 1190 800 515 114 75 --1875 1457
NM_002359chr1764229 4146 2984 2649 1450 152 11586 34087 3911 577 --
NM_002374chr21918 --11117 --
NM_002382chr14----21140 504 --
NM_002387chr553812 1854 1514 715 69 23792 1180 ----
NM_002390chr17102073 1631 1515 1480 1377 1312 524 422 198 152 --31690 1619 611 --
NM_002408chr141203 ------
NM_002430chr2221834 100 ----1179
NM_002436chrX182 --1176 --
NM_002445chr831612 1073 288 ------
NM_002449chr511215 --149 --
NM_002545chr1155094 4423 1618 519 203 1657 ----
NM_002577chr313234 14062 ----
NM_002581chr974800 4385 4342 3854 1346 702 381 --11639 --
NM_002592chr201261 ------
NM_002609chr571641 1610 1316 744 244 193 164 ------
NM_002628chr3----11026 --
NM_002646chr15719 627 618 568 90 --11731 --
NM_002655chr831887 1640 1549 11073 1433 --
NM_002698chr19112879 2859 2670 2507 2068 1152 909 860 679 361 299 1765 12898 --
NM_002701chr6179 ------
NM_002709chr2------11307
NM_002713chr1252 23 --1435 --
NM_002717chr81215 ------
NM_002718chr31443 12478 ----
NM_002719chr1411777 ------
NM_002730chr194993 435 91 71 1141 21076 368 --
NM_002731chr132674 1139 1050 12214 ----
NM_002734chr1731715 527 295 11455 ----
NM_002737chr1764615 4555 4546 4476 4266 2502 1134 16239 --
NM_002745chr2244105 4058 3488 136 ------
NM_002753chr42642 306 ------
NM_002758chr172488 123 ------
NM_002786chr111198 ------
NM_002811chr16174 ------
NM_002822chr122604 321 --1205 --
NM_002869chr11----11946 --
NM_002871chr111517 2806 153 21293 314 --
NM_002876chr17125 ------
NM_002884chr111043 ------
NM_002886chr333180 601 358 --14713 13350
NM_002897chr22724 41 ------
NM_002902chr15----1534 --
NM_002928chr131156 261 252 ----1240
NM_002940chr4----21476 361 --
NM_002945chr171598 ------
NM_002958chr3147 --1220 --
NM_002966chr1149 ------
NM_003010chr1722162 2121 --135 --
NM_003011chr91532 ------
NM_003028chr993786 3726 3548 3425 3067 2999 316 196 167 --11059 --
NM_003069chrX1683 ------
NM_003074chr351858 1423 826 713 659 ------
NM_003075chr121308 --1263 --
NM_003076chr1211242 ------
NM_003081chr201874 ------
NM_003085chr52210 71 ------
NM_003107chr67990 976 790 651 272 132 25 --12438 11632
NM_003108chr2147242 6448 5268 2876 2694 2513 2487 2469 2403 2091 1988 1944 1932 1794 --12795 --
NM_003112chr731292 1277 136 ------
NM_003133chr1------1779
NM_003161chr1722598 303 --11449 23143 356
NM_003189chr153062 2752 1216 163 33 12087 ----
NM_003204chr1741489 1198 732 713 --154 --
NM_003211chr124501 489 384 186 ------
NM_003216chr2293227 3124 2925 2296 753 602 595 190 58 1370 12791 --
NM_003220chr6------11163
NM_003222chr201783 ------
NM_003234chr322334 1865 186 1340 --
NM_003253chr2121558 724 --21321 240 --
NM_003262chr334599 3629 826 ------
NM_003269chr6----1961 --
NM_003272chr11299 ------
NM_003286chr204960 736 386 264 ------
NM_003298chr375034 4276 3909 2221 1128 1052 271 15369 11083 11836
NM_003334chrX165 ------
NM_003338chr10----11870 --
NM_003376chr631291 196 33 ------
NM_003376chr631291 196 33 ------
NM_003390chr11--1249 1342 --
NM_003410chrX--12121 12664 --
NM_003454chr16------1196
NM_003458chr363327 3229 2550 1297 1196 500 13503 22715 488 --
NM_003482chr1282735 2195 1800 634 249 156 110 104 11057 11787 --
NM_003489chr2143130 2578 2456 2257 ------
NM_003559chr1772957 2541 1279 741 480 120 71 33353 2695 318 ----
NM_003566chr12--1725 ----
NM_003581chr21885 ------
NM_003582chr1------1166
NM_003583chr1222385 1088 --13560 --
NM_003589chr1331035 500 466 ------
NM_003607chr164077 3710 2779 2735 1135 677 --21261 109 --
NM_003644chr17156133 5710 5652 4799 4787 4540 1526 1431 1408 1071 405 381 165 140 44 ------
NM_003672chr11734 ----1268
NM_003693chr172548 169 --1217 1272
NM_003713chr11682 ----11313
NM_003750chr101218 ------
NM_003758chr1521117 419 ----11515
NM_003758chr1521117 419 ----11515
NM_003762chr1--11378 ----
NM_003768chr161716 1389 709 477 235 81 1268 --1223
NM_003800chr61522 2810 24 ----
NM_003822chr122135 687 ------
NM_003872chr282904 2781 2169 1855 1117 844 830 233 12522 22156 49 --
NM_003885chr1742331 1809 339 103 --1610 1914
NM_003913chr633365 3312 141 --125 --
NM_003927chr18----1960 --
NM_003948chr42941 883 ------
NM_003953chr152670 2477 2178 2096 2016 --1396 --
NM_003966chr515706 --11325 --
NM_003971chr17--1493 ----
NM_003983chr1683973 3913 3539 1052 942 331 196 124 --1380 --
NM_004006chrX1193 ------
NM_004007chrX1193 ------
NM_004009chrX1193 ------
NM_004010chrX1193 ------
NM_004011chrX1193 ------
NM_004012chrX1193 ------
NM_004013chrX1193 ------
NM_004014chrX1193 ------
NM_004015chrX1193 ------
NM_004016chrX1107 ------
NM_004017chrX1193 ------
NM_004018chrX1107 ------
NM_004020chrX1193 ------
NM_004021chrX1107 ------
NM_004022chrX1107 ------
NM_004023chrX1107 ------
NM_004028chr1832543 1184 695 --11514 --
NM_004050chr1482178 814 808 670 577 246 220 129 123 12186 --
NM_004081chrY138 ------
NM_004085chrX1173 ------
NM_004093chr1372445 2320 731 521 389 343 68 --1743 --
NM_004117chr631990 338 178 ------
NM_004124chr141881 --1679 --
NM_004157chr31861 ------
NM_004161chr211101 --11403 --
NM_004165chr16----143 --
NM_004229chrX11701 ------
NM_004232chr18----13506 --
NM_004263chr221794 237 ------
NM_004272chr511393 ------
NM_004281chr10------1151
NM_004296chr1493831 3764 3726 1083 962 882 705 136 126 --23422 3217 --
NM_004311chr1073013 2586 2413 2398 2165 1105 822 12674 ----
NM_004323chr962566 2000 737 373 246 91 ------
NM_004330chr151742 --1942 --
NM_004384chr511986 ------
NM_004397chr1134205 3934 1213 1629 23166 1123 --
NM_004422chr171377 ------
NM_004427chr1121179 1089 1083 491 362 332 220 190 168 121 102 77 --2884 109 --
NM_004442chr141334 1094 652 438 --2662 309 --
NM_004454chr33710 195 63 --1392 1477
NM_004457chr22435 403 1681 ----
NM_004491chr19133451 3419 3400 2675 1511 1486 1272 935 868 552 480 402 100 --14102 --
NM_004496chr14--1347 ----
NM_004501chr11248 --22683 647 --
NM_004588chr11113258 3004 2871 925 867 797 657 576 525 432 399 --2784 242 --
NM_004598chr521202 194 --11070 --
NM_004637chr311122 ------
NM_004667chr151217 ------
NM_004677chrY1413 ------
