TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1302
miRNA Sequence: UUGGGACAUACUUAUGCUAAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr521555 426 ----1807
NM_000084chrX146726 6546 5846 5818 5382 4908 2605 2214 2095 1749 1595 1131 536 123 1897 25399 1469 22323 1323
NM_000090chr22770 53 --1177 1241
NM_000125chr631286 711 83 13625 23921 875 13863
NM_000141chr1041312 1163 91 21 ----1475
NM_000192chr1251505 1489 631 387 249 ----1214
NM_000208chr1964436 3985 3931 3367 3349 614 --33611 3463 452 --
NM_000210chr241913 1825 1798 63 1565 22242 608 --
NM_000217chr1244933 3599 3388 1852 1738 25198 4576 --
NM_000237chr841834 1415 1344 271 1170 --1730
NM_000259chr1545081 4152 2119 1154 ----14488
NM_000267chr1773441 3287 2636 2440 950 418 69 --12826 11385
NM_000314chr1023294 1178 12497 --12203
NM_000332chr676286 6209 5996 5559 1686 496 348 --12749 --
NM_000337chr566440 5894 1883 1230 836 775 56282 5598 5421 4865 324 --14670
NM_000362chr2263627 3442 3015 1364 1254 678 ----1548
NM_000368chr994809 4606 4096 4090 3720 2955 708 452 265 11689 24036 1356 --
NM_000390chrX42224 1353 964 51 23229 3219 1774 --
NM_000393chr211321 11304 --21859 1401
NM_000461chr354131 2912 1227 1137 1072 ----1565
NM_000489chrX1535 23381 3286 33138 2721 2333 --
NM_000555chrX117289 6572 5757 5623 4766 2943 2756 2629 2188 2176 1616 --17484 --
NM_000633chr1842078 1963 1540 275 13932 24479 996 --
NM_000634chr281267 1089 963 900 841 830 812 343 ------
NM_000697chr17------2293 222
NM_000719chr12186330 6060 6034 5898 4522 4478 4426 4392 4224 4207 2645 2638 2536 1342 1215 405 223 46 --24157 1387 --
NM_000767chr1951515 1144 1067 247 49 ----11278
NM_000809chr469029 9013 8211 6929 6056 754 29134 1859 57840 7812 7786 2068 731 --
NM_000813chr5115294 5273 5106 5076 5009 4639 4623 4328 1088 1073 407 ------
NM_000831chr1135635 5599 5303 5256 5230 4713 4396 1763 1502 1415 1064 877 80 1547 46005 2502 1638 1090 --
NM_000870chr591423 1349 650 611 431 369 350 287 276 158 1315 --
NM_000872chr1081441 1319 1068 1001 615 298 235 68 ------
NM_000875chr15106446 4894 4849 2408 1135 757 417 312 306 178 --35514 4601 2373 --
NM_000891chr1753401 2843 1304 917 191 --23320 1450 --
NM_000899chr1243160 936 668 271 13105 1315 14340
NM_000901chr442306 908 248 242 --22371 50 --
NM_000926chr11129149 8317 8210 8191 7715 7384 7082 6284 3278 2562 2548 723 ------
NM_001001323chr121765 ----11042
NM_001001331chr342613 2350 1679 500 --11808 1783
NM_001001694chr22102149 2021 1947 1888 1655 1546 1481 762 430 342 1407 22313 2188 --
NM_001001890chr2183898 3179 3167 2716 1440 1418 1140 1096 13721 ----
NM_001001928chr22138147 7654 7437 6511 6239 5062 2646 2502 2103 1803 1640 1202 700 37996 5811 1018 18289 15308
NM_001001971chr1031284 513 230 ----1868
NM_001001995chrX2468 420 ----21535 128
NM_001002814chr843755 2951 2577 1430 --13067 12536
NM_001002860chr1443958 1276 997 599 --24437 1424 11111
NM_001002909chr1771832 1710 861 549 218 202 53 ------
NM_001003406chr22153079 2558 2510 2302 1250 1074 1056 836 696 627 610 450 430 416 43 ------
NM_001003407chr1074933 3950 1735 1243 971 925 215 --33932 1892 932 --
NM_001003408chr1074933 3950 1735 1243 971 925 215 --33932 1892 932 --
NM_001003652chr1898569 8150 7586 6917 3021 1616 758 127 21 --25276 2397 1274
NM_001003674chr1865131 4718 4544 2343 1941 862 --25827 2179 11909
NM_001003675chr1865131 4718 4544 2343 1941 862 --25827 2179 11909
NM_001003681chr221523 ----1604
NM_001003760chr643516 942 815 141 --11197 --
NM_001003794chr392923 2443 2355 1900 669 471 340 323 233 ------
NM_001004304chr1293223 3058 2346 2284 2173 1226 1102 1061 77 21112 969 1103 --
NM_001004419chr1252805 1799 1505 557 340 --14278 154
NM_001005353chr12824 220 --1443 21226 234
NM_001005353chr12824 220 --1443 21226 234
NM_001005404chr1782922 1759 1609 666 562 183 175 93 --11240 --
NM_001005463chr1022260 839 21974 706 --12498
NM_001005473chr535514 4166 4016 14988 35372 2631 2406 --
NM_001005527chr341205 1027 408 383 ----1364
NM_001006641chr93205 173 100 ----11106
NM_001006642chr93205 173 100 ----11106
NM_001006643chr93205 173 100 ----11106
NM_001007097chr9114585 4500 4256 3287 3203 3119 3091 1354 1307 1161 1104 --13252 --
NM_001008392chr393364 3332 3029 2917 673 586 339 314 68 --23371 1124 --
NM_001008539chr885299 5106 4733 4274 4205 3993 3652 727 1748 25013 1216 --
NM_001008738chr532343 2253 2159 --1354 12748
NM_001010867chr1126476 5769 5481 5167 4476 2312 2077 1971 1651 639 315 81 22197 270 45926 1798 1711 478 14644
NM_001010891chr525372 1679 --26675 2611 11180
NM_001010895chr92782 420 --1397 11415
