TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1291
miRNA Sequence: UGGCCCUGACUGAAGACCAGCAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr882103 2049 1994 1869 1814 917 420 352 22090 114 32159 1796 1651 11633
NM_000053chr1341723 1413 815 25 --1410 --
NM_000084chrX56775 6295 5607 5239 4691 15573 15553 11563
NM_000092chr254128 3099 1710 1154 1111 ------
NM_000104chr221076 231 ------
NM_000114chr201804 1245 1867 --
NM_000192chr1211423 ------
NM_000206chrX----133 --
NM_000208chr1964266 3792 3716 3121 1115 604 ------
NM_000217chr1244610 4466 3837 3467 12008 24735 3512 --
NM_000259chr1534865 4680 928 ------
NM_000262chr2231238 430 72 31572 1340 463 ----
NM_000267chr171919 ------
NM_000271chr18141 ------
NM_000314chr101166 12222 ----
NM_000315chr11147 ------
NM_000321chr1311594 11191 ----
NM_000330chrX21548 504 1845 --2205 92
NM_000332chr682446 764 672 545 423 376 359 269 --1237 14663
NM_000335chr341639 693 552 91 --1814 11483
NM_000337chr524310 2121 26019 2088 --11334
NM_000368chr933815 3253 1679 1254 192 --
NM_000390chrX22354 1256 ------
NM_000399chr102274 121 ------
NM_000406chr421929 1050 12051 ----
NM_000408chr213427 ------
NM_000430chr1731046 413 291 ------
NM_000434chr6171 --1394 --
NM_000445chr86721 373 343 312 272 64 --2986 185 --
NM_000461chr334230 1060 840 --1403 --
NM_000478chr12239 90 1181 2610 538 --
NM_000489chrX33252 762 158 ----12954
NM_000516chr20192 ------
NM_000542chr2----1332 --
NM_000555chrX37680 2035 354 --13155 187
NM_000587chr511238 ------
NM_000599chr284024 3662 3329 3006 2945 1589 399 165 --23589 3523 --
NM_000609chr1051049 584 117 92 68 32416 1114 479 2300 98 1551
NM_000615chr1142895 2136 2023 211 --12738 12721
NM_000633chr1833555 1163 1065 11409 23249 1031 --
NM_000634chr21353 1159 21241 330 --
NM_000675chr221180 1237 1269 1633
NM_000686chrX11073 1580 ----
NM_000719chr1276180 5251 4736 1313 447 227 220 25461 2420 1420 16624
NM_000721chr14625 601 531 481 1960 21728 784 --
NM_000722chr71178 185 ----
NM_000725chr125922 776 635 68 53 --2325 141 --
NM_000726chr2----11017 --
NM_000739chr71289 ------
NM_000782chr202804 86 ------
NM_000806chr511516 ------
NM_000831chr1135936 5788 5553 5203 5082 4984 4382 3945 2175 2026 1924 1690 1530 33954 3832 1860 14821 --
NM_000832chr94845 590 233 201 --3782 253 226 --
NM_000838chr632670 493 100 --12425 --
NM_000839chr31365 ----167
NM_000868chrX22117 1989 ------
NM_000872chr101101 --1542 --
NM_000875chr1575584 5252 4753 2184 2035 1569 939 1544 45260 2135 2050 1912 --
NM_000880chr81133 ------
NM_000901chr411929 ------
NM_000924chr124961 550 481 161 2912 340 21076 326 --
NM_000942chr15----162 --
NM_000945chr2----1761 --
NM_000950chrX13616 ------
NM_000958chr511203 197 ----
NM_001001132chr211252 ------
NM_001001342chr10----11223 --
NM_001001549chr722345 537 11116 1198 --
NM_001001550chr722345 537 11116 1198 --
NM_001001555chr722345 537 11116 1198 --
NM_001001556chr15136 ------
NM_001001701chr432091 1454 354 --12217 --
NM_001001791chr1071309 536 424 394 340 185 146 --31244 588 124 --
NM_001001890chr2154207 3923 1343 1093 124 11045 ----
NM_001001924chr81629 --1330 --
NM_001001925chr81629 --1330 --
NM_001001928chr2278327 6258 5758 5048 3253 2939 1800 16920 ----
NM_001001931chr81629 --1330 --
NM_001001974chr10----12135 --
NM_001001995chrX21801 290 ------
NM_001002295chr10----2243 25 --
NM_001002762chr1062292 2194 610 437 337 192 22126 329 145 1762
NM_001002838chrX31587 1273 537 ------
NM_001002860chr1411267 --1641 11772
NM_001002914chr1751119 961 889 835 297 ------
NM_001003406chr2263006 2642 531 407 363 118 12676 32415 353 110 12972
NM_001003652chr1847345 6910 5897 1894 --13405 --
NM_001003682chr13443 361 305 --31337 287 190 --
NM_001003760chr622359 213 ------
NM_001003794chr353057 2332 1985 945 494 2938 482 ----
NM_001003800chr933050 2356 930 11000 1735 11006
NM_001003940chr1593766 3710 3480 3095 2359 943 443 269 207 --23185 482 22810 1452
NM_001003942chr1593766 3710 3480 3095 2359 943 443 269 207 --23185 482 22810 1452
NM_001003943chr1593770 3714 3484 3099 2363 947 447 273 211 --23189 486 22814 1456
NM_001003954chr8129 ------
NM_001004023chr1--1166 ----
NM_001004346chr41278 ------
NM_001004720chr23884 315 224 ------
NM_001004722chr231053 484 393 --1160 --
NM_001005209chr22242 116 ------
NM_001005290chr1----1100 --
NM_001005404chr1772739 870 634 401 307 121 107 --23876 315 --
NM_001005473chr52114 55 11697 ----
NM_001005609chrX43642 337 219 153 --12483 --
NM_001005746chr2----11017 --
NM_001005747chr2----11017 --
NM_001005849chr171499 ------
NM_001006115chr362397 1843 890 508 430 291 --72031 907 882 769 519 387 347 --
NM_001006605chr1--1857 ----
NM_001006605chr1--1857 ----
NM_001006626chr71289 ------
NM_001006627chr71289 ------
NM_001006628chr71289 ------
NM_001006629chr71289 ------
NM_001006630chr71289 ------
NM_001006631chr71289 ------
NM_001006632chr71289 ------
NM_001006665chr13784 112 27 --1749 188
NM_001006946chr23756 642 204 --21687 1419 --
NM_001007024chr1743988 3151 3015 1584 --11717 13553
NM_001007025chr1743988 3151 3015 1584 --11717 13553
NM_001007102chr611028 --1573 11532
NM_001007156chr1531285 1210 188 --21757 1649 --
NM_001007246chr2111777 --11924 --
NM_001007553chr1--11077 11033 --
NM_001007794chr11213 ------
NM_001008220chr5103519 3308 3142 2557 2502 2425 1225 423 253 179 13595 1915 --
NM_001008222chrX--143 21350 278 --
NM_001008392chr323264 120 12312 --21107 633
NM_001008407chr731791 729 284 ----1437
NM_001008541chr1021603 28 2795 143 ----
NM_001008541chr1021603 28 2795 143 ----
NM_001008564chr132432 376 ------
NM_001008701chr1982728 1093 857 553 356 196 183 169 12432 32600 728 60 --
NM_001008707chr1431334 635 575 ------
NM_001008711chr81631 --139 --
NM_001008726chr1421589 1191 ------
NM_001008738chr51126 ------
NM_001008938chr11--1407 ----
NM_001009185chr5----1641 --
NM_001009554chr443152 1814 1627 205 --1583 --
NM_001009554chr443152 1814 1627 205 --1583 --
NM_001009993chr264206 3840 3683 1688 1584 1397 32969 1532 1366 11156 12981
NM_001010888chrX33571 1838 504 23983 918 --1220
NM_001010917chr1051979 1778 1417 353 46 12089 2764 490 --
NM_001010923chr611638 ------
NM_001010935chr111042 ------
NM_001010942chr1211263 ------
NM_001011546chr20--1726 187 --
NM_001011666chr734185 2014 1078 ------
NM_001012329chr152235 2106 1746 1652 729 141 3869 807 518 11704
NM_001012393chr1124422 202 ------
NM_001012398chr161154 ------
NM_001012426chr623217 365 12358 83371 2516 1229 815 390 334 303 24 --
NM_001012427chr623217 365 12358 83371 2516 1229 815 390 334 303 24 --
NM_001012642chr1541942 1332 577 544 12030 41949 775 628 501 --
NM_001012755chrX43348 1716 1518 528 ------
NM_001012974chr6------172
NM_001013415chr411116 ------
NM_001013437chr181109 ------
NM_001013620chr1235940 5498 1067 --28094 759 --
NM_001013693chr151175 976 758 188 84 22075 134 42182 1899 370 356 --
NM_001013693chr151175 976 758 188 84 22075 134 42182 1899 370 356 --
NM_001013839chr17112521 2264 2170 1866 1782 1665 1653 906 796 344 335 11804 42126 1930 1889 411 1684
NM_001014435chr16249 31 --1221 --
NM_001014797chr1077185 6191 2922 2871 2745 2493 1034 11237 --17623
NM_001014839chr12395 339 --1350 --
NM_001014841chr12395 339 --1350 --
NM_001014972chr2142 ------
NM_001015048chr1422976 2352 ------
NM_001015049chr1422976 2352 ------
NM_001015887chr321205 467 --1505 --
NM_001017368chr172107 63 ------
NM_001017424chr121664 1196 --1366 --
NM_001017425chr121664 1196 --1366 --
NM_001017440chr776657 6223 5789 2868 2297 466 202 1411 16418 --
NM_001017523chr1221234 525 --11828 --
NM_001017923chr1421621 60 ------
NM_001017970chr141865 --1406 --
NM_001017995chr584053 3997 3187 3003 1500 1353 367 26 21403 1341 33884 1242 742 --
NM_001018025chrX--1152 ----
NM_001018050chr2293056 2128 1313 1148 1073 1001 992 885 654 42983 2583 1194 1130 13114 12863
NM_001018052chr2293056 2128 1313 1148 1073 1001 992 885 654 42983 2583 1194 1130 13114 12863
NM_001018057chr1131050 567 216 --11138 --
NM_001018067chr11880 15093 ----
NM_001018068chr11880 15093 ----
NM_001018069chr11880 15093 ----
NM_001018072chr1221234 525 --11828 --
NM_001018108chr1542192 1962 1941 1480 --1842 --
NM_001018111chr731295 838 650 --21062 137 1499
NM_001020658chr11339 ------
NM_001020658chr11339 ------
NM_001024372chr842120 1963 1820 1711 --1870 --
NM_001024463chr15--11072 11032 --
NM_001024649chr521983 815 1766 --11053
NM_001024666chrX1187 ------
NM_001024808chr1262529 2521 692 571 378 238 --1653 --
NM_001024858chr1472618 2510 2235 2181 2093 827 254 22932 667 42735 835 731 602 22374 1193
NM_001024948chr133021 2230 950 ------
NM_001025079chr32355 316 ----12984
NM_001025108chr221443 147 ------
NM_001025366chr631172 633 32 1594 1599 --
NM_001025366chr631172 633 32 1594 1599 --
NM_001025367chr631172 633 32 1594 1599 --
NM_001025367chr631172 633 32 1594 1599 --
NM_001025368chr631172 633 32 1594 1599 --
NM_001025368chr631172 633 32 1594 1599 --
NM_001025369chr631188 649 48 1610 1615 --
NM_001025369chr631188 649 48 1610 1615 --
NM_001025370chr631172 633 32 1594 1599 --
NM_001025370chr631172 633 32 1594 1599 --
NM_001025580chrX1674 ------
NM_001025596chr11134 ------
NM_001025780chr911102 ------
NM_001029875chr51873 ------
NM_001030001chr141148 1169 ----
NM_001030006chr1722095 150 ------
NM_001030055chr14167 ------
NM_001031680chr141953 796 126 109 21597 872 ----
NM_001031695chr2244806 2039 1417 1401 --35175 5137 3997 --
NM_001031717chr32715 171 ------
NM_001031732chr4--13239 ----
NM_001031740chr141508 593 350 49 ----1108
NM_001031801chr22----1115 --
NM_001032288chr20----11121 --
NM_001032293chr172506 422 ------
NM_001032296chr1362914 2580 1982 1949 1056 635 22952 206 --12409
NM_001032999chr2075050 4957 4012 3922 3774 3282 1551 --24684 3938 --
NM_001033044chr111759 --11229 --
NM_001033045chr214014 33058 1192 916 1162 --
NM_001033056chr111759 --11229 --
NM_001033081chr111828 ------
NM_001033082chr111828 ------
NM_001033507chr151422 1405 1222 608 598 11677 ----
NM_001033561chr17----1284 --
NM_001033578chr82733 167 ------
NM_001033723chr822154 626 --129 --
NM_001033925chr1011802 ------
NM_001035254chr932012 1869 388 1491 3905 794 452 1975
NM_001035511chr131630 1422 70 2453 200 11366 --
NM_001035512chr131737 1529 177 2560 307 11473 --
NM_001035513chr131737 1529 177 2560 307 11473 --
NM_001037132chr71820 12078 ----
NM_001037133chr71820 12078 ----
NM_001037332chr52235 149 11605 1155 --
NM_001037333chr52235 149 11605 1155 --
NM_001037339chr131194 239 220 3106 83 66 ----