NM_004690chr62557 40 ------
NM_004730chr541811 813 761 556 ------
NM_004734chr1322444 1000 12635 --1336
NM_004736chr111671 --1575 --
NM_004737chr2251147 875 493 392 321 --1934 2845 284
NM_004742chr321440 418 --11423 --
NM_004745chr845164 4393 2464 765 --36074 5409 4705 --
NM_004762chr1771942 1496 665 554 541 477 166 ------
NM_004774chr1752904 830 819 659 188 12278 1398 --
NM_004822chr17113265 3179 1203 1132 1070 981 797 701 598 277 98 --32546 2486 334 --
NM_004836chr2------1209
NM_004841chr12912 789 --1757 1995
NM_004842chr611232 ------
NM_004845chrX63467 2697 396 85 63 48 --13317 --
NM_004869chr181367 ------
NM_004871chr1763989 3593 3396 3150 2940 1600 11586 13652 --
NM_004873chr1412975 ------
NM_004904chr746112 4186 1248 66 1989 11078 --
NM_004947chr341928 1685 646 508 11884 31807 578 197 21898 782
NM_004958chr11722 --1768 --
NM_004960chr16----198 --
NM_004961chrX1149 11271 ----
NM_004973chr611252 --1250 --
NM_004976chr11134576 4525 4350 4279 4124 4117 3865 3519 2058 1625 1066 841 279 23724 3399 1486 --
NM_004992chrX107826 7758 7582 6556 6457 6029 3167 3054 1150 77 13389 35715 1925 1670 --
NM_004992chrX107826 7758 7582 6556 6457 6029 3167 3054 1150 77 13389 35715 1925 1670 --
NM_005010chr712076 ------
NM_005023chr511087 ------
NM_005063chr1043475 3120 3044 2756 11519 21304 809 --
NM_005072chr161369 ------
NM_005076chr1104090 3519 3447 3325 1569 1346 1059 884 704 469 --2826 555 --
NM_005105chr12819 523 11486 ----
NM_005109chr3----1642 --
NM_005121chr1723637 593 1922 --1157
NM_005126chr31732 ------
NM_005156chr931668 1348 1262 --1984 --
NM_005197chr1454090 2042 1778 1654 601 --24286 3768 14224
NM_005235chr257321 6691 5090 2522 2500 --26491 2430 --
NM_005249chr141135 ------
NM_005252chr14194 ------
NM_005316chr112741 380 ------
NM_005324chr1732064 420 369 --1764 --
NM_005329chr1641636 1586 291 210 --31966 1742 1549 --
NM_005347chr91652 31642 1618 1453 ----
NM_005359chr1826032 5375 --35508 4197 118 14692
NM_005388chr921544 665 --1593 --
NM_005399chr153292 2970 1549 1442 463 1689 13489 --
NM_005400chr252451 2325 1148 678 498 --1298 1780
NM_005406chr181166 1119 ----
NM_005407chr1441473 1328 1063 393 --1373 --
NM_005433chr1812278 --12230 --
NM_005450chr17199 ------
NM_005487chr2241809 567 311 304 11598 ----
NM_005520chr5179 ------
NM_005596chr956018 5575 1226 1010 305 --15227 --
NM_005599chr141453 381 291 224 --1302 --
NM_005613chr122218 236 ------
NM_005644chr1----1338 --
NM_005647chrX63118 2997 1191 949 899 61 ------
NM_005668chr534248 2974 201 13897 12893 --
NM_005693chr111149 ------
NM_005708chr131326 ------
NM_005719chr121178 ------
NM_005779chr523366 504 --12704 13245
NM_005780chr131836 --2359 48 1411
NM_005785chr1241682 663 443 145 ------
NM_005808chr353536 3265 2330 2310 1180 --11379 --
NM_005813chr21903 --1540 --
NM_005814chr151293 1214 434 419 383 ----135
NM_005819chr162618 2506 2400 806 717 179 --13086 1746
NM_005828chr1794870 4042 3854 3836 2039 1976 1423 744 215 --133 --
NM_005840chrX77647 7429 7316 2780 2651 1876 1358 17025 37480 4734 323 12736
NM_005871chr1021015 35 ------
NM_005902chr1564261 3110 1830 402 232 26 ----11212
NM_005907chr611400 ----11377
NM_005909chr52658 210 ------
NM_005910chr1743822 3192 2774 1596 11000 2903 555 13904
NM_005920chr1113701 3641 2799 2572 1531 1523 1097 794 784 527 263 --12986 1804
NM_005933chr113426 309 114 ------
NM_005935chr435080 4746 4363 --1451 --
NM_005937chr17134136 3512 3495 3463 3209 1148 1137 1016 849 649 582 571 532 --34004 3072 436 --
NM_005941chr863955 2795 2636 663 142 120 --13118 23042 1495
NM_005955chr174675 3348 1740 789 530 488 327 --23389 921 15006
NM_005962chr1021604 141 ------
NM_005962chr1021604 141 ------
NM_006011chr1564244 3977 2992 1001 796 565 --11470 --
NM_006022chr13----1342 --
NM_006037chr284546 3837 3365 3350 3075 1943 1933 98 --21867 869 --
NM_006090chr11214 ------
NM_006099chr13353 105 93 --1308 1175
NM_006113chr11812 --1632 1867
NM_006194chr14----1307 --
NM_006195chr921040 328 ------
NM_006202chr1971880 1802 1749 1469 765 527 204 --1219 --
NM_006203chr545103 4834 3531 3462 21752 1394 ----
NM_006212chr1115192 4880 1591 1489 1026 1014 921 681 391 301 217 21981 1363 25149 4976 --
NM_006252chr156673 5941 1714 327 124 --11098 --
NM_006259chr41362 ------
NM_006268chr111308 ------
NM_006275chr2032250 341 112 ------
NM_006311chr171243 ------
NM_006328chr111408 158 ----
NM_006329chr14----1508 --
NM_006345chr4----11397 --
NM_006389chr1151262 1158 1051 350 73 ------
NM_006390chr1221226 573 --21126 87 --
NM_006400chr12171 --1127 --
NM_006403chr611649 ------
NM_006408chr72856 810 ------
NM_006434chr1021068 1002 ------
NM_006454chr4103034 2991 2520 2431 1893 1005 933 883 581 506 --42176 1030 864 344 --
NM_006482chr1222385 1088 --13560 --
NM_006496chr111856 1580 11305 --
NM_006544chr14--15010 26092 4223 --
NM_006546chr17196082 5443 5328 5252 5230 5089 4979 4959 4718 4292 4205 4185 4081 2593 2466 2090 1978 1915 762 --21048 854 --
NM_006547chr72756 238 ------
NM_006549chr1272529 1981 1843 1106 667 517 51 1443 1617 --
NM_006561chr1045281 5129 5090 3788 12459 14605 14459
NM_006565chr162900 224 ------
NM_006575chr1431121 529 297 --11374 --
NM_006599chr1645722 2690 1255 535 --13082 18080
NM_006601chr12----1167 --
NM_006614chr313447 --12655 --
NM_006621chr11206 --11872 --
NM_006624chr101532 1547 ----
NM_006636chr2----11003 --
NM_006650chr5113559 3520 3141 2929 2870 2558 2501 1226 581 541 429 --2774 136 --
NM_006653chr6296 89 ------
NM_006654chr1233106 1030 674 ----14517
NM_006682chr71953 ------
NM_006721chr101144 ------
NM_006722chr332230 2164 1859 ----12513
NM_006729chrX44776 3449 1668 446 --15419 --
NM_006734chr621361 1181 11260 ----
NM_006750chr1668060 6964 6207 5087 3086 2628 27061 871 1555 --
NM_006766chr812021 ----1430
NM_006807chr1731029 953 261 ------
NM_006815chr1221150 941 ------
NM_006832chr1421006 336 ------
NM_006839chr2----168 --
NM_006876chr112571 539 --1554 --
NM_006885chr16----11597 --
NM_006897chr123576 492 180 ------
NM_006925chr141465 ------