NM_001010984chr121685 32 21775 380 32323 1938 1888 --
NM_001011666chr755067 4739 4509 2464 1358 36258 5190 1557 25126 4882 --
NM_001011708chr262885 2710 2426 2304 1172 1166 ----2725 618
NM_001013620chr1247692 2860 1692 1172 15968 16243 11133
NM_001014797chr1097705 7181 6510 6247 2811 2780 2350 1851 1066 --11420 11479
NM_001015053chr1771593 1540 1362 1113 577 264 233 --1225 --
NM_001015508chr8--1606 --2751 570
NM_001017395chr363218 2552 2468 2386 651 24 13265 12994 11080
NM_001017440chr7137794 7414 6237 5891 5563 5204 3027 2888 1993 1592 1553 880 685 26717 449 12757 --
NM_001018008chr15----172 1620
NM_001023567chr152931 698 --1960 11672
NM_001024847chr362526 1928 1715 1540 849 661 12423 1547 --
NM_001025076chr1075398 4797 4689 3923 3835 120 87 1100 21817 1330 --
NM_001025077chr10106756 6155 6047 5281 5193 1478 1445 1170 151 54 11458 12688 172
NM_001025580chrX73930 3405 3314 3145 2985 2615 317 --1293 --
NM_001029858chr652649 2599 2570 2548 1219 --23065 758 --
NM_001030007chr1653740 3500 3486 370 181 --13024 13251
NM_001030055chr1421476 984 --14007 24644 4383
NM_001031680chr1172091 2037 1995 1892 1776 1759 943 937 887 840 676 512 342 307 247 133 122 ------
NM_001031695chr2274982 4845 1890 1768 1293 1124 794 --11551 24025 221
NM_001031812chr51285 ----11483
NM_001032221chr971588 1348 1279 1172 603 420 414 ------
NM_001032394chr611060 --21781 880 11136
NM_001032395chr61927 --21648 747 11003
NM_001033045chr253220 1378 1015 284 116 --12961 11494
NM_001033047chr432301 768 256 --12031 1688
NM_001033049chr2191952 1932 1855 1675 927 687 667 584 145 ----11484
NM_001033087chr2042036 970 153 102 11273 --1579
NM_001033117chr3114829 4761 4605 4521 4499 4434 4426 4086 1664 1601 672 --11275 --
NM_001033551chr1793943 3596 3132 2572 2545 1373 1209 1195 494 ------
NM_001034841chr1654933 4044 1809 1348 207 ----15342
NM_001035254chr9112505 2121 2106 2087 1814 712 659 564 551 467 404 --12514 --
NM_001037553chr2194796 3292 1573 1078 592 456 431 410 202 --34833 4179 647 14577
NM_001039547chr3137485 7404 6087 5836 5642 3065 2912 2605 2391 2163 1264 967 552 22830 2331 --35758 1195 386
NM_001039577chr184388 3156 1801 1717 1444 927 713 236 ------
NM_001039585chr12189 112 --11500 23495 2991
NM_001039590chrX73695 2645 1522 1479 1204 828 24 --11155 --
NM_001039591chrX73695 2645 1522 1479 1204 828 24 --11155 --
NM_001039618chr1145291 1259 545 508 1581 21131 852 --
NM_001039693chr283953 3905 3313 3142 2959 2906 1564 549 1813 21366 501 23226 3075
NM_001039802chr12952 375 ----11374
NM_001039840chrX64777 4322 4148 4012 930 498 --23920 1878 --
NM_001039937chr1364130 3294 2927 2734 2702 2672 ------
NM_001040110chr741750 1669 1268 1222 ----1228
NM_001040142chr231656 916 882 --2720 685 --
NM_001040143chr231656 916 882 --2720 685 --
NM_001040172chr591423 1349 650 611 431 369 350 287 276 158 1315 --
NM_001040173chr591423 1349 650 611 431 369 350 287 276 158 1315 --
NM_001040272chr962192 1880 1619 701 472 452 1306 ----
NM_001040284chr1675333 5242 4644 4345 1039 1010 726 ----22213 1803
NM_001040441chr134136 1451 1292 34394 1911 1057 ----
NM_001040450chr1532757 1843 1144 ----12318
NM_001040453chr1532757 1843 1144 ----12318
NM_001040624chr852291 2171 2059 284 42 --12638 12515
NM_001040625chr852291 2171 2059 284 42 --12638 12515
NM_001040626chr852291 2171 2059 284 42 --12638 12515
NM_001040627chr852291 2171 2059 284 42 --12638 12515
NM_001040628chr852291 2171 2059 284 42 --12638 12515
NM_001040629chr852291 2171 2059 284 42 --12638 12515
NM_001040630chr852291 2171 2059 284 42 --12638 12515
NM_001040653chr372521 2408 2298 2263 1790 820 345 --11703 --
NM_001040876chr42636 195 11855 --11839
NM_001042413chr974058 2692 2591 1606 1358 1249 1086 21390 496 ----
NM_001042473chr1032100 1777 613 ----12016
NM_001042476chr1651994 1845 1632 176 26 1285 --1861
NM_001042492chr1773441 3287 2636 2440 950 418 69 --12826 11385
NM_001042555chr1284285 3537 1854 1293 1277 1196 895 720 --14570 23777 1486
NM_001042599chr296731 6714 6437 5762 5554 5199 2979 2801 408 12093 1555 --
NM_001042601chr342615 2054 560 219 --11164 --
NM_001042603chr1293806 3277 2060 1540 1475 1451 1430 1163 234 ----13957
NM_001042749chrX31813 782 723 1681 --11832
NM_001042750chrX31813 782 723 1681 --11832
NM_001042751chrX31813 782 723 1681 --11832
NM_001044385chr243063 1461 1261 785 --144 11482
NM_001044722chr51285 ----11483
NM_001044723chr51285 ----11483
NM_001048183chr173624 3531 2962 2352 1332 1277 289 22807 1448 ----
NM_001099678chr375884 5838 4898 4011 1787 1145 180 13931 25309 4669 --
