TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1299
miRNA Sequence: UUCUGGAAUUCUGUGUGAGGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr5--11477 21872 359 2832 556
NM_000052chrX82898 2620 2435 2200 2167 1182 821 206 --11385 12236
NM_000084chrX136480 6388 6247 5810 5436 4945 2474 2398 2346 1870 1773 987 820 16414 2750 501 --
NM_000092chr234501 3912 108 --3867 717 648 33764 3515 3371
NM_000104chr262588 2295 854 549 480 76 --1444 --
NM_000108chr781834 1626 1591 1424 767 446 197 99 ------
NM_000112chr5104154 3951 3632 2216 1994 1812 1558 831 822 212 --11950 25486 1660
NM_000125chr683641 3552 1539 876 712 699 668 28 --22956 127 --
NM_000168chr793196 2501 2411 2310 2173 690 427 208 185 12495 --23308 2449
NM_000176chr553439 3113 3095 998 202 23463 3089 31545 1046 385 13223
NM_000208chr1944230 4120 523 115 44348 4134 4110 4030 --23525 455
NM_000217chr1284463 3714 3624 3455 2124 1413 1164 668 23793 3409 14920 34191 3612 803
NM_000237chr82661 531 ----11216
NM_000240chrX41854 750 631 179 ----1353
NM_000259chr1586170 6152 5709 3994 2533 1610 1347 65 26160 4916 45652 4895 2486 1955 --
NM_000276chrX71974 1864 1727 1416 876 401 361 ----261 29
NM_000314chr1063108 3070 2806 2438 951 293 ----12853
NM_000332chr6207181 7076 6913 6645 6623 6602 6401 6335 5615 5546 5525 4956 2703 2410 1776 1266 1064 486 242 52 26292 5897 24501 1058 11875
NM_000337chr5104585 4308 2600 2182 1913 1330 1107 660 385 225 26597 345 ----
NM_000351chrX64054 2912 1733 1303 1049 938 1950 ----
NM_000368chr9114314 3897 3813 3274 3037 1563 1357 1135 1119 1073 386 1567 189 34487 655 460
NM_000390chrX53356 2766 2484 2225 480 --13422 33101 2788 371
NM_000439chr532188 871 688 1589 --1189
NM_000448chr1152411 2140 2007 1055 674 22477 1066 23132 2671 --
NM_000461chr384487 3799 2835 1660 1624 903 693 449 --13149 13071
NM_000462chr1531561 570 207 ----11272
NM_000489chrX62429 2353 899 759 723 247 12994 11151 13402
NM_000555chrX107713 7233 2988 2262 1844 1391 977 918 902 27 21129 788 35737 3152 248 27252 2026
NM_000610chr1142643 2416 2248 243 22008 501 32931 2110 511 --
NM_000615chr1162020 720 658 568 476 423 --22852 410 --
NM_000618chr1284809 2212 2203 1987 1832 1356 1121 1080 15242 12577 --
NM_000618chr1284809 2212 2203 1987 1832 1356 1121 1080 15242 12577 --
NM_000633chr1874799 3968 3407 1671 1170 1050 638 13589 24207 1542 14088
NM_000686chrX31195 295 159 1987 --21432 1149
NM_000719chr12176465 6295 5648 5248 5206 5025 5003 4752 4339 4330 4243 4158 2633 2443 1986 1596 502 16592 12250 2460 65
NM_000793chr1464633 4451 1005 659 539 532 --23526 2059 24029 3834
NM_000794chr51163 1248 1412 1726
NM_000813chr555576 5322 1907 1000 204 44660 4567 2118 92 ----
NM_000814chr1544037 3517 3099 877 11128 13916 33807 2679 1171
NM_000831chr1146190 5336 5090 5051 4952 4761 2024 1772 1439 1416 1327 775 449 301 --44459 4037 2504 1204 26317 5270
NM_000875chr1597043 4841 4587 2772 2173 2023 1235 643 520 1119 34751 2812 1012 15960
NM_000885chr241771 1640 616 568 11701 --12142
NM_000899chr1284006 3709 3049 2955 1611 1572 435 387 32895 346 163 ----
NM_000902chr383205 2753 2733 2405 2137 1078 961 818 --1718 11214
NM_000933chr2031617 1506 222 11303 1697 11117
NM_000950chrX82640 2598 2532 2315 1452 1427 1378 59 --1776 --
NM_000962chr983073 2745 2077 1229 959 701 313 212 2475 431 22626 53 32325 375 185
NM_001001323chr1252443 2281 1208 839 90 11137 12687 --
NM_001001389chr1142643 2416 2248 243 22008 501 32931 2110 511 --
NM_001001390chr1142643 2416 2248 243 22008 501 32931 2110 511 --
NM_001001391chr1142643 2416 2248 243 22008 501 32931 2110 511 --
NM_001001392chr1152689 2462 2294 1871 289 22054 547 32977 2156 557 --
NM_001001395chr1262447 2156 815 638 463 180 ----11133
NM_001001396chr173817 3557 3393 1558 1436 1371 677 21406 24 12765 1984
NM_001001419chr525109 3280 24859 243 22098 584 1408
NM_001001420chr525109 3280 24859 243 22098 584 1408
NM_001001549chr742810 2706 1748 832 ----22507 953
NM_001001550chr742810 2706 1748 832 ----22507 953
NM_001001555chr742810 2706 1748 832 ----22507 953
NM_001001664chr264030 1580 1234 562 146 49 156 ----
NM_001001668chr1973748 3393 1249 1029 811 45 24 14278 13556 --
NM_001001890chr2143751 3001 2749 785 22675 950 24101 1142 23481 2920
NM_001001928chr22148324 8125 7698 6290 6109 5852 5527 3345 2655 2469 2424 2189 1691 453 58086 8077 5169 2565 2381 48149 2757 2588 984 23071 32
NM_001001974chr1031875 1691 63 ----12305
NM_001001995chrX21590 162 1563 --21625 684
NM_001002814chr873334 3090 870 684 368 299 57 --23282 607 13654
NM_001002838chrX2141 50 1273 --2313 40
NM_001002860chr14124319 3752 3547 3433 3293 3111 2968 1488 1405 543 525 124 14025 ----
NM_001002909chr1732025 463 171 11945 --12145
NM_001003652chr1865672 5641 3012 2942 2595 980 35806 1285 196 12335 --
NM_001003674chr18126372 5915 5587 4952 4839 4514 4350 2628 2434 2297 2180 863 16222 16518 --
NM_001003675chr18126372 5915 5587 4952 4839 4514 4350 2628 2434 2297 2180 863 16222 16518 --
NM_001003679chr12648 602 ----11711
NM_001003792chr3175 21210 325 --1247
NM_001003793chr3175 21210 325 --1247
NM_001003800chr983678 3168 2363 2354 1361 963 666 444 11369 11116 12518
NM_001004317chr663357 1687 1456 828 515 196 1707 13804 --
NM_001004360chr221473 576 186 --11436
NM_001005242chr1221595 1106 41615 1166 488 136 11554 1171
NM_001005404chr1764373 4097 3296 1723 617 234 ----11690
NM_001005463chr1042232 2017 1909 1618 --32578 960 852 --
NM_001005473chr596292 6216 5482 5428 4238 4227 2248 325 223 --45814 5271 1147 701 --
NM_001005502chr1274231 3434 1052 957 828 575 59 14435 --14325
NM_001005609chrX113623 3368 3294 3160 2689 2612 1041 792 370 335 151 23637 1024 --1179
NM_001005861chr31639 --1188 2817 116
NM_001007023chr1464633 4451 1005 659 539 532 --23526 2059 24029 3834
NM_001007097chr974910 4568 4146 4139 3329 1377 514 14069 --23560 827
NM_001007102chr611025 11625 --21342 393
NM_001007237chr172877 2656 2271 2251 2126 443 270 --22111 1140 --
NM_001007278chr13105051 4666 3331 3261 2061 1738 1106 1065 85 67 --14852 --
NM_001007466chr674874 4095 3239 2036 365 320 28 1408 121 25073 1968
NM_001008239chr1852743 2603 1445 390 341 194 1720 12582
NM_001008405chr731742 1425 130 11635 --1558
NM_001008408chr7126293 5800 5355 5147 4408 4395 4345 1747 1672 1025 942 132 25297 5033 21505 162 --
NM_001008495chr832198 1440 543 ----1442
NM_001008541chr1052149 1898 1817 1571 333 21786 215 1899 --
NM_001008541chr1052149 1898 1817 1571 333 21786 215 1899 --
NM_001008701chr1972552 2507 2206 1148 1128 1023 115 --32577 2445 310 13059
NM_001009899chr376315 6024 4876 4678 4150 4048 122 24659 448 25513 5193 --
NM_001009909chr1112848 --23558 156 11427
NM_001009993chr254364 3845 1571 1059 555 ----23917 3014
NM_001010000chr1863099 2950 2906 958 472 284 32649 2604 261 11109 1244
NM_001010861chr132310 1881 510 --22051 1873 12406
NM_001010867chr1134717 2078 1941 1856 1748 1531 840 502 469 415 338 254 67 45744 4859 1221 658 25026 1507 --
NM_001010888chrX33569 502 340 11868 --23786 935
NM_001010891chr5116800 6722 6273 6059 5920 5705 5637 1621 1598 647 172 14753 34989 4635 2333 25764 783
NM_001011513chr473797 3425 3167 3148 3037 855 132 12846 ----
NM_001011666chr776531 6167 6098 5857 5417 4182 2046 25679 1073 1472 --
NM_001012393chr1174840 4542 4177 3300 1971 1596 165 --25007 115 13651
NM_001012420chr1532792 1156 397 ----22551 1931
NM_001012423chr1542792 1991 1156 397 ----22551 1931
NM_001012751chr102333 312 ----1109
NM_001012755chrX75081 3406 1088 889 525 373 224 14475 13076 14315
NM_001012761chr542469 2432 2140 460 11964 --32379 2318 610
NM_001012968chrX42761 2200 806 424 --11892 1764
NM_001012977chrX----1474 21330 1294
NM_001013031chr1052722 2557 2210 344 118 22387 1073 --33102 3041 1249
NM_001013620chr1298429 8159 5659 3366 3189 3126 1191 514 355 1631 1237 --
NM_001014434chr12811 252 ----1321
NM_001014797chr10107390 7273 6832 6613 6470 6156 5448 1394 950 764 46893 5811 2929 628 36110 5745 5201 --
NM_001015048chr1463125 2284 1048 529 98 70 21104 338 12773 1331
NM_001015049chr1463125 2284 1048 529 98 70 21104 338 12773 1331
NM_001017440chr7147705 7584 7102 7049 6110 5886 3032 1524 1411 1202 1179 335 323 292 27920 7631 46151 3244 1644 624 23303 2929
NM_001017923chr1421558 129 --1575 1117
NM_001018065chr966042 5927 3983 3657 2176 847 25919 1222 14574 24149 2211
NM_001018066chr966042 5927 3983 3657 2176 847 25919 1222 14574 24149 2211
NM_001018067chr154257 3564 1894 1350 722 --25211 248 --
NM_001018068chr154257 3564 1894 1350 722 --25211 248 --
NM_001018069chr154257 3564 1894 1350 722 --25211 248 --
NM_001018074chr553439 3113 3095 998 202 23463 3089 31545 1046 385 13223
NM_001018075chr553439 3113 3095 998 202 23463 3089 31545 1046 385 13223
NM_001018076chr553439 3113 3095 998 202 23463 3089 31545 1046 385 13223
NM_001018077chr553439 3113 3095 998 202 23463 3089 31545 1046 385 13223
NM_001018090chr1542230 2134 1039 362 --1384 1154
NM_001018091chr1542340 2244 1149 472 141 1494 21834 264
NM_001018102chr1542230 2134 1039 362 --1384 1154
NM_001023567chr1562184 2008 1739 806 700 397 ----11952
NM_001024094chr553439 3113 3095 998 202 23463 3089 31545 1046 385 13223
NM_001024596chr1963551 3224 2939 2449 1002 507 21225 1032 1188 --
NM_001024647chr12126644 6469 6040 5982 4854 4820 3051 1380 1369 1140 963 302 77031 6656 6601 1675 1607 1297 439 35673 971 209 --
NM_001024649chr532106 2037 1926 32640 835 98 21981 1049 11871
NM_001024660chr3--1249 1503 21433 200
NM_001024956chr1165853 2086 2013 699 442 252 11355 14326 --
NM_001025076chr1075209 5069 4923 4425 533 505 427 24552 1825 14933 1958