NM_006941chr223348 311 135 --2740 264 1453
NM_006955chr1022950 74 13394 ----
NM_006965chr181853 --1993 --
NM_006981chr932089 2023 262 --1403 --
NM_006990chr1112344 2292 2117 2070 791 490 482 465 326 209 116 --12266 --
NM_007005chr91990 ------
NM_007011chr1546300 5028 4804 2333 --36138 4351 902 --
NM_007034chr11115 ------
NM_007042chr352623 2208 1789 763 257 ------
NM_007050chr20157376 6735 6523 6325 6122 5008 3098 2335 1883 1481 793 589 488 245 152 --36309 6269 2638 --
NM_007173chr112831 32 --12283 --
NM_007175chr863200 2747 2338 1352 1068 628 12946 23376 1190 --
NM_007197chr12128 --2851 187 --
NM_007202chr171700 ------
NM_007238chr2094807 4713 4052 3724 3717 3502 361 301 117 24382 1311 13908 --
NM_007249chr1376115 2768 929 710 543 98 66 --22092 1664 17788
NM_007282chr3----1681 --
NM_007345chr1822300 1443 1741 ----
NM_007350chr1264245 4111 3393 3007 1432 443 --24231 816 --
NM_007358chr11808 ------
NM_012069chrX52381 2158 2133 2011 838 --11655 --
NM_012072chr2053405 1756 1671 1607 76 31688 748 315 24071 322 --
NM_012090chr141042 493 322 304 --11032 --
NM_012095chr1023457 745 --11025 --
NM_012104chr1133590 1376 984 --1779 --
NM_012104chr1133590 1376 984 --1779 --
NM_012124chr11--1122 ----
NM_012164chr9125827 5767 5086 2603 2396 1681 1395 1248 174 158 151 43 --11844 --
NM_012193chr1124859 810 14428 ----
NM_012197chr91535 ------
NM_012199chr143730 3341 3224 270 13534 1422 --
NM_012214chr214148 1742 15816 --
NM_012215chr1021613 744 --11233 --
NM_012223chr211058 --11089 1894
NM_012234chr32814 355 ----1509
NM_012238chr10----11386 --
NM_012250chr111400 ------
NM_012262chr131832 1334 404 ----14772
NM_012287chr323445 1704 ----23852 228
NM_012290chr221181 377 ------
NM_012296chr1163000 2454 1194 747 344 173 --1338 1837
NM_012300chr52452 29 ------
NM_012306chr12123436 3261 2835 2726 2458 1326 1257 735 722 696 601 381 12326 ----
NM_012325chr2041628 541 493 256 ------
NM_012330chr101567 --1648 --
NM_012333chr131696 1429 1108 ------
NM_012384chr2092405 2216 2105 2007 1880 915 649 86 37 1313 12081 --
NM_012412chr71687 ------
NM_012416chr91863 21177 1052 ----
NM_012428chr151154 ------
NM_013227chr153800 711 645 ------
NM_013231chr1434112 387 269 11470 14301 11657
NM_013233chr2----11078 --
NM_013253chr1111138 1218 ----
NM_013260chr1751355 1310 1209 1015 351 --1980 --
NM_013269chr1264310 3889 2952 2772 782 413 --1661 --
NM_013272chr15142 ------
NM_013277chr121141 ----1259
NM_013282chr1931067 970 49 --21220 1109 --
NM_013323chr172930 850 1783 31208 902 226 --
NM_013386chr11506 11506 ----
NM_013390chr941525 1399 1327 330 --1635 1598
NM_013396chr21173 ------
NM_013450chr21267 ------
NM_014043chr31368 ------
NM_014048chr1643598 3375 1981 1903 --24577 4236 --
NM_014089chr131863 ------
NM_014110chr1252 23 --1435 --
NM_014112chr834347 4313 1809 11251 1359 --
NM_014155chr1112350 27212 6569 ----
NM_014232chr1731557 1404 34 --11439 --
NM_014232chr1731557 1404 34 --11439 --
NM_014250chr2241809 567 311 304 11598 ----
NM_014252chr132298 61 ------
NM_014292chr2291659 1647 1307 438 270 206 179 143 25 --11747 --
NM_014293chr2233253 3176 515 --63896 3789 3571 3093 1345 709 --
NM_014305chr131264 ------
NM_014309chr2295165 4797 4777 3447 2028 1921 1828 1406 1159 ----13297
NM_014316chr1662121 1912 1864 796 312 99 --1820 --
NM_014331chr447462 7134 5353 2114 ----1618
NM_014333chr1112117 1728 ----
NM_014423chr585541 5323 5094 4922 4868 3773 3673 3479 1339 1807 --
NM_014447chr43341 252 172 ------
NM_014491chr7----1317 --
NM_014494chr1662313 1732 1457 469 85 65 ------
NM_014502chr114393 381 99 59 ------
NM_014575chr31532 ------
NM_014604chr172564 223 ----1114
NM_014612chr9138 ------
NM_014640chr21202 ------
NM_014646chr1852967 2065 406 222 28 ------
NM_014647chr161511 ----11410
NM_014661chr10143738 3702 3465 2888 2792 1243 1128 1004 980 954 404 384 372 24 1805 33747 2966 2939 --
NM_014671chr741401 413 381 370 ------
NM_014690chr7113017 2619 2522 2318 1092 1080 1026 933 796 542 42 --22560 498 --
NM_014701chr15----22492 42 --
NM_014742chr2071354 1229 608 593 405 159 140 --21697 371 --
NM_014743chr42780 714 --11983 --
NM_014747chr1235181 4974 4749 4733 4689 4616 4545 4220 3755 3572 2242 2150 1901 1777 1730 1088 1005 984 937 872 757 682 544 --24407 2095 --
NM_014755chr254093 3418 2953 2756 831 --13332 --
NM_014756chr111405 ------
NM_014757chr552072 1904 1852 537 254 ------
NM_014766chr763423 2777 2714 2344 1138 453 11533 ----
NM_014767chr10102960 2682 2577 2319 1379 1346 1107 1097 747 554 --11395 --
NM_014770chr1271079 1051 812 534 439 342 138 1457 ----
NM_014774chr123212 797 1944 ----
NM_014786chr117925 816 354 343 321 312 104 --11019 --
NM_014810chr143586 724 279 226 ------
NM_014824chr1121947 1646 --1684 11795
NM_014826chr164077 3710 2779 2735 1135 677 --21261 109 --
NM_014828chr1441801 1773 1745 239 11969 1411 --
NM_014836chr1011410 1487 1744 --
NM_014873chr144323 4263 4080 1647 --24747 4143 --
NM_014877chr1797588 7237 7019 6941 6258 5113 2269 2159 490 ------
NM_014893chrY2549 133 ------
NM_014903chr123763 459 105 --1385 11769
NM_014904chr1023510 3206 --13088 --
NM_014920chr632827 1348 92 1437 ----
NM_014921chr19122727 2613 2450 2430 2260 2041 380 355 294 197 184 60 --21946 23 --
NM_014924chr14--12609 ----
NM_014952chr15101706 1476 1388 1348 1321 779 338 143 137 44 125 21445 1342 --
NM_014961chr411968 1198 ----
NM_014969chr111163 ------
NM_014977chr14199 ------
NM_014978chr102159 113 ----11679
NM_014989chr611753 --2662 595 --
NM_015000chr1232852 2180 1202 ------
NM_015008chr342945 875 368 301 --11132 --
NM_015020chr1653718 3105 1257 1011 42 --1477 --
NM_015039chr154172 4137 3876 3352 1732 ----1464
NM_015042chr15104194 3592 3367 2997 2941 2933 2704 2633 1215 735 13040 14157 14151
NM_015075chrX92170 2154 1875 1836 1716 1695 725 526 134 11395 12203 --
NM_015076chr684446 3964 3395 3199 3188 3111 3063 1441 --1799 --
NM_015077chr1794519 4191 3659 2979 1666 1546 1520 1090 631 1843 34286 3375 949 14678
NM_015090chr1146140 5447 5312 5069 4471 3975 2363 2079 2017 1995 1778 1022 994 111 24240 3885 23924 2346 14637