NM_001100108chr188037 7981 7029 6921 6556 5944 5574 5230 25688 1073 35121 3306 597 --
NM_001106chr3199584 8668 8542 8058 8026 7925 7568 7143 7102 6923 6607 3796 2854 1275 1165 1053 588 356 314 28073 7657 13325 --
NM_001113490chrX--23616 948 12814 12613
NM_001128chr1653740 3500 3486 370 181 --13024 13251
NM_001148chr442126 1496 803 738 ----11458
NM_001167chrX46174 5942 5535 5287 --35454 1165 445 14298
NM_001173chr1421476 984 --14007 24644 4383
NM_001204chr277035 5379 5213 4985 2199 1669 1143 25338 288 26924 927 --
NM_001259chr756013 2177 1243 1188 604 --26386 4387 24998 4157
NM_001329chr1021604 1299 ----11057
NM_001331chr1172784 2227 1867 1139 1026 966 728 ----1192
NM_001386chr861783 1635 1569 854 820 611 --12190 --
NM_001543chr5194024 4001 3469 3128 3081 2955 1868 1793 1463 1167 1111 1085 780 502 395 389 325 313 301 11787 13379 13296
NM_001616chr242847 2352 601 107 13295 12337 --
NM_001650chr1832692 1328 46 11538 --11065
NM_001659chr1271803 910 796 368 340 201 70 12251 --11701
NM_001668chr172279 2121 1533 624 409 266 146 1668 ----
NM_001682chr121479 ----1756
NM_001683chr342613 2350 1679 500 --11808 1783
NM_001690chr31647 12423 1299 1526
NM_001695chr853813 3067 1441 974 31 --23743 1277 --
NM_001754chr2183898 3179 3167 2716 1440 1418 1140 1096 13721 ----
NM_001759chr1274785 3546 1336 1130 987 603 164 13451 13360 --
NM_001791chr12952 375 ----11374
NM_001969chr1433119 3049 2901 12500 33465 2591 620 --
NM_002006chr455837 5017 2072 1462 829 --1157 32192 1674 1558
NM_002025chrX129215 8766 8379 8329 8298 7083 6941 6333 2088 1922 1430 794 18982 11467 --
NM_002033chr1173766 3018 1209 631 601 593 399 1719 14073 --
NM_002035chr186500 492 484 476 468 460 ----13413
NM_002076chr1273181 2695 2059 1237 981 872 212 --13042 --
NM_002086chr1792025 1713 1600 1453 1388 790 596 427 325 21920 905 ----
NM_002092chr474966 4799 4059 3314 1160 727 84 1779 13658 13198
NM_002128chr1372575 2499 971 784 475 329 184 ------
NM_002203chr563472 3086 2966 2849 2759 1539 --22878 2608 --
NM_002254chr262250 2043 1567 796 468 317 ----12340
NM_002313chr1074933 3950 1735 1243 971 925 215 --33932 1892 932 --
NM_002334chr113130 102 33 ----11968
NM_002359chr17163735 3710 3659 3627 3609 3310 3301 2887 2785 2779 1633 674 382 375 357 70 --13809 --
NM_002375chr3112050 2013 1749 1684 773 722 634 164 61 52 41 --12334 --
NM_002382chr1471225 1084 1072 325 233 49 39 ------
NM_002401chr17101948 1900 1696 878 715 619 557 533 307 231 --1968 --
NM_002508chr151785 1631 524 153 84 11280 2621 292 --
NM_002522chr1772730 1560 1549 1338 626 186 150 13649 13659 --
NM_002577chr353510 2680 2513 1611 333 ----1854
NM_002646chr121853 179 ----1391
NM_002655chr833286 1191 211 --14495 23898 2091
NM_002657chr20103594 2901 2858 2529 2489 1296 1287 1157 868 71 21232 408 --23151 1258
NM_002698chr1992597 2375 2319 2033 1931 1128 1007 994 133 ------
NM_002709chr233308 2977 1022 ----12897
NM_002716chr11133683 3557 3550 3519 3272 3219 3146 3109 3018 1246 532 403 251 --32745 1406 326 --
NM_002731chr11840 12698 22884 728 12791
NM_002737chr1775744 5051 4283 4240 2430 2389 566 --1393 --
NM_002745chr2294070 4009 3915 2834 1545 1256 1144 977 85 --31473 1297 901 --
NM_002829chr91345 ----21220 261
NM_002874chr932166 2096 1732 ----12467
NM_002886chr344925 3360 1435 1346 24187 467 34234 1613 1067 --
NM_002940chr42636 195 11855 --11839
NM_003042chr381707 1595 1536 819 691 685 645 351 --11699 --
NM_003045chr1383473 1877 1417 1218 818 550 481 250 --33072 1754 1164 --
NM_003046chr885299 5106 4733 4274 4205 3993 3652 727 1748 25013 1216 --
NM_003048chr262689 1117 817 678 499 192 12361 ----
NM_003099chr15125857 4554 2521 2389 2265 2180 2123 919 731 141 125 56 1588 12564 14711
NM_003108chr277266 6183 2271 1099 852 268 257 --25938 5771 1294
NM_003150chr1742273 752 308 113 ----1875
NM_003199chr1845430 2038 1702 803 11447 11838 --
NM_003216chr2273133 2255 2039 1252 685 497 143 --32604 816 271 12269
NM_003242chr362526 1928 1715 1540 849 661 12423 1547 --
NM_003385chr2--137 144 1770
NM_003391chr73731 659 304 ----1366
NM_003392chr362968 2707 1730 1542 1344 390 --24225 620 --
NM_003411chrY31841 1148 165 ----1705
NM_003439chr722825 666 1634 --33495 3064 1094
NM_003458chr373998 3960 3554 3048 2885 1589 1344 --23439 662 1818
NM_003468chr244328 2802 1247 350 24184 385 1164 --
NM_003472chr621071 228 ----11089
NM_003478chr1132937 1207 1004 ----12104
NM_003483chr1242967 2783 2537 218 ----12017
NM_003498chr161167 11913 --12682
NM_003566chr1242540 1215 919 752 12158 11202 --
NM_003574chr1824992 3491 1744 31987 1232 564 15512