NM_001025077chr10106567 6427 6281 5783 1891 1863 1785 1215 995 982 15910 16291 12316
NM_001025079chr394086 3395 3373 3135 3014 2934 1452 866 306 ------
NM_001025108chr254013 3354 1145 498 368 1218 33940 3185 680 --
NM_001025252chr853011 1149 695 631 327 1860 12047 --
NM_001025253chr853011 1149 695 631 327 1860 12047 --
NM_001025356chr1242437 572 148 142 1537 1416 1691
NM_001025580chrX64098 3481 3295 2822 1343 644 22847 1686 23006 1194 13763
NM_001029858chr652817 2174 686 627 339 12665 22651 884 --
NM_001029875chr562462 2402 1909 1880 721 66 --12678 --
NM_001030055chr14134732 4662 4567 4429 4360 3768 3515 1835 1496 488 376 64 50 11525 11419 11284
NM_001031679chr1253483 2969 2609 2476 2351 22430 314 22936 2295 12868
NM_001031690chr752867 2507 825 169 126 1183 --31942 1231 380
NM_001031695chr2275159 4882 2153 1677 1517 816 482 11881 35238 3401 1223 --
NM_001031732chr443633 2866 2649 90 --13155 12823
NM_001032380chr1041562 1483 1246 768 --1335 11493
NM_001032999chr2084606 4009 3935 3405 1095 745 545 293 24457 3580 44482 4294 4189 1453 11304
NM_001033059chr631299 1290 580 --165 1468
NM_001033087chr2042713 1293 723 239 12203 1618 12176
NM_001033117chr384661 4078 3798 3556 3327 1958 1447 1234 21349 677 11496 21895 694
NM_001033566chr171357 --2311 223 1297
NM_001033568chr171357 --2311 223 1297
NM_001033576chr1752496 2332 2186 1008 725 1471 --1236
NM_001033659chr1721630 40 ----11406
NM_001035003chr441150 1118 524 167 ----1421
NM_001035004chr441150 1118 524 167 ----1421
NM_001035260chr1031529 1040 463 152 --11538
NM_001035511chr142186 2023 819 672 1520 --1571
NM_001035512chr132293 2130 779 1627 1126 1678
NM_001035513chr132293 2130 779 1627 1126 1678
NM_001037317chr132310 1881 510 --22051 1873 12406
NM_001037332chr522177 733 --21931 1861 12361
NM_001037333chr522177 733 --21931 1861 12361
NM_001037535chrX21158 558 --140 1492
NM_001037536chrX21158 558 --140 1492
NM_001037540chrX21158 558 --140 1492
NM_001039199chr2054973 4860 3535 1701 962 ----33842 3134 368
NM_001039580chr494926 4437 3401 3127 1608 1156 697 403 331 --21936 613 --
NM_001039590chrX63924 3440 3395 3081 1608 813 --1581 11254
NM_001039591chrX63924 3440 3395 3081 1608 813 --1581 11254
NM_001039618chr1164809 4073 1658 1512 804 518 --34797 704 100 14414
NM_001039709chr2084606 4009 3935 3405 1095 745 545 293 24457 3580 44482 4294 4189 1453 11304
NM_001039840chrX115736 5590 5451 4767 3984 1939 1879 1077 1031 749 365 25936 1021 11010 --
NM_001040001chr651938 1619 558 443 46 ----21878 398
NM_001040157chr482828 2520 2403 1816 1171 991 237 26 12797 --11831
NM_001040202chr44922 525 424 378 --2830 759 1590
NM_001040284chr1685146 4603 3884 3712 1986 1513 425 103 --12078 --
NM_001040402chr463251 967 938 919 806 357 ----1416
NM_001040441chr155258 4204 1995 1422 1271 --23534 283 13336
NM_001040624chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040625chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040626chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040627chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040628chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040629chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040630chr842610 1866 1730 492 --11010 32268 2221 833
NM_001040665chr7105052 4515 4167 3929 1598 1560 1189 1143 1099 198 --24036 1114 --
NM_001042355chr1674948 4588 4102 3580 2021 1932 1608 3929 202 126 14998 --
NM_001042412chr1674948 4588 4102 3580 2021 1932 1608 3929 202 126 14998 --
NM_001042413chr973593 3192 2526 1588 1250 1062 1035 --22537 1635 1139
NM_001042599chr295662 3000 2538 2472 2447 2296 1389 1260 994 --46411 5181 3125 3040 --
NM_001042601chr362916 2910 2524 2347 2308 2055 ----12618
NM_001042603chr1284824 4807 4666 2021 1826 798 669 118 15183 1912 --
NM_001042604chr374777 4208 4180 3298 1894 1535 740 13878 23663 1403 13785
NM_001042646chr361894 1840 1420 1395 1389 1262 --21658 1497 --
NM_001042749chrX51578 1465 1440 760 648 1412 --1639
NM_001042750chrX51578 1465 1440 760 648 1412 --1639
NM_001042751chrX51578 1465 1440 760 648 1412 --1639
NM_001044385chr234035 2800 1262 21587 920 23796 2937 1872
NM_001046chr542007 955 936 422 22074 30 ----
NM_001099678chr365885 5132 5091 4506 2179 510 12540 --11171
NM_001100108chr1108215 7264 7043 7022 5763 2382 1520 1341 1126 856 27588 7385 23186 3134 27313 84
NM_001106chr3159153 8537 7685 7591 7538 7339 7274 7103 6726 6499 3893 3389 1603 1199 26 59758 8489 7125 6538 1905 38531 6962 6716 --
NM_001113490chrX53430 3344 621 574 500 --2729 333 22589 2451
NM_001121chr1031614 1305 432 21413 188 21563 161 --
NM_001125chr361746 1653 1617 1564 155 68 --11869 2392 176
NM_001146chr83564 109 46 184 --32256 709 552
NM_001173chr14134732 4662 4567 4429 4360 3768 3515 1835 1496 488 376 64 50 11525 11419 11284
NM_001204chr267479 6219 5347 3105 2024 147 36131 5953 1100 24741 1671 27351 6276
NM_001256chr1741068 1059 780 435 12471 --22916 2286
NM_001259chr7116233 5908 5025 2475 2403 1840 1533 1433 694 338 113 1737 25353 2038 34782 4595 257
NM_001270chr51391 --1943 2986 135
NM_001304chr1723282 839 2953 381 23625 906 33362 2736 2609
NM_001310chr1272712 2346 802 793 677 550 210 12426 --12005
NM_001315chr661807 1726 1654 915 474 244 ----11503
NM_001343chr561625 1244 487 402 107 30 --1426 1308
NM_001356chrX52321 2199 2141 1588 671 1195 22525 1765 --
NM_001399chrX113623 3368 3294 3160 2689 2612 1041 792 370 335 151 23637 1024 --1179
NM_001400chr131256 1167 1036 ----1948
NM_001412chrX31346 399 299 12964 12630 2840 606
NM_001419chr1984504 4211 3885 3236 2963 730 689 628 --44614 845 711 492 14362
NM_001438chr183648 3619 2865 2524 1360 1077 890 807 33394 2792 2567 32497 855 154 12680
NM_001497chr942395 665 503 131 --2605 143 11896
NM_001542chr172877 2656 2271 2251 2126 443 270 --22111 1140 --
NM_001587chrX71974 1864 1727 1416 876 401 361 ----261 29
NM_001609chr1094169 3479 2741 1693 1072 953 577 363 172 34048 3962 1151 23022 584 24222 3244
NM_001616chr233131 2795 2338 --21258 406 12815
NM_001621chr752878 2465 2429 2353 1032 --22784 781 1908
NM_001621chr752878 2465 2429 2353 1032 --22784 781 1908
NM_001634chr631299 1290 580 --165 1468
NM_001650chr1833840 2806 824 43438 1362 1044 673 ----
NM_001655chr1172162 1874 1661 1481 1422 274 167 --137 --
NM_001656chr531466 535 345 --1275 1750
NM_001663chr1431934 659 289 11989 --1901
NM_001699chr1971826 1577 1513 1320 305 291 268 11132 31343 1272 1250 --
NM_001746chr532106 2037 1926 32640 835 98 21981 1049 11871
NM_001754chr2143751 3001 2749 785 22675 950 24101 1142 23481 2920
NM_001777chr394086 3395 3373 3135 3014 2934 1452 866 306 ------
NM_001858chr644906 4658 1342 745 33428 1310 1099 1395 13912
NM_001874chr1274231 3434 1052 957 828 575 59 14435 --14325
NM_001939chrX93222 3037 2924 2538 1292 973 300 85 48 43144 1242 1231 550 1958 --
NM_001949chr662881 2750 2325 2134 759 233 1134 1806 --
NM_001969chr1453354 2932 2592 881 310 --12869 11108
NM_001977chr42668 347 21252 456 11508 11546
NM_001987chr1241553 1481 868 675 24146 1034 33117 3036 2889 12828
NM_002006chr4115420 5111 4160 3942 3654 3636 3626 3510 1410 901 613 24983 741 24968 3600 --
NM_002009chr1542484 1999 501 31 ----22366 2265
NM_002015chr1362641 2421 1347 1182 1030 37 --2738 308 --
NM_002025chrX108972 7819 7338 3393 2741 2546 2315 2309 1468 850 48830 5846 5644 2231 --28382 451
NM_002092chr4115063 4121 3816 3431 3109 1350 1202 858 811 697 85 23419 244 1483 14871
NM_002103chr1971124 876 779 705 333 89 46 3943 215 182 1891 1965
NM_002126chr1763749 3561 3029 2806 1022 559 --22970 1467 22686 382
NM_002210chr253334 3205 1305 1139 177 --11378 22447 471
NM_002214chr784945 4886 4377 4338 4111 2064 1743 635 --34625 3649 188 --
NM_002241chr142779 2133 1945 166 --32842 912 792 32944 2513 467
NM_002264chr393356 1959 1697 1345 957 647 589 522 464 --23223 1556 11598
NM_002270chr554392 3916 3767 2200 831 ----13533
NM_002271chr1351822 904 807 583 576 --11728 --
NM_002285chr254013 3354 1145 498 368 1218 33940 3185 680 --
NM_002293chr13986 671 646 --31830 711 90 11114
NM_002310chr585249 5220 4605 4574 4547 2118 890 756 45683 4595 4134 1979 1460 26427 4238
NM_002336chr1264559 3405 1812 1627 1058 852 23680 1848 14797 11930
NM_002387chr564789 3888 1252 1210 280 194 24121 1609 35052 3680 1450 1403
NM_002481chr1107718 7384 6813 3007 2953 1735 1704 1548 1224 65 47369 6035 5076 438 --16644
NM_002505chr63472 407 205 11090 2485 222 21493 53
NM_002522chr1763269 3062 1370 1181 1170 1160 21554 1316 --11590
NM_002545chr1174840 4542 4177 3300 1971 1596 165 --25007 115 13651
NM_002577chr354057 3439 3269 1043 246 33730 588 208 1380 --
NM_002581chr9125030 4228 3872 2181 1698 1567 1428 1171 699 607 316 271 34713 3750 1098 ----
NM_002639chr1841108 941 857 71 1505 2396 86 --
NM_002645chr1142921 2861 1019 1011 22287 1143 --1583
NM_002657chr2093742 3704 3549 3388 1165 695 553 374 122 --196 1179
NM_002716chr1163687 3064 2602 2523 873 52 1623 33628 3093 328 13590
NM_002731chr162534 2354 2095 1095 649 392 --21247 337 --
NM_002736chr771866 1716 1352 627 488 350 103 --11661 --
NM_002737chr17136607 5909 5753 5400 5082 2368 2020 1996 1813 1696 1125 825 349 25168 5118 21976 760 26344 6052
NM_002745chr2294468 4124 4112 3485 3471 3086 3077 964 188 34394 1115 574 24235 4025 --
NM_002869chr1152196 1808 1435 235 225 2796 31 ----
NM_002886chr3124327 4265 4011 3651 3326 1578 1285 1209 1144 1068 461 331 24527 1353 24805 4236 1553
NM_002958chr31639 --1188 2817 116
NM_003001chr132293 2130 779 1627 1126 1678
NM_003012chr843161 1951 458 451 22198 1272 --12349