NM_015092chr1664055 3571 3240 1456 222 112 --24098 3993 13857
NM_015094chr22114244 4000 3810 3804 2934 2922 1757 717 683 333 85 --33894 3472 3293 --
NM_015097chr31772 ------
NM_015132chr7168 11553 21327 689 --
NM_015137chr821613 71 ------
NM_015155chr10113236 3182 3161 2467 2434 2244 1245 1030 617 440 76 12061 ----
NM_015157chr1171020 981 477 358 231 209 36 --1349 1874
NM_015185chrX72348 2335 2248 2106 2046 2039 507 ------
NM_015191chr1171992 1779 979 595 371 347 269 12632 ----
NM_015192chr2022755 1154 --11925 --
NM_015206chr1523570 494 ----1526
NM_015236chr421168 469 ------
NM_015264chr2294356 4246 3612 1924 1415 1383 1299 818 798 ------
NM_015269chr1169 ------
NM_015270chr1282172 1847 1603 1461 957 821 378 236 --11814 21617 185
NM_015271chr423555 1065 1193 ----
NM_015278chr632676 2132 407 --13409 --
NM_015288chr5113840 3815 3340 3288 2989 2655 1050 807 781 768 555 --12931 --
NM_015299chr1474016 3161 3067 898 331 262 243 13840 ----
NM_015305chr1461866 1768 1305 791 526 258 1313 ----
NM_015310chr847479 6447 1769 47 --12351 --
NM_015313chr1184578 3489 3259 3158 1200 1174 1012 816 ------
NM_015314chr71120 ----1787
NM_015330chr2292522 2329 2250 2034 641 619 561 381 142 --22009 324 --
NM_015336chr121303 1117 --1839
NM_015338chr2051883 1825 1615 681 498 1466 ----
NM_015344chr82719 565 --1599 --
NM_015349chr632524 2079 645 21907 857 12312 --
NM_015355chr171152 ------
NM_015365chrX22655 675 --23680 3088 --
NM_015385chr1021068 1002 ------
NM_015455chr523877 631 --13634 --
NM_015460chr33766 719 141 1686 ----
NM_015464chr721065 1035 --1326 --
NM_015477chr15----1227 --
NM_015497chr151790 ------
NM_015525chr61839 ------
NM_015534chr1----1978 --
NM_015542chr101458 1242 ----
NM_015553chr644538 3578 271 170 ------
NM_015554chr1522773 2298 ------
NM_015565chr21------1616
NM_015570chr71441 ------
NM_015576chr311026 142 153 --
NM_015602chr111295 ------
NM_015609chr182870 2856 2745 1940 689 683 573 252 --1224 --
NM_015622chr71101 ------
NM_015630chr21930 ------
NM_015640chr124349 1050 ----15093
NM_015678chr13--11266 1623 --
NM_015680chr22641 31 ------
NM_015833chr2141911 1665 321 33 1893 ----
NM_015878chr8----1653 1600
NM_015881chr1111138 1218 ----
NM_015888chr133014 2765 463 --1680 --
NM_015906chr121269 624 ----14456
NM_015912chr821669 1016 ------
NM_015955chr2------1526
NM_015975chrX21764 1752 ------
NM_015981chr593164 2126 2068 2030 1999 1032 889 446 241 --32217 2151 356 --
NM_015995chr15115281 5115 5049 4773 4099 3763 2091 1696 1528 1320 783 14005 ----
NM_016072chr1212439 --11978 --
NM_016075chr1343032 1258 1128 457 12267 ----
NM_016076chr122831 561 --12107 --
NM_016090chr111196 --1215 --
NM_016097chr182287 139 ------
NM_016131chr222246 657 ------
NM_016132chr1542915 2888 2687 2109 --1399 --
NM_016169chr10103187 2966 2817 2631 2533 2291 2263 1038 632 193 ----12869
NM_016203chr71107 ------
NM_016206chr332305 1051 45 23043 2134 --17985
NM_016217chr613648 --1146 --
NM_016230chr6161 ------
NM_016240chr891355 1277 1134 1096 654 542 127 117 45 ------
NM_016298chr373163 2849 2666 1218 787 629 513 ----12617
NM_016308chr12684 232 ------
NM_016312chr121174 ------
NM_016319chr121734 --1696 --
NM_016322chr922959 2140 --11249 --
NM_016376chr1763656 3232 1155 1141 1014 589 ------
NM_016377chr611232 ------
NM_016396chr15----12166 1150
NM_016413chr131383 ------
NM_016422chr1133086 2844 70 ------
NM_016424chr172598 66 ------
NM_016513chr632827 1348 92 1437 ----
NM_016530chr1542820 863 440 38 --1498 --
NM_016621chr1184250 4189 4175 3913 3543 2810 1218 1111 12794 13885 --
NM_016651chr143464 429 414 --1932 --
NM_016834chr1743822 3192 2774 1596 11000 2903 555 13904
NM_016835chr1743822 3192 2774 1596 11000 2903 555 13904
NM_016836chr22724 41 ------
NM_016839chr22724 41 ------
NM_016841chr1743822 3192 2774 1596 11000 2903 555 13904
NM_017412chr821341 524 ------
NM_017420chr1422748 2652 11074 ----
NM_017449chr141334 1094 652 438 --2662 309 --
NM_017455chr151154 ------
NM_017456chr1771942 1496 665 554 541 477 166 ------
NM_017545chr201115 ------
NM_017548chr31642 11679 1328 --
NM_017558chr161340 ------
NM_017580chr1042096 946 741 646 ------
NM_017590chr22132256 1999 1991 1740 1083 1033 922 897 787 452 342 267 73 11937 ----
NM_017594chr962758 2350 776 534 432 147 ------
NM_017599chr1211466 --1211 --
NM_017612chr121239 ------
NM_017628chr434124 1782 1289 ------
NM_017629chr111714 --1299 --
NM_017633chr612694 ------
NM_017635chr11----1412 --
NM_017637chr968366 7712 6419 5886 2655 545 --39382 9239 8787 16172
NM_017643chr1731212 528 21 181 --11962
NM_017658chr1424539 3366 1585 1496 --
NM_017666chrX21499 92 ------
NM_017667chr7--1524 ----
NM_017739chr15403 359 219 153 26 1106 199 --
NM_017744chr132404 2089 90 22125 260 1272 12357
NM_017752chrX41426 1321 327 77 ----1756
NM_017758chr1751386 1304 311 162 71 --21118 582 --
NM_017770chr612852 --2692 357 22343 1835
NM_017772chr651653 1335 1228 707 253 --11308 1569
NM_017780chr82625 594 ------
NM_017784chr3174 --1795 --
NM_017787chr1052707 1098 638 482 200 1219 1579 --
NM_017790chr91147 ------
NM_017824chr1041939 1928 1878 610 ------
NM_017873chr982593 1060 509 355 347 292 258 173 13132 1733 --
NM_017902chr10105697 5123 4951 4848 4320 4166 3809 1474 1431 657 --24243 3888 --
NM_017925chr92748 195 11715 ----
NM_017953chr12991 469 ------
NM_017954chr711137 11462 ----
NM_017998chr91912 ------
NM_018045chr162380 2146 1070 853 420 414 22477 529 22787 985 12661
NM_018084chr2----13051 --
NM_018086chr21106 ------
NM_018110chr164501 86 52 37 --1166 11032
NM_018120chr82444 42 --11401 --
NM_018128chr1711026 ------
NM_018171chr121823 --157 --
NM_018178chr121380 148 ----21571 1421
NM_018184chr3----12033 --
NM_018191chr132261 160 ------
NM_018287chr1011242 ------
NM_018302chr4------1607
NM_018314chr111285 ------
NM_018424chr91468 ------
NM_018444chr8149 --1670 --
NM_018489chr131782 665 94 --1181 1240
NM_018553chr1731745 1738 175 --11495 --
NM_018566chr114209 ----14776
NM_018650chr121853 1616 ------