NM_003583chr1262678 2597 804 772 669 440 1984 13946 --
NM_003644chr17146590 6322 6069 5791 5727 5563 4342 1085 1000 884 794 413 374 216 15400 45951 4870 1177 682 --
NM_003679chr163157 3098 2983 2414 679 498 1843 ----
NM_003716chr32279 54 1748 1867 11053
NM_003759chr463930 3134 742 426 374 234 --23924 1244 --
NM_003877chr122890 855 --128 1803
NM_003885chr1731799 947 730 --12558 12376
NM_003913chr633999 2916 462 --23728 2958 13565
NM_003939chr1093681 2946 2921 2656 2614 733 648 477 323 ------
NM_003958chr643409 3079 2990 537 23371 1115 23262 2896 --
NM_003966chr536170 2668 1945 --27819 136 26339 5558
NM_003981chr1551028 835 677 189 117 ----1769
NM_003994chr1243160 936 668 271 13105 1315 14340
NM_004028chr1832692 1328 46 11538 --11065
NM_004037chr18755 625 252 140 122 107 91 54 --1279 --
NM_004067chr751119 1065 622 579 511 11366 1152 --
NM_004090chr1782839 2735 2659 1057 934 882 479 218 ----2135 62
NM_004094chr1422149 293 ----12001
NM_004096chr1072162 1788 1690 1508 449 202 195 12079 12033 1347
NM_004114chrX11188 ----11152
NM_004117chr681927 1826 1748 677 547 537 531 27 ------
NM_004171chr11118857 8652 8386 7742 2774 2330 1766 1437 1003 978 425 --12054 --
NM_004321chr2103244 2484 1259 1148 1121 926 854 479 467 64 13481 11274 13501
NM_004338chr1865131 4718 4544 2343 1941 862 --25827 2179 11909
NM_004350chr1172091 2037 1995 1892 1776 1759 943 937 887 840 676 512 342 307 247 133 122 ------
NM_004384chr51285 ----11483
NM_004397chr1134102 4080 3135 14280 44187 1254 959 195 --
NM_004411chr72638 611 --2163 44 1224
NM_004426chr1232003 703 662 11876 21390 719 21778 101
NM_004428chr11721 ----1766
NM_004438chr231267 1089 508 13131 --1732
NM_004491chr1983793 2966 2904 1676 882 640 441 270 ----14313
NM_004514chr17102878 2624 2317 2021 1156 1021 852 434 268 217 12997 ----
NM_004549chr1121559 285 11406 1438 11119
NM_004586chrX63895 3883 1918 1008 344 131 24278 609 1105 11762
NM_004598chr573187 3126 2984 1318 1124 430 151 --12818 13335
NM_004663chr1511389 ----2172 130
NM_004687chr1731734 1564 1548 1218 21927 441 --
NM_004726chrX55575 5106 4488 1337 234 --15632 --
NM_004742chr341796 1458 1241 261 11534 11698 --
NM_004745chr8106089 4896 4733 1664 1583 1401 793 723 551 85 --44857 4388 2303 1119 25565 2518
NM_004748chr1533984 1062 708 --1402 11168
NM_004759chr171836 1712 1530 1417 428 405 399 --12109 --
NM_004796chr1452004 1813 933 742 218 --1383 --
NM_004815chr144886 4034 3368 1282 24483 332 24467 1717 --
NM_004822chr17113826 3678 3230 3184 3080 2639 2536 2526 763 688 662 --33418 2933 2440 --
NM_004857chr1434555 3581 1506 12986 --14301
NM_004863chr14105092 4501 4136 4081 3307 1055 740 461 307 72 1471 --34937 1795 1155
NM_004904chr755067 4739 4509 2464 1358 36258 5190 1557 25126 4882 --
NM_004938chr931108 375 176 ----21096 790
NM_004976chr1194580 4452 4445 3668 3643 3470 3206 2046 510 15135 24381 3657 --
NM_004978chr161612 1300 1091 571 528 488 --1579 11048
NM_004985chr1233490 1058 549 --1494 13600
NM_004992chrX148246 7433 7362 6162 6059 5432 5377 2419 2365 2226 2070 1376 1000 57 25798 2333 37212 5192 2165 17061
NM_004992chrX148246 7433 7362 6162 6059 5432 5377 2419 2365 2226 2070 1376 1000 57 25798 2333 37212 5192 2165 17061
NM_005011chr741750 1669 1268 1222 ----1228
NM_005028chr1012270 --1591 32278 2259 321
NM_005036chr22138147 7654 7437 6511 6239 5062 2646 2502 2103 1803 1640 1202 700 37996 5811 1018 18289 15308
NM_005056chr1294050 3521 3483 1784 1719 1695 1674 1407 478 ----14201
NM_005096chrX71255 1189 1040 892 380 58 45 ------
NM_005105chr141801 1515 631 383 1508 1146 1185
NM_005116chr20114587 4147 3913 3580 2845 1683 1627 1620 988 260 177 --11293 --
NM_005156chr974227 3651 3588 3347 1789 1522 684 --54349 4180 1718 1398 676 --
NM_005188chr11157793 7465 6760 6278 6051 5956 5710 5625 5536 5515 2920 2823 2735 399 225 78005 7429 6591 3314 1966 1399 143 37526 6258 5521 --
NM_005197chr1444853 4584 4239 1732 13952 --1779
NM_005235chr296731 6714 6437 5762 5554 5199 2979 2801 408 12093 1555 --
NM_005338chr752946 2684 1187 550 94 --33942 3457 3143 12800
NM_005359chr1856450 4983 4811 2383 2368 --23993 896 --
NM_005399chr144100 4008 3577 2723 24083 3838 --12783
NM_005415chr22313 208 ----1178
NM_005474chr1771593 1540 1362 1113 577 264 233 --1225 --
NM_005487chr221523 ----1604
NM_005497chr1786137 5577 4681 1812 1420 850 798 187 14912 24054 1392 --
NM_005499chr19170 ----179
NM_005522chr73971 391 282 ----1530
NM_005578chr343482 3200 2046 217 --54029 3310 882 783 303 --
NM_005596chr966050 4734 4475 2344 1413 392 --24462 2373 --