NM_001037340chr131194 239 220 3106 83 66 ----
NM_001037341chr131194 239 220 3106 83 66 ----
NM_001037341chr131194 239 220 3106 83 66 ----
NM_001037553chr21124545 4420 3680 3627 3491 1858 1656 1643 1305 874 821 505 14841 1199 24815 3730
NM_001039469chr11----1276 --
NM_001039538chr21917 ------
NM_001039547chr334872 2802 1822 --11803 --
NM_001039590chrX13053 --11201 --
NM_001039591chrX13053 --11201 --
NM_001039709chr2075050 4957 4012 3922 3774 3282 1551 --24684 3938 --
NM_001039711chr12709 405 ------
NM_001039712chr12709 405 ------
NM_001039762chr1012307 11685 --1750
NM_001039840chrX21437 758 ------
NM_001039888chr1------1297
NM_001039905chr153481 333 302 --1177 --
NM_001040057chr711059 1164 ----
NM_001040102chr1062031 1744 1697 476 58 44 --12103 1837
NM_001040103chr1062031 1744 1697 476 58 44 --12103 1837
NM_001040110chr7------1513
NM_001040151chr1143310 2810 1187 98 13331 1893 --
NM_001040152chr713495 34289 4180 1298 ----
NM_001040167chr74880 335 102 50 1236 1251 --
NM_001040181chr31748 ------
NM_001040182chr31748 ------
NM_001040183chr31748 ------
NM_001040199chr31748 ------
NM_001040200chr31748 ------
NM_001040202chr41330 ------
NM_001040284chr1611516 ----23839 262
NM_001040424chr2142804 880 311 24 12322 21948 266 --
NM_001040429chr13------1430
NM_001040431chr17--1393 ----
NM_001040450chr1522115 1032 ----11823
NM_001040453chr1522115 1032 ----11823
NM_001040455chr1141273 448 268 35 --41208 1020 473 436 --
NM_001040708chr811013 ------
NM_001042357chr10187 ------
NM_001042358chr10187 ------
NM_001042360chr10187 ------
NM_001042361chr101118 ------
NM_001042363chr10187 ------
NM_001042364chr101118 ------
NM_001042365chr101118 ------
NM_001042371chr1641983 1940 1582 498 --2648 302 11309
NM_001042387chr101118 ------
NM_001042389chr10187 ------
NM_001042390chr10187 ------
NM_001042392chr10187 ------
NM_001042393chr101118 ------
NM_001042395chr10187 ------
NM_001042396chr101118 ------
NM_001042397chr101118 ------
NM_001042404chr1------11707
NM_001042486chr2071446 1289 1249 1157 999 542 144 --11458 --
NM_001042492chr171919 ------
NM_001042603chr1224221 325 ----1515
NM_001042724chr192634 516 1626 1554 --
NM_001043318chr1482802 1611 1227 648 456 295 246 134 21369 1127 ----
NM_001043351chr1192 --11585 --
NM_001044385chr243280 2475 1592 706 ------
NM_001046chr532244 1857 550 ------
NM_001092chr1712299 22139 912 32187 1645 1610 --
NM_001095chr1241654 234 108 59 1444 11918 --
NM_001100108chr167632 5064 2689 2416 2385 233 17454 47026 5883 477 330 --
NM_001106chr3138069 7496 6244 3700 3565 3333 3287 3046 2863 2315 2223 1792 1066 ------
NM_001116chr1662533 2507 2479 1017 938 161 --1262 --
NM_001117chr1822222 866 ------
NM_001135chr152799 646 --1711 --
NM_001149chr101443 ------
NM_001167chrX65668 1647 997 821 799 181 --14694 --
NM_001173chr14167 ------
NM_001191chr2041369 1000 293 126 21015 513 1940 --
NM_001198chr62173 55 ------
NM_001204chr244772 1253 724 565 --16334 --
NM_001241chr212031 ------
NM_001241chr212031 ------
NM_001248chr31800 --1342 --
NM_001259chr736299 6159 2244 22218 1476 --11286
NM_001260chr13----147 --
NM_001261chr94898 787 73 23 11149 1367 --
NM_001271chr1553040 3006 2769 2200 391 12700 12219 1359
NM_001282chr1722095 150 ------
NM_001295chr31271 ------
NM_001351chr321508 1436 11244 ----
NM_001356chrX2950 513 ------
NM_001392chr18171 ------
NM_001397chr182581 2476 2392 2118 1661 973 685 73 --32449 1018 103 --
NM_001399chrX43642 337 219 153 --12483 --
NM_001407chr321578 464 --21414 145 --
NM_001409chr152164 865 667 134 124 --1715 1361
NM_001412chrX33139 1365 1233 ------
NM_001419chr1943814 3106 1936 591 24045 599 --11436
NM_001420chr19102851 2655 2637 2541 745 427 175 152 126 83 32902 2842 2684 1759 1784
NM_001421chrX2294 213 11385 1453 --
NM_001430chr221765 528 1593 ----
NM_001438chr112694 ------
NM_001440chr852475 2211 2174 2089 223 21698 750 42624 2553 2112 2042 --
NM_001447chr55972 469 331 300 217 11097 11324 --
NM_001448chrX----21690 377 --
NM_001523chr193238 208 31 ------
NM_001543chr5124782 4670 4616 4028 3980 3858 3370 1931 1204 890 360 95 34264 3832 478 43917 1757 1351 644 --
NM_001616chr212388 ------
NM_001620chr111517 ------
NM_001650chr1811514 ------
NM_001655chr1111956 ------
NM_001659chr1241693 971 762 508 11720 41655 1648 546 103 --
NM_001664chr3----2402 193 --
NM_001668chr132249 1796 1730 ------
NM_001682chr1211076 ------
NM_001709chr1121893 71 12413 ----
NM_001742chr71313 ------
NM_001746chr521983 815 1766 --11053
NM_001754chr2154207 3923 1343 1093 124 11045 ----
NM_001755chr1611960 --1716 --
NM_001759chr1254020 3536 3216 1641 1321 --24141 2122 11563
NM_001777chr32355 316 ----12984
NM_001796chr16--155 ----
NM_001798chr12----1867 --
NM_001854chr1----1224 --
NM_001935chr21401 ------
NM_001949chr633186 2989 1171 ------
NM_001951chr81177 ------
NM_001962chr53482 411 171 --142 --
NM_001981chr111625 --12086 --
NM_001987chr1223389 194 ----14281
NM_001995chr4----11322 --
NM_002017chr11----11076 --
NM_002044chr15136 ------
NM_002051chr10----2243 25 --
NM_002065chr111759 --11229 --
NM_002074chr12544 416 1670 11363 1238
NM_002077chr941864 1479 579 217 11394 ----
NM_002111chr463677 3504 3306 2747 2507 40 --33759 2513 680 --
NM_002126chr1743456 3176 2808 411 ------
NM_002130chr52244 30 ------
NM_002137chr711550 --11786 --
NM_002139chrX1440 ------
NM_002140chr91216 ------
NM_002146chr17----2907 260 --
NM_002148chr21281 --165 --
NM_002192chr71433 --1208 --
NM_002193chr221682 135 ------
NM_002199chr4------1232
NM_002211chr10176 ------
NM_002221chr172456 2040 1808 1140 1078 928 452 1213 52431 593 487 427 174 --
NM_002234chr122635 188 ------
NM_002247chr101392 ------
NM_002252chr21102 ------
NM_002267chr131655 ------
NM_002268chr31530 1295 ----
NM_002270chr544404 1531 1468 505 25583 3835 ----
NM_002283chr121621 --121 --
NM_002285chr221443 147 ------
NM_002296chr11494 --1102 --
NM_002309chr2292353 1264 979 794 516 355 91 85 64 11004 51200 1190 1009 750 369 11185
NM_002314chr72442 285 11014 1248 --
NM_002355chr1241232 984 414 234 ------
NM_002356chr61793 ------
NM_002359chr17104163 4147 4136 3911 3583 2985 2650 1449 500 372 --13247 31586 263 37
NM_002374chr21917 ------
NM_002375chr361940 1909 1510 921 872 314 --2153 135 --
NM_002387chr543813 1853 883 70 13792 1715 11180
NM_002390chr1791690 1678 1632 1619 1376 802 525 421 180 21325 486 21419 391 12041
NM_002397chr5--1610 ----
NM_002399chr15175 ------
NM_002401chr17102470 2250 2185 1789 1783 918 657 435 366 340 --22321 1959 --
NM_002436chrX----182 --
NM_002442chr12--1547 21315 635 11252
NM_002445chr821611 289 --11073 --
NM_002515chr141449 ------
NM_002522chr1762600 1483 1221 1214 919 767 23289 1059 12560 1721
NM_002537chr153348 119 81 --3961 844 681 --
NM_002539chr21110 ------
NM_002545chr1124422 202 ------
NM_002546chr81128 ------
NM_002577chr323233 203 ----24062 266
NM_002586chr621071 185 1113 11122 --
NM_002588chr531436 1192 29 21117 117 11247 192
NM_002592chr201262 ------
NM_002600chr131194 239 220 3106 83 66 ----
NM_002608chr222990 31 ------
NM_002613chr16134543 4487 4272 4006 3942 2023 1792 1021 989 940 904 717 488 34517 1285 865 31817 1659 215 15179
NM_002643chr2145 ------
NM_002645chr1121015 975 ------
NM_002646chr141941 720 628 569 192 197 --
NM_002655chr824251 1071 21748 1551 ----
NM_002666chr15------1931
NM_002667chr61199 ------
NM_002673chr3--1558 3525 510 183 --
NM_002698chr19122898 2860 2734 2671 2432 2426 2067 2044 910 834 392 270 22892 301 32507 2027 282 --
NM_002701chr6178 ------
NM_002714chr6----11045 --
NM_002717chr81220 ------
NM_002731chr112719 12214 ----
NM_002737chr1736336 4547 827 12504 1165 --
NM_002740chr352415 2152 2059 989 394 ------
NM_002745chr2254057 3487 1834 905 446 ------
NM_002753chr41305 --1642 --
NM_002779chr106432 369 154 137 108 94 --1148 --
NM_002786chr111199 ------
NM_002819chr1941010 427 292 274 --1541 2259 245
NM_002830chr21252 ------
NM_002834chr1221462 1039 11317 11569 12690
NM_002837chr1254421 3832 3408 3389 695 ----1414
NM_002844chr611147 ----11118
NM_002884chr111042 ------
NM_002886chr354971 4183 1176 290 114 --11019 --
NM_002893chrX1243 ------
NM_002897chr21723 ------
NM_002942chr311045 ------
NM_002945chr171597 ------
NM_002953chr13784 112 27 --1749 188
NM_002959chr183579 3268 3260 1741 851 707 373 164 --14088 13241
NM_002966chr1150 ------
NM_002994chr4--1642 ----
NM_002997chr23756 642 204 --21687 1419 --
NM_003001chr131737 1529 177 2560 307 11473 --
NM_003003chr171255 ------
NM_003010chr17135 11980 ----
NM_003012chr842720 890 700 187 22509 214 ----
NM_003024chr212283 255 --131 --
NM_003028chr9103653 3426 3302 3214 3068 3000 2410 1059 724 396 13550 33450 3231 1490 --
NM_003034chr1232365 320 33 ------
NM_003035chr1138 ------
NM_003071chr321474 1331 ------
NM_003075chr121263 ------
NM_003076chr121144 ------
NM_003107chr621813 26 11632 1132 --
NM_003108chr2107241 6449 4725 2693 2470 2332 2065 1945 1339 409 15270 32820 2316 2279 --
NM_003112chr742709 1293 1278 135 ------
NM_003133chr1--1779 ----
NM_003137chr632015 426 84 ------
NM_003149chr351603 1128 1048 356 171 1627 ----
NM_003161chr17--13143 ----
NM_003162chr22814 331 ------
NM_003178chr332012 1967 791 --1235 --
NM_003183chr21701 1654 ----
NM_003188chr61534 ------
NM_003189chr1167 22087 620 1562 --
NM_003196chr11255 ------
NM_003202chr521699 1386 --2325 145 --
NM_003204chr1751490 1223 1197 567 54 1734 1225 --
NM_003216chr2272926 2831 1234 1148 1089 608 426 31266 370 192 2753 327 --
NM_003222chr2011022 ------
NM_003250chr17----2443 111 --
NM_003253chr211240 --21558 267 --
NM_003255chr1741658 1050 395 354 --4935 812 360 263 --
NM_003281chr1184837 4426 3969 3614 3594 3518 3439 2190 1849 1742 1510 1386 1090 816 780 553 457 213 1516 54126 3600 2067 1980 543 14566
NM_003286chr201959 ------
NM_003298chr395035 4340 3908 2097 1392 1168 1083 473 404 24278 2223 34993 3935 1052 --
NM_003304chr311283 ------
NM_003314chr51163 ------
NM_003326chr131686 831 64 ------
NM_003334chrX164 ------
NM_003342chr17--12422 140 --
NM_003345chr16----1190 --
NM_003349chr20----11121 --
NM_003359chr41290 ------
NM_003376chr631172 633 32 1594 1599 --
NM_003376chr631172 633 32 1594 1599 --
NM_003387chr222234 451 ------
NM_003390chr112342 247 ------
NM_003392chr3----1526 --
NM_003413chrX1496 1113 ----
NM_003442chr111227 ------
NM_003454chr16--1196 ----
NM_003457chr172506 422 ------
NM_003458chr393501 3328 2715 2551 1312 1101 508 501 287 11198 33260 1297 565 --
NM_003463chr642658 750 472 45 ------