NM_018667chr1682136 1849 1084 622 596 569 348 100 --21895 1840 --
NM_018685chr7----1108 --
NM_018711chr1251176 1003 511 131 51 ------
NM_018840chr20----1163 --
NM_018898chr512073 ------
NM_018899chr512073 ------
NM_018900chr512073 ------
NM_018901chr512073 ------
NM_018902chr512073 ------
NM_018903chr512073 ------
NM_018904chr512073 ------
NM_018905chr512073 ------
NM_018906chr512073 ------
NM_018907chr512073 ------
NM_018908chr512073 ------
NM_018909chr512073 ------
NM_018910chr512073 ------
NM_018911chr512073 ------
NM_018951chr721058 152 ------
NM_018963chr2121277 392 ------
NM_018979chr1252172 2064 1972 968 231 1286 22153 2071 --
NM_018994chr12444 417 ------
NM_019022chr1822803 749 ------
NM_019050chr411706 --1557 --
NM_019084chr101621 --12461 --
NM_019106chr2263103 2675 2604 2545 2343 525 1415 --12741
NM_019610chr111781 ------
NM_019895chr3--1750 ----
NM_020148chr1842994 2120 621 480 --1838 --
NM_020163chr371836 1764 1521 887 744 677 323 --1163 --
NM_020182chr2053146 1107 788 441 27 --12266 11342
NM_020184chr242144 1886 917 817 1317 1376 --
NM_020198chr17----21178 189 --
NM_020205chr173319 3116 2974 2800 1255 181 21 --21385 200 --
NM_020239chr121787 154 --1495 12113
NM_020245chr664498 3706 3675 647 535 147 1739 13081 --
NM_020336chr2022681 2626 --23563 867 --
NM_020337chr432126 1229 890 11244 ----
NM_020341chr201140 ------
NM_020342chr232143 2115 802 ------
NM_020363chrY138 ------
NM_020364chrY138 ------
NM_020420chrY138 ------
NM_020429chr742498 2098 719 383 --22631 123 --
NM_020432chr72458 236 ------
NM_020440chr162483 2369 2355 2278 2145 1232 --22890 800 --
NM_020453chr421319 686 1180 ----
NM_020455chr611853 ----157
NM_020463chr221005 332 ------
NM_020474chr181525 ------
NM_020640chr342232 1502 919 122 ------
NM_020686chr1682562 2556 2082 1994 670 340 266 116 1834 42366 2314 1231 175 --
NM_020699chr184971 4776 4723 3944 3697 654 594 561 14362 13663 --
NM_020717chrX74019 3341 1152 759 459 416 262 ----11931
NM_020728chr721939 1090 --1645 --
NM_020752chr1032555 1841 824 ------
NM_020771chr62348 109 ------
NM_020772chr1745360 3290 1355 682 18009 ----
NM_020774chr1835741 4695 1729 --13814 --
NM_020800chr3160 ------
NM_020810chr1423418 81 ------
NM_020830chr221283 395 ------
NM_020850chr1662528 2320 2310 774 665 48 --32681 2462 1055 --
NM_020856chr19------11074
NM_020859chr433097 2691 412 --23716 3609 --
NM_020868chr2196 --1226 --
NM_020873chr3----1171 --
NM_020919chr21311 ------
NM_020921chr1421449 514 11082 13025 --
NM_020948chr143185 955 199 61 --13475 --
NM_020952chr9----1327 1266
NM_020956chr19264709 4683 4573 4390 4305 4291 4250 4008 3760 3742 3633 3619 3550 3540 3359 3346 3260 3240 3124 3058 2954 1306 936 736 637 523 13886 44546 3353 3145 1159 --
NM_020983chr1272172 1847 1603 1461 821 378 236 --11814 21617 185
NM_021012chr17123101 2752 2489 2208 2085 1159 834 745 558 267 260 66 ------
NM_021020chr893298 2191 1306 1088 817 625 541 141 51 --32341 645 272 --
NM_021033chr1313289 --23051 727 1997
NM_021045chr1062532 2415 2358 2070 1929 956 ------
NM_021079chr1742922 2696 2294 642 --1803 --
NM_021090chr22114875 4338 4104 3911 3843 3209 1526 1195 1173 949 764 13948 34820 674 279 --
NM_021096chr2272641 2630 894 849 782 498 364 --23006 2151 1934
NM_021097chr232449 384 179 --1240 12189
NM_021148chr7--11879 ----
NM_021183chrX22373 1593 ----1297
NM_021189chr18900 422 405 399 392 209 192 34 ------
NM_021255chr1443474 547 482 425 13068 1113 12882
NM_021637chrX21143 1106 ----11174
NM_021638chr494037 3698 3668 3385 3142 1615 775 480 473 --1890 --
NM_021647chr464178 3501 1626 1299 583 188 --24764 43 --
NM_021649chr51686 --11220 --
NM_021783chrX2312 86 12404 1653 --
NM_021784chr204623 483 442 198 ------
NM_021785chrX1331 ------
NM_021809chr202797 79 ------
NM_021949chrX72379 2308 1913 822 756 713 475 ------
NM_021954chr1343093 1256 649 296 --1246 --
NM_021984chrX1149 11271 ----
NM_021987chrX1149 11271 ----
NM_021990chrX1149 11271 ----
NM_022041chr1621008 772 ------
NM_022049chr111300 --1599 --
NM_022093chr11919 ------
NM_022140chr53665 335 21 ------
NM_022166chr1675674 5494 4840 3833 2372 2361 1790 14393 35237 1462 507 --
NM_022476chr161155 ------
NM_022477chr2021440 613 11617 11644 --
NM_022497chr333515 3010 2968 --23591 406 --
NM_022648chr2114098 3611 3479 3119 3083 2962 1864 1468 1441 1141 709 --23575 42 --
NM_022719chr22103283 2479 1225 1130 1097 1072 866 621 358 345 --21036 142 --
NM_022735chr121307 32 ------
NM_022737chr1921080 987 --21197 1092 --
NM_022755chr952318 1722 1684 1006 293 ------
NM_022780chr221846 189 ------
NM_022824chr51482 --186 --
NM_022828chr51637 ----1541
NM_022845chr1621437 367 --11914 --
NM_022893chr212025 ----1627
NM_022898chr1443482 829 819 177 --13963 --
NM_023034chr81492 1211 1583 --
NM_023039chr51355 ------
NM_023940chr44880 131 122 46 --1109 1927
NM_024007chr51524 ------
NM_024345chr936068 5878 3887 ----14880
NM_024408chr11844 ------
NM_024423chr1811166 ------
NM_024429chr71107 ------
NM_024430chr1841704 1489 702 54 ------
NM_024501chr2----1736 --
NM_024523chr721255 54 ----1529
NM_024524chr312474 --12032 --
NM_024539chrX1406 ------
NM_024545chr22154 66 --1535 --
NM_024561chr13154 ------
NM_024569chr152747 2554 2255 2173 2093 --1473 --
NM_024615chr5--1197 ----
NM_024646chr123321 200 ------
NM_024686chr1----1422 --
NM_024759chr81627 ------
NM_024812chr82764 22 --21857 1714 --
NM_024830chr572163 2151 1681 754 210 143 133 --11884 --
NM_024887chr171842 1655 1610 766 265 250 48 --21980 1734 --
NM_024913chr7--11221 ----
NM_024915chr862809 1964 1764 859 792 548 22036 782 ----
NM_024946chr1651775 1767 380 257 38 --1325 --
NM_024947chr357795 7490 2425 757 250 --26619 2413 17002
NM_024969chr21633 ------
NM_024971chr9----1327 1266
NM_024989chr227661 1608 ------
NM_024991chr1021068 1002 ------
NM_025049chr152403 29 1150 ----
NM_025133chr2----11134 --
NM_025134chr161864 ----12269
NM_025146chr321670 332 ----12171
NM_025160chr111636 ----22806 656
NM_025179chr184671 4634 4090 3311 3275 3141 1948 1771 ------
NM_025248chr1793240 2224 1134 1095 979 938 841 761 521 --23140 1014 --