NM_003028chr923640 3376 1144 --33600 2719 287
NM_003034chr1287518 7227 6910 5487 5240 2756 1724 155 33193 874 280 23215 1592 --
NM_003043chr343526 3182 2696 526 23724 1331 23214 922 34005 3250 1461
NM_003099chr1596499 5104 4912 4886 4832 1836 1507 953 300 --11780 16200
NM_003108chr296822 6755 6667 5243 5228 4472 1026 1014 965 24857 439 22110 787 --
NM_003112chr752661 2521 1997 1228 1079 1764 1133 --
NM_003128chr252480 986 722 52 41 ----12647
NM_003144chr61547 1580 --22209 2180
NM_003185chr201977 --11044 11292
NM_003199chr1855150 5004 4827 3549 157 1247 31055 851 704 --
NM_003215chr441536 1327 1107 154 11052 3457 166 138 --
NM_003234chr331689 763 78 32311 1814 241 151 1512
NM_003236chr253503 2957 1209 1080 680 1839 2781 346 12260
NM_003262chr344193 3997 3302 1958 11015 13680 11702
NM_003298chr385309 4925 4028 2051 1592 1195 1007 706 34559 783 698 54855 4319 2484 2264 1390 144
NM_003350chr82171 105 ----1895
NM_003373chr1041762 1204 628 268 ----2530 393
NM_003410chrX62812 1218 1149 1031 992 133 12606 1519 --
NM_003411chrY41584 508 259 128 --1475 --
NM_003412chr342633 2620 2228 562 22682 1088 --1966
NM_003439chr773465 2654 2571 1410 946 285 134 22228 1342 155 23324 1368
NM_003489chr2112544 11254 --1371
NM_003498chr1622111 189 11803 22765 2009 22389 2001
NM_003574chr1894944 4243 4188 4128 3984 3886 1180 868 317 ------
NM_003583chr1293805 2882 2482 1374 1023 899 683 415 124 --12637 23928 209
NM_003590chr243141 3114 2917 575 22818 2476 41289 1225 702 122 --
NM_003597chr251624 1615 639 448 420 ----2202 52
NM_003607chr1103975 3876 3701 3389 3365 3050 2918 2891 1412 258 22847 405 ----
NM_003644chr17126613 6027 5450 4594 4468 2287 1804 1560 1440 1316 1166 378 --66071 4859 2352 2067 2018 1213 24238 136
NM_003663chr342800 2770 960 492 23318 1039 --23447 2551
NM_003718chr73490 225 51 ----1528
NM_003722chr33698 562 517 11094 --11822
NM_003743chr222170 1803 31851 1669 619 11926 11774
NM_003759chr421637 568 1602 44028 3693 2866 366 14010
NM_003787chr1831490 1060 1054 ----11501
NM_003829chr911247 1152 --2823 777
NM_003831chr1821488 695 11235 31706 1603 467 21555 538
NM_003872chr262900 2322 649 600 471 38 22254 116 1806 22282 396
NM_003873chr1031664 606 445 ----21952 1656
NM_003884chr321515 537 11452 2358 161 1577
NM_003909chr842343 2261 771 152 2909 871 1694 11877
NM_003913chr674127 4000 3361 3054 2984 2959 1500 ------
NM_003939chr1074028 4003 3609 2957 2527 807 436 14156 1325 --
NM_003941chr752402 2245 2193 1970 793 1950 32460 1962 1663 --
NM_003948chr431875 1692 957 --1588 1150
NM_003966chr576964 6217 5516 3079 1217 1168 85 --25715 2387 36307 1677 767
NM_003994chr1284006 3709 3049 2955 1611 1572 435 387 32895 346 163 ----
NM_004028chr1833840 2806 824 43438 1362 1044 673 ----
NM_004035chr1774921 4883 4636 1476 1098 1065 1054 3929 220 34 23148 150 11240
NM_004050chr1432572 2472 662 21102 998 32317 1062 243 1690
NM_004061chr52459 163 ----1648
NM_004087chr321341 352 11934 --1214
NM_004124chr1473510 2806 2748 2216 2202 1270 236 1553 23176 704 --
NM_004171chr11168762 8360 8101 7368 6542 6036 3428 3363 3140 2873 2493 1862 1753 1252 959 366 39305 7015 466 ----
NM_004172chr541689 1527 1407 655 1745 --1388
NM_004232chr1863700 3595 2601 1448 677 109 11439 13889 13224
NM_004253chr94884 711 653 626 1838 --1960
NM_004274chr1452831 2728 2704 2257 1291 23194 398 23078 2482 --
NM_004279chr742352 1874 746 263 --11632 11483
NM_004329chr103419 150 30 11186 --11152
NM_004338chr18126372 5915 5587 4952 4839 4514 4350 2628 2434 2297 2180 863 16222 16518 --
NM_004342chr731734 1502 175 32002 1640 359 1485 11986
NM_004397chr1144188 3561 2854 584 1482 13484 44138 3203 1491 1151
NM_004437chr173534 2523 2347 921 694 136 96 12216 42563 2401 1081 173 --
NM_004438chr222649 2155 --12551 22929 2142
NM_004458chrX22313 190 161 --32343 1045 389
NM_004464chr464164 3897 3095 2897 604 64 23116 1409 ----
NM_004480chr143830 276 64 ----1751
NM_004505chr1731613 291 207 ----11521
NM_004514chr1752702 2642 684 610 567 12064 --33014 1169 499
NM_004571chr21103338 3264 3255 3057 2922 2781 2667 2403 1154 361 --33105 1314 661 --
NM_004575chr471200 1192 1166 1128 269 99 21 ----1416
NM_004586chrX65376 4590 4377 4307 3692 2088 24167 3798 ----
NM_004612chr983937 3576 3177 1176 979 481 451 38 1606 ----
NM_004685chr1363021 2850 2574 1140 999 185 22910 2891 --12143
NM_004687chr1741559 647 595 518 --12006 11486
NM_004703chr1792509 2083 2039 2008 1712 967 407 226 22 11835 1137 12263
NM_004719chr1212142 22782 2056 --12011
NM_004726chrX95156 5095 4894 4855 3756 2225 1131 399 296 12188 ----
NM_004734chr1373204 3177 3018 2678 1215 481 243 52162 1990 1193 673 559 ----
NM_004745chr885064 2745 2735 1651 1402 1356 1202 947 45774 4911 4874 644 65436 5201 4390 4365 2101 1409 25021 1106
NM_004775chr1842237 2205 1942 931 1938 ----
NM_004781chr12270 134 --1255 2393 342
NM_004781chr12270 134 --1255 2393 342
NM_004815chr143671 3378 1298 777 54937 4121 3442 3393 1982 13454 1832
NM_004824chr621176 545 --11169 21151 401
NM_004845chrX113963 3929 3918 3640 3394 1588 1473 810 553 240 208 12690 21565 1152 --
NM_004857chr1463375 3090 2951 1796 551 128 33641 1134 108 ----
NM_004863chr14125139 5107 4496 3939 3606 3473 3387 3296 1375 988 456 239 --21311 771 175
NM_004866chr5124982 4924 4724 4714 4672 4507 3535 1585 1132 481 272 191 35029 3914 1958 11753 14749
NM_004873chr1463125 2284 1048 529 98 70 21104 338 12773 1331
NM_004896chr1021444 378 ----21453 598
NM_004898chr492918 2139 1033 825 733 572 312 125 92 1866 1484 1513
NM_004904chr776531 6167 6098 5857 5417 4182 2046 25679 1073 1472 --
NM_004949chr1832002 1558 728 ----1867
NM_004956chr784381 4221 3659 3043 3029 1197 956 789 43330 3203 2816 1662 23912 3057 14374
NM_004966chr105992 398 242 206 172 1893 ----
NM_004985chr1243506 2956 481 403 --11531 13343
NM_004992chrX168454 7755 6849 6418 5744 3375 3336 3127 3011 2804 2435 2216 1708 1575 936 129 68363 6300 6155 6137 5843 2612 47230 7214 3022 1312 12145
NM_004992chrX168454 7755 6849 6418 5744 3375 3336 3127 3011 2804 2435 2216 1708 1575 936 129 68363 6300 6155 6137 5843 2612 47230 7214 3022 1312 12145
NM_004993chr1431423 1338 440 ----1488
NM_004999chr633007 1283 728 33154 1374 1005 1486 2586 578
NM_005028chr1041707 729 341 195 2809 517 12364 21684 1601
NM_005036chr22148324 8125 7698 6290 6109 5852 5527 3345 2655 2469 2424 2189 1691 453 58086 8077 5169 2565 2381 48149 2757 2588 984 23071 32
NM_005056chr1275068 5051 4910 2070 1042 913 362 25427 109 11156 --
NM_005063chr1052886 1383 371 221 120 ----1889
NM_005079chr853011 1149 695 631 327 1860 12047 --
NM_005093chr2084606 4009 3935 3405 1095 745 545 293 24457 3580 44482 4294 4189 1453 11304
NM_005116chr2074123 4072 3848 1510 365 358 261 --24172 3391 23663 3125
NM_005121chr1772706 1297 1095 1041 948 937 265 23333 377 ----
NM_005156chr994964 4870 4824 4141 3582 1976 331 56 43 14607 34351 3961 1702 1871
NM_005168chr241513 1147 549 500 --31316 1176 476 --
NM_005235chr295662 3000 2538 2472 2447 2296 1389 1260 994 --46411 5181 3125 3040 --
NM_005238chr1153043 2849 2758 2336 230 ----1104
NM_005281chr14862 152 122 63 ----3253 189 47
NM_005311chr742810 2706 1748 832 ----22507 953
NM_005324chr1721649 1375 21759 770 --11705
NM_005329chr1682335 2153 1952 1870 1488 1472 768 287 2835 558 31749 603 233 --
NM_005339chr484071 3992 3364 3258 2656 1080 884 558 1535 13386 --
NM_005342chrX22519 1053 1152 --22115 2055
NM_005359chr18166370 5964 5952 5760 5614 5293 5114 4937 4572 2528 2035 1876 1326 781 595 279 34062 1956 191 11619 --
NM_005388chr991728 1606 1444 1371 1282 694 319 268 90 ------
NM_005399chr1103753 3391 3212 3106 2952 1410 1158 1046 772 596 --21640 121 --
NM_005400chr252652 2460 962 751 611 ----13080
NM_005436chr1073716 3416 2833 1220 491 469 281 13800 --12846
NM_005465chr132024 1656 390 1459 --1413
NM_005475chr1282610 2400 2363 1238 1161 987 814 632 --194 13315
NM_005497chr1776044 5936 4638 3781 2294 2238 1288 1934 35770 525 245 12069
NM_005504chr1234294 1954 1325 14622 11714 14556
NM_005506chr432638 1090 1080 1294 --32675 988 571
NM_005522chr741134 1079 879 204 1425 1289 1560
NM_005578chr384628 4570 4350 3654 1665 1653 1646 956 1619 --23914 858
NM_005591chr1172257 2133 1081 1012 739 550 127 --22069 2036 2939 529
NM_005596chr941754 1629 1444 680 15247 56178 4313 2346 1334 423 14324
NM_005613chr152189 2054 404 397 207 --11949 --
NM_005638chrX51512 624 550 196 152 ----11583
NM_005639chr125643 456 354 305 94 11615 11808 11314
NM_005642chr54366 154 31 23 ----1311
NM_005647chrX43330 882 701 567 --12712 1538
NM_005715chr682619 2355 2046 1910 1031 412 389 375 11777 --22082 43
NM_005732chr531415 1067 932 11178 1224 21477 1266
NM_005734chr113689 624 220 ----1765
NM_005759chr264722 4659 4029 1628 1438 916 41574 1378 951 309 1519 --
NM_005798chr13105051 4666 3331 3261 2061 1738 1106 1065 85 67 --14852 --
NM_005822chr681922 1801 847 748 584 558 340 218 --1769 11899
NM_005828chr1745030 3474 912 87 33988 3334 3283 23655 926 11687
NM_005840chrX116810 6530 6473 5960 5025 2556 1922 1866 1660 1403 23 16120 67641 2316 1951 891 607 445 12162
NM_005843chr251702 1420 278 236 181 --2505 258 11611
NM_005898chr1172130 1097 1073 724 509 483 99 --22644 2101 --
NM_005901chr1865672 5641 3012 2942 2595 980 35806 1285 196 12335 --
NM_005902chr1574044 3710 2945 1722 911 481 409 14179 43302 1738 1591 1105 --
NM_005903chr525109 3280 24859 243 22098 584 1408
NM_005909chr574205 4037 3997 3674 3545 3044 1662 1767 12916 146
NM_005935chr454878 3225 1772 1229 70 1289 11125 --
NM_005941chr833202 285 246 --22701 1040 23825 507