NM_003466chr282375 2165 2121 2048 953 817 606 379 --22137 772 --
NM_003468chr233905 2762 182 11607 22797 591 --
NM_003482chr1241094 334 157 103 21057 251 ----
NM_003485chr141429 --2348 63 11020
NM_003489chr2113131 12259 --11391
NM_003490chr2231016 808 104 1799 ----
NM_003505chr77792 677 540 510 359 189 39 ----1556
NM_003559chr1773628 3299 3214 3163 2931 481 121 22695 2585 ----
NM_003576chr1362914 2580 1982 1949 1056 635 22952 206 --12409
NM_003581chr23884 315 224 ------
NM_003582chr1--1166 ----
NM_003583chr1243180 2845 2384 374 ------
NM_003590chr213900 ------
NM_003597chr21354 ------
NM_003612chr15145 ----1479
NM_003620chr17149 1298 ----
NM_003629chr153113 3100 2265 1211 1197 --12156 --
NM_003644chr17126134 5844 5711 4539 2069 1409 1020 988 904 406 396 63 15470 45492 4440 1071 381 --
NM_003670chr32434 139 --1444 --
NM_003685chr191140 ------
NM_003714chr55564 516 435 334 179 --22536 345 --
NM_003718chr71130 ------
NM_003735chr531436 1192 29 21117 117 11247 192
NM_003736chr531436 1192 29 21117 117 11247 192
NM_003740chr641760 654 371 131 31665 1503 125 61408 624 599 493 320 180 --
NM_003749chr132976 780 ------
NM_003758chr1511116 11515 ----
NM_003758chr1511116 11515 ----
NM_003759chr421437 844 ----13879
NM_003760chr11201 ------
NM_003774chr1223180 764 ------
NM_003787chr1811686 ------
NM_003800chr61521 ----1810
NM_003822chr122411 194 ------
NM_003858chr14189 ------
NM_003872chr282903 2827 2780 2511 2168 2156 2069 232 21119 672 --22774 2522
NM_003885chr174610 340 295 104 21786 914 ----
NM_003924chr44413 319 253 128 --2272 52 1267
NM_003939chr1043264 2705 1464 1445 11593 21204 140 --
NM_003949chr1741762 550 538 214 2808 496 21563 569 1411
NM_003953chr132553 467 396 12312 22711 2096 --
NM_004028chr1811514 ------
NM_004050chr1462575 2528 2186 1907 950 671 140 2814 246 --
NM_004085chrX1679 1175 ----
NM_004093chr133743 390 344 --1521 --
NM_004094chr1431986 1214 765 11917 ----
NM_004096chr1011849 ------
NM_004097chr2--1618 3903 147 133 --
NM_004112chr1741597 1472 517 326 ----1502
NM_004119chr131477 ----1723
NM_004124chr1433366 882 679 ------
NM_004157chr3----1852 --
NM_004183chr111634 ------
NM_004200chr1192473 2415 2206 681 644 466 118 34 27 ------
NM_004215chr81452 ------
NM_004225chr81134 ------
NM_004227chr73814 686 431 --12543 12426
NM_004229chrX1143 11703 ----
NM_004235chr91301 ------
NM_004253chr91303 1939 ----
NM_004263chr231793 1270 321 1173 1237 --
NM_004281chr10--1151 ----
NM_004295chr1741038 258 214 77 --31307 1194 236 --
NM_004306chr8129 ------
NM_004311chr1063012 2672 2406 2399 1958 823 ------
NM_004316chr12150 ------
NM_004321chr2113194 2801 2748 2342 2222 1393 1127 1011 989 940 505 21311 252 ----
NM_004323chr942565 1999 609 374 1248 191 --
NM_004330chr151847 ------
NM_004331chr81259 ------
NM_004342chr711654 159 11660 --
NM_004350chr141953 796 126 109 21597 872 ----
NM_004379chr21661 ------
NM_004393chr382071 1762 903 690 580 137 40 28 --11838 --
NM_004397chr1123933 1214 ----1629
NM_004417chr5195 ------
NM_004420chr115877 823 652 473 280 11854 12158 11491
NM_004421chr15625 591 559 340 107 191 --1618
NM_004422chr171376 ------
NM_004423chr362756 2031 1070 979 621 144 --22124 911 --
NM_004425chr1--125 ----
NM_004427chr191178 1090 1074 884 490 169 91 78 32 --1332 --
NM_004432chr91222 ------
NM_004434chr1431334 635 575 ------
NM_004437chr133492 2727 2259 --22759 348 12567
NM_004438chr242395 1314 586 475 --12580 --
NM_004441chr3------148
NM_004442chr12439 309 11201 21334 652 192
NM_004451chr112260 66 --2663 532 1114
NM_004454chr31392 --22251 896 --
NM_004458chrX----1455 --
NM_004501chr132683 647 247 ------
NM_004504chr21169 ------
NM_004513chr15----53594 3536 2684 1477 74 11004
NM_004514chr1721893 1116 --21096 88 --
NM_004530chr164894 430 417 85 1838 ----
NM_004556chr62913 661 1134 2220 30 --
NM_004569chr14----1500 --
NM_004588chr11102820 1618 904 556 433 400 333 289 242 124 23260 728 32856 576 113 --
NM_004598chr522199 1070 ------
NM_004602chr2021131 262 ------
NM_004637chr311121 ------
NM_004640chr6156 ------
NM_004654chrY1184 ------
NM_004656chr33979 904 470 --2457 56 --
NM_004664chr12------1332
NM_004667chr151218 ------
NM_004687chr17----1233 --
NM_004690chr62556 41 ------
NM_004719chr121308 --12804 --
NM_004730chr51762 ------
NM_004734chr131919 --22465 1000 --
NM_004737chr225934 876 391 315 65 --1321 --
NM_004745chr886074 5046 4745 4392 2463 1614 950 766 15166 --14570
NM_004748chr1521036 999 ------
NM_004755chr14--1281 ----
NM_004762chr17101941 1656 1416 1406 1302 710 476 262 242 33 --21463 579 11327
NM_004774chr1763014 2330 2276 1247 398 187 ----22109 30
NM_004776chr2062025 1069 1004 797 431 81 ------
NM_004779chr52429 21 ------
NM_004783chr16136 --1555 1174
NM_004796chr141890 11824 ----
NM_004805chr22489 350 ------
NM_004822chr17183266 3243 3178 2718 2671 2486 1477 1125 1071 599 469 402 389 356 276 218 99 40 33569 3318 1231 31457 131 46 --
NM_004836chr2--1209 ----
NM_004840chrX22175 38 --21760 465 --
NM_004841chr12911 157 1995 ----
NM_004845chrX32698 397 62 12553 ----
NM_004857chr1411822 ------
NM_004870chr173516 131 51 --1509 --
NM_004871chr1743988 3151 3015 1584 --11717 13553
NM_004873chr1422976 2352 ------
NM_004904chr734185 2014 1078 ------
NM_004906chr6--1260 ----
NM_004915chr211594 ------
NM_004922chr10125 1935 ----
NM_004926chr141638 ------
NM_004956chr734436 1540 23 --13319 --
NM_004958chr12768 721 ------
NM_004972chr91434 ------
NM_004975chr202644 207 ------
NM_004976chr11124786 4577 4552 4280 4024 4016 3866 3837 2059 929 461 114 23521 781 34517 4046 1625 23724 3433
NM_004981chr221353 ------
NM_004992chrX128051 7802 5987 5941 5715 3328 3168 3037 1730 726 157 76 11873 47758 6709 6457 2900 36488 6343 230
NM_004992chrX128051 7802 5987 5941 5715 3328 3168 3037 1730 726 157 76 11873 47758 6709 6457 2900 36488 6343 230
NM_005010chr71820 12078 ----
NM_005011chr7------1513
NM_005036chr2278327 6258 5758 5048 3253 2939 1800 16920 ----
NM_005052chr17128 --2244 232 --
NM_005056chr1224465 569 1163 --1759
NM_005063chr1043119 3045 2757 1517 --13356 --
NM_005076chr184089 3966 3507 3079 1570 1306 883 826 13521 44047 3045 2894 688 --
NM_005080chr22--1679 ----
NM_005093chr2075050 4957 4012 3922 3774 3282 1551 --24684 3938 --
NM_005099chr141106 420 360 286 --138 --
NM_005116chr2023017 1639 --2361 333 --
NM_005121chr1722651 1436 1922 ----
NM_005126chr31731 ------
NM_005156chr9--11670 ----
NM_005182chr16249 31 --1221 --
NM_005197chr1465828 4286 4091 2043 1653 602 14224 ----
NM_005202chr121900 669 --21405 226 --
NM_005206chr1741448 912 325 310 1991 --1975
NM_005219chr531598 671 305 --1258 --
NM_005241chr3------1110
NM_005256chr11----1911 --
NM_005311chr722345 537 11116 1198 --
NM_005316chr111457 ------
NM_005318chr22--11107 ----
NM_005329chr1621966 74 11588 2553 210 --
NM_005334chrX41334 1126 1120 1093 1347 31553 1200 66 --
NM_005339chr434189 4120 3388 ----1369
NM_005342chrX2987 502 22325 1007 ----
NM_005347chr9--21642 1453 ----
NM_005359chr1814889 ------
NM_005374chr1732075 792 637 31897 756 258 32206 941 630 1741
NM_005382chr81151 ------
NM_005387chr111538 ------
NM_005388chr9--11376 2487 301 --
NM_005397chr731295 838 650 --21062 137 1499
NM_005398chr101385 ------
NM_005399chr123544 3291 1689 ----
NM_005400chr232452 2326 677 1780 ----
NM_005406chr181117 ------
NM_005407chr1431062 394 373 ------
NM_005433chr1822230 2162 --1213 --
NM_005458chr951727 923 725 594 159 1492 2915 25 --
NM_005477chr1572373 2003 1595 901 872 499 296 21963 485 21743 490 12381
NM_005477chr1572373 2003 1595 901 872 499 296 21963 485 21743 490 12381
NM_005479chr1031071 474 62 1176 1423 11160
NM_005502chr91852 ----1759
NM_005509chr511430 ------
NM_005517chr1----1569 --
NM_005523chr71540 ------
NM_005542chr71461 ------
NM_005586chr62627 513 2185 69 153 1546
NM_005596chr946017 1307 1261 306 ------
NM_005600chr11262 ------
NM_005602chr31413 1872 151 --
NM_005614chr7------11045
NM_005634chrX2682 132 ------
NM_005647chrX63119 3012 2998 2396 940 595 11193 22502 1122 --
NM_005665chr1160 ------
NM_005668chr534249 2893 202 --14104 --
NM_005688chr3----1994 --
NM_005717chr11948 ------
NM_005739chr15--12074 --12273
NM_005740chr223271 220 209 --2333 33 --
NM_005746chr71219 ------
NM_005759chr221383 1319 --14380 --
NM_005779chr51307 23368 3245 ----
NM_005780chr131246 1411 ----
NM_005808chr323264 120 12312 --21107 633
NM_005819chr133086 2401 936 22304 181 22506 806 --
NM_005822chr61750 1149 ----
NM_005828chr1723835 859 13365 24870 215 11276
NM_005832chr3----1277 --
NM_005840chrX67315 4734 2652 1977 1357 109 17649 12780 1301
NM_005859chr5--1621 ----
NM_005860chr19151649 1332 1052 649 625 601 577 529 505 481 457 433 349 238 184 --11247 --
NM_005871chr1011016 --135 --
NM_005898chr1122629 290 ------
NM_005901chr1847345 6910 5897 1894 --13405 --
NM_005907chr6--11377 ----
NM_005909chr51477 --11666 --
NM_005910chr1773816 1610 1449 889 881 744 711 23097 1000 23192 2762 --
NM_005920chr1103724 2800 2588 1524 1098 937 785 733 528 333 1804 12572 --
NM_005935chr424745 851 ------
NM_005937chr1783464 1440 1297 1082 1028 839 628 436 13497 53209 2543 1137 1072 1016 13086
NM_005941chr822810 119 33042 2638 665 ----
NM_005955chr174676 3887 3349 1173 921 580 529 15006 1789 23445 1649
NM_005962chr1021603 28 2795 143 ----
NM_005962chr1021603 28 2795 143 ----
NM_005969chr113404 375 356 --31009 851 131 --
NM_005990chr521756 994 --42297 1808 297 45 --
NM_006007chr923856 1021 --1651 --
NM_006034chr1192299 1743 804 662 351 139 91 55 21 --1221 --
NM_006038chr2031803 874 398 132 1481 --
NM_006090chr11213 ------
NM_006094chr841509 837 612 179 --12359 12194
NM_006108chr1121610 363 --124 --
NM_006116chr2231005 591 578 1269 61457 1387 1087 1026 53 31 11604
NM_006129chr81564 1217 1527 1123
NM_006135chr11103 ------
NM_006141chr1642167 1073 316 300 ------
NM_006145chr194871 196 109 98 1990 ----
NM_006166chr1212173 ------
NM_006167chr861949 779 768 731 651 50 176 ----
NM_006172chr1----130 --
NM_006191chr121945 ----1349
NM_006201chrX71117 1046 976 916 844 808 59 --1862 11066
NM_006202chr1951894 1468 766 526 454 1534 21880 184 --
NM_006203chr524835 3530 15105 25297 3462 --
NM_006224chr1721961 577 11894 --22349 2265
NM_006237chr1311845 1812 ----
NM_006246chr1411332 ------
NM_006251chr522241 105 --22114 294 --
NM_006252chr166672 5755 1290 1131 1098 932 ----11907
NM_006256chr12528 404 --12061 --
NM_006259chr41363 ------
NM_006275chr2021596 340 --12172 --
NM_006277chr2------1276
NM_006279chr11105 1217 --1669