NM_025250chr772967 2945 2039 1165 832 684 161 --32400 932 181 --
NM_030627chr523947 630 ------
NM_030634chr132226 972 534 --22152 484 --
NM_030637chr14--188 ----
NM_030647chr745394 493 262 248 ------
NM_030648chr424688 4398 12200 23563 428 --
NM_030650chr2104003 3661 3590 3580 3541 2937 2673 2638 1629 98 ------
NM_030674chr1223597 3579 ----14862
NM_030759chr10194 1322 ----
NM_030761chr142603 1718 546 171 --21015 904 --
NM_030762chr121375 ------
NM_030784chr6198 ------
NM_030806chr1179356 8595 8434 7955 7929 7379 6981 6972 6854 3305 2743 2647 1864 1486 1384 1359 873 --16744 --
NM_030816chr112492 ------
NM_030885chr332132 205 22 --11462 --
NM_030920chr111978 ------
NM_030922chr152830 555 ------
NM_030939chr61925 --11099 --
NM_030959chr6--1290 ----
NM_031157chr12----1247 --
NM_031216chr1811424 --1312 --
NM_031262chr92175 160 ------
NM_031263chr92232 217 ------
NM_031411chr512073 ------
NM_031417chr19122653 2537 2517 2398 2323 2277 2040 630 564 532 462 343 12479 11746 --
NM_031426chr962717 2538 2445 2420 721 113 --32608 247 170 --
NM_031435chr12----11354 --
NM_031442chrX1271 12676 ----
NM_031468chr797303 6418 6303 5535 2117 1719 485 467 409 12386 26223 202 --
NM_031483chr2032433 2275 1325 ------
NM_031844chr11248 --22683 647 --
NM_031845chr21918 --11117 --
NM_031847chr21918 --11117 --
NM_031849chr512073 ------
NM_031857chr512073 ------
NM_031860chr512073 ------
NM_031886chr1992605 2563 2388 1786 991 660 537 67 55 ------
NM_032013chr2021440 613 11617 11644 --
NM_032121chrX1831 ------
NM_032138chr131117 ------
NM_032139chr191291 ------
NM_032144chr2----11802 --
NM_032154chr101880 ------
NM_032221chr2031339 367 352 --11834 --
NM_032242chr382734 2640 1078 900 866 784 755 230 --52958 2226 684 329 314 --
NM_032268chr16133207 3159 3151 3051 2691 2545 2382 2149 2080 1285 1127 1069 251 --12420 --
NM_032281chr19102921 2900 2876 2852 2574 759 541 369 125 82 1938 12655 1768
NM_032311chr2282023 2006 1686 1501 765 592 390 361 --2399 115 --
NM_032312chr21336 ------
NM_032315chr1--1231 ----
NM_032364chr12----2903 46 --
NM_032373chr1035402 3660 1114 1933 ----
NM_032408chr741242 1229 1029 841 ------
NM_032413chr151116 ------
NM_032434chr211537 ------
NM_032438chr631029 573 285 ------
NM_032439chr101413 ------
NM_032440chr101758 ----12124
NM_032449chr14737 550 478 131 12139 12079 --
NM_032458chrX11364 --1420 11098
NM_032468chr81372 ------
NM_032521chr2042755 2644 676 211 12163 ----
NM_032550chr1021077 87 ------
NM_032558chr9----11266 --
NM_032595chr17121498 1141 1072 1033 393 367 361 271 261 241 216 161 ------
NM_032687chr8125 ------
NM_032711chr1764229 4146 2984 2649 1450 152 11586 34087 3911 577 --
NM_032800chr161987 1792 1784 867 524 75 21717 737 --1942
NM_032812chr101317 ------
NM_033020chr121269 624 ----14456
NM_033027chr37983 906 861 854 365 206 63 ------
NM_033044chr141042 493 322 304 --11032 --
NM_033102chr16931 529 210 173 77 29 1326 2366 273 --
NM_033102chr16931 529 210 173 77 29 1326 2366 273 --
NM_033133chr1752520 2510 1304 1036 420 1661 32934 990 829 --
NM_033207chr1062103 1743 1650 139 59 45 --1295 --
NM_033290chrX73513 2668 2602 2490 1411 957 135 1713 1719 --
NM_033358chr22103 33 ------
NM_033387chr962207 2082 664 607 351 344 --22230 803 12407
NM_033389chr1763592 1593 921 483 135 50 13271 ----
NM_033397chr1032214 1550 42 11706 ----
NM_033406chr11--140 ----
NM_033407chr1----1465 --
NM_033429chr1542107 1168 790 414 1450 22203 1132 --
NM_033449chr5102004 1399 1382 766 563 546 515 472 273 133 --21965 664 --
NM_033495chrX------1862
NM_033503chr1563765 3479 3094 1200 639 482 11452 33450 495 269 13664
NM_033644chr52452 29 ------
NM_033645chr52452 29 ------
NM_033656chr2125746 5667 1918 14020 --
NM_052818chr1311855 ------
NM_052827chr124883 867 828 264 1422 ----
NM_052876chr19112296 2241 1964 1953 1071 1004 905 855 748 512 312 ------
NM_052879chr121318 --13480 --
NM_052906chr22194921 4731 4172 4093 4008 3426 3222 1983 1779 1469 1316 1159 1039 1012 791 694 308 62 39 21919 364 54743 4365 3695 1832 1218 --
NM_052911chr18----1954 --
NM_052913chr6130 ------
NM_052918chr1021239 389 --1334 --
NM_052965chr13895 109 90 ------
NM_052966chr143793 2537 2377 1013 --1772 148
NM_053016chr967631 6816 6580 6208 5187 4874 26922 5229 --15676
NM_053023chr1161192 986 912 753 718 109 1266 ----
NM_053024chr3----11348 --
NM_053025chr31392 --11560 --
NM_053026chr31392 --11560 --
NM_053027chr31392 --11560 --
NM_053028chr31392 --11560 --
NM_053031chr31392 --11560 --
NM_053032chr31392 --11560 --
NM_053056chr1152957 1074 484 272 43 ------
NM_053279chr872715 841 401 238 169 131 39 --22687 27 --
NM_057175chr422501 442 12400 ----
NM_057178chr1732149 108 64 ------
NM_057749chr81376 ------
NM_058229chr8131 ------
NM_058240chr1441143 369 166 56 --11202 --
NM_080392chr11503 ------
NM_080491chr1163000 2454 1194 747 344 173 --1338 1837
NM_080546chr921519 692 --11561 --
NM_080599chr101458 1242 ----
NM_080666chr1411192 --11589 --
NM_080669chr17114071 3681 3623 3349 1789 1539 1296 769 357 113 26 --1499 --
NM_080671chr232012 915 363 ----11892
NM_080676chr2042977 846 646 557 --12687 --
NM_080717chr1211175 ------
NM_080743chr642540 2279 254 179 --11784 --
NM_080797chr2053234 928 599 130 67 11084 23454 581 --
NM_080872chr863413 519 479 380 277 205 ------
NM_130439chr1021604 141 ------
NM_130439chr1021604 141 ------
NM_130468chr153555 102 95 1186 1767 --
NM_130469chr142668 244 ------
NM_130811chr201874 ------
NM_130830chr393973 3942 2879 2692 2640 2513 1087 274 22 ------
NM_130838chr1511863 ----1325
NM_130839chr1511863 ----1325
NM_133170chr20157376 6735 6523 6325 6122 5008 3098 2335 1883 1481 793 589 488 245 152 --36309 6269 2638 --
NM_133264chr17113808 3560 3485 2510 1432 1203 1070 1029 845 669 525 13283 13935 --
NM_133265chrX21279 550 --21438 95 --
NM_133329chr2--11518 --11409
NM_133433chr51825 ------
NM_133468chr772320 2040 1861 1786 757 461 445 ------
NM_133642chr2251147 875 493 392 321 --1934 2845 284
NM_138270chrX1763 22954 564 ----