NM_005955chr165170 5107 3523 3440 1015 398 --44106 4059 1009 127 11824
NM_005962chr1052149 1898 1817 1571 333 21786 215 1899 --
NM_005962chr1052149 1898 1817 1571 333 21786 215 1899 --
NM_005966chr232109 2064 341 1943 --1840
NM_005999chr151506 1478 1274 1149 283 ----11579
NM_006016chr632260 1743 1418 12127 32149 815 559 1104
NM_006047chr2063421 3199 3053 2462 296 59 1565 181 --
NM_006055chr252403 2397 1133 869 806 1648 1609 3513 281 133
NM_006080chr71612 1569 12926 22201 825
NM_006095chr4134265 3735 1626 1440 1295 1019 817 603 557 426 414 140 83 --33018 1571 1429 --
NM_006106chr1173152 2832 2459 1382 1005 544 89 13078 22889 2452 11131
NM_006154chr152598 73 11156 11984 12649
NM_006203chr595211 4884 4260 4236 3549 2196 1839 698 237 1646 45099 4442 3843 911 1370
NM_006206chr432405 2340 719 32452 880 58 12416 12201
NM_006212chr1104996 4737 4200 3809 2064 1994 1987 1276 1120 25 24229 1639 ----
NM_006241chr352427 2361 2207 1681 735 --12027 --
NM_006251chr553343 2690 2111 902 455 --12990 12065
NM_006252chr197375 7337 5990 5510 2408 2295 1062 611 394 36869 5815 5574 26093 121 22550 520
NM_006256chr142515 1692 1114 795 ----1826
NM_006275chr2042137 1917 1796 321 11548 --11652
NM_006283chr8134669 4629 4555 4062 3931 3925 3516 3246 3108 3098 3017 1310 1099 2202 78 14513 13177
NM_006364chr141460 --1831 1233
NM_006371chr384656 4406 4238 1702 1577 1043 862 442 14177 55132 3796 1659 1350 757 --
NM_006375chrX2667 293 1724 --2647 512
NM_006420chr2032535 987 297 ----22498 806
NM_006457chr473797 3425 3167 3148 3037 855 132 12846 ----
NM_006464chr274614 4537 4285 4012 3656 1544 65 1173 12955 13116
NM_006482chr1293805 2882 2482 1374 1023 899 683 415 124 --12637 23928 209
NM_006538chr254041 3941 3218 3043 3009 --43909 3340 1417 710 21299 137
NM_006540chr82215 60 1600 1379 1979
NM_006544chr1485129 3947 1571 1415 1273 1244 729 454 14640 35207 1524 255 --
NM_006546chr17126637 6161 5753 5366 4811 4605 4086 2419 814 280 235 153 46229 5396 1285 31 25223 2020 --
NM_006549chr1242735 2663 2310 889 1905 22058 487 2925 321
NM_006561chr1075209 5069 4923 4425 533 505 427 24552 1825 14933 1958
NM_006572chr1743221 2233 1371 287 ----1864
NM_006577chr22994 500 1486 --1888
NM_006599chr16138142 7792 6328 5644 5569 5355 5098 5014 4982 2522 1820 512 250 11325 48119 6999 2705 655 27580 1861
NM_006603chrX51578 1465 1440 760 648 1412 --1639
NM_006609chr252501 1847 1183 973 256 11914 --12248
NM_006624chr1031391 254 183 --21770 44 1396
NM_006626chr952476 961 544 424 276 --11856 12106
NM_006646chr1362412 2356 2323 635 532 156 12010 --11123
NM_006682chr742258 1768 708 23 1926 32553 2318 1985 --
NM_006708chr641199 438 263 142 ----132
NM_006717chr992835 2739 2608 2091 1235 1179 938 663 79 --12175 12450
NM_006729chrX94968 4825 4566 4154 3854 2148 2043 1472 638 13642 25056 2020 1962
NM_006738chr15114623 4609 4547 4172 3434 3185 2912 2848 1560 802 728 23387 782 --12866
NM_006746chrX21158 558 --140 1492
NM_006750chr16147435 7070 6822 5501 3052 3002 2798 1878 1695 1649 1579 991 686 194 22294 415 22264 474 37513 6933 926
NM_006777chrX1225 12297 21980 1971 156
NM_006851chr1262681 1164 1079 967 811 247 1416 --1104
NM_006885chr1641280 1210 562 451 ----2588 532
NM_006918chr1165853 2086 2013 699 442 252 11355 14326 --
NM_006922chr242250 704 566 377 --2733 584 1795
NM_006940chr12----11362 21486 349
NM_006947chr42354 293 --1702 11668
NM_006999chr51766 --11529 21669 460
NM_007011chr15105888 5763 2660 1735 1623 1090 841 265 176 69 44199 2224 2026 1582 26526 440 --
NM_007034chr12825 229 ----1417
NM_007038chr2195186 4459 3972 2421 1764 1730 916 740 608 13904 1771 35807 1344 517
NM_007039chr1431638 771 423 32037 1977 619 1294 --
NM_007042chr382619 2078 2020 1780 784 463 213 137 ----22394 609
NM_007050chr20167918 7700 7502 7403 7210 7017 5995 5920 5892 5719 5275 2897 2747 2611 2531 33 46096 5782 2604 2218 27034 1652 --
NM_007064chr3--1249 1503 21433 200
NM_007078chr1052691 789 560 248 182 1649 12224 12979
NM_007084chr1331474 1184 360 --1224 11066
NM_007114chr363202 3149 2386 2371 715 685 ------
NM_007137chrX54976 4518 1942 1099 445 21560 160 24440 1955 12220
NM_007172chr2222873 1127 1401 12738 12927
NM_007173chr1121702 1519 --1971 1815
NM_007200chr15114623 4609 4547 4172 3434 3185 2912 2848 1560 802 728 23387 782 --12866
NM_007238chr20124724 4676 3178 3099 1903 1051 1032 949 690 505 319 221 --1450 --
NM_007249chr13149193 8708 8470 7958 7102 7011 3601 3175 2910 2102 2006 1892 1852 1644 47994 7643 5917 2226 27141 3568 27000 1598
NM_007287chr383205 2753 2733 2405 2137 1078 961 818 --1718 11214
NM_007288chr383205 2753 2733 2405 2137 1078 961 818 --1718 11214
NM_007289chr383205 2753 2733 2405 2137 1078 961 818 --1718 11214
NM_007292chr1774921 4883 4636 1476 1098 1065 1054 3929 220 34 23148 150 11240
NM_007331chr411041 11781 1432 22634 2309
NM_007345chr1862279 2020 1666 926 737 533 1448 1153 12266
NM_007350chr1274148 3478 1779 1522 1240 944 266 21628 606 24398 2825 1497
NM_012062chr121288 1745 --1785
NM_012081chr573748 3697 3255 2882 2330 111 73 21476 591 --23500 2306
NM_012089chr12233 181 1989 --11429
NM_012095chr1023516 95 12806 12799 11114
NM_012120chr652527 2353 2120 1907 1897 142 22967 33 11001
NM_012164chr9127159 7095 5932 5410 4890 4714 2683 1877 1437 1418 929 551 12113 46611 6073 5673 2580 25527 4604
NM_012175chr113611 123 38 1308 --1228
NM_012193chr1194424 4298 3637 3619 3292 1208 841 592 316 45224 2052 1350 473 55254 4988 3554 1766 431 1308
NM_012214chr265983 5540 4302 2506 1702 989 16083 26302 1661 24751 2402
NM_012234chr373029 2453 2324 1257 755 440 408 31045 987 849 1957 --
NM_012249chr253389 2641 2331 441 431 --21099 1010 12599
NM_012262chr134439 1214 187 11729 24717 3761 1310
NM_012281chr761910 1738 1538 908 687 328 1531 31968 803 181 21784 1772
NM_012290chr231351 1177 589 --144 11239
NM_012294chr773457 3347 3288 3018 2808 484 476 33314 2617 2583 --13357
NM_012297chr462568 2355 1617 919 553 208 ----1652
NM_012304chr592223 2127 1600 907 825 669 549 437 111 12565 --1794
NM_012309chr1184133 3841 3791 1490 843 403 370 172 31641 888 852 14242 23671 1554
NM_012334chr594429 4146 4072 3394 3260 3177 2906 1783 1573 14385 --11081
NM_012338chr7--31041 891 829 11266 180
NM_012382chr574461 3997 3733 3680 1812 1582 1413 14298 44305 1507 924 120 --
NM_012388chr1552643 2519 2235 2071 121 ----12508
NM_012420chr1052135 1733 907 753 240 --21715 1494 21664 375
NM_012425chr1022000 30 21927 1711 --12688
NM_012464chr462869 1994 1788 560 303 161 12198 1690 --
NM_013231chr1453699 3540 2971 745 476 33487 1613 483 11588 1855
NM_013255chr7106330 5894 3078 2820 2675 2502 2409 1544 1119 232 48059 6948 883 783 68747 8406 7986 5501 966 323 15775
NM_013281chr2051522 1451 1192 993 177 --11153 --
NM_013286chr393459 2896 2573 1066 826 802 417 336 225 13502 --13353
NM_013309chr1582516 2442 1059 1004 991 967 813 478 --31874 605 198 1536
NM_013348chr1931098 1048 965 21253 1142 41002 941 479 286 1870
NM_013374chr343141 2752 2709 31 21931 807 --12681
NM_013381chr1272143 1729 949 750 575 378 105 1340 12075 --
NM_013989chr1464633 4451 1005 659 539 532 --23526 2059 24029 3834
NM_014000chr1041762 1204 628 268 ----2530 393
NM_014016chr331300 1213 665 ----11665
NM_014021chr143192 2973 2233 901 22786 2128 22902 2303 11094
NM_014048chr16104213 4036 3628 3242 2036 1914 1634 933 704 259 21774 566 33442 1711 880 13473
NM_014112chr834391 1491 488 1347 34704 3952 548 11941
NM_014141chr755123 3258 1618 951 443 --25080 4938 11420
NM_014154chr341043 470 255 238 --1564 11501
NM_014155chr1165906 5805 5762 4810 2958 1835 16363 46653 6383 5108 1004 --
NM_014181chr242360 1143 507 223 --11885 12601
NM_014253chrX12373 22033 314 31665 458 80 1265
NM_014263chr1021374 1198 --1391 11128
NM_014268chr181900 ----21126 293
NM_014294chr861402 1345 1211 455 403 61 ------
NM_014309chr2275149 4872 2143 1667 1507 806 472 11871 35228 3391 1213 --
NM_014319chr12----21230 276 1131
NM_014325chr1251778 1496 908 814 155 --22271 125 1759
NM_014331chr497767 7130 6832 5240 2146 1095 1081 612 82 36220 1308 641 25368 1424 11179
NM_014333chr1142156 1751 454 274 3824 686 551 ----
NM_014335chr1531303 523 273 ----1128
NM_014350chr53961 804 289 ----1107
NM_014352chr1141397 611 272 162 193 21017 317 11451
NM_014376chr522177 733 --21931 1861 12361
NM_014388chr185865 5530 4937 4229 4004 1452 728 151 11879 43916 1212 1003 342 44813 1724 961 211
NM_014393chr822227 337 ----1491
NM_014423chr5124649 4505 4224 4063 4021 3805 3469 3419 2230 2188 2005 270 14352 45309 4187 2181 994 34774 1582 784
NM_014504chr731817 1505 758 2691 79 --11456
NM_014548chr1511051 ----21356 525
NM_014569chr741430 968 233 86 11320 --21046 472
NM_014586chr21124673 4387 3707 3530 2999 1767 1716 1126 986 434 231 207 34277 1504 33 24506 3453 11780
NM_014607chr242067 1676 1506 310 ----12104
NM_014615chr1633008 1350 1279 1147 22547 139 --
NM_014636chr934304 3786 29 23500 1320 33043 1461 758 11520
NM_014667chr32696 690 ----1902
NM_014683chr1751934 1842 1608 1412 425 ----21741 700
NM_014690chr752867 2507 825 169 126 1183 --31942 1231 380
NM_014701chr1562851 2590 2270 703 220 210 32167 2131 844 ----
NM_014721chr667361 7245 7157 6736 4514 2650 36411 2840 861 24564 2734 14769
NM_014730chr12134787 4634 4548 4329 4310 4164 3683 1777 1379 1024 732 448 436 34038 3851 3494 --11642
NM_014730chr12134787 4634 4548 4329 4310 4164 3683 1777 1379 1024 732 448 436 34038 3851 3494 --11642
NM_014743chr452138 1988 539 386 119 --22514 1929 12881
NM_014746chr273289 1051 929 597 417 398 148 13652 24013 348 --