NM_006281chr81333 1476 ----
NM_006281chr81333 1476 ----
NM_006304chr7157 ------
NM_006306chrX65367 4606 4205 3596 1168 1136 ----1238
NM_006311chr17126 ------
NM_006312chr125931 676 310 260 73 ------
NM_006321chr331397 484 190 --21941 111 --
NM_006328chr111455 1410 ----
NM_006390chr1221759 98 167 ----
NM_006409chr71279 ------
NM_006413chr1021048 330 ------
NM_006449chr231929 322 71 ------
NM_006451chr5--1833 ----
NM_006454chr4113035 2992 2956 2927 2791 2519 2432 2379 1030 1004 580 12982 32093 222 166 1596
NM_006455chr171914 --2964 924 --
NM_006465chr15102164 2120 2068 1803 1775 683 652 503 302 276 1885 3644 583 338 2639 409
NM_006482chr1243180 2845 2384 374 ------
NM_006489chr141449 ------
NM_006496chr121855 799 ------
NM_006510chr63655 405 26 ------
NM_006526chr2011789 ------
NM_006527chr42610 282 ------
NM_006532chr1961566 1426 698 624 125 34 1752 31284 600 444 --
NM_006538chr244117 3648 3011 621 23374 1059 11139 13368
NM_006540chr81149 ------
NM_006546chr1775381 5327 5090 4293 4186 1048 847 ------
NM_006548chr341629 1258 452 172 --1241 --
NM_006549chr1232738 805 617 11108 21981 517 --
NM_006560chr11134 ------
NM_006575chr14--11128 ----
NM_006599chr1666297 5721 5465 3082 1254 982 ------
NM_006609chr212412 ------
NM_006614chr312797 --13046 --
NM_006621chr121872 205 ------
NM_006624chr101531 ----21404 547
NM_006628chr1511327 24543 4077 ----
NM_006644chr131445 ------
NM_006650chr5103519 3308 3142 2557 2502 2425 1225 423 253 179 13595 1915 --
NM_006653chr6295 88 ------
NM_006682chr72952 43 ------
NM_006690chr2052266 2239 2167 1931 192 22154 616 4634 589 104 61 196
NM_006698chr20----2490 383 --
NM_006734chr621258 1161 ------
NM_006736chr2111571 1545 1475 1460 1397 1388 661 653 240 228 213 --1187 --
NM_006750chr1657927 6208 5086 3085 1233 ------
NM_006777chrX----12258 --
NM_006815chr121913 ------
NM_006832chr14--1223 1336 --
NM_006852chr1732585 2246 1808 ------
NM_006854chr721730 37 ------
NM_006861chr121722 --42002 1635 551 532 --
NM_006870chr20--1726 187 --
NM_006876chr111572 --1539 --
NM_006902chr121317 69 --13069 --
NM_006913chr6154 ------
NM_006924chr1734179 1423 811 ------
NM_006930chr51473 --11228 --
NM_006931chr1211960 --12087 --
NM_006937chr171499 ------
NM_006940chr1211726 ------
NM_006941chr223412 347 312 1453 1912 --
NM_006943chr20103082 2669 2547 2107 1330 1013 683 520 501 69 --33246 2917 2576 12565
NM_006955chr1032949 913 75 --11360 --
NM_006988chr21150 --1913 --
NM_006990chr182505 2266 2116 2101 1807 792 525 483 2492 118 ----
NM_006997chr101317 ------
NM_007008chr2--171 ----
NM_007011chr1556301 6138 5048 5027 902 --12333 11670
NM_007033chr142158 1881 1806 598 11451 --11515
NM_007040chr1911123 1177 1119 --
NM_007042chr332622 2023 258 --11901 1426
NM_007050chr2086715 6463 6269 2638 1874 1259 489 246 26525 3100 47376 2488 2213 793 27325 2513
NM_007158chr1--11077 11033 --
NM_007159chr3--1134 ----
NM_007172chr2232279 1283 302 --12268 11270
NM_007173chr11133 --1831 --
NM_007197chr121851 ------
NM_007202chr171518 ------
NM_007214chr61988 ------
NM_007238chr2064808 3908 3725 362 302 116 31480 1311 253 54713 4052 4039 3502 1291 --
NM_007245chr163667 290 32 --1690 2685 247
NM_007283chr353057 2332 1985 945 494 2938 482 ----
NM_007294chr172341 166 ------
NM_007295chr172341 166 ------
NM_007296chr172341 166 ------
NM_007297chr172341 166 ------
NM_007298chr172341 166 ------
NM_007299chr172341 166 ------
NM_007300chr172341 166 ------
NM_007302chr172341 166 ------
NM_007303chr172341 166 ------
NM_007304chr172341 166 ------
NM_007305chr172341 166 ------
NM_007308chr4----1214 --
NM_007345chr1822299 739 ------
NM_007350chr1234197 3394 816 1768 ----
NM_007366chr2134 ------
NM_007372chr172288 279 --175 --
NM_012072chr2084071 3068 1686 890 752 746 313 297 34515 3407 1673 ----
NM_012081chr513005 ------
NM_012095chr1013456 ------
NM_012099chr192196 180 ------
NM_012124chr111120 ------
NM_012134chr151572 1219 1208 479 414 --1292 2384 63
NM_012156chr2072813 2712 2355 2302 2196 1192 64 1787 23108 1301 --
NM_012164chr986148 5766 2395 1394 1349 1249 175 42 26301 153 1158 --
NM_012166chr931339 1280 1027 11114 --21293 24
NM_012193chr1154944 4426 3379 341 318 --13950 --
NM_012199chr153989 3918 3838 3314 1655 ----23088 165
NM_012215chr1021614 461 ------
NM_012223chr211014 1894 11058 --
NM_012224chr41481 ------
NM_012234chr32356 37 --1814 12600
NM_012244chr1421255 1233 11610 2551 202 --
NM_012262chr115168 24772 1666 11334 --
NM_012286chrX----1111 --
NM_012287chr3--23852 228 13445 13649
NM_012288chr655348 4488 3829 1049 40 21088 995 34379 2284 446 --
NM_012290chr211180 ------
NM_012296chr11112924 2455 2398 1574 1432 1352 1239 1195 1052 338 174 1837 2747 207 --
NM_012300chr5128 --2819 452 --
NM_012306chr12103262 2957 2202 1296 723 704 615 404 380 280 --33237 2458 1257 32648 2642 1220
NM_012316chr115188 --35485 3905 1434 --
NM_012325chr2011627 1495 1541 --
NM_012333chr111107 11121 ----
NM_012384chr2052215 2106 1879 914 650 22407 2249 32007 86 37 --
NM_012398chr1962008 902 824 642 541 443 2954 721 2769 183 --
NM_012402chr114975 171 129 58 --1219 --
NM_012405chr133248 2337 29 --13045 11291
NM_012412chr7--1689 ----
NM_012416chr921050 862 ------
NM_012419chr6132 ------
NM_012421chr11337 1347 ----
NM_012479chr732086 1914 448 ------
NM_013227chr152799 646 --1711 --
NM_013231chr1443063 1553 410 268 21657 1470 --13883
NM_013253chr1131050 567 216 --11138 --
NM_013257chr82733 167 ------
NM_013260chr1741016 980 362 350 --1185 --
NM_013272chr15--144 ----
NM_013279chr1152121 1935 645 622 297 2756 251 ----
NM_013313chr2233096 785 358 --53500 2354 1244 1204 853 --
NM_013323chr174931 902 781 76 --1850 --
NM_013368chr191133 ------
NM_013390chr931173 635 458 --11773 --
NM_013396chr21172 ------
NM_013433chr1971413 778 638 619 603 379 254 2274 200 11890 11482
NM_013437chr81108 ------
NM_013443chr941132 982 794 255 2883 32 3235 157 123 --
NM_013450chr21898 --1958 --
NM_013951chr282375 2165 2121 2048 953 817 606 379 --22137 772 --
NM_013952chr282452 2242 2198 2125 1030 894 683 456 --22214 849 --
NM_013953chr282452 2242 2198 2125 1030 894 683 456 --22214 849 --
NM_013992chr282452 2242 2198 2125 1030 894 683 456 --22214 849 --
NM_014089chr132432 376 ------
NM_014112chr835155 4497 490 11251 ----
NM_014155chr1126729 6151 ----16569
NM_014181chr222083 411 ------
NM_014191chr1211083 ------
NM_014217chr121664 1196 --1366 --
NM_014233chr1761942 1602 883 484 426 21 ------
NM_014252chr13160 --1298 --
NM_014271chrX1561 --1133 --
NM_014280chr11845 ------
NM_014284chr12395 339 --1350 --
NM_014292chr2281747 1646 1335 538 518 439 368 35 1181 21588 1386 --
NM_014293chr2243571 1345 1240 709 23425 1218 33226 3176 21 23221 431
NM_014294chr81406 ------
NM_014309chr2244796 2029 1407 1391 --35165 5127 3987 --
NM_014325chr1242012 1781 1674 1554 11435 ----
NM_014338chr224738 430 96 55 --1839 1950
NM_014368chr931575 602 249 --21907 1762 11871
NM_014369chr21123 ------
NM_014376chr52235 149 11605 1155 --
NM_014423chr523783 3772 24924 1559 ----
NM_014452chr6148 ------
NM_014497chr2142 ------
NM_014500chrX159 ------
NM_014502chr112392 382 --1262 --
NM_014505chr121403 1215 1113 1103
NM_014515chr12--1889 1231 --
NM_014564chr93348 110 64 192 2703 198 --
NM_014572chr13190 --147 --
NM_014574chr14151 ------
NM_014583chr3180 1196 ----
NM_014634chr2283193 2902 2686 2652 2538 1181 592 97 --33267 3033 622 23183 465
NM_014636chr993123 1042 1036 988 663 632 368 159 97 13667 31656 859 438 --
NM_014644chr12954 145 ------
NM_014646chr1832966 2815 282 --4570 425 406 28 --
NM_014659chr15--11072 11032 --
NM_014661chr10113464 2958 2875 1129 1064 1005 955 896 803 689 385 32973 406 399 43827 3820 423 24 --
NM_014665chr8123485 3385 3139 2914 2452 1397 1381 1347 1185 826 667 228 12923 33197 2675 58 23495 748
NM_014666chr51319 1176 ----
NM_014670chr21116 ------
NM_014674chr393586 3514 3424 3399 3318 3154 1382 563 437 --43580 2996 2494 414 --
NM_014676chr11339 ------
NM_014678chr223797 742 629 ------
NM_014686chr1912488 ----178
NM_014711chr1611363 ------
NM_014713chr2----177 --
NM_014729chr822241 1643 ------
NM_014730chr1264903 4527 3666 1520 993 26 24361 4213 --13200
NM_014730chr1264903 4527 3666 1520 993 26 24361 4213 --13200
NM_014742chr2031230 607 160 1697 2593 405 --
NM_014743chr421983 779 ------
NM_014747chr1124690 4546 4407 2204 2095 1778 1703 1006 983 756 683 545 15183 64649 4616 3643 1118 937 647 13893
NM_014755chr234094 3643 1216 1833 --12908
NM_014756chr11--1407 ----
NM_014758chr1112211 11750 --1486
NM_014765chr122714 1806 ------
NM_014766chr711531 23425 2716 1453 --
NM_014767chr1062953 2683 2290 1378 834 773 22775 1109 11346 --
NM_014770chr1231121 838 385 2476 457 11051 --
NM_014772chr18113524 3463 3367 3199 3180 2202 1030 1014 963 380 42 ----158
NM_014774chr143211 1221 1204 796 ----1944
NM_014779chr3----1452 --
NM_014781chr811037 ------
NM_014798chr1761736 1671 1178 748 624 310 --31866 559 259 1631
NM_014803chr1012572 22857 270 ----
NM_014810chr132804 2774 225 1281 1724 --
NM_014812chr1------11707
NM_014819chr5----1707 1901
NM_014827chr11537 ------
NM_014830chr1253575 2508 1310 1044 490 13246 --1233
NM_014871chr121499 2438 128 1120 --
NM_014872chr922190 2166 1903 ----
NM_014873chr134747 1136 393 ------
NM_014877chr1747238 7020 6942 5921 25729 2271 12159 --
NM_014901chr561989 1453 917 552 333 63 --1483 1140
NM_014902chr2071446 1289 1249 1157 999 542 144 --11458 --
NM_014903chr123762 273 106 11769 2459 404 --
NM_014904chr1013511 ----12862
NM_014906chr171681 ------
NM_014909chr14102862 2693 2491 1562 1481 1058 784 514 105 88 33301 325 43 53802 3671 3554 2915 1067 13240
NM_014912chr1012786 --174 --
NM_014918chr1511512 ------
NM_014920chr632826 2349 1347 ------
NM_014921chr1982728 1093 857 553 356 196 183 169 12432 32600 728 60 --
NM_014925chr12146 ------
NM_014935chr163114 3053 2910 2430 2386 1125 23597 156 43432 3288 530 257 --
NM_014938chr1252295 1835 1663 264 173 12200 3767 369 104 --
NM_014939chr181988 11370 --11026
NM_014945chr541976 786 412 365 11808 1586 --
NM_014951chr1021040 603 ----12567
NM_014961chr42900 196 ------
NM_014963chr192495 193 --3364 209 172 176
NM_014989chr621875 595 ------
NM_014994chr15102182 1910 897 644 562 507 384 315 156 84 ------
NM_015020chr1642632 1271 1012 41 --13105 --
NM_015025chr222165 2015 --12148 11681
NM_015027chr1611818 ------
NM_015035chr2046360 5068 1657 1584 15981 34344 4062 1163 45899 5791 4504 2464
NM_015039chr123353 1572 33878 1734 464 14137 1641