NM_138292chr1132737 1157 1108 ------
NM_138340chr181438 ------
NM_138396chr122784 702 --1368 --
NM_138423chr15------11595
NM_138447chr163788 740 678 1257 1285 --
NM_138457chr6102884 2356 2156 1358 1213 703 366 235 170 24 --13260 --
NM_138473chr1264941 4603 4444 3711 3287 1064 ------
NM_138558chr1252 23 --1435 --
NM_138576chr1443482 829 819 177 --13963 --
NM_138578chr2071385 1013 1001 964 511 292 127 --1271 --
NM_138633chr611232 ------
NM_138713chr1645722 2690 1255 535 --13082 18080
NM_138714chr1645722 2690 1255 535 --13082 18080
NM_138727chr132404 2089 90 22125 260 1272 12357
NM_138728chr132404 2089 90 22125 260 1272 12357
NM_138806chr3----1771 --
NM_138927chr211323 ------
NM_138961chr11154 ------
NM_138971chr1133590 1376 984 --1779 --
NM_138971chr1133590 1376 984 --1779 --
NM_138972chr1133590 1376 984 --1779 --
NM_138972chr1133590 1376 984 --1779 --
NM_138973chr1133590 1376 984 --1779 --
NM_138973chr1133590 1376 984 --1779 --
NM_138980chr42511 175 ------
NM_138981chr42642 306 ------
NM_138982chr42511 175 ------
NM_139035chrX1683 ------
NM_139067chr121308 --1263 --
NM_139071chr1211242 ------
NM_139072chr2----1697 --
NM_139244chr61273 --1344 --
NM_139283chr12----31993 898 532 --
NM_144571chr456030 5955 1244 1165 180 26952 5754 11797 --
NM_144574chr141524 ------
NM_144579chr282891 2783 2529 2474 1962 1847 889 53 1902 --11905
NM_144588chr1071402 1294 630 586 311 286 235 1983 21417 463 --
NM_144595chr13150 ------
NM_144599chr1555131 5107 4182 3891 3545 --14862 --
NM_144664chr1122397 345 ------
NM_144671chr1261557 1422 759 629 606 375 ----11978
NM_144778chr132496 440 --1286 --
NM_144967chrX141 ------
NM_144982chr121567 ------
NM_145112chr14----21140 504 --
NM_145117chr1162615 2527 2191 1289 1172 1078 ------
NM_145266chr51324 ------
NM_145277chr12212 151 ------
NM_145349chr1731942 1563 788 --11611 11666
NM_145350chr1771294 599 592 476 433 290 140 ----11018
NM_145800chrX4961 691 652 115 ------
NM_145802chrX3910 640 64 ------
NM_145912chr22104573 4039 3903 3335 1828 1782 1673 722 672 419 --3801 539 288 --
NM_147202chr952282 2234 1928 295 43 --32413 430 365 --
NM_148174chr8----1653 1600
NM_148177chr8131 ------
NM_148898chr7----1317 --
NM_148899chr7----1317 --
NM_148976chr111198 ------
NM_152244chr172930 850 1783 31208 902 226 --
NM_152309chr1032034 1930 504 --1200 --
NM_152342chr162529 115 ------
NM_152344chr171121 ------
NM_152352chr1811897 1124 12903 --
NM_152380chr121576 1108 ------
NM_152408chr5------154
NM_152417chr811300 ------
NM_152424chrX74351 3608 1698 1561 1381 556 72 --11067 --
NM_152470chr18103791 3646 3278 3072 960 906 890 826 273 260 --23396 1176 --
NM_152519chr21174 --12042 --
NM_152588chr1221780 1691 1407 ----
NM_152594chr15----11431 --
NM_152653chr3--1468 ----
NM_152660chr11896 151 ----
NM_152667chr2041386 1269 1051 617 --11536 --
NM_152688chr61391 ------
NM_152699chr342872 935 561 447 ------
NM_152722chr1161726 1307 1237 680 636 67 --2552 309 --
NM_152733chr6126283 6114 5434 4865 4534 4473 4424 4347 2486 1894 1609 1327 26142 1527 25443 175 --
NM_152739chr72916 30 ------
NM_152754chr733689 611 161 --13662 11324
NM_152758chr823059 1855 ------
NM_152772chr12----1411 --
NM_152780chrX----11148 --
NM_152787chrX33180 2955 530 ------
NM_152789chr741412 1060 491 162 ------
NM_152835chr112109 --1111 --
NM_152860chr122111 30 ----11469
NM_152914chr17114223 3221 3034 1500 1353 1230 1219 1126 868 534 334 14379 23933 1726 1281
NM_152924chr1546300 5028 4804 2333 --36138 4351 902 --
NM_153029chr1673207 3189 3022 1602 813 791 35 1636 11231 --
NM_153035chr162555 2375 2318 675 641 280 ------
NM_153050chr22114875 4338 4104 3911 3843 3209 1526 1195 1173 949 764 13948 34820 674 279 --
NM_153051chr22114875 4338 4104 3911 3843 3209 1526 1195 1173 949 764 13948 34820 674 279 --
NM_153184chr311791 ------
NM_153188chr553833 2272 1469 155 109 --14404 --
NM_153207chr1233767 709 648 ------
NM_153267chr93591 303 165 ------
NM_153273chr372396 882 610 519 454 429 178 1569 1890 1101
NM_153280chrX165 ------
NM_153354chr51269 1258 168 --
NM_153456chr1356053 5887 5381 5326 2189 --11944 --
NM_153499chr1272627 2079 1941 1204 765 615 149 1541 1715 --
NM_153500chr1272627 2079 1941 1204 765 615 149 1541 1715 --
NM_153607chr512975 11034 ----
NM_153620chr711615 ------
NM_153675chr204623 483 442 198 ------
NM_153715chr721058 152 ------
NM_153756chr161927 1877 1839 1412 368 276 11281 11862 --
NM_153836chr21750 --31350 724 99 --
NM_170609chr621054 962 ------
NM_170665chr1253870 3328 1659 1566 1089 13386 ----
NM_170692chr12912 789 --1757 1995
NM_170706chr154172 4137 3876 3352 1732 ----1464
NM_170780chr3----1771 --
NM_170782chr11388 ------
NM_171825chr593164 2126 2068 2030 1999 1032 889 446 241 --32217 2151 356 --
NM_172037chr811207 ------
NM_172216chr1272529 1981 1843 1106 667 517 51 1443 1617 --
NM_172226chr1272627 2079 1941 1204 765 615 149 1541 1715 --
NM_172240chr121133 ------
NM_172344chr2--11518 --11409
NM_173078chrX1119 ------
NM_173082chr62569 143 ------
NM_173198chr932089 2023 262 --1403 --
NM_173200chr932089 2023 262 --1403 --
NM_173214chr1645722 2690 1255 535 --13082 18080
NM_173463chr484213 3946 3453 2901 1355 927 483 201 ------
NM_173468chr455721 5504 437 212 118 ------
NM_173495chrX42530 2201 2157 2134 --11741 --
NM_173511chr211311 ----12757
NM_173532chr12586 164 --1668 --
NM_173536chr413141 ----14922
NM_173552chr32449 331 ------
NM_173595chr12175094 5054 4848 4666 4085 3922 3908 3842 3499 1974 1712 1474 1263 1213 1115 796 517 --22055 688 14448
NM_173797chr521090 362 ------
NM_174911chr863878 2635 1320 950 777 549 12775 11000 --
NM_174921chr421062 244 ------
NM_174926chr11------1113
NM_174934chr11113255 2957 2911 2679 1332 1051 723 665 643 486 181 11233 2712 267 --
NM_175748chr1451621 1548 758 646 550 1257 11887 --
NM_175854chr1332088 2070 417 ------
NM_175856chr51157 ------
NM_175861chr1244067 3727 207 86 ----1546
NM_175876chr121733 653 ------
NM_175898chr151464 ------
NM_175907chr1812618 ----11737
NM_177414chr11682 ----11313
NM_177424chr131548 1375 40 ------