NM_014747chr184708 3701 2187 1598 1275 1167 729 342 15425 44746 4613 1110 754 15452
NM_014755chr253893 2904 2863 1675 667 --1102 12735
NM_014776chr1252526 2318 78 62 33 ----12052
NM_014781chr8--2456 247 --11187
NM_014810chr153541 2772 2735 830 215 21431 1054 11203 12384
NM_014819chr512097 1277 11784 2542 507
NM_014822chr41570 --171 2124 111
NM_014826chr1103975 3876 3701 3389 3365 3050 2918 2891 1412 258 22847 405 ----
NM_014829chr51261 --2273 210 22048 770
NM_014832chr1321955 829 --21327 260 21686 1523
NM_014836chr1041562 1483 1246 768 --1335 11493
NM_014839chr131952 702 71 ----21682 137
NM_014840chr12112947 2927 2842 2522 2443 2243 1193 1094 469 343 265 ------
NM_014844chr1454167 1371 334 103 62 ----21674 169
NM_014850chr384661 4078 3798 3556 3327 1958 1447 1234 21349 677 11496 21895 694
NM_014873chr174384 3934 3651 3395 3220 1189 41 33060 547 405 14130 24815 1542
NM_014877chr1797041 6928 6825 5431 5270 4771 3014 2893 2164 25369 1668 35344 1749 1359 12837
NM_014893chrY31609 684 176 21905 484 --11759
NM_014897chr1771255 844 810 781 651 443 401 129 22811 989 11181
NM_014900chr241023 924 86 42 --11016 1872
NM_014904chr1053568 3055 1350 1054 731 23840 309 13797 23317 1030
NM_014906chr1753861 3803 1166 931 342 --23691 2945 --
NM_014912chr1023385 1353 32249 1365 831 --1406
NM_014913chr186965 952 452 360 228 54 --11498 1372
NM_014920chr623307 958 23713 2361 1348 11374
NM_014921chr1972552 2507 2206 1148 1128 1023 115 --32577 2445 310 13059
NM_014934chr1352437 1098 82 60 44 1277 --22934 28
NM_014946chr262224 2128 1118 1112 1076 896 23067 2856 12769 1342
NM_014951chr1052552 1692 664 612 330 12058 --22604 57
NM_014953chr1364088 3994 3095 2769 1210 1121 1680 1124 --
NM_014982chr1475159 4926 4186 4106 3852 3560 1014 21818 971 14086 --
NM_015000chr1252574 2419 1989 1163 438 23110 700 --1983
NM_015020chr1643751 3558 2750 2516 11419 --23242 1507
NM_015026chr1244592 3548 1706 1478 24052 1489 34100 3689 1009 --
NM_015032chr1362680 2496 1970 972 809 566 2916 872 22923 2733 --
NM_015035chr20116554 6146 4759 4719 2390 2231 2209 1938 863 783 276 15966 2989 964 21715 133
NM_015046chr942230 2043 708 75 11083 1191 1938
NM_015071chr5136454 5734 5703 5274 5244 5233 2476 1992 1574 1509 917 420 61 22362 330 ----
NM_015074chr1123779 3469 3439 3093 1805 1635 1505 1430 1235 917 726 143 --13480 11826
NM_015077chr17154392 3650 3587 3523 3420 3362 3299 2859 1877 1657 1509 1471 1280 839 622 --13175 14230
NM_015079chr1543042 2976 742 391 22207 623 32952 2678 2085 22275 696
NM_015090chr174756 3859 2409 1675 1453 1013 392 35599 4789 1424 1925 12191
NM_015092chr1684315 3673 3530 1876 1397 838 728 463 1383 --34686 883 556
NM_015097chr321769 1491 --12378 12231
NM_015107chrX72366 2080 1874 779 492 242 166 1424 --1604
NM_015115chr463251 967 938 919 806 357 ----1416
NM_015144chr1643410 3060 1450 685 --1335 23547 2587
NM_015149chr121984 763 ----21693 1423
NM_015156chr1473884 3443 2540 1401 734 339 136 23568 3396 1419 21305 448
NM_015170chr84687 638 486 366 12342 --1400
NM_015172chr121337 114 21548 1203 11190 11175
NM_015191chr1162658 875 717 591 305 64 21832 672 --12105
NM_015199chr3154 12866 --32332 2002 188
NM_015208chr1873969 3584 1610 1402 1201 721 354 12459 12835 --
NM_015215chr113021 --145 12402
NM_015221chr1021205 43 1197 --11146
NM_015236chr42413 236 ----21137 567
NM_015247chr1674948 4588 4102 3580 2021 1932 1608 3929 202 126 14998 --
NM_015250chr941980 1470 665 656 ----1820
NM_015267chr1231950 1780 1369 --21829 879 21642 602
NM_015271chr433459 3142 789 33072 2989 585 --13785
NM_015278chr662507 2377 1244 1098 701 575 2173 105 --33114 1043 253
NM_015291chr193008 2922 2472 1320 1259 807 481 68 33 --11115 1121
NM_015310chr8177804 7706 7524 7470 7241 6073 5713 5672 5412 2852 2310 1606 1318 1257 844 668 414 46240 3328 1483 888 --37999 1881 254
NM_015313chr1134566 3805 1724 21251 260 23554 3406 11420
NM_015314chr721889 387 --22069 745 12148
NM_015317chr252872 2529 2300 984 792 ----12658
NM_015328chr771933 1907 1086 818 391 344 326 --42178 1245 974 931 --
NM_015330chr22112591 2269 1959 1700 796 732 615 583 433 305 97 ----12335
NM_015335chr127970 690 525 352 302 233 102 ----12380
NM_015336chr1232158 2116 621 --12062 32484 475 430
NM_015344chr852092 1807 1459 809 455 21371 363 ----
NM_015347chr1222362 2082 --12786 22979 2477
NM_015365chrX64098 3481 3295 2822 1343 644 22847 1686 23006 1194 13763
NM_015387chr211748 --11429 12099
NM_015455chr543281 2688 1372 375 12962 2719 412 --
NM_015458chr894454 4391 3835 3743 3422 1894 1142 757 490 1821 44574 3755 3522 342 --
NM_015460chr321535 811 1162 21470 1334 11936
NM_015532chr1542230 2134 1039 362 --1384 1154
NM_015542chr1061145 1112 1045 505 409 109 21235 464 1198 --
NM_015550chr733475 1447 1313 22589 1417 23411 2986 --
NM_015564chr522547 2508 23002 607 1555 12725
NM_015568chr20104287 2985 2967 1369 1104 1095 725 613 313 53 13052 42952 1686 1010 120 --
NM_015569chr184727 4018 3815 3436 1145 1007 355 316 21156 756 24094 721 1563
NM_015570chr751696 1607 1591 1451 1170 --31766 363 190 --
NM_015571chr622369 199 --11891 134
NM_015640chr154257 3564 1894 1350 722 --25211 248 --
NM_015879chr18158007 7729 7512 7441 7110 5764 5310 2845 2728 2518 1776 1560 1360 1066 884 57796 6127 2415 1172 70 27754 2780 11741
NM_015886chr865363 4560 2175 1560 1428 1366 34108 2049 1147 34873 1661 1533 14701
NM_015906chr154488 1631 1529 876 464 11171 13951 34170 1569 735
NM_015912chr821555 252 ----2416 90
NM_015975chrX31645 1497 175 --3553 306 78 11794
NM_016021chr662405 2333 1016 557 160 152 23013 2291 --2883 769
NM_016075chr1373013 2957 2571 2262 2014 890 352 2192 158 ----
NM_016132chr1542734 680 299 270 ----12413
NM_016206chr3128764 8242 6927 6543 5841 2878 2670 2214 1798 879 581 364 27973 7335 47189 6077 5585 1522 16127
NM_016217chr663459 3064 3025 2517 1467 856 1885 --23692 1436
NM_016248chr1393903 3842 3598 3454 3183 2983 468 365 284 11186 12458 43926 3606 2715 2604
NM_016255chr652949 2034 1147 802 312 22526 175 --12297
NM_016260chr2116975 6129 5900 5712 4978 2876 2370 1877 513 480 378 32894 1383 351 16110 1789
NM_016271chr1871756 1694 1557 806 755 686 497 ----1828
NM_016272chr2242377 1946 576 329 22676 2514 12780 1125
NM_016275chr32565 173 --11072 12475
NM_016289chr252055 1617 915 151 145 21941 1664 --2622 227
NM_016297chr242971 2754 873 809 11364 --1665
NM_016322chr972641 2594 2318 2304 2095 2021 230 ----13140
NM_016338chr51446 ----21218 35
NM_016376chr1774347 4092 4024 3710 2728 330 22 14000 11425 14154
NM_016422chr1132775 2322 2269 --32390 910 299 1790
NM_016442chr541732 1469 893 778 21721 1616 --11499
NM_016507chr1743175 2549 952 345 ----12164
NM_016513chr623307 958 23713 2361 1348 11374
NM_016530chr1593666 3540 3157 2766 1406 1208 590 322 155 --44097 3679 627 371 12872
NM_016621chr1184491 3981 3335 3220 2889 1712 1482 1090 34200 838 68 33965 392 123 --
NM_016631chr213915 182 172 1157 ----
NM_016824chr1031614 1305 432 21413 188 21563 161 --
NM_016953chr255254 5072 1486 1382 55 1798 54783 4138 3862 674 648 --
NM_017412chr831385 229 104 --21058 972 1397
NM_017415chr5104233 4012 3856 3699 3179 3169 2853 1117 1067 821 23156 525 21238 774 --
NM_017447chr2153473 3442 1659 528 177 14052 14041 12931
NM_017563chr3106073 6030 5764 5572 5561 4765 4473 4160 2464 341 35445 2441 2309 44818 4563 4480 4415 12473
NM_017580chr1041903 1795 420 358 --32318 752 409 --
NM_017628chr494910 4639 4120 4055 3561 3534 1725 1073 163 13324 --21798 1389
NM_017633chr653569 2767 1505 647 455 11107 139 13176
NM_017637chr9148905 8441 8401 8363 7941 7161 6089 5961 3335 2763 2274 1238 1220 249 12987 --33004 2211 1014
NM_017643chr1753052 2602 968 134 119 --1126 --
NM_017644chr395041 4724 1689 1527 1501 1344 1121 494 444 11844 54299 3957 3280 1698 1383 --
NM_017650chr795901 5716 5375 921 828 732 465 379 74 34781 3946 1650 25948 4622 11426
NM_017658chr1473800 3753 3653 914 769 381 59 --11645 --
NM_017666chrX41872 771 467 144 2579 281 2295 152 --
NM_017693chr1331434 453 142 --21161 180 21352 1233
NM_017709chr173754 3147 1433 1413 1274 1100 934 --176 --
NM_017712chr1996190 6122 5874 5848 5385 5133 2406 1441 272 14924 24828 2166 35622 5008 375
NM_017742chr1831576 786 242 11459 11228 11939
NM_017799chr1451590 713 623 257 224 ----1295
NM_017811chr932949 2699 2295 12535 32734 2440 2002 12360
NM_017813chr8115730 4998 4205 3705 2246 1762 1634 1471 1176 956 817 --25428 4571 14599
NM_017824chr1052453 2257 1013 747 280 --1616 1801
NM_017848chrX73998 3017 1806 1505 1489 1455 174 21287 110 14105 34581 1272 581
NM_017849chr222681 1202 11991 --22693 2109
NM_017896chr2033460 2168 270 13017 12644 23334 2765
NM_017902chr10135575 4921 4456 4442 4339 4325 3589 1650 1155 1021 833 766 399 ----14142
NM_017919chr965110 4591 4312 2102 1036 979 23894 426 34712 1933 1183 13755
NM_017944chr1142833 2588 2285 2203 1457 --11009
NM_017952chr253394 3239 1379 785 468 34544 3945 1735 34143 3437 248 --
NM_017994chr74865 386 284 118 32035 1037 178 12968 --
NM_018017chr1072737 2036 1165 1138 968 520 95 --21976 632 --
NM_018036chr1494156 3700 3379 3277 3176 3039 930 812 72 13777 12743 11299
NM_018085chr1158069 8055 7930 6480 6049 5760 5588 3197 2788 2627 1020 881 532 428 152 2300 236 15461 --
NM_018124chr1652295 1707 943 780 141 1101 1627 11625
NM_018155chr352846 2468 2304 1354 408 --22699 916 --
NM_018211chr131821 829 823 21634 1470 ----
NM_018243chr463504 3253 2569 1549 1116 601 ----2901 228
NM_018246chr862643 2449 2321 2308 2225 2213 ----1496
NM_018247chr652585 2219 1914 437 429 1889 --1969
NM_018290chr411285 1363 --11119
NM_018293chr3--12313 1583 42772 1913 223 151