NM_015042chr1543593 2738 2703 1003 64151 3040 2999 2635 1719 1217 1735 --
NM_015045chr1021804 798 ------
NM_015049chr233215 3067 2274 12130 ----
NM_015050chr651187 1148 906 285 65 156 1172 --
NM_015075chrX4701 510 135 127 32156 1877 439 31461 638 477 12162
NM_015076chr613064 --13395 --
NM_015090chr1156141 5479 5068 4472 4116 3974 3924 2364 2346 2294 2080 2045 1994 1761 1433 1996 35498 1778 1044 14105
NM_015092chr1634122 4098 3432 ----1217
NM_015094chr22124001 3894 3472 3261 3191 1478 1270 718 682 531 498 359 24277 255 74244 3810 2994 1625 1562 1004 265 --
NM_015097chr31771 ------
NM_015132chr721760 689 ------
NM_015141chr322088 990 ------
NM_015150chr32740 301 --1335 1158
NM_015155chr1032468 1031 499 32246 619 442 13161 12061
NM_015161chr1611060 11213 ----
NM_015178chr872217 2132 1906 1687 508 401 102 --62293 2244 2016 1983 824 324 --
NM_015185chrX42107 2040 1054 506 --22348 1209 --
NM_015191chr1142630 978 877 143 22093 597 ----
NM_015194chr1741798 848 778 106 --31866 1421 668 1551
NM_015206chr151477 1526 ----
NM_015215chr12503 344 ------
NM_015219chr17112521 2264 2170 1866 1782 1665 1653 906 796 344 335 11804 42126 1930 1889 411 1684
NM_015225chr912219 --178 --
NM_015254chr8132524 2438 2208 1127 891 818 645 615 608 567 322 199 110 --2825 139 --
NM_015256chr5----1641 --
NM_015265chr22761 590 ------
NM_015270chr1232173 1604 235 1959 2821 378 --
NM_015271chr423554 3189 ------
NM_015288chr562990 2656 1213 1026 769 556 1783 43840 3340 1020 393 2869 800
NM_015292chr122665 90 1562 1288 1691
NM_015299chr1463139 2977 1348 897 336 242 ----13840
NM_015305chr1461805 1769 687 651 589 311 ------
NM_015310chr857480 6880 5334 2351 1343 16449 25863 840 --
NM_015313chr1111175 1611 23310 1296 --
NM_015314chr71121 1787 ----
NM_015327chr161173 1057 897 883 391 153 1402 11084 --
NM_015329chr1931825 572 347 --21164 33 1139
NM_015332chr743507 1360 1299 914 12744 12342 33527 3057 190
NM_015336chr12--1117 ----
NM_015338chr2021826 464 ----21394 523
NM_015343chr17----1106 --
NM_015354chr92319 83 ------
NM_015355chr171151 ------
NM_015358chr21--1386 ----
NM_015365chrX1674 ------
NM_015374chr2241430 1268 1197 569 --3559 362 149 --
NM_015382chr141235 ------
NM_015396chr31463 ------
NM_015447chr91215 ------
NM_015455chr533876 3634 2740 --13706 13921
NM_015460chr32801 767 --1141 1686
NM_015464chr71326 ------
NM_015483chr71904 ------
NM_015497chr15----1804 --
NM_015508chr31107 --11366 --
NM_015550chr71409 ------
NM_015553chr624537 3579 --1170 --
NM_015557chr1123506 3465 3420 3341 3263 3016 3003 2533 1203 1050 789 601 1950 42984 2624 2454 2271 --
NM_015565chr2111719 11450 ----
NM_015567chr132983 252 ------
NM_015568chr2043908 3798 1371 89 21421 1165 13947 13464
NM_015576chr322062 53 21028 42 --12700
NM_015584chr1731418 982 436 1489 1583 --
NM_015605chr101118 ------
NM_015609chr152871 2595 886 755 224 --22745 689 --
NM_015638chr206663 601 573 253 219 177 ----1261
NM_015640chr11880 15093 ----
NM_015646chr1211263 ------
NM_015678chr13--11266 ----
NM_015686chrX2707 186 2976 944 21575 585 --
NM_015691chrX22742 736 --32030 721 182 --
NM_015695chr63847 377 49 --21957 427 11318
NM_015702chr21245 ------
NM_015704chr22----136 --
NM_015719chr193808 191 159 ------
NM_015878chr811646 ------
NM_015881chr1131050 567 216 --11138 --
NM_015898chr1992367 1976 1808 810 554 362 355 281 227 --11824 --
NM_015955chr21198 1526 ----
NM_015995chr15115282 4774 4395 3764 1623 1529 996 980 784 647 464 22033 1698 24745 3877 14005
NM_015999chr11479 ------
NM_016022chr11131 ------
NM_016032chrX--143 21350 278 --
NM_016037chr11243 ------
NM_016057chr1221222 233 ----195
NM_016076chr122830 562 12479 ----
NM_016090chr111195 134 ----
NM_016097chr181138 ------
NM_016125chr17------188
NM_016131chr212245 ------
NM_016132chr1522288 399 22917 2890 12109 --
NM_016169chr1092632 2534 2301 2152 2093 1037 755 631 194 32869 2265 812 22897 962 --
NM_016206chr332132 1271 46 26548 3043 ----
NM_016210chr361295 592 473 227 179 119 21236 643 31241 572 315 --
NM_016218chr51321 ------
NM_016248chr1323332 3039 ------
NM_016252chr21792 ------
NM_016257chr133370 2376 305 --2619 21 22281 384
NM_016260chr212594 21237 641 ----
NM_016272chr222970 159 21832 23 --12622
NM_016287chr11566 ------
NM_016298chr343164 921 547 453 1789 21218 513 --
NM_016312chr121101 ------
NM_016351chr7------1481
NM_016396chr1522166 1939 ------
NM_016424chr17165 ------
NM_016507chr1712886 11102 ----
NM_016513chr632826 2349 1347 ------
NM_016522chr111325 --11086 --
NM_016526chr1142437 2311 1957 158 1444 1213 1990
NM_016530chr1532819 498 39 ------
NM_016531chr4--33387 3322 722 ----
NM_016604chr521285 281 --173 --
NM_016605chr592420 2073 1791 886 667 373 125 113 83 126 11943 --
NM_016609chr14----186 --
NM_016620chr12515 466 ------
NM_016621chr1174378 3885 3857 3559 3064 2792 608 13778 44250 3968 2810 1624 --
NM_016622chr242114 1945 1930 1350 ------
NM_016626chr1821683 551 ------
NM_016651chr142932 396 ------
NM_016734chr961815 1625 1468 1247 175 162 21770 1276 --21758 1263
NM_016818chr211594 ------
NM_016823chr1731318 195 180 1861 --1845
NM_016834chr1773816 1610 1449 889 881 744 711 23097 1000 23192 2762 --
NM_016835chr1773816 1610 1449 889 881 744 711 23097 1000 23192 2762 --
NM_016836chr21723 ------
NM_016839chr21723 ------
NM_016841chr1773816 1610 1449 889 881 744 711 23097 1000 23192 2762 --
NM_017413chrX41551 623 550 523 --11625 --
NM_017420chr1411072 22750 2654 ----
NM_017449chr12439 309 11201 21334 652 192
NM_017452chr2021131 262 ------
NM_017453chr2021131 262 ------
NM_017454chr2021131 262 ------
NM_017456chr17101941 1656 1416 1406 1302 710 476 262 242 33 --21463 579 11327
NM_017488chr231511 1143 243 ----1420
NM_017519chr6--2945 45 ----
NM_017548chr31641 ------
NM_017551chr1022105 712 ----1592
NM_017553chr152281 218 1439 --141
NM_017575chr1741176 496 380 336 --21511 1032 11252
NM_017589chr111103 ------
NM_017590chr2282390 2291 923 529 384 328 268 100 42001 1937 75 54 2787 342 1804
NM_017593chr41454 ------
NM_017594chr9178 --12350 --
NM_017599chr121211 ------
NM_017628chr444013 1783 1758 791 ------
NM_017633chr612693 ------
NM_017637chr948365 7711 951 252 36421 6172 547 15886 --
NM_017641chr1211169 ------
NM_017643chr17--1530 ----
NM_017658chr1434538 639 496 1585 ----
NM_017660chr1943251 2984 2221 403 --22731 2158 1181
NM_017667chr71522 ------
NM_017686chr111063 ------
NM_017703chr191386 ------
NM_017715chr72600 267 ------
NM_017719chr32868 828 11738 ----
NM_017737chr111730 ------
NM_017740chr1641340 1264 438 94 --11468 --
NM_017744chr132405 596 89 1419 22089 1562 32125 1972 260
NM_017749chr11--1127 1687 --
NM_017762chr1522099 2030 31605 584 498 ----
NM_017772chr641654 1229 708 252 21458 569 1302 --
NM_017780chr81595 ------
NM_017789chr25795 649 595 577 190 --2708 548 --
NM_017790chr9--1123 ----
NM_017799chr1421585 1326 1350 11392 --
NM_017811chr932325 2172 790 --11227 --
NM_017824chr1021877 143 --1610 --
NM_017849chr263166 3054 2466 1098 974 370 31142 1089 154 ----
NM_017857chr113596 507 228 ------
NM_017873chr983088 2613 2337 1061 510 354 303 84 1577 42110 646 347 258 13132
NM_017902chr1085696 5073 4630 3810 3600 1361 1273 160 24953 1476 24320 1431 1492
NM_017919chr911860 15730 34634 4110 457 --
NM_017925chr921713 747 --1195 --
NM_017933chr22471 422 11141 ----
NM_017955chr14------1892
NM_017958chr22717 66 12329 12688 --
NM_017998chr91911 ------
NM_018011chr131441 ------
NM_018032chr165687 232 163 116 72 --161 --
NM_018045chr12854 86 42661 2148 529 99 22380 1070 --
NM_018086chr22560 149 ------
NM_018110chr1641112 502 166 51 11032 --1432
NM_018154chr192765 682 193 170 1714
NM_018159chrX11062 ------
NM_018167chr14----1345 --
NM_018171chr121724 ------
NM_018178chr11674 11421 1148 --
NM_018180chr10----131 --
NM_018247chr6--12857 ----
NM_018254chr122385 693 ------
NM_018275chr71407 --1377 1450
NM_018287chr1011241 ------
NM_018315chr411116 ------
NM_018320chr1131196 301 52 ------
NM_018328chr21131 ------
NM_018362chr11--12532 ----
NM_018400chr1143310 2810 1187 98 13331 1893 --
NM_018409chr412664 12969 ----
NM_018416chr1262259 2162 1966 1740 821 495 --133 --
NM_018429chr511026 ------
NM_018445chr15----1145 --
NM_018448chr121293 ------
NM_018462chr3----1108 --
NM_018486chrX2401 378 ------
NM_018557chr221343 1086 ------
NM_018566chr11882 14211 ----
NM_018638chr1234425 1203 1129 ------
NM_018667chr1632114 570 347 12512 82136 2062 730 688 608 596 562 21 --
NM_018689chr1562252 2099 1969 1702 788 383 ------
NM_018700chr511331 ------
NM_018717chr431867 1112 840 --1701 --
NM_018912chr531436 1192 29 21117 117 11247 192
NM_018913chr531436 1192 29 21117 117 11247 192
NM_018914chr531436 1192 29 21117 117 11247 192
NM_018915chr531436 1192 29 21117 117 11247 192
NM_018916chr531436 1192 29 21117 117 11247 192
NM_018917chr531436 1192 29 21117 117 11247 192
NM_018918chr531436 1192 29 21117 117 11247 192
NM_018919chr531436 1192 29 21117 117 11247 192
NM_018920chr531436 1192 29 21117 117 11247 192
NM_018921chr531436 1192 29 21117 117 11247 192
NM_018922chr531436 1192 29 21117 117 11247 192
NM_018923chr531436 1192 29 21117 117 11247 192
NM_018924chr531436 1192 29 21117 117 11247 192
NM_018925chr531436 1192 29 21117 117 11247 192
NM_018926chr531436 1192 29 21117 117 11247 192
NM_018927chr531436 1192 29 21117 117 11247 192
NM_018928chr531436 1192 29 21117 117 11247 192
NM_018929chr531436 1192 29 21117 117 11247 192
NM_018951chr7--11060 1152 --
NM_018963chr211391 ------
NM_018979chr1232071 1973 529 22174 286 ----
NM_019006chr152287 254 ------
NM_019022chr1822804 750 ------
NM_019050chr41557 ------
NM_019072chr5--1342 ----
NM_019084chr1032461 1707 1039 ------
NM_019091chr21329 ------
NM_019105chr6175 ------
NM_019555chr321191 426 1664 ----
NM_019556chrX1551 ------
NM_019590chr1011152 ------
NM_019593chr201666 ------
NM_019595chr2------1276
NM_019606chr71553 ------
NM_019859chr101132 --1573 --
NM_019891chr1----1408 --
NM_019895chr31748 ------
NM_020039chr1241654 234 108 59 1444 11918 --
NM_020066chr11916 ------
NM_020132chr21124545 4420 3680 3627 3491 1858 1656 1643 1305 874 821 505 14841 1199 24815 3730
NM_020137chrX2168 83 ------
NM_020141chr132341 1930 1718 ------
NM_020144chr71249 ------
NM_020148chr1843047 2993 2251 973 ------
NM_020150chr1011976 ------
NM_020168chr15143 31302 934 438 11167 --
NM_020182chr2043502 2266 1130 1108 1790 23146 2255 --
NM_020184chr22315 39 11992 2839 817 --
NM_020198chr171189 ------
NM_020211chr1561101 1086 531 520 399 141 --31366 998 962 --