NM_005611chr163989 507 166 --11119 1436
NM_005638chrX21718 606 --41763 1580 1377 142 --
NM_005647chrX43221 3162 2243 634 22271 895 12116 --
NM_005668chr543306 1232 683 205 1875 11078 --
NM_005730chr12103242 3106 2783 2741 2278 1290 1098 917 652 341 1705 43441 3164 1120 1037 11011
NM_005737chr252544 2308 2204 1156 597 --12885 --
NM_005748chr1223142 584 --138 1895
NM_005759chr274696 4318 3661 3357 3315 1467 1389 --13865 --
NM_005808chr393364 3332 3029 2917 673 586 339 314 68 --23371 1124 --
NM_005819chr143228 3127 2846 910 12495 22545 418 --
NM_005822chr641767 440 345 168 --22107 552 --
NM_005828chr1784699 3870 3642 3118 1599 1414 384 352 13234 13653 11749
NM_005840chrX96250 5894 4899 3025 2514 2036 672 658 123 12621 15102 15670
NM_005868chr712258 --1331 133
NM_005898chr1163088 2760 2363 2299 2226 1999 1537 12419 1213
NM_005901chr1898569 8150 7586 6917 3021 1616 758 127 21 --25276 2397 1274
NM_005904chr186948 565 537 470 436 423 1460 11491 --
NM_005910chr17113999 3313 3242 2868 2568 1632 1625 1420 1363 1121 690 23646 1109 13846 11225
NM_005941chr83945 741 537 13353 --11586
NM_005955chr185084 4490 4090 4033 1014 1007 1000 750 --33757 1515 837 --
NM_005957chr1114815 4400 4385 4112 3166 1510 1145 1123 1024 842 97 --2877 42 24929 3097
NM_006011chr15134210 3996 3795 3755 3684 3583 3062 1486 1116 961 756 574 315 21414 1282 23332 926 --
NM_006015chr12211 204 --21313 1055 --
NM_006060chr784045 3322 3238 3047 2880 1694 974 809 1878 13079 11618
NM_006095chr424499 1010 --22752 1018 --
NM_006136chr7----1479 1295
NM_006154chr1532276 1982 319 ----12581
NM_006166chr1221965 764 --12048 12312
NM_006202chr19101985 1818 1707 565 396 333 228 101 93 24 --11501 --
NM_006206chr432820 2589 2552 22346 992 --11788
NM_006224chr1752065 1798 937 306 286 --12077 22516 658
NM_006282chr2074765 4306 4246 3997 3420 3061 689 14041 11302 --
NM_006375chrX31545 1425 1202 11283 --1604
NM_006379chr7--2549 405 --11691
NM_006482chr1262678 2597 804 772 669 440 1984 13946 --
NM_006517chrX71767 1641 1524 1488 746 369 93 12105 3862 855 717 1161
NM_006538chr253714 2941 2922 1051 653 --12827 13176
NM_006546chr17115993 5491 5157 5034 4116 2502 1680 1234 978 866 783 --25900 152 --
NM_006559chr111009 11114 --11032
NM_006561chr1075398 4797 4689 3923 3835 120 87 1100 21817 1330 --
NM_006572chr1753128 1110 983 972 350 23165 391 22207 861 13295
NM_006599chr1668062 5904 5107 3151 62 45 --11428 --
NM_006603chrX31813 782 723 1681 --11832
NM_006624chr1011835 ----1746
NM_006654chr1284285 3537 1854 1293 1277 1196 895 720 --14570 23777 1486
NM_006690chr2081954 1908 1639 953 693 484 462 227 --21610 708 11592
NM_006720chr1074933 3950 1735 1243 971 925 215 --33932 1892 932 --
NM_006750chr16127941 7882 7606 7302 5898 5337 3001 1996 1720 633 504 425 11833 1561 --
NM_006763chr142001 1928 1912 429 --11343 1580
NM_006854chr731539 648 30 1286 --1715
NM_006861chr1272016 1713 687 642 582 518 83 2763 623 11951 --
NM_006902chr173152 3096 1339 705 604 566 349 --12493 12826
NM_006922chr21480 --1833 12243
NM_006924chr1753778 3663 2701 982 868 1938 ----
NM_006930chr542020 1696 1592 1420 --12032 21995 737
NM_006931chr1262090 1807 1661 1540 1374 799 11975 ----
NM_006948chr2132428 1963 707 ----11810
NM_007011chr1596792 5972 2666 2557 1161 820 563 406 145 11834 22401 894 --
NM_007030chr5105072 4694 4469 4376 4203 4055 1244 484 265 36 --13945 --
NM_007050chr2088046 6979 6656 5467 1735 1698 1023 539 11475 32253 1981 143 --
NM_007106chr1352626 2564 2518 2354 699 --12538 1349
NM_007189chr721431 200 ----21538 1239
NM_007195chr1863474 3434 2687 1395 1192 891 11047 1119 --
NM_007249chr13138834 8145 8014 6859 3566 2984 1619 1511 1441 1162 1122 524 265 25893 2058 29246 7482 16658
NM_007283chr392923 2443 2355 1900 669 471 340 323 233 ------
NM_007350chr1274585 3938 3740 3505 3231 3212 3103 11639 23080 2894 --
NM_007363chrX----11017 1737
NM_012095chr1032900 2545 341 ----22831 435
NM_012104chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_012104chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_012137chr111885 ----12916
NM_012141chr1364130 3294 2927 2734 2702 2672 ------
NM_012153chr1141757 1036 1016 476 --1198 11968
NM_012154chr82262 158 --1751 1272
NM_012164chr9137158 6805 6799 6295 6280 5660 5178 2399 1663 1543 1522 1326 799 12846 11239 --
NM_012199chr184543 4480 3128 2897 1576 1539 1492 213 --1304 --
NM_012214chr2115803 5093 4229 2362 2341 1701 1368 1207 1123 730 188 11537 16076 --
NM_012234chr323083 1124 ----1651
NM_012238chr10----133 11491
NM_012262chr134499 3643 1220 14899 23355 480 --