NM_018307chr171357 --2311 223 1297
NM_018361chr823877 1378 1976 11114 24039 1321
NM_018364chr121070 541 13265 --1711
NM_018373chr1496391 6331 6140 5610 4492 4424 1942 1441 1260 1795 45851 4826 3987 3924 --
NM_018374chr7115258 4994 4565 4133 3499 1697 1299 1248 871 567 477 1845 24002 3653 --
NM_018383chr251917 1871 1690 1676 644 ------
NM_018409chr442684 1992 478 455 1352 12127 12585
NM_018440chr8138160 7621 7508 6677 5659 5392 3063 2565 2134 1357 801 751 458 48565 6978 2791 379 1832 27953 1497
NM_018444chr831799 403 89 22106 770 1442 --
NM_018448chr122445 203 --1510 2795 181
NM_018555chr1932096 769 689 --12147 21716 107
NM_018638chr12105568 4472 3999 3914 1619 984 965 779 422 410 --44713 3442 1302 838 25095 3865
NM_018640chr1262447 2156 815 638 463 180 ----11133
NM_018718chr731823 1586 498 --11478 283 47
NM_018844chr741984 1667 372 195 31877 81 66 1171 1800
NM_018947chr754604 3659 3036 1023 96 53649 3617 3313 3065 731 24734 1529 14950
NM_018958chr1563913 3263 1597 1475 571 84 1126 12882 53482 3434 2949 1169 331
NM_018976chr1272831 2650 2294 1052 1001 804 87 21813 514 1262 --
NM_018979chr121240 --11737 21748 1616
NM_019001chr374777 4208 4180 3298 1894 1535 740 13878 23663 1403 13785
NM_019004chr732079 1546 672 ----2730 417
NM_019035chr461967 1900 1888 1783 1539 574 11285 2719 696 11697
NM_019042chr7180 1978 --11207
NM_019091chr22888 369 ----1737
NM_019094chr1253270 3033 2602 1023 291 13385 2502 143 --
NM_019116chr1652883 1435 1115 989 527 --22649 84 22756 941
NM_019590chr1021486 151 --1572 1332
NM_019591chr122821 248 --1338 2890 157
NM_019592chr93296 280 127 --1140 2853 208
NM_019903chr1031614 1305 432 21413 188 21563 161 --
NM_020122chr285890 4079 3987 2087 1376 1217 187 96 ------
NM_020151chr271191 1160 535 389 156 116 36 ----11564
NM_020182chr2063007 2936 2909 2848 2785 291 --43208 2279 945 708 13247
NM_020204chr12811 252 ----1321
NM_020245chr664780 4001 3145 1942 271 226 1314 --24979 1874
NM_020309chr194951 728 360 274 1433 --2410 34
NM_020310chr1762717 2359 2267 2091 415 86 12485 --21047 886
NM_020336chr2073790 3637 3405 3370 2419 986 905 13826 32978 2814 2800 11476
NM_020338chr1083619 3549 2450 2306 1471 1432 421 360 --32509 388 349 13351
NM_020390chr354423 3862 3249 455 237 --1125 11565
NM_020432chr71255 ----32126 1926 38
NM_020440chr182680 2412 2076 1183 785 542 440 37 1887 --33073 2519 2430
NM_020466chr684282 4256 3767 3268 1895 1303 1249 1013 2932 730 ----
NM_020673chr2066695 5616 1918 1655 1013 176 26999 2898 11552 --
NM_020718chr1686345 5605 2488 2446 1911 1557 1153 1117 35979 5594 5027 34782 909 304 --
NM_020727chr2153734 3519 1326 808 392 --11033 13775
NM_020742chrX72737 2323 2303 1685 501 194 103 11972 --11825
NM_020752chr1052767 1862 1014 522 245 --22444 556 --
NM_020766chrX43316 1069 947 823 --43709 1599 988 109 --
NM_020772chr1786778 5339 5310 3211 3063 2548 1834 918 11841 11864 --
NM_020774chr1865782 4666 4347 2349 2283 846 15693 44926 2054 627 489 --
NM_020783chr182529 237 ----12067
NM_020792chr341717 458 432 352 1581 12310 11091
NM_020803chr452344 1756 1746 625 507 ----1593
NM_020805chr1851530 1340 1282 660 38 11699 21852 231 --
NM_020810chr1463488 3310 3219 3082 1319 750 --23361 605 --
NM_020834chr1451885 1852 1221 652 405 21830 357 --11309
NM_020854chr1811502 ----2630 255
NM_020868chr221473 576 186 --11436
NM_020871chrX41948 1937 553 433 ----2476 269
NM_020917chr1953257 1092 599 535 482 23895 2915 --22607 1251
NM_020918chr1053468 3239 1017 715 475 23246 2501 22256 1374 --
NM_020922chrX2141 50 1273 --2313 40
NM_020927chr1632062 1955 1685 31929 1669 795 11852 22086 277
NM_020948chr163000 2922 1268 884 277 57 --21288 662 23639 2423
NM_021038chr373046 2902 2882 2666 2184 1286 279 --1721 1178
NM_021061chr8103717 3349 3200 3168 2920 2768 1771 1250 443 177 74106 3402 3284 3074 2800 1408 137 ----
NM_021083chrX63441 2732 2539 2276 484 247 1980 1356 --
NM_021090chr22114975 4479 4310 4137 4131 4047 1652 1614 940 758 348 --14866 24062 955
NM_021097chr272821 2469 2168 1016 797 305 254 2576 235 --1652
NM_021111chr911209 --1374 11294
NM_021116chr7228928 7877 7843 7744 7732 7519 5932 3046 2652 2474 2343 2238 1949 1910 1772 1754 1560 856 802 349 299 142 48827 1224 1197 1025 1234 21493 1038
NM_021167chr71140 11925 21010 27 11063
NM_021227chr4--1387 1483 1368
NM_021252chr1062061 1747 842 753 563 437 ----11984
NM_021255chr1493840 3193 3063 2785 2752 2715 1638 1507 66 43946 2792 2522 440 --12673
NM_021622chr1031875 1691 63 ----12305
NM_021629chr353629 1174 915 607 136 --34319 3789 1451 23770 847
NM_021638chr474914 4533 4435 4027 3903 1863 112 24646 1459 43266 1538 1021 718 24451 968
NM_021705chr63472 407 205 11090 2485 222 21493 53
NM_021813chr685829 5350 4931 4861 1150 1130 262 44 14206 1702 15302
NM_021911chr555576 5322 1907 1000 204 44660 4567 2118 92 ----
NM_021912chr1544037 3517 3099 877 11128 13916 33807 2679 1171
NM_021913chr1971826 1577 1513 1320 305 291 268 11132 31343 1272 1250 --
NM_021914chr1452312 1856 1848 912 384 12456 22100 1753 --
NM_021954chr1372604 2408 2389 826 627 396 22 --12589 13560
NM_021961chr1187284 5639 5300 5022 4629 2257 1151 257 12560 32777 2003 1494 37461 2972 1940
NM_021964chr385456 4632 2603 2301 1260 1239 1133 379 12540 11098 1665
NM_021977chr643237 657 144 91 138 33660 1141 635 13081
NM_022048chr15155222 5207 5187 5133 4960 4904 4606 4498 4483 4187 3946 1790 887 870 694 25969 1082 11532 24386 1591
NM_022133chr81565 --21698 1617 1756
NM_022140chr532117 1850 1532 --1720 1854
NM_022166chr1655613 3991 2201 797 284 21122 497 46331 2244 1136 320 --
NM_022456chr12126644 6469 6040 5982 4854 4820 3051 1380 1369 1140 963 302 77031 6656 6601 1675 1607 1297 439 35673 971 209 --
NM_022458chr72210 48 42209 445 392 108 32568 2485 849 --
NM_022459chr13105224 4607 3860 2371 2245 2121 1211 962 603 477 11770 11239 14703
NM_022462chr19103638 3309 3178 3054 2573 2558 2453 1522 1237 949 12619 103113 2995 2711 2528 2421 1458 1392 792 760 369 52744 2499 2438 2356 1367
NM_022475chr4------2473 136
NM_022491chr1242505 2387 736 241 --43406 2693 2365 209 1769
NM_022726chr631763 233 64 ----11532
NM_022735chr121690 570 41537 1496 1437 526 --11180
NM_022893chr242673 1157 436 104 ----12242
NM_022977chrX22313 190 161 --32343 1045 389
NM_023037chr1311060 11140 --1335
NM_024052chr1752794 2698 2263 2048 712 1853 32144 2005 689 12832
NM_024345chr975827 5405 5095 4727 4164 2210 2047 34413 4370 2353 25983 5199 25543 669
NM_024524chr343022 2537 554 275 ----1253
NM_024548chr3153 21658 673 2153 146 11719
NM_024607chr883572 3350 3289 822 802 698 523 177 43673 2996 1375 1337 11508 --
NM_024639chr642258 2110 2003 1931 21912 1026 12864 --
NM_024665chr374630 3952 3898 3730 3053 1775 1575 24724 1272 14165 --
NM_024670chr1041305 1270 612 583 1702 --1673
NM_024689chrX51464 1354 1255 722 296 1160 1496 149
NM_024692chr21139 11359 --1529
NM_024740chr1143593 3305 993 52 --23977 744 11649
NM_024761chr9105072 4463 4146 4132 3835 1980 1798 1355 949 490 ----25169 1208
NM_024770chr286698 6377 5586 5480 5007 1811 612 529 --45466 5437 4947 442 24262 2626
NM_024841chr1141993 1953 964 619 ----2792 562
NM_024947chr3116568 6421 6348 5921 3795 2682 2466 1638 1013 979 543 182 37190 6479 1928 27773 2102
NM_024989chr2117046 6173 5820 5779 5604 2243 1793 1662 1643 1361 882 27807 3285 26962 1284 26929 1160
NM_025040chr1961909 1877 773 746 537 91 21665 1595 ----
NM_025054chr854084 3718 2840 2586 1529 12614 32758 1427 623 23260 943
NM_025134chr1642397 722 644 112 21753 869 2861 144 1997
NM_025147chr251108 987 945 925 399 ----182
NM_025154chr751149 591 527 502 430 --1458 11176
NM_025160chr183917 3806 3720 1467 991 857 559 526 11617 11240 13616
NM_025191chr143561 3292 3213 874 ----12937
NM_025221chr441150 1118 524 167 ----1421
NM_025235chr102784 204 --52037 1793 1776 563 228 --
NM_030579chr1623263 864 ----13649
NM_030627chr583813 3049 2940 2716 1387 1017 626 26 1755 ----
NM_030637chr146685 572 231 167 101 83 ------
NM_030647chr765943 4777 2400 1803 684 305 25950 5543 --14980
NM_030648chr495290 4142 3749 1756 1651 1201 895 335 23 13576 --11834
NM_030650chr263839 3225 1539 1007 991 124 13103 13897 --
NM_030660chr1431423 1338 440 ----1488
NM_030674chr1285646 4728 2037 1958 1901 1650 650 360 --45815 5735 3665 1693 --
NM_030755chr1462959 2298 2097 1941 462 114 1146 1837 --
NM_030799chr521798 870 --22128 1497 11394
NM_030806chr1217725 7061 6872 6816 6582 6525 6430 5935 5805 5799 5714 3365 3082 2337 2001 1868 1828 1376 1079 458 268 29188 2357 18063 17844
NM_030816chr153287 2391 1373 168 89 11063 12778 1631
NM_030817chr1253446 2955 1190 475 210 4757 516 469 60 12934 23169 445
NM_030918chr1113748 1673 1473 1179 720 681 608 547 268 106 42 --75390 5267 4991 4765 882 781 631 1770
NM_030953chr54614 449 362 105 ----21469 1312
NM_031267chr73490 225 51 ----1528
NM_031271chr831574 669 441 11214 11605 1614
NM_031296chr45824 625 467 248 193 --1695 11777
NM_031427chr1465597 5300 5200 1426 575 337 3503 431 394 --35817 5801 1418
NM_031435chr1233141 2333 712 11317 13151 147
NM_031468chr7147705 7584 7102 7049 6110 5886 3032 1524 1411 1202 1179 335 323 292 27920 7631 46151 3244 1644 624 23303 2929
NM_031469chr653793 3593 2605 1390 818 11573 72909 2838 2673 1363 1138 1085 558 33614 2993 616
NM_031935chr1--2366 201 168 1770
NM_032012chr995052 4828 3685 3486 2080 870 209 83 29 44478 4016 1635 1121 34666 3942 775 --
NM_032041chr842610 1866 1730 492 --11010 32268 2221 833
NM_032042chr541972 1902 996 449 1557 32326 442 161 31872 957 740