NM_020225chr4--1141 ----
NM_020248chr152235 2106 1746 1652 729 141 3869 807 518 11704
NM_020309chr1911041 --1278 --
NM_020336chr2033563 2680 2627 ------
NM_020337chr421242 1230 ------
NM_020341chr203316 154 139 ------
NM_020342chr212116 ------
NM_020372chr14----186 --
NM_020374chr1221918 1628 ------
NM_020381chr631900 1880 332 --11535 --
NM_020390chr331586 467 331 ----13285
NM_020432chr72779 457 ------
NM_020438chr961030 453 313 217 202 169 ----1335
NM_020453chr411318 1180 --11867
NM_020463chr21331 ------
NM_020474chr181524 ------
NM_020475chr882040 1986 1931 1806 1751 854 357 289 22027 51 32096 1733 1588 11570
NM_020476chr882040 1986 1931 1806 1751 854 357 289 22027 51 32096 1733 1588 11570
NM_020477chr882040 1986 1931 1806 1751 854 357 289 22027 51 32096 1733 1588 11570
NM_020478chr882103 2049 1994 1869 1814 917 420 352 22090 114 32159 1796 1651 11633
NM_020480chr882040 1986 1931 1806 1751 854 357 289 22027 51 32096 1733 1588 11570
NM_020532chr2--171 ----
NM_020640chr312231 ------
NM_020673chr2056155 5913 5646 5354 63 25529 906 --12764
NM_020692chr146957 945 905 826 445 335 124 --1713
NM_020699chr145054 4972 4675 601 --13697 --
NM_020703chr12162 81 ------
NM_020713chr20152855 2794 2645 2635 2435 2206 2149 2087 1939 1236 1211 911 799 746 189 --32822 2574 2457 164
NM_020717chrX34020 1775 1151 23343 1558 41627 759 485 416 --
NM_020728chr731089 645 233 --12219 --
NM_020732chr6--2945 45 ----
NM_020737chr6137 ------
NM_020739chr1521036 999 ------
NM_020747chr5----1289 --
NM_020749chr81629 --1330 --
NM_020752chr1032554 1840 823 ------
NM_020764chr163862 185 147 --31209 393 106 --
NM_020766chrX34292 3287 229 ----12824
NM_020768chr531072 606 181 12819 1589 --
NM_020769chrX1829 ------
NM_020771chr6----1109 --
NM_020772chr1757418 3469 1478 1356 563 12277 ----
NM_020778chr1573505 1509 1146 767 708 498 21 23516 1012 2583 226 23736 3132
NM_020794chr111574 ------
NM_020795chr1731580 1537 326 --11481 --
NM_020796chr512796 ------
NM_020801chr511906 ------
NM_020804chr672320 2256 2154 2046 1987 1722 218 12344 52494 2289 2240 2199 1741 21770 177
NM_020813chr1922516 283 ------
NM_020830chr241284 731 394 385 ------
NM_020850chr1652681 2321 2311 824 775 12530 148 2804 769
NM_020859chr432690 413 390 ------
NM_020899chr172732 124 21595 868 1468 1248
NM_020920chr14--1363 ----
NM_020922chrX31587 1273 537 ------
NM_020926chrX167 ------
NM_020935chr224184 3533 ----1125
NM_020948chr123186 60 ------
NM_020956chr19144684 4449 4306 4251 4165 4009 3759 3707 3632 3353 3261 3241 1362 737 23962 3621 54709 4322 1500 713 137 13028
NM_020972chr42332 257 4411 362 198 60 2722 440 1762
NM_020983chr1232173 1604 235 --2821 378 --
NM_020987chr101443 ------
NM_020993chr1262529 2521 692 571 378 238 --1653 --
NM_021020chr863297 2834 2341 1305 682 272 1892 41413 1088 541 51 --
NM_021033chr1333288 2314 257 1997 ----
NM_021064chr61400 ----167
NM_021072chr512339 1199 11755 --
NM_021079chr1742923 2695 2293 803 11024 23298 2408 1673
NM_021090chr22104953 4874 4786 3844 3407 1685 1427 1233 948 893 23948 1175 13911 --
NM_021096chr2263006 2642 531 407 363 118 12676 32415 353 110 12972
NM_021097chr23383 240 143 ----1214
NM_021148chr721877 1797 ------
NM_021183chrX12372 ------
NM_021184chr63604 526 498 1591 1126 --
NM_021190chr11369 ------
NM_021202chr2072654 2070 1939 884 757 560 554 --21241 1017 --
NM_021220chr201147 ------
NM_021224chr9160 ------
NM_021255chr1413066 12882 ----
NM_021260chr1451161 367 312 186 48 ----1128
NM_021622chr10----12135 --
NM_021639chr11612 ------
NM_021647chr443152 1814 1627 205 --1583 --
NM_021722chr7------1440
NM_021723chr7------1481
NM_021783chrX5717 653 606 577 87 ----12404
NM_021784chr201484 2625 200 ----
NM_021945chr622530 22 --131 1358
NM_021947chr171377 ------
NM_021959chr6----1375 --
NM_021961chr1165545 5517 5190 3006 2273 110 11190 --12387
NM_021962chr1712299 22139 912 32187 1645 1610 --
NM_021976chr64829 757 122 76 185 2849 734 --
NM_021988chr20----11121 --
NM_021991chr173538 330 141 --1197 --
NM_021999chr13----1116 --
NM_022048chr1556082 1486 1326 854 252 42403 1813 1343 150 21943 168 --
NM_022068chr18------1223
NM_022075chr11378 174 ----
NM_022114chr163485 3321 2979 921 770 21 11362 43040 3019 1037 71 33014 2943 726
NM_022123chr14--1205 ----
NM_022166chr16125673 4841 4192 2520 2360 2255 2189 1536 507 473 381 67 ------
NM_022169chr1141104 1037 352 106 --21410 446 --
NM_022336chr222325 54 ------
NM_022338chr111238 ------
NM_022340chr383665 3637 2419 724 530 413 338 97 --1663 --
NM_022351chr81377 ------
NM_022373chr7132 ------
NM_022442chr20----11121 --
NM_022455chr5142 ------
NM_022459chr1346262 6219 5709 2374 15513 11656 --
NM_022461chr321099 979 ------
NM_022470chr331000 170 158 --1454 1227
NM_022476chr161154 ------
NM_022484chr711103 ------
NM_022491chr1243386 2724 2439 150 12807 ----
NM_022497chr383591 3011 2967 1427 741 562 406 170 23123 937 ----
NM_022552chr221214 166 ------
NM_022574chr761874 1613 1404 769 65 39 3739 631 534 ----
NM_022648chr294110 4103 3120 2963 1799 1469 1292 1034 856 23454 3095 21823 1191 123
NM_022664chr1--125 ----
NM_022719chr2291281 1131 1115 1036 838 359 344 318 48 1154 53283 3018 2479 196 88 --
NM_022733chr131073 1030 350 ------
NM_022737chr1931079 1019 986 1164 3895 132 26 --
NM_022748chr742155 578 274 74 12531 32654 2571 564 --
NM_022755chr922586 612 --51722 1711 1684 574 293 --
NM_022756chr121428 1047 --11117 --
NM_022758chr653183 2685 2520 2008 63 22398 1158 13036 --
NM_022776chr31141 ------
NM_022780chr21188 ------
NM_022781chr9--1112 12383 --
NM_022817chr231622 1505 397 ------
NM_022832chr431636 670 572 --2888 367 --
NM_022841chr151563 ------
NM_022845chr1611914 --1670 --
NM_022912chr21553 ------
NM_022977chrX----1455 --
NM_023079chr1741757 273 165 150 1239 31657 1349 481 1316
NM_023929chr8--1136 ----
NM_023940chr43132 109 47 1124 ----
NM_024007chr52525 195 --1885 --
NM_024050chr191627 ------
NM_024077chr92787 504 ------
NM_024090chr441893 1278 1203 488 ----136
NM_024293chr2138 1800 --1248
NM_024294chr653183 2685 2520 2008 63 22398 1158 13036 --
NM_024297chr17----164 --
NM_024345chr922070 1481 14880 ----
NM_024519chr16180 --150 --
NM_024539chrX1405 --158 --
NM_024554chr111155 --21086 130 --
NM_024561chr1331026 67 53 ------
NM_024567chr81129 ------
NM_024569chr132630 544 473 12389 22788 2173 --
NM_024599chr17159 --3607 114 45 --
NM_024646chr123450 201 ------
NM_024658chr14----1143 --
NM_024665chr324108 4095 ------
NM_024698chr113905 314 133 1963 41222 996 141 39 --
NM_024759chr81628 ------
NM_024763chr11935 ------
NM_024769chr11----144 --
NM_024808chr132783 144 ----1296
NM_024811chr1131390 641 479 31453 1256 471 1441 --
NM_024812chr842014 1857 1714 1605 --1764 --
NM_024814chr71124 ------
NM_024828chr911584 ------
NM_024874chr121001 24 --3929 244 30 --
NM_024884chr1434378 4085 352 --14359 --
NM_024887chr161980 1893 1609 767 755 702 2711 267 148 --
NM_024949chr4----24094 3998 --
NM_024954chr102147 93 --3555 459 234 1567
NM_024989chr2--146 12708 --
NM_025027chr191485 ------
NM_025076chr21470 ------
NM_025083chr1551969 1477 1469 1369 371 --31613 1303 511 21794 1592
NM_025126chr121626 --1573 --
NM_025134chr161863 ------
NM_025160chr123698 1637 22806 148 --14056
NM_025179chr144672 4010 3566 1949 23643 1773 54354 4135 4090 3275 241 11838
NM_025195chr81397 11474 11816 --
NM_025208chr1112366 --11612 --
NM_025212chr41127 ------
NM_025222chr332661 738 683 12764 --12691
NM_025250chr742366 1166 821 416 42888 2575 1902 686 42661 2447 2039 604 --
NM_030576chr1761757 1605 925 906 542 136 31988 1053 92 3553 349 142 1821
NM_030594chr151948 ------
NM_030627chr533017 2888 629 ------
NM_030634chr132152 1007 484 22228 974 ----
NM_030637chr142114 86 ------
NM_030647chr735395 4384 249 1495 1262 --
NM_030648chr444689 4603 4465 4399 21893 710 11948 --
NM_030650chr243662 3542 2674 2639 14005 ----
NM_030661chr721271 306 ------
NM_030674chr1233596 3578 537 24862 1498 ----
NM_030753chr171264 ------
NM_030759chr102656 320 ------
NM_030761chr152602 2538 1015 904 379 11914 1184 --
NM_030762chr121376 ------
NM_030766chr12----2273 202 --
NM_030806chr1109357 7380 7150 6980 6945 5708 3485 2646 1487 872 28253 6856 27089 3305 16876
NM_030884chr361940 1909 1510 921 872 314 --2153 135 --
NM_030885chr321462 204 --22132 150 --
NM_030918chr134650 4487 3851 --35111 2018 1848 --
NM_030937chr141378 1235 1213 1178 21423 1083 1248 1958
NM_030958chr81160 ------
NM_030962chr11----2239 107 --
NM_030964chr553332 1012 850 458 256 22694 1335 1217 --
NM_031216chr1821914 1425 ------
NM_031231chr203609 126 25 ----1666
NM_031232chr203609 126 25 ----1666
NM_031243chr711550 --11786 --
NM_031262chr91159 ------
NM_031263chr91216 ------
NM_031267chr71130 ------
NM_031268chr16134543 4487 4272 4006 3942 2023 1792 1021 989 940 904 717 488 34517 1285 865 31817 1659 215 15179
NM_031309chr8122371 2355 2190 2093 606 470 259 230 185 158 127 85 --52207 1844 1450 829 419 --
NM_031417chr19102652 2603 2518 2495 2324 1853 1746 760 558 433 32400 2071 345 22277 292 --
NM_031426chr952608 2512 1796 722 247 --2517 444 1281
NM_031427chr1425357 1270 15018 34628 3742 3708 14609
NM_031431chr1331409 1285 275 ------
NM_031433chr11----294 55 --
NM_031442chrX1272 ----12676
NM_031455chr1031253 616 379 --21337 530 132
NM_031468chr776657 6223 5789 2868 2297 466 202 1411 16418 --
NM_031478chr163470 293 269 --289 55 --
NM_031483chr2032274 1324 737 ------
NM_031844chr132683 647 247 ------
NM_031845chr21917 ------
NM_031847chr21917 ------
NM_031886chr1942604 2306 992 60 42390 896 804 424 ----
NM_031890chr2232745 2686 2200 32586 1188 126 2914 88 1119
NM_031918chr1981825 1800 1753 1641 1404 783 270 145 11307 1260 --
NM_031936chr1194 2256 40 --1659
NM_031953chr4178 ------
NM_031990chr1941010 427 292 274 --1541 2259 245
NM_031991chr1941010 427 292 274 --1541 2259 245
NM_032017chr131774 1742 118 21647 1472 51792 1652 1496 337 72 --
NM_032088chr531436 1192 29 21117 117 11247 192
NM_032092chr531436 1192 29 21117 117 11247 192
NM_032121chrX1830 ------
NM_032124chr181856 --11113 --
NM_032127chr11152 ----126
NM_032182chr101565 ------
NM_032186chr12515 466 ------
NM_032192chr171107 --1482 --
NM_032221chr20----21339 168 --
NM_032236chr12961 65 ------
NM_032239chr421418 487 ------
NM_032242chr352965 785 463 314 231 --52734 1078 755 471 348 --
NM_032268chr1673259 3208 3160 2692 1126 1070 114 11287 22382 2243 --
NM_032281chr19102851 2655 2637 2541 745 427 175 152 126 83 32902 2842 2684 1759 1784