NM_012288chr674985 875 688 430 320 259 247 41651 1349 1044 108 14064 14280
NM_012316chr165326 4181 2118 2069 1458 86 11209 11401 25204 767
NM_012334chr594350 4236 4186 3767 3001 1850 1503 1322 142 1720 ----
NM_012399chr2231538 1443 538 ----1589
NM_012479chr772185 1788 510 426 361 271 132 ------
NM_013231chr1454129 2731 1444 1424 708 --11402 --
NM_013281chr2011509 11501 --1506
NM_013313chr2263518 3376 2299 873 178 165 32373 800 639 11199 --
NM_013341chr262885 2710 2426 2304 1172 1166 ----2725 618
NM_013381chr122365 211 11939 1377 1841
NM_013410chr12824 220 --1443 21226 234
NM_013411chr182129 2023 1810 1714 775 460 410 377 ----1751
NM_014016chr311270 ----11478
NM_014021chr122966 1251 ----1345
NM_014023chr1092754 2456 2196 2110 1783 1146 1034 946 664 --22809 2718 --
NM_014048chr1653886 3551 1910 1892 852 --11480 15309
NM_014112chr864698 4424 3830 1165 770 682 14718 14629 21364 414
NM_014155chr1155417 4687 2281 1595 1443 12553 --12404
NM_014181chr232825 1883 1860 --173 1576
NM_014231chr1261937 1841 1759 707 164 50 ----11772
NM_014233chr1741611 1350 764 89 1340 1844 11738
NM_014240chr353785 2827 858 444 305 13600 13116 13952
NM_014250chr221523 ----1604
NM_014263chr1021249 599 --1389 11093
NM_014292chr2261766 1369 1211 463 300 160 11546 11445 1113
NM_014293chr22113277 3151 2893 2769 2696 1582 615 394 261 188 181 1214 13755 11339
NM_014309chr2274972 4835 1880 1758 1283 1114 784 --11541 24015 211
NM_014316chr1651994 1845 1632 176 26 1285 --1861
NM_014319chr1231958 355 128 1146 11586 --
NM_014331chr465903 5797 5062 5018 2388 939 --15366 15215
NM_014333chr1142734 2365 2293 893 --12331 2983 499
NM_014335chr151996 1238 --11387
NM_014342chr1131379 508 38 1311 --11393
NM_014388chr1105843 5360 4810 4148 3926 3838 3817 3792 1164 163 32132 1109 993 --1648
NM_014423chr584781 4685 4347 3870 2245 2102 1846 1652 --24771 3418 --
NM_014494chr1621664 420 --1447 21523 921
NM_014607chr26854 722 641 601 595 116 ------
NM_014613chr562754 2223 1932 753 703 491 --21081 320 --
NM_014615chr1673338 3246 2878 2769 2332 557 439 --12893 12458
NM_014634chr22113534 3260 3250 3113 2874 2789 2750 2678 2288 1324 45 23601 3310 22428 1389 1525
NM_014636chr944199 3111 2733 722 ----12694
NM_014646chr1872553 2122 1992 1093 708 600 128 --1365 12718
NM_014647chr1621444 670 --31849 724 476 1304
NM_014730chr12125203 4323 3835 3738 3706 1835 1747 1318 625 591 340 186 --15231 --
NM_014730chr12125203 4323 3835 3738 3706 1835 1747 1318 625 591 340 186 --15231 --
NM_014746chr244357 3148 1536 1529 11087 13674 --
NM_014747chr1155257 5139 5003 4707 3781 3700 2102 1463 1457 1022 802 752 264 103 61 --21414 471 --
NM_014752chr1141900 1852 1477 124 --11270 --
NM_014766chr773809 3515 3508 2589 2332 899 522 --42326 1292 777 150 --
NM_014767chr10143581 3530 3264 2409 2376 2331 2324 1216 1189 946 667 531 404 245 --23041 803 --
NM_014776chr1252987 2967 2914 2114 416 --32525 2160 2001 --
NM_014797chr632917 2444 1059 12847 22527 252 --
NM_014819chr531943 944 355 11870 --11799
NM_014850chr3114829 4761 4605 4521 4499 4434 4426 4086 1664 1601 672 --11275 --
NM_014864chr163559 2933 1203 1038 1012 799 --23099 461 1780
NM_014877chr1787660 6951 6380 5419 5176 2953 1747 1320 26965 6850 17715 15839
NM_014906chr1763639 3093 1463 1147 450 232 ------
NM_014932chr311972 ----11878
NM_014934chr1323840 3081 ----23189 1234
NM_014982chr1454073 3720 2125 447 183 --11242 --
NM_014991chr443211 3001 798 274 --22523 61 1920
NM_015008chr363218 2552 2468 2386 651 24 13265 12994 11080
NM_015020chr1662795 2746 2603 1382 584 192 --1218 --
NM_015026chr1253836 3754 3351 3289 1422 13020 --14786
NM_015033chr993253 3235 2888 2820 2096 1052 817 797 60 11173 22586 476 --
NM_015035chr2076363 6187 5225 4466 1295 1249 550 25545 1889 --21808 1782
NM_015039chr1104132 3328 3256 3134 3120 1630 1585 1575 1531 1219 --24071 3521 --
NM_015044chr16122988 2827 2810 2631 2420 2202 655 598 525 382 324 104 ----13056
NM_015059chr15113871 3622 3544 3078 2659 1429 965 958 889 657 64 --43372 244 199 153 --
NM_015064chr1261366 1266 1211 1048 907 712 --22983 2941 1322
NM_015071chr576363 4785 1897 1841 1077 993 899 14036 24534 4216 --
NM_015076chr644287 4172 3180 2983 --1227 1529
NM_015090chr1175797 5708 5692 5393 5161 4844 4708 4674 2435 2415 2408 2131 1785 1451 1356 403 292 --24879 4820 --
NM_015147chr232062 1288 1068 ----12179
NM_015156chr1473863 1564 1382 1112 1054 374 244 ------
NM_015176chr161656 1640 1467 375 91 23 --1652 --
NM_015185chrX72562 1095 1086 956 638 588 309 12709 ----
NM_015208chr1853968 3282 2833 2784 1546 --1629 131