NM_177974chr15------11595
NM_177990chr201140 ------
NM_177999chr983156 2360 1072 918 910 855 821 736 13695 11296 --
NM_178136chr2282023 2006 1686 1501 765 592 390 361 --2399 115 --
NM_178151chrX77679 7452 6200 5366 2828 2036 353 187 ----
NM_178152chrX77679 7452 6200 5366 2828 2036 353 187 ----
NM_178153chrX77679 7452 6200 5366 2828 2036 353 187 ----
NM_178426chr152185 1897 1831 1577 551 ------
NM_178427chr152085 1797 1731 1477 451 ------
NM_178454chr1------1762
NM_178496chr311379 --11424 --
NM_178527chr1127 ------
NM_178554chr392747 1318 1206 1072 1033 599 329 59 33 13411 ----
NM_178565chr811597 ------
NM_178566chr9----11791 --
NM_178586chr1411777 ------
NM_181302chr141524 ------
NM_181308chr141524 ------
NM_181349chr742498 2098 719 383 --22631 123 --
NM_181358chr134145 1513 128 --23377 2624 13570
NM_181486chr1211175 ------
NM_181489chr3112451 2220 2065 1713 1253 1131 1079 908 498 372 94 25831 2546 --11223
NM_181521chr16116752 6463 5533 5485 5469 5441 1743 581 523 332 206 12422 21690 138 --
NM_181537chr17171 ------
NM_181552chr72966 45 ------
NM_181656chr173758 707 174 --1817 --
NM_181672chrX31333 1325 810 ------
NM_181673chrX31333 1325 810 ------
NM_181714chr621913 398 ------
NM_181842chr61294 --2209 57 --
NM_181897chr31443 12478 ----
NM_182485chr43494 305 41 ------
NM_182620chr1751665 1404 895 171 101 ------
NM_182646chr43494 305 41 ------
NM_182649chr201261 ------
NM_182663chr122034 1512 ------
NM_182664chr122164 1642 ------
NM_182665chr122034 1512 ------
NM_182691chr71182 ------
NM_182692chr71182 ------
NM_182734chr2013002 --12172 --
NM_182758chr1523261 2916 12815 ----
NM_182765chr1021580 636 ------
NM_182898chr746112 4186 1248 66 1989 11078 --
NM_182899chr746112 4186 1248 66 1989 11078 --
NM_182936chr1441143 369 166 56 --11202 --
NM_182943chr3--11002 ----
NM_182948chr132674 1139 1050 12214 ----
NM_182964chr1162615 2527 2191 1289 1172 1078 ------
NM_182970chr20174236 4069 3926 3306 3293 3233 3203 3026 2877 2711 2603 1038 976 501 466 99 76 11543 33050 1626 895 --
NM_183002chr1441143 369 166 56 --11202 --
NM_183058chr10144 ------
NM_183381chr3----1681 --
NM_183383chr3----1681 --
NM_183384chr3----1681 --
NM_183397chr20105031 4937 4276 3948 3941 3726 585 525 341 82 24606 1535 14132 125
NM_183422chr13----1342 --
NM_194278chr1493615 3308 3080 2803 1610 1317 979 222 135 21229 1127 2648 456 11158
NM_194286chr12145393 5316 5276 4888 4268 2060 1867 1849 1716 1539 1274 782 155 97 11654 21166 668 --
NM_194314chr132147 1338 78 ----13711
NM_194358chr1241682 663 443 145 ------
NM_194359chr1241682 663 443 145 ------
NM_194463chrX1406 ------
NM_197955chr151116 ------
NM_198040chr1121179 1089 1083 491 362 332 220 190 168 121 102 77 --2884 109 --
NM_198087chr16------1196
NM_198088chr16------1196
NM_198097chr71101 ------
NM_198158chr332230 2164 1859 ----12513
NM_198159chr332230 2164 1859 ----12513
NM_198177chr332230 2164 1859 ----12513
NM_198178chr332230 2164 1859 ----12513
NM_198225chr1011410 1487 1744 --
NM_198268chr134145 1513 128 --23377 2624 13570
NM_198269chr134145 1513 128 --23377 2624 13570
NM_198273chr5----1131 --
NM_198484chr321374 78 --12096 --
NM_198490chr3103348 3125 2203 2185 1287 1257 1141 859 421 287 11128 22894 2354 --
NM_198513chr831274 504 334 --1637 --
NM_198581chr257047 7011 6865 5328 526 --26993 2968 --
NM_198595chr494037 3698 3668 3385 3142 1615 775 480 473 --1890 --
NM_198686chr1472632 2354 865 454 217 110 98 12104 ----
NM_198721chr4141 ------
NM_198794chr1431121 529 297 --11374 --
NM_198834chr1741718 806 618 320 1446 --147
NM_198836chr1741718 806 618 320 1446 --147
NM_198837chr1741718 806 618 320 1446 --147
NM_198838chr1741718 806 618 320 1446 --147
NM_198839chr1741718 806 618 320 1446 --147
NM_198896chr11----11946 --
NM_198990chr7----12355 1280
NM_199169chr2053146 1107 788 441 27 --12266 11342
NM_199170chr2053146 1107 788 441 27 --12266 11342
NM_199171chr2053146 1107 788 441 27 --12266 11342
NM_199188chr121318 --13480 --
NM_199190chr121318 --13480 --
NM_199262chr17102016 1946 1806 1767 1556 1448 699 668 577 497 1178 ----
NM_199320chr421802 747 --12626 --
NM_199320chr421802 747 --12626 --
NM_199324chr423088 1024 ------
NM_199355chr1621304 342 --2335 37 --
NM_201266chr282904 2781 2169 1855 1117 844 830 233 12522 22156 49 --
NM_201279chr282904 2781 2169 1855 1117 844 830 233 12522 22156 49 --
NM_201280chr61175 1358 ----
NM_201432chr17156133 5710 5652 4799 4787 4540 1526 1431 1408 1071 405 381 165 140 44 ------
NM_201433chr17156133 5710 5652 4799 4787 4540 1526 1431 1408 1071 405 381 165 140 44 ------
NM_201436chr71687 ------
NM_201516chr71743 ------
NM_201517chr71687 ------
NM_202004chr12212 151 ------
NM_203349chr1531924 853 209 ------
NM_203372chr22435 403 1681 ----
NM_203394chr1222388 1105 ------
NM_203459chr1------1993
NM_203463chr253356 3123 1491 1222 296 1702 14173 --
NM_205860chr122135 687 ------
NM_205861chr171842 1655 1610 766 265 250 48 --21980 1734 --
NM_206594chr112695 ------
NM_206595chr112695 ------
NM_206808chr13134 ------
NM_206866chr212635 550 --12190 --
NM_206876chr2------11307
NM_206884chr7155 ------
NM_206885chr7155 ------
NM_206909chr847479 6447 1769 47 --12351 --
NM_206944chr9----1327 1266
NM_206945chr9----1327 1266
NM_206946chr9----1327 1266
NM_206947chr9----1327 1266
NM_207012chr1023457 745 --11025 --
NM_207111chr7122530 2452 2319 1969 1767 554 498 457 416 406 387 115 ----1153
NM_207116chr7122530 2452 2319 1969 1767 554 498 457 416 406 387 115 ----1153
NM_207304chr132383 327 --21009 173 --
NM_207371chr1021506 1302 --1211 --
NM_207380chr15113499 3207 3140 3118 2655 2530 1469 1338 1149 752 155 12375 23475 2639 --
NM_207406chr432200 1220 156 --34977 1405 1353 11297
NM_207481chr21899 ------
NM_207517chr1511610 --1567 --
NM_207518chr194993 435 91 71 1141 21076 368 --
NM_212471chr1731715 527 295 11455 ----
NM_212472chr1731715 527 295 11455 ----
NM_213606chr103694 631 511 ------
NM_213651chr11506 11506 ----
NM_213652chr12212 151 ------
NM_213653chr12212 151 ------
NM_213662chr1762134 2127 1960 1733 635 32 ------