NM_032294chr1731335 1297 401 --1209 31252 538 23
NM_032315chr11229 ------
NM_032353chr17----147 --
NM_032364chr12146 ------
NM_032376chr171521 148 ----
NM_032379chr111375 ------
NM_032403chr531436 1192 29 21117 117 11247 192
NM_032408chr721230 840 --11029 --
NM_032438chr611028 --1573 11532
NM_032440chr101841 12124 ----
NM_032468chr81371 ------
NM_032470chr6175 ------
NM_032509chr842183 1831 1764 941 ------
NM_032521chr202675 212 12163 12644 --
NM_032538chr682314 2185 2082 2015 1121 527 220 184 11890 12490 --
NM_032552chr96749 624 409 389 232 41 --31455 1393 767 --
NM_032575chr1651788 1725 1343 1275 760 --31846 1613 705 --
NM_032595chr1751499 360 272 262 162 --21447 1072 --
NM_032632chr14--1639 ----
NM_032682chr322575 1405 ----23593 2562
NM_032687chr8124 --1206 --
NM_032711chr17104163 4147 4136 3911 3583 2985 2650 1449 500 372 --13247 31586 263 37
NM_032737chr194689 556 450 311 ----2458 265
NM_032786chr124581 190 98 55 --2587 41 --
NM_032800chr142035 1988 837 523 2942 77 1867 11717
NM_032812chr101316 ------
NM_032822chr2----127 --
NM_032842chr72569 407 ------
NM_032867chr111570 ------
NM_032883chr203248 95 60 ------
NM_032924chr7--1727 ----
NM_032943chr111375 ------
NM_032998chr12709 405 ------
NM_033016chr222990 31 ------
NM_033018chrX71117 1046 976 916 844 808 59 --1862 11066
NM_033036chr1131260 652 272 --1408 11339
NM_033102chr14324 273 209 30 ------
NM_033102chr14324 273 209 30 ------
NM_033121chr123508 378 87 181 172 --
NM_033133chr1763413 2934 2679 1303 811 672 52522 2512 1344 1038 276 32343 1136 532 1888
NM_033135chr1112366 --11612 --
NM_033138chr711654 159 11660 --
NM_033139chr711654 159 11660 --
NM_033140chr711654 159 11660 --
NM_033141chr1461964 1722 576 377 167 79 --1184 1155
NM_033157chr711654 159 11660 --
NM_033207chr1062031 1744 1697 476 58 44 --12103 1837
NM_033222chr911058 11134 ----
NM_033224chr71342 --27876 2558 --
NM_033225chr832565 2164 713 --1171 --
NM_033246chr15----1110 --
NM_033285chr854122 1372 1365 1307 1276 ----1402
NM_033315chr1752121 1851 1577 559 65 --32137 472 53 --
NM_033358chr2132 ------
NM_033375chr1741436 1366 1317 395 1170 --1226
NM_033389chr1764144 3269 1915 558 484 134 11950 --13756
NM_033394chr211096 ------
NM_033449chr55767 619 564 547 523 --1492 1364
NM_033495chrX--1862 ----
NM_033503chr1593766 3710 3480 3095 2359 943 443 269 207 --23185 482 22810 1452
NM_033540chr31157 ------
NM_033631chr153796 3509 3466 1124 367 23610 3165 13815 --
NM_033632chr411116 ------
NM_033637chr1043264 2705 1464 1445 11593 21204 140 --
NM_033644chr5128 --2819 452 --
NM_033645chr5128 --2819 452 --
NM_052818chr1312175 ------
NM_052827chr12----1867 --
NM_052840chr1561601 1426 1016 494 282 225 ------
NM_052843chr12428 103 --1440 --
NM_052847chr1973407 3257 3243 2435 2311 1241 79 23052 451 22543 726 --
NM_052876chr19102491 2295 2242 1963 1057 1043 717 663 415 189 12029 41770 1733 905 748 124
NM_052880chr2241036 975 277 186 1991 21181 906 --
NM_052898chr831764 1271 89 --155 --
NM_052905chr22116 30 ------
NM_052906chr22184922 4401 4324 4009 3695 3202 1730 1687 1160 1040 861 831 435 423 77 63 47 40 53233 1919 1495 1471 98 44731 4570 1983 300 1559
NM_052907chr1214292 1800 23646 3196 --
NM_052918chr1033082 1493 1238 ------
NM_052937chr811004 --12480 1924
NM_053016chr967630 6209 5366 5188 2872 1251 26626 6582 14874 16922
NM_053023chr1141291 528 515 110 --1753 --
NM_053024chr31101 ------
NM_053279chr872716 762 402 239 170 132 40 --1853 --
NM_057175chr422502 2398 ------
NM_057178chr172107 63 ------
NM_058172chr411213 ------
NM_058229chr8132 ------
NM_058240chr1431144 368 27 ------
NM_058241chr211931 ------
NM_058241chr211931 ------
NM_078487chr95826 593 277 197 160 ----1260
NM_080425chr20192 ------
NM_080426chr20192 ------
NM_080476chr20--147 1278 1123
NM_080491chr11112924 2455 2398 1574 1432 1352 1239 1195 1052 338 174 1837 2747 207 --
NM_080546chr911518 ------
NM_080629chr1----1224 --
NM_080630chr1----1224 --
NM_080666chr1421589 1191 ------
NM_080669chr1774093 4072 4026 3853 1367 654 358 1760 43615 3349 3137 769 --
NM_080679chr64600 140 118 87 1701 1751 --
NM_080680chr64600 140 118 87 1701 1751 --
NM_080681chr64600 140 118 87 1701 1751 --
NM_080717chr1211423 ------
NM_080764chr2233007 1062 507 1963 1319 --
NM_080872chr833412 478 206 1382 ----
NM_130386chr181196 ------
NM_130439chr1021603 28 2795 143 ----
NM_130439chr1021603 28 2795 143 ----
NM_130468chr153767 554 154 ----1186
NM_130809chr512903 --1462 --
NM_130830chr353972 3941 2693 535 275 12642 32879 2513 22 --
NM_133170chr2086715 6463 6269 2638 1874 1259 489 246 26525 3100 47376 2488 2213 793 27325 2513
NM_133171chr202505 203 ------
NM_133264chr1753484 3108 905 771 336 23810 3283 13572 --
NM_133329chr211484 ----11518
NM_133370chr4--13239 ----
NM_133372chr51126 ------
NM_133433chr51824 ------
NM_133445chr91195 ------
NM_133633chr2241132 924 785 220 1915 ----
NM_133634chr2131752 1223 132 --31723 477 371 11452
NM_133635chr2131399 583 483 --21370 124 11099
NM_133642chr225934 876 391 315 65 --1321 --
NM_134442chr21661 ------
NM_138270chrX33252 762 158 ----12954
NM_138316chr10--11200 ----
NM_138338chr2293056 2128 1313 1148 1073 1001 992 885 654 42983 2583 1194 1130 13114 12863
NM_138357chr101202 ------
NM_138385chr491339 1236 1168 1133 1023 439 321 281 243 11296 ----
NM_138423chr15--21822 1595 ----
NM_138447chr163677 81 43 1742 --1257
NM_138457chr623217 365 12358 83371 2516 1229 815 390 334 303 24 --
NM_138473chr1234672 4443 3712 --24941 4750 --
NM_138492chr531238 348 315 ------
NM_138578chr2041369 1000 293 126 21015 513 1940 --
NM_138621chr244117 3648 3011 621 23374 1059 11139 13368
NM_138713chr1666297 5721 5465 3082 1254 982 ------
NM_138714chr1666297 5721 5465 3082 1254 982 ------
NM_138727chr132405 596 89 1419 22089 1562 32125 1972 260
NM_138728chr132405 596 89 1419 22089 1562 32125 1972 260
NM_138764chr19171 ------
NM_138782chr511937 ------
NM_138795chr151557 646 636 431 119 --21380 1353 11129
NM_138927chr212955 322 ------
NM_138961chr11--156 ----
NM_138967chr1542342 2290 1847 87 136 11671 1398
NM_138970chr141890 11824 ----
NM_138980chr41174 --1511 --
NM_138981chr41305 --1642 --
NM_138982chr41174 --1511 --
NM_139014chr641897 1525 766 326 ------
NM_139067chr121263 ------
NM_139071chr121144 ------
NM_139131chr111538 ------
NM_139161chr191188 --1336 --
NM_139280chr17128 1596 11075 --
NM_144571chr445956 5752 1164 179 36952 6032 1246 ----
NM_144574chr141523 ------
NM_144579chr262892 2826 2523 1848 724 574 --2756 59 --
NM_144581chr14123 ------
NM_144584chr1----130 --
NM_144633chr321038 272 ------
NM_144635chr361181 1154 1046 373 214 112 2880 869 21030 236 --
NM_144658chrX1138 ------
NM_144664chr111344 12399 ----
NM_144671chr122628 435 21978 361 2759 256 --
NM_144703chr2011026 ----1489
NM_144732chr1911123 1177 1119 --
NM_144973chr1244926 1104 1004 934 --1957 --
NM_144982chr121566 ------
NM_145117chr1142614 2526 1077 536 22160 1297 ----
NM_145166chr362837 2550 916 743 344 33 --52572 1981 1866 561 46 --
NM_145174chr2211508 ------
NM_145176chr622829 515 --12867 --
NM_145206chr1043359 2866 990 323 ------
NM_145277chr11150 --192 --
NM_145313chr102528 200 --1206 --
NM_145320chr71409 ------
NM_145321chr71409 ------
NM_145322chr71409 ------
NM_145331chr61534 ------
NM_145349chr1741941 1564 789 37 11666 1562 11469
NM_145350chr1721293 141 31018 549 435 1556 --
NM_145351chr1772433 2056 529 344 160 113 21 32158 1689 359 21696 1054 11961
NM_145644chr21356 ------
NM_145753chr32467 29 ------
NM_145799chrX42558 1198 854 337 --138 --
NM_145800chrX----138 --
NM_145804chr113976 359 101 1997 250 32 --
NM_145891chr16--1295 --11358
NM_145892chr16--1295 --11358
NM_145893chr16--1417 --11480
NM_145912chr22144265 4040 3968 3904 3609 1859 1783 1674 673 526 386 288 206 49 11830 13335 --
NM_147189chr81237 ------
NM_147202chr972413 2233 655 452 238 44 28 --2295 34 --
NM_148174chr811646 ------
NM_148177chr8132 ------
NM_148976chr111199 ------
NM_148977chr10--11200 ----
NM_148978chr10--11200 ----
NM_152240chr331000 170 158 --1454 1227
NM_152244chr174931 902 781 76 --1850 --
NM_152253chr2294210 4113 3587 1520 990 629 600 538 191 ------
NM_152271chr8--1422 ----
NM_152309chr1042033 503 487 200 ------
NM_152341chr1631112 936 567 ----11308
NM_152342chr161528 ------
NM_152344chr171539 1123 ----
NM_152388chr243280 2475 1592 706 ------
NM_152424chrX74263 3630 3609 3121 1697 1110 751 --21381 33 13067
NM_152441chr12----1137 --
NM_152470chr1874076 3790 3277 1176 961 889 274 13074 23079 906 13140
NM_152519chr222098 2042 ------
NM_152529chr214014 33058 1192 916 1162 --
NM_152538chr321205 467 --1505 --
NM_152556chr722308 901 ------
NM_152570chr9----1123 --
NM_152608chr1--1230 1148 --
NM_152622chr5------1715
NM_152624chr536863 6448 1196 11441 ----
NM_152667chr2021385 70 11271 ----
NM_152678chr31130 ------
NM_152680chr432284 2073 373 ------
NM_152734chr655311 5206 4073 3517 905 25187 1814 24742 318 35283 4289 775
NM_152745chr71315 --157 --
NM_152753chr621419 397 1436 21701 485 --
NM_152756chr533656 3053 1674 ------
NM_152769chr194725 715 279 30 --2825 231 1573
NM_152787chrX21316 962 ------
NM_152789chr711059 1164 ----
NM_152835chr11656 ------
NM_152868chr221353 ------
NM_152890chr11282 ------
NM_152896chr91767 ------
NM_152924chr1556301 6138 5048 5027 902 --12333 11670
NM_152989chr1211726 ------
NM_152995chr4----1727 --
NM_152996chr121476 478 ------
NM_153006chr17140 --1291 --
NM_153029chr1643500 1231 814 607 13372 2791 35 1636
NM_153050chr22104953 4874 4786 3844 3407 1685 1427 1233 948 893 23948 1175 13911 --
NM_153051chr22104953 4874 4786 3844 3407 1685 1427 1233 948 893 23948 1175 13911 --
NM_153188chr544404 1531 1468 505 25583 3835 ----
NM_153207chr122708 647 ------
NM_153228chr17--173 ----
NM_153260chr1521316 234 --1162 --
NM_153267chr9----1165 --
NM_153273chr362397 1843 890 508 430 291 --72031 907 882 769 519 387 347 --
NM_153280chrX164 ------
NM_153334chr222527 192 --1705 --
NM_153335chr1731383 1009 913 11357 ----
NM_153354chr52157 68 1258 ----
NM_153362chr6----1343 --
NM_153367chr1043441 2693 991 122 --13457 --
NM_153456chr1345325 5058 4454 1944 25889 2191 ----
NM_153487chr694052 3634 3144 3135 3081 1024 965 586 125 34527 3927 3193 54001 1847 1669 724 105 13124
NM_153607chr511032 ------
NM_153620chr72257 162 ------
NM_153631chr721271 306 ------
NM_153632chr721271 306 ------
NM_153645chr2232279 1283 302 --12268 11270
NM_153649chr1192 --11585 --
NM_153675chr201484 2625 200 ----
NM_153695chr91238 ------