NM_015225chr922983 294 1417 11246 12366
NM_015271chr421290 856 ----23815 3198
NM_015285chr1852546 2363 1606 88 68 12252 ----
NM_015288chr5113798 2666 2642 2522 2399 1172 1082 1074 587 567 240 --33419 95 21 --
NM_015299chr1453678 752 678 537 368 ----12620
NM_015308chr111660 ----1682
NM_015310chr8118267 7957 7834 7247 7035 6618 6255 2958 1605 1029 961 15783 21317 1188 --
NM_015313chr1124415 935 1142 159 11742
NM_015315chr563264 2617 1316 1180 558 75 --22912 466 --
NM_015329chr1982740 2595 2499 2363 2186 1878 232 105 1331 --12299
NM_015345chr662759 852 727 558 338 157 --22606 2207 --
NM_015347chr121189 ----1147
NM_015349chr642893 2693 2023 108 ----12279
NM_015353chr1772763 1917 1098 1049 1005 601 383 --22224 942 --
NM_015365chrX73930 3405 3314 3145 2985 2615 317 --1293 --
NM_015453chr331377 804 285 ----1454
NM_015455chr5--12937 1928 12565
NM_015550chr773168 2826 2543 2290 2253 842 640 23194 2757 1881 --
NM_015557chr193498 3286 3127 2351 1075 740 517 429 412 --11063 --
NM_015568chr20124272 3582 3575 3304 2950 2787 2743 1684 1642 1460 479 178 --1171 --
NM_015569chr133107 1441 1345 --21825 1385 --
NM_015576chr351958 1821 1144 764 24 12519 11938 --
NM_015609chr152441 1837 751 448 425 ----1231
NM_015833chr2191952 1932 1855 1675 927 687 667 584 145 ----11484
NM_015879chr1866647 5943 2021 1929 1922 901 36377 5536 1716 --48599 5196 2622 2613
NM_015886chr845703 1659 683 304 12137 25532 4692 --
NM_015975chrX21650 1474 1239 --21840 1467
NM_015995chr15105182 4422 4270 3880 3805 3507 3472 1283 1203 605 12207 25496 823 --
NM_016076chr142847 1148 1074 33 ----12128
NM_016083chr673181 2908 2657 1108 961 439 75 1248 13021 --
NM_016173chr363748 2839 1432 1103 1091 759 1948 33002 2791 974 --
NM_016206chr388556 7178 6294 3273 3172 2862 2078 173 25465 2904 12646 28145 2769
NM_016255chr643162 2906 2485 493 --11295 13358
NM_016260chr226784 5180 ----16497
NM_016272chr2231812 1784 849 --22778 692 12125
NM_016297chr2--41287 1001 351 34 12391 12687
NM_016352chr751376 1215 306 173 162 21134 435 --11067
NM_016376chr1794383 3276 2961 2949 1541 1108 1048 1042 704 --43027 2779 2750 219 --
NM_016559chr32600 324 ----1514
NM_016577chr343987 3355 2807 2768 ----24540 4184
NM_016598chr341394 1035 307 59 ----1127
NM_016621chr11124466 4261 4101 4040 3626 3034 3024 1582 1478 1162 764 121 --13442 --
NM_016834chr17113999 3313 3242 2868 2568 1632 1625 1420 1363 1121 690 23646 1109 13846 11225
NM_016835chr17113999 3313 3242 2868 2568 1632 1625 1420 1363 1121 690 23646 1109 13846 11225
NM_016841chr17113999 3313 3242 2868 2568 1632 1625 1420 1363 1121 690 23646 1109 13846 11225
NM_017413chrX52185 2041 1832 1637 49 --1319 12363
NM_017420chr1423013 1293 1532 13704 1547
NM_017563chr376153 5804 5506 1633 913 666 101 15972 32281 1804 1056 --
NM_017580chr1042067 1523 468 402 ----12199
NM_017596chr1174650 4545 4508 4385 4313 4116 3508 3346 3044 1421 867 838 741 507 168 137 23 --14097 13180
NM_017612chr12294 42 ----1132
NM_017633chr633719 2860 423 ----11118
NM_017644chr314005 --14814 24426 1007
NM_017660chr1992657 2347 2234 2149 1352 1328 1286 1236 1103 33370 2582 1380 12445 --
NM_017737chr1------22107 332
NM_017787chr1062844 2511 1996 1046 1039 868 ----12371
NM_017848chrX43344 3010 337 236 1243 33732 1111 128 --
NM_017902chr10165493 5406 5192 5109 4546 4488 4015 3987 3846 2225 2088 1541 1116 374 367 272 1661 24757 4441 --
NM_017919chr984918 4805 4790 4121 1931 1566 1463 739 --1978 --
NM_018048chr1262043 1794 1690 762 423 304 1557 11563 --
NM_018078chr4179 129 --1820
NM_018085chr1118149 7904 7279 2802 2300 2072 1978 1703 1491 639 273 12430 26829 935 11875
NM_018121chr1053173 2235 1239 1141 430 11968 ----
NM_018155chr342403 2125 721 269 --11120 --
NM_018200chr1551931 1025 801 777 211 --22619 30 --
NM_018201chr992491 2442 2309 1672 856 651 633 251 25 --1468 --
NM_018227chr433154 2351 593 --1550 22527 816
NM_018243chr493631 3609 3544 3532 2735 1578 861 608 24 11162 --1478
NM_018362chr1173779 3495 2705 2450 1464 473 165 --1227 --
NM_018374chr744279 2077 2066 870 --34665 4158 2086 11862
NM_018416chr1282599 2135 1923 988 573 554 443 283 --11974 --
NM_018429chr531125 522 324 1971 12044 --
NM_018440chr8107656 7396 6998 6683 6248 5961 5552 3343 669 290 26304 3205 28159 7643 --
NM_018557chr211352 ----165
NM_018566chr164028 3784 3252 3192 685 502 ------
NM_018590chr1031646 1512 313 ----1246
NM_018638chr1235246 3871 568 ----1370
NM_018697chr772084 1908 1706 939 889 795 251 ------
NM_018837chr201723 --1766 1823
NM_018841chr163475 3369 2633 1587 544 161 --23828 985 --