NM_032105chr1127851 7517 6946 3140 3086 1868 1837 1681 1357 198 146 47 47502 6168 5209 571 --16777
NM_032189chr1395023 4936 1329 1307 1300 1287 634 422 291 ----11241
NM_032199chr1073616 3056 2431 1091 811 505 244 1294 --11134
NM_032208chr253272 2699 1247 619 65 33538 2293 245 2916 254 --
NM_032268chr1672937 2023 1132 813 681 671 55 12605 22409 138 1758
NM_032291chr12258 194 ----1583
NM_032373chr1043641 1496 663 109 15086 15054 24950 4464
NM_032438chr611025 11625 --21342 393
NM_032446chr533788 3147 741 --12687 142
NM_032457chr493220 3030 2475 1505 1423 1217 1093 672 140 --23654 465 23268 794
NM_032505chr31180 12278 --21083 87
NM_032509chr832026 1688 913 32431 1730 574 22342 1603 12109
NM_032510chr1831788 1636 914 --2824 135 11535
NM_032557chr42953 718 1247 --1887
NM_032582chr1741636 1275 303 219 ----11544
NM_032622chr41201 11395 --1447
NM_032623chr42370 23 --1268 1107
NM_032842chr72383 233 ----21582 226
NM_032873chr1194593 4530 4160 3020 1824 878 624 442 180 ------
NM_032968chrX94233 2993 2698 2689 1494 1099 670 496 425 24204 189 --130
NM_032969chrX94233 2993 2698 2689 1494 1099 670 496 425 24204 189 --130
NM_032973chrY84225 2988 2693 1494 1099 670 496 425 24196 189 --130
NM_033020chr154488 1631 1529 876 464 11171 13951 34170 1569 735
NM_033030chr22185 24 ----21500 594
NM_033138chr731734 1502 175 32002 1640 359 1485 11986
NM_033139chr731734 1502 175 32002 1640 359 1485 11986
NM_033140chr731734 1502 175 32002 1640 359 1485 11986
NM_033143chr464495 4228 3426 3228 935 395 23447 1740 ----
NM_033157chr731734 1502 175 32002 1640 359 1485 11986
NM_033224chr7147916 7808 7363 7138 6630 6547 5477 3144 3090 1626 1507 1214 733 340 47769 6937 6045 1208 37186 6418 1974 1717
NM_033285chr864200 4018 3976 3923 1712 863 11248 1219 --
NM_033326chr1111581 ----2957 683
NM_033360chr1243627 3077 602 524 --11652 13464
NM_033389chr1774200 3972 3501 987 564 293 149 14610 43182 573 438 257 130
NM_033426chr1442846 2362 2251 880 22459 2096 --11911
NM_033429chr1573244 2251 2152 1072 852 280 164 --23128 3083 --
NM_033505chr2126357 6230 5342 4563 4315 4179 2628 2394 2201 1431 947 580 --34868 4110 2330 22518 345
NM_033542chr20101914 1673 1528 1362 1333 1285 756 636 488 70 --22027 482 --
NM_033631chr142552 2428 884 530 --12587 11164
NM_033637chr1074028 4003 3609 2957 2527 807 436 14156 1325 --
NM_033656chr2175808 5357 5288 5085 4887 2152 1129 --44902 4215 1508 1393 25339 1751
NM_052811chr13105051 4666 3331 3261 2061 1738 1106 1065 85 67 --14852 --
NM_052879chr1253835 2986 1470 624 322 --1800 1998
NM_052885chr1274715 3988 3703 3276 1644 618 600 34152 3392 764 --34018 1507 131
NM_052896chr142169 1881 1780 1006 --11711 12433
NM_052907chr1284265 3398 3200 3193 3135 2831 655 550 --21437 365 22955 1282
NM_052917chr222160 993 --12419 1147
NM_052918chr1052921 2756 2409 543 317 22586 1272 --33301 3240 1448
NM_053016chr977924 7755 6839 5775 5614 5313 4945 27954 1311 1559 37699 2345 1285
NM_053043chr7126293 5800 5355 5147 4408 4395 4345 1747 1672 1025 942 132 25297 5033 21505 162 --
NM_053064chr1462899 2248 2212 1206 904 80 21000 803 23104 1118 1974
NM_054016chr131862 1427 1278 ----21683 1490
NM_054016chr131862 1427 1278 ----21683 1490
NM_054016chr131862 1427 1278 ----21683 1490
NM_057169chr1252526 2318 78 62 33 ----12052
NM_057170chr1252526 2318 78 62 33 ----12052
NM_078470chr1052173 2101 1920 294 53 ----1503
NM_080546chr92935 914 32033 1952 1822 1485 22064 1696
NM_080591chr983073 2745 2077 1229 959 701 313 212 2475 431 22626 53 32325 375 185
NM_080599chr1061145 1112 1045 505 409 109 21235 464 1198 --
NM_080676chr2042713 1293 723 239 12203 1618 12176
NM_080867chr1453659 3284 3249 308 151 11127 24820 3653 24769 1046
NM_080927chr351155 1106 756 412 281 12827 12233 --
NM_130434chr15--1852 --2905 415
NM_130439chr1052149 1898 1817 1571 333 21786 215 1899 --
NM_130439chr1052149 1898 1817 1571 333 21786 215 1899 --
NM_130838chr1531561 570 207 ----11272
NM_130839chr1531561 570 207 ----11272
NM_133170chr20167918 7700 7502 7403 7210 7017 5995 5920 5892 5719 5275 2897 2747 2611 2531 33 46096 5782 2604 2218 27034 1652 --
NM_133265chrX53430 3344 621 574 500 --2729 333 22589 2451
NM_133334chr4125095 4586 4515 3968 2448 2433 2378 2098 2011 1800 290 234 --15746 --
NM_133370chr443633 2866 2649 90 --13155 12823
NM_133445chr993811 3456 3220 2870 1369 1340 456 211 193 33668 3534 3444 23036 962 21446 732
NM_133482chr531415 1067 932 11178 1224 21477 1266
NM_133493chr694416 4105 4021 3787 3097 2867 1007 771 40 33947 3168 279 22827 1678 33705 1477 534
NM_133507chr124923 325 133 90 ----1375
NM_133646chr265494 5460 5012 2041 1962 1038 65519 5060 4690 4139 1091 766 34732 3374 1005 --
NM_138270chrX62429 2353 899 759 723 247 12994 11151 13402
NM_138286chr1964084 3257 3165 2906 1620 1046 ----34347 4160 279
NM_138288chr1431901 1584 560 --22229 93 1688
NM_138333chr952349 2240 1765 672 425 --2206 147 1966
NM_138423chr1532086 1652 928 122 1708 11589
NM_138426chr762492 2408 1926 1577 946 408 --2289 56 12137
NM_138444chr1364090 3202 3173 1853 1803 753 1374 24803 4589 --
NM_138459chr643493 569 545 495 ----11338
NM_138473chr1273609 1928 1912 1289 977 816 802 13217 --11521
NM_138621chr254041 3941 3218 3043 3009 --43909 3340 1417 710 21299 137
NM_138635chr762626 2355 1282 627 344 176 --1203 21972 998
NM_138638chr1452312 1856 1848 912 384 12456 22100 1753 --
NM_138694chr622663 747 11097 23194 2849 13554
NM_138713chr16138142 7792 6328 5644 5569 5355 5098 5014 4982 2522 1820 512 250 11325 48119 6999 2705 655 27580 1861
NM_138714chr16138142 7792 6328 5644 5569 5355 5098 5014 4982 2522 1820 512 250 11325 48119 6999 2705 655 27580 1861
NM_138731chr1413618 23734 3263 --23834 990
NM_138771chr741563 1176 1127 191 1572 11298 --
NM_138782chr541965 939 287 236 1857 --1341
NM_138959chr196352 5868 5251 4683 1485 1398 1289 537 403 45235 2210 2071 1247 1379 12401
NM_139012chr661807 1726 1654 915 474 244 ----11503
NM_139207chr1242171 1703 506 364 --21592 1478 22200 642
NM_139279chr273159 3021 2885 2599 950 937 685 --22878 1074 1917
NM_139312chr1021374 1198 --1391 11128
NM_139319chr1211794 1260 --11442
NM_144571chr476460 5386 5305 2727 1451 1150 352 --2965 433 25225 4753
NM_144578chr1465372 4980 4206 3966 1009 687 13511 34082 1753 1112 --
NM_144599chr1585545 5495 5230 4645 4479 3812 3541 658 55150 4909 4686 4261 1329 13555 13388
NM_144632chr252387 1618 1589 1475 175 --21947 1791 --
NM_144642chr3151 11168 11272 2487 396
NM_144664chr111526 1226 22574 385 1328
NM_144767chr15114623 4609 4547 4172 3434 3185 2912 2848 1560 802 728 23387 782 --12866
NM_144778chr1342608 2574 2117 454 22419 380 1672 12208
NM_144973chr12115309 4924 4851 4511 1258 1101 954 810 600 579 410 12050 24330 2016 --
NM_145011chr1021828 105 1407 1519 22056 265
NM_145055chr1852743 2603 1445 390 341 194 1720 12582
NM_145102chr741430 968 233 86 11320 --21046 472
NM_145165chr141171 22441 2325 12726 1343
NM_145176chr663376 2780 1010 980 502 96 ----13201
NM_145307chr1054582 4328 3948 3474 57 14156 34552 1404 231 1875
NM_145320chr733475 1447 1313 22589 1417 23411 2986 --
NM_145321chr733475 1447 1313 22589 1417 23411 2986 --
NM_145322chr733475 1447 1313 22589 1417 23411 2986 --
NM_147181chr441150 1118 524 167 ----1421
NM_147182chr441150 1118 524 167 ----1421
NM_147183chr441150 1118 524 167 ----1421
NM_147188chr1521264 469 ----2489 53
NM_147189chr831904 424 218 1738 --12153
NM_147223chr232353 1986 1560 32034 1852 802 12109 21957 1568
NM_147233chr222170 1803 31851 1669 619 11926 11774
NM_148955chr1596499 5104 4912 4886 4832 1836 1507 953 300 --11780 16200
NM_148957chr132216 149 12193 --2641 415
NM_152253chr22123429 3380 3290 1706 1673 1518 1437 1425 1369 535 433 424 2936 804 12736 13539
NM_152263chr194771 4525 4405 4389 4257 3888 1876 1839 1209 --1461 --
NM_152280chr193326 3272 2330 2265 2141 1184 878 403 316 --23037 450 --
NM_152332chr1452222 2155 992 956 415 1612 12537 12867
NM_152387chr22985 304 ----1797
NM_152388chr234035 2800 1262 21587 920 23796 2937 1872
NM_152400chr41825 --1696 21300 379
NM_152407chr552367 745 720 613 475 33266 2424 1295 ----
NM_152420chr93695 522 273 ----1178
NM_152440chr122868 246 --11166 1109
NM_152594chr1521953 1819 --21502 939 144
NM_152622chr533384 2192 1161 12164 21016 706 13505
NM_152624chr587393 7161 6311 5957 1946 1170 836 210 11595 37058 5518 1756 26360 1695
NM_152629chr973593 3192 2526 1588 1250 1062 1035 --22537 1635 1139
NM_152724chr1022000 30 21927 1711 --12688
NM_152733chr696195 5989 5958 5028 4700 2588 2258 1345 1143 26330 1378 55922 5834 2235 514 110 24334 4007
NM_152734chr6115302 5092 4666 4567 4151 3722 2151 978 841 535 267 1516 55035 4869 4676 3688 33 14439
NM_152737chr622003 1444 ----21907 1758
NM_152756chr5103618 3144 3050 3020 3006 2723 1711 1562 553 245 --23654 3446 --
NM_152774chr732074 251 201 --1228 22318 192
NM_152826chr1596499 5104 4912 4886 4832 1836 1507 953 300 --11780 16200
NM_152836chr81565 --21698 1617 1756
NM_152837chr81565 --21698 1617 1756
NM_152838chr2063421 3199 3053 2462 296 59 1565 181 --
NM_152924chr15105888 5763 2660 1735 1623 1090 841 265 176 69 44199 2224 2026 1582 26526 440 --
NM_152989chr12----11362 21486 349
NM_152999chr7105052 4515 4167 3929 1598 1560 1189 1143 1099 198 --24036 1114 --
NM_153050chr22114975 4479 4310 4137 4131 4047 1652 1614 940 758 348 --14866 24062 955
NM_153051chr22114975 4479 4310 4137 4131 4047 1652 1614 940 758 348 --14866 24062 955
NM_153184chr311530 --11256 21942 71
NM_153188chr554392 3916 3767 2200 831 ----13533
NM_153207chr122699 356 12524 11151 11339
NM_153235chr621934 155 32326 1959 1651 22179 954 12390