NM_153715chr7--11060 1152 --
NM_153756chr121862 1411 1278 21433 368 --
NM_153759chr221214 166 ------
NM_153810chr1035085 4951 4011 ------
NM_153828chr2--171 ----
NM_170609chr621055 961 ------
NM_170674chr15175 ------
NM_170677chr15175 ------
NM_170692chr12911 157 1995 ----
NM_170706chr123353 1572 33878 1734 464 14137 1641
NM_170709chr82733 167 ------
NM_170731chr1121893 71 12413 ----
NM_170732chr1121893 71 12413 ----
NM_170733chr1121893 71 12413 ----
NM_170734chr1121893 71 12413 ----
NM_170735chr1121893 71 12413 ----
NM_172071chr117167 17235 1305 --
NM_172206chr1731335 1297 401 --1209 31252 538 23
NM_172216chr1232738 805 617 11108 21981 517 --
NM_172217chr15----53594 3536 2684 1477 74 11004
NM_172315chr15175 ------
NM_172316chr15175 ------
NM_172344chr211484 ----11518
NM_172349chr5142 ------
NM_172375chr141148 --1137 --
NM_173082chr62568 144 ------
NM_173214chr1666297 5721 5465 3082 1254 982 ------
NM_173463chr443454 1067 751 373 13948 3911 860 423 --
NM_173468chr425495 467 --1437 --
NM_173475chr1661670 1627 1558 453 370 138 ------
NM_173491chr511335 ----1926
NM_173495chrX32202 1863 1771 ----1871
NM_173511chr211310 12757 ----
NM_173515chr61640 ------
NM_173536chr413142 14922 ----
NM_173552chr31564 ------
NM_173595chr12105085 3995 3909 3485 2055 1975 688 557 225 78 23406 1476 43499 3452 1599 1121 --
NM_173683chr811764 ------
NM_173797chr521091 363 ------
NM_173808chr113848 ------
NM_173809chr10----11223 --
NM_173822chr211926 ------
NM_173832chr873285 2828 2617 2534 1507 800 290 --52834 2744 2518 552 99 --
NM_173851chr823741 2681 ------
NM_174911chr832710 1000 933 1779 22635 549 --
NM_174916chr152101 82 ------
NM_174921chr411061 ------
NM_174926chr11--1113 ----
NM_174934chr1153256 2958 1052 1022 724 11370 42679 643 330 181 11358
NM_174963chr11105 1217 --1669
NM_174964chr11105 1217 --1669
NM_174965chr11124 1236 --1688
NM_174966chr11105 1217 --1669
NM_174967chr11124 1236 --1688
NM_174968chr11105 1217 --1669
NM_174969chr11105 1217 --1669
NM_174970chr11124 1236 --1688
NM_174971chr11105 1217 --1669
NM_175077chr202233 38 ----1350
NM_175629chr221214 166 ------
NM_175630chr2----2768 713 1661
NM_175736chr1293107 2549 2504 1797 1761 794 294 91 79 2248 238 36736 5636 1933 47039 2687 1242 259
NM_175748chr1441887 1622 645 255 11382 1758 --
NM_175847chr1941010 427 292 274 --1541 2259 245
NM_175852chr152759 1920 999 537 170 12805 22565 443 --
NM_175854chr1312087 ------
NM_175863chr6--2945 45 ----
NM_175873chr52369 122 ----1275
NM_175898chr1531402 600 463 --1209 1446
NM_176871chr893251 3211 3069 2993 2530 989 787 494 146 22512 924 33078 2741 775 156
NM_177398chr151422 1405 1222 608 598 11677 ----
NM_177399chr151422 1405 1222 608 598 11677 ----
NM_177553chr11----1911 --
NM_177974chr15--21822 1595 ----
NM_177977chr1741762 550 538 214 2808 496 21563 569 1411
NM_177990chr203316 154 139 ------
NM_177996chr2072813 2712 2355 2302 2196 1192 64 1787 23108 1301 --
NM_177999chr983651 3176 2900 2361 1073 917 866 647 11140 52673 1209 910 821 50 13695
NM_178010chr1211726 ------
NM_178123chr21911 ------
NM_178138chr93348 110 64 192 2703 198 --
NM_178151chrX37680 2035 354 --13155 187
NM_178152chrX37680 2035 354 --13155 187
NM_178153chrX37680 2035 354 --13155 187
NM_178426chr132349 1896 1830 ------
NM_178427chr132249 1796 1730 ------
NM_178441chr1451161 367 312 186 48 ----1128
NM_178554chr352961 2459 2302 827 60 135 31206 1072 1033 --
NM_178562chr73892 806 156 ------
NM_181054chr141110 ------
NM_181302chr141523 ------
NM_181308chr141523 ------
NM_181336chr641263 1042 460 214 170 11362 --
NM_181351chr1142895 2136 2023 211 --12738 12721
NM_181361chr3----1277 --
NM_181486chr1211423 ------
NM_181489chr3114868 4795 4556 2460 2450 2221 2066 1878 1714 909 95 32049 1081 374 12270 --
NM_181504chr5166 13537 ----
NM_181505chr171107 --1482 --
NM_181523chr5166 13537 ----
NM_181524chr5166 13537 ----
NM_181537chr17172 ------
NM_181655chr171608 2551 500 ----
NM_181656chr171817 2760 709 ----
NM_181672chrX11326 ------
NM_181673chrX11326 ------
NM_181706chr1112130 ----11481
NM_181714chr621939 1912 1480 ----
NM_181715chr1----1300 --
NM_181746chr11378 174 ----
NM_181832chr2273765 3626 3620 3172 790 691 492 31324 1285 1172 33708 1181 827 13791
NM_181843chr111285 ----1112
NM_182487chr963965 3779 3526 1233 834 535 43231 1292 486 100 22686 110 34136 1307 460
NM_182493chr1643874 1623 1510 877 1359 11744 --
NM_182509chr142599 587 --21235 126 --
NM_182526chr14102996 608 539 467 350 226 169 155 125 21 --22470 579 --
NM_182557chr1151682 1637 1575 895 28 21863 1624 31845 1832 881 11372
NM_182565chr172736 48 169 2588 501 --
NM_182580chr182359 2106 1880 984 943 898 742 697 11890 1906 --
NM_182643chr841509 837 612 179 --12359 12194
NM_182649chr201262 ------
NM_182664chr13712 617 118 --11642 --
NM_182728chr1421255 1233 11610 2551 202 --
NM_182758chr15----12916 --
NM_182764chr202505 203 ------
NM_182765chr1021441 635 ------
NM_182789chr5--1833 ----
NM_182895chr222527 192 --1705 --
NM_182898chr734185 2014 1078 ------
NM_182899chr734185 2014 1078 ------
NM_182907chr62173 55 ------
NM_182925chr53476 62 50 --1551 2286 206
NM_182936chr1431144 368 27 ------
NM_182948chr112719 12214 ----
NM_182964chr1142614 2526 1077 536 22160 1297 ----
NM_182970chr20134245 4160 3927 3294 2861 2712 1649 1363 1316 1187 676 502 98 13308 14069 --
NM_183002chr1431144 368 27 ------
NM_183006chr2071446 1289 1249 1157 999 542 144 --11458 --
NM_183323chr5--1833 ----
NM_183397chr2075032 4132 3949 3149 586 526 340 41704 1535 477 25 54937 4276 4263 3726 1515 --
NM_194259chr16----1190 --
NM_194260chr16----1190 --
NM_194261chr16----1190 --
NM_194271chr121626 --1573 --
NM_194278chr1482802 1611 1227 648 456 295 246 134 21369 1127 ----
NM_194328chr9--1112 12383 --
NM_194329chr9--1112 12383 --
NM_194330chr9--1112 12383 --
NM_194332chr9--1112 12383 --
NM_194356chr12141 ------
NM_194442chr11494 --1102 --
NM_194452chr1131196 301 52 ------
NM_194453chr1131196 301 52 ------
NM_194463chrX1405 --158 --
NM_198040chr191178 1090 1074 884 490 169 91 78 32 --1332 --
NM_198056chr341639 693 552 91 --1814 11483
NM_198087chr16--1196 ----
NM_198088chr16--1196 ----
NM_198120chr81452 ------
NM_198270chrX32879 2845 1398 ------
NM_198334chr111152 --1292 --
NM_198336chr71373 ------
NM_198463chr3----161 --
NM_198484chr364993 2533 2514 2096 1375 79 ------
NM_198490chr363291 2926 2727 2354 2171 1391 43203 3127 1143 289 63348 3326 2233 2203 1257 713 11128
NM_198513chr84637 505 333 249 ------
NM_198560chr3143658 3280 3067 2912 2858 2805 2537 2368 1441 1075 908 440 366 205 --31164 638 613 --
NM_198597chr10125 1935 ----
NM_198686chr1472631 2224 1937 1799 738 216 111 22356 1705 1454 --
NM_198700chr11134 ------
NM_198721chr42111 42 ------
NM_198793chr32351 312 ----12980
NM_198794chr14--11128 ----
NM_198834chr1731924 807 319 2446 47 ----
NM_198836chr1731924 807 319 2446 47 ----
NM_198837chr1731924 807 319 2446 47 ----
NM_198838chr1731924 807 319 2446 47 ----
NM_198839chr1731924 807 319 2446 47 ----
NM_198859chr324976 3116 --14151 --
NM_198900chr1293107 2549 2504 1797 1761 794 294 91 79 2248 238 36736 5636 1933 47039 2687 1242 259
NM_199044chr122465 1009 --1984 11115
NM_199144chr20----11121 --
NM_199160chr931516 543 190 --21848 1703 11812
NM_199169chr2043502 2266 1130 1108 1790 23146 2255 --
NM_199170chr2043502 2266 1130 1108 1790 23146 2255 --
NM_199171chr2043502 2266 1130 1108 1790 23146 2255 --
NM_199203chr20----11121 --
NM_199320chr41617 ------
NM_199320chr41617 ------
NM_199368chr206663 601 573 253 219 177 ----1261
NM_199454chr163485 3321 2979 921 770 21 11362 43040 3019 1037 71 33014 2943 726
NM_201266chr282903 2827 2780 2511 2168 2156 2069 232 21119 672 --22774 2522
NM_201269chr12515 466 ------
NM_201279chr282903 2827 2780 2511 2168 2156 2069 232 21119 672 --22774 2522
NM_201378chr86721 373 343 312 272 64 --2986 185 --
NM_201379chr86721 373 343 312 272 64 --2986 185 --
NM_201380chr86721 373 343 312 272 64 --2986 185 --
NM_201381chr86721 373 343 312 272 64 --2986 185 --
NM_201382chr86721 373 343 312 272 64 --2986 185 --
NM_201383chr86721 373 343 312 272 64 --2986 185 --
NM_201384chr86721 373 343 312 272 64 --2986 185 --
NM_201432chr17126134 5844 5711 4539 2069 1409 1020 988 904 406 396 63 15470 45492 4440 1071 381 --
NM_201433chr17126134 5844 5711 4539 2069 1409 1020 988 904 406 396 63 15470 45492 4440 1071 381 --
NM_201436chr7--1689 ----
NM_201516chr7--1745 ----
NM_201517chr7--1689 ----
NM_201521chr61146 ------
NM_201522chr61146 ------
NM_201523chr61146 ------
NM_201632chr521699 1386 --2325 145 --
NM_201634chr521798 1485 --2424 244 --
NM_202004chr11150 --192 --
NM_203301chr1431233 201 47 ------
NM_203305chr932012 1869 388 1491 3905 794 452 1975
NM_203307chr1921629 1354 ------
NM_203327chr2023017 1639 --2361 333 --
NM_203342chr133492 2727 2259 --22759 348 12567
NM_203343chr133492 2727 2259 --22759 348 12567
NM_203344chr191133 ------
NM_203351chr17102470 2250 2185 1789 1783 918 657 435 366 340 --22321 1959 --
NM_203394chr1242387 1829 1022 551 ------
NM_203406chr522144 2011 ------
NM_203434chr96889 374 357 314 107 39 147 130 --
NM_203446chr21----1450 1497
NM_203459chr1--1993 ----
NM_203499chr172288 279 --175 --
NM_205846chr531238 348 315 ------
NM_205848chr11720 --161 12621
NM_205860chr122411 194 ------
NM_205861chr161980 1893 1609 767 755 702 2711 267 148 --
NM_206594chr112694 ------
NM_206595chr112694 ------
NM_206860chr101317 ------
NM_206861chr101317 ------
NM_206862chr101317 ------
NM_206907chr522241 105 --22114 294 --
NM_206909chr857480 6880 5334 2351 1343 16449 25863 840 --
NM_206914chr1222018 31 1344 1811 --
NM_206927chr111375 ------
NM_206928chr111375 ------
NM_206929chr111375 ------
NM_206930chr111375 ------
NM_207012chr1013456 ------
NM_207043chr121571 222 ------
NM_207044chr121571 222 ------
NM_207047chr121571 222 ------
NM_207111chr752541 2453 2269 449 388 2500 153 32530 2371 2319 --
NM_207116chr752541 2453 2269 449 388 2500 153 32530 2371 2319 --
NM_207174chr211594 ------
NM_207306chr134261 4172 1467 13763 34326 4160 3768 --
NM_207351chr31559 ----123
NM_207371chr1011489 11508 11302 --
NM_207380chr1573125 3079 2654 2639 2373 2271 753 --43118 1149 561 388 33563 830 774
NM_207520chr2--171 ----
NM_207521chr2--171 ----
NM_207627chr211594 ------
NM_207628chr211594 ------
NM_207629chr211594 ------
NM_213648chr521699 1386 --2325 145 --
NM_213652chr11150 --192 --
NM_213653chr11150 --192 --
NM_213662chr1752120 1959 1734 1704 1614 --22256 2134 --