NM_153262chr151960 1130 841 529 503 1251 32501 2231 731 13107
NM_153367chr1083689 3536 2794 999 938 837 568 432 22976 288 --12787
NM_153371chr1342354 1742 336 240 11572 12365 21638 234
NM_153456chr1386090 5743 5709 4929 4537 2492 2251 462 45051 1749 1573 695 25649 916 14104
NM_153499chr1242833 2761 2408 987 11003 22156 585 21023 419
NM_153500chr1242833 2761 2408 987 11003 22156 585 21023 419
NM_153607chr522536 2403 43119 2881 2002 838 2730 184 --
NM_153619chr1573141 2894 2581 1097 989 720 316 12941 --1645
NM_153620chr741525 1470 1270 595 21201 1111 1680 1219
NM_153645chr2222873 1127 1401 12738 12927
NM_153810chr1083680 3513 3278 1730 1337 1204 1123 68 14031 14361 --
NM_170665chr12114598 4364 4075 3821 3576 3382 3223 1608 799 423 129 --23636 689 --
NM_170720chr1931098 1048 965 21253 1142 41002 941 479 286 1870
NM_170751chr621176 545 --11169 21151 401
NM_170752chr621176 545 --11169 21151 401
NM_172037chr8154 21078 308 --1351
NM_172071chr176315 5477 2826 1914 1331 302 238 22464 115 56097 5710 5461 600 489 --
NM_172216chr1242735 2663 2310 889 1905 22058 487 2925 321
NM_172226chr1242833 2761 2408 987 11003 22156 585 21023 419
NM_172373chr1321224 255 ----1192
NM_173167chr1752496 2332 2186 1008 725 1471 --1236
NM_173214chr16138142 7792 6328 5644 5569 5355 5098 5014 4982 2522 1820 512 250 11325 48119 6999 2705 655 27580 1861
NM_173468chr486035 5121 5007 1856 1718 1361 799 535 24062 1890 --31444 1392 963
NM_173495chrX62560 1944 1785 1754 851 180 21019 664 --1447
NM_173511chr253433 2886 2603 543 111 --23080 517 12572
NM_173536chr455141 4651 4589 1065 172 24768 149 13174 11139
NM_173582chr1176057 5415 4595 4440 2347 589 191 25448 4178 --14376
NM_173642chr1126705 6547 5833 3560 3448 3433 3112 3063 2271 1626 1043 563 47405 2377 2328 853 27181 2241 16762
NM_173644chr2041809 1270 1233 267 --31511 229 30 22022 717
NM_173654chr321895 784 --22007 836 22159 1826
NM_173808chr164166 1597 1300 543 512 481 23472 3228 13860 --
NM_175623chr12126644 6469 6040 5982 4854 4820 3051 1380 1369 1140 963 302 77031 6656 6601 1675 1607 1297 439 35673 971 209 --
NM_175624chr12126739 6564 6135 6077 4949 4915 4746 1475 1464 1235 1058 397 77126 6751 6696 1770 1702 1392 534 35768 1066 304 --
NM_175625chr12126739 6564 6135 6077 4949 4915 4746 1475 1464 1235 1058 397 77126 6751 6696 1770 1702 1392 534 35768 1066 304 --
NM_175733chr1171718 1429 1369 524 430 102 93 21475 495 1152 1392
NM_175736chr12157738 7495 6937 6621 5633 5388 3122 2190 2129 1969 1438 566 401 276 190 12644 36950 6767 5536 --
NM_175767chr561760 1566 1534 1407 1296 1155 2742 570 11488 11851
NM_175854chr1322766 857 1988 --11914
NM_175907chr1812387 --31803 282 267 1462
NM_175921chr594270 4062 3511 3217 1135 1013 988 921 486 24100 401 24016 3204 --
NM_176823chr1103909 3462 3297 2495 918 585 453 379 369 26 22446 768 41047 741 294 121 13496
NM_177974chr1532086 1652 928 122 1708 11589
NM_178010chr12----11362 21486 349
NM_178011chr1072741 2701 2628 963 621 449 402 --23141 2312 1585
NM_178151chrX107713 7233 2988 2262 1844 1391 977 918 902 27 21129 788 35737 3152 248 27252 2026
NM_178152chrX107713 7233 2988 2262 1844 1391 977 918 902 27 21129 788 35737 3152 248 27252 2026
NM_178153chrX107713 7233 2988 2262 1844 1391 977 918 902 27 21129 788 35737 3152 248 27252 2026
NM_178154chr143830 276 64 ----1751
NM_178155chr143830 276 64 ----1751
NM_178156chr143830 276 64 ----1751
NM_178157chr143830 276 64 ----1751
NM_178423chr72848 254 --1217 1345
NM_178425chr72848 254 --1217 1345
NM_178470chrX4345 307 245 23 --1433 1632
NM_178498chr1142574 775 586 577 11027 23362 788 --
NM_178539chr124765 335 292 206 22103 1412 --11537
NM_181077chr1562006 1737 1517 806 700 397 --12178 11950
NM_181332chrX72737 2323 2303 1685 501 194 103 11972 --11825
NM_181351chr1162020 720 658 568 476 423 --22852 410 --
NM_181358chr1114219 3459 3422 3352 3134 3099 2716 1581 975 571 264 14019 ----
NM_181481chr18126372 5915 5587 4952 4839 4514 4350 2628 2434 2297 2180 863 16222 16518 --
NM_181482chr18126372 5915 5587 4952 4839 4514 4350 2628 2434 2297 2180 863 16222 16518 --
NM_181483chr18126372 5915 5587 4952 4839 4514 4350 2628 2434 2297 2180 863 16222 16518 --
NM_181504chr553322 3069 3057 1488 841 3993 861 590 ----
NM_181523chr553322 3069 3057 1488 841 3993 861 590 ----
NM_181524chr553322 3069 3057 1488 841 3993 861 590 ----
NM_181705chr533844 3553 1336 35576 4936 1057 35027 5019 1917 15127
NM_181784chr292333 1805 1688 1630 994 813 737 348 150 22389 1886 ----
NM_181836chr562616 2527 2099 1814 786 644 11907 ----
NM_182314chrX2667 293 1724 --2647 512
NM_182503chr6125342 5163 4997 4841 3996 1792 1636 1306 1101 743 304 284 1399 1453 2413 207
NM_182607chrX1699 21418 145 --1302
NM_182762chr755421 5356 5122 2283 353 14513 --24296 2414
NM_182797chr2031637 1526 242 11323 1717 11137
NM_182898chr776531 6167 6098 5857 5417 4182 2046 25679 1073 1472 --
NM_182899chr776531 6167 6098 5857 5417 4182 2046 25679 1073 1472 --
NM_182935chr362026 1885 598 321 252 232 32137 848 303 22109 1617 --
NM_182948chr162534 2354 2095 1095 649 392 --21247 337 --
NM_182970chr20103429 3405 3271 2615 1326 1143 966 773 485 262 22697 371 13466 33480 1438 804
NM_183004chr1453354 2932 2592 881 310 --12869 11108
NM_194247chr264394 4248 4200 3912 3368 3025 24373 3207 11105 11726
NM_194283chr543072 1447 87 36 12595 23287 2930 1820
NM_194285chr1133237 2955 63 --4703 179 168 30 12572
NM_194314chr175584 5411 4991 4317 1409 1080 654 ----24600 821
NM_194317chr272036 1963 1734 870 804 533 389 ----1885
NM_194434chr1894944 4243 4188 4128 3984 3886 1180 868 317 ------
NM_197970chr22185 24 ----21500 594
NM_198128chr1871756 1694 1557 806 755 686 497 ----1828
NM_198225chr1041562 1483 1246 768 --1335 11493
NM_198268chr1114219 3459 3422 3352 3134 3099 2716 1581 975 571 264 14019 ----
NM_198269chr1114219 3459 3422 3352 3134 3099 2716 1581 975 571 264 14019 ----
NM_198320chr1274231 3434 1052 957 828 575 59 14435 --14325
NM_198391chr2051522 1451 1192 993 177 --11153 --
NM_198392chr642190 2101 1934 433 42371 2305 2117 2075 32241 1459 551 --
NM_198400chr152598 73 11156 11984 12649
NM_198465chrX3946 300 62 --21009 69 21827 388
NM_198468chr674237 3613 3345 3151 1669 923 113 ----1771
NM_198484chr3126286 6212 5350 4814 4768 4602 4206 2389 1416 1281 518 170 45757 5035 4982 2029 15691 --
NM_198595chr474914 4533 4435 4027 3903 1863 112 24646 1459 43266 1538 1021 718 24451 968
NM_198793chr394082 3391 3369 3131 3010 2930 1448 862 302 ------
NM_198859chr374020 1975 1850 1719 1697 1364 356 --34717 4236 1758 --
NM_198896chr1152196 1808 1435 235 225 2796 31 ----
NM_198900chr12157738 7495 6937 6621 5633 5388 3122 2190 2129 1969 1438 566 401 276 190 12644 36950 6767 5536 --
NM_198935chr2043207 2096 286 48 --1610 22767 962
NM_198968chr1352437 1098 82 60 44 1277 --22934 28
NM_199003chr82982 465 21299 401 --1205
NM_199040chr1253270 3033 2602 1023 291 13385 2502 143 --
NM_199169chr2063007 2936 2909 2848 2785 291 --43208 2279 945 708 13247
NM_199170chr2063007 2936 2909 2848 2785 291 --43208 2279 945 708 13247
NM_199171chr2063007 2936 2909 2848 2785 291 --43208 2279 945 708 13247
NM_199188chr1253835 2986 1470 624 322 --1800 1998
NM_199190chr1253835 2986 1470 624 322 --1800 1998
NM_199324chr442633 2375 1162 1064 1211 43240 1076 939 353 --
NM_199421chr1453659 3284 3249 308 151 11127 24820 3653 24769 1046
NM_199436chr262224 2128 1118 1112 1076 896 23067 2856 12769 1342
NM_199461chr1092905 2630 2574 2241 1010 981 896 589 219 2396 234 23064 529 11215
NM_199482chr211748 --11429 12099
NM_201266chr262900 2322 649 600 471 38 22254 116 1806 22282 396
NM_201279chr262900 2322 649 600 471 38 22254 116 1806 22282 396
NM_201432chr17126613 6027 5450 4594 4468 2287 1804 1560 1440 1316 1166 378 --66071 4859 2352 2067 2018 1213 24238 136
NM_201433chr17126613 6027 5450 4594 4468 2287 1804 1560 1440 1316 1166 378 --66071 4859 2352 2067 2018 1213 24238 136
NM_203327chr2074123 4072 3848 1510 365 358 261 --24172 3391 23663 3125
NM_203342chr173534 2523 2347 921 694 136 96 12216 42563 2401 1081 173 --
NM_203343chr173534 2523 2347 921 694 136 96 12216 42563 2401 1081 173 --
NM_203403chr91507 --31134 493 301 1418
NM_203453chr951535 731 501 123 104 ----1260
NM_203458chr163409 2569 1272 1207 862 683 32879 2363 1466 31017 696 370 --
NM_203504chr462568 2355 1617 919 553 208 ----1652
NM_203505chr462568 2355 1617 919 553 208 ----1652
NM_206594chr183648 3619 2865 2524 1360 1077 890 807 33394 2792 2567 32497 855 154 12680
NM_206595chr183648 3619 2865 2524 1360 1077 890 807 33394 2792 2567 32497 855 154 12680
NM_206907chr553343 2690 2111 902 455 --12990 12065
NM_206909chr8177804 7706 7524 7470 7241 6073 5713 5672 5412 2852 2310 1606 1318 1257 844 668 414 46240 3328 1483 888 --37999 1881 254
NM_207012chr1023516 95 12806 12799 11114
NM_207015chr341948 1850 738 422 11798 --1620
NM_207292chr373046 2902 2882 2666 2184 1286 279 --1721 1178
NM_207293chr373046 2902 2882 2666 2184 1286 279 --1721 1178
NM_207294chr373046 2902 2882 2666 2184 1286 279 --1721 1178
NM_207295chr373046 2902 2882 2666 2184 1286 279 --1721 1178
NM_207296chr373046 2902 2882 2666 2184 1286 279 --1721 1178
NM_207297chr373071 2927 2907 2691 2209 1311 304 --1746 1203
NM_207304chr1342495 2461 2004 341 22306 267 1559 12095
NM_207445chr1561900 846 757 639 212 45 ----12033
NM_212558chr974218 4178 3140 3057 2652 1695 334 1308 13465 --
NM_213589chr254515 3867 3552 718 84 11812 --24898 1695
NM_213590chr13105051 4666 3331 3261 2061 1738 1106 1065 85 67 --14852 --
NM_213654chr341043 470 255 238 --1564 11501