NM_018958chr1553973 3766 2880 855 198 1879 23912 1166 --
NM_018976chr122938 782 ----12519
NM_018979chr121770 1751 --11760
NM_018999chr1084549 4253 4178 3862 1619 1119 1065 822 --24171 327 --
NM_019008chr2283766 3721 3486 3108 1196 645 420 359 12436 ----
NM_019009chr1162524 1828 1650 780 248 231 ----177
NM_019041chr652492 2050 1929 1813 512 --1737 --
NM_019094chr1243437 2826 2607 39 33710 3276 1451 11013 --
NM_019102chr72399 89 ----1407
NM_019102chr72399 89 ----1407
NM_019106chr2283336 3206 2680 2459 2171 799 722 284 --22780 94 1301
NM_019600chr151324 ----1190
NM_019859chr1081472 1350 1099 1032 646 329 266 99 ------
NM_019860chr1071520 1398 1147 1080 377 314 147 ------
NM_020122chr295511 5111 4428 2306 1375 1369 673 628 28 --14619 13772
NM_020123chr10----1436 1341
NM_020127chr151871 1260 420 227 101 --1137 11694
NM_020130chr811045 1988 --11144
NM_020132chr2194796 3292 1573 1078 592 456 431 410 202 --34833 4179 647 14577
NM_020148chr1842399 2340 673 302 1977 42502 1177 653 145 --
NM_020177chr532444 1274 908 11225 12727 1428
NM_020182chr20103175 2976 2924 2725 2636 2601 2314 1122 943 797 ------
NM_020194chr2178 ----133
NM_020200chr10282 29 11078 --2889 218
NM_020310chr17112573 2517 2224 2044 1738 1120 910 841 778 565 52 ------
NM_020337chr453057 2836 2436 732 372 ------
NM_020452chr171914 1603 472 395 163 137 127 --11772 --
NM_020455chr611060 --21781 880 11136
NM_020456chr1331657 932 423 11847 --11524
NM_020465chr1641665 743 655 68 --21246 467 1694
NM_020673chr2077240 6694 5122 5065 2148 1956 1444 ------
NM_020699chr174961 4905 3422 3337 1221 525 379 --11050 11029
NM_020717chrX85034 4845 3286 1780 1542 1028 695 131 1161 21661 110 24961 682
NM_020718chr1696634 5486 5381 5360 4983 1895 1016 766 424 --11235 --
NM_020739chr1533984 1062 708 --1402 11168
NM_020752chr1042537 2505 999 906 --1539 1924
NM_020766chrX43521 3404 2929 2898 --14327 13728
NM_020772chr17108360 8275 7241 6789 6684 3435 2604 2349 1967 1862 --15867 16980
NM_020774chr1844162 2331 1313 487 11620 12178 --
NM_020776chr1852876 2667 1991 567 91 12485 21047 114 --
NM_020804chr6132581 2448 2124 1995 1877 1070 1005 947 842 346 310 273 90 ------
NM_020830chr232657 2230 84 --32647 2420 2042 1908
NM_020935chr2124582 4316 4198 4025 3985 3826 3477 1749 985 732 479 191 1692 12992 13686
NM_020977chr442126 1496 803 738 ----11458
NM_021007chr231656 916 882 --2720 685 --
NM_021035chr2031285 1241 1136 ----1383
NM_021079chr1743011 2072 992 203 --22335 2044 22453 373
NM_021083chrX43626 627 589 421 --12672 12300
NM_021090chr22104215 4185 4031 3904 3159 1053 952 701 174 41 --11539 --
NM_021096chr22153079 2558 2510 2302 1250 1074 1056 836 696 627 610 450 430 416 43 ------
NM_021116chr7168721 8577 8136 7174 6989 6406 5958 3378 2562 2399 2357 2158 2104 1851 1593 1068 17011 28978 5560 --
NM_021202chr2062887 2553 2404 1224 441 286 --1403 11209
NM_021643chr271875 1625 1442 1316 665 559 32 ----21902 307
NM_021813chr695605 4575 4197 2203 1855 1653 1291 573 144 25096 553 25299 4011 187
NM_021911chr5115294 5273 5106 5076 5009 4639 4623 4328 1088 1073 407 ------
NM_021961chr1165871 4645 2685 2620 2034 1913 --36274 5638 2200 21760 641
NM_021977chr673501 2842 2496 2360 1561 633 277 --1656 --
NM_022048chr15106399 5461 5169 5081 4255 2247 1027 648 231 218 --45517 5293 4186 2074 --
NM_022114chr1104345 4128 3808 1906 1626 1093 985 666 194 88 11752 33665 3611 3421 --
NM_022166chr1676102 5043 4574 1721 1541 1388 259 26062 4305 34518 4090 232 11490
NM_022459chr1376315 5899 5712 3859 1466 854 732 25570 4976 25863 80 --
NM_022474chr1452401 1890 1764 1101 271 1757 1356 12245
NM_022491chr1242630 1324 804 499 11302 --12592
NM_022497chr362959 2554 1125 1073 255 96 23538 1442 12864 11239
NM_022648chr2124145 4127 4060 3807 3656 3637 3101 3039 878 659 388 322 --1666 14233
NM_022716chr182996 2940 1240 1183 549 448 410 193 --12337 12670
NM_022719chr22113313 3290 3090 2945 2865 2394 1462 1407 1356 1088 332 12561 13228 --
NM_022781chr973026 2832 2331 1311 1075 1065 36 1756 ----
NM_022802chr1021604 1299 ----11057
NM_022842chr353159 986 751 584 67 32945 2125 360 1743 --
NM_022893chr273178 2647 2571 2028 617 400 109 --1889 --
NM_022898chr1494705 4460 4104 3996 3616 1260 542 161 109 24372 707 ----
NM_022910chr1641665 743 655 68 --21246 467 1694
NM_022970chr1041312 1163 91 21 ----1475
NM_023010chrX3807 730 26 ----1570
NM_023923chr173624 3531 2962 2352 1332 1277 289 22807 1448 ----
NM_023929chr852803 2725 1048 916 292 ------
NM_024511chr463404 2995 783 352 343 35 1533 ----
NM_024524chr352709 2464 985 211 107 1178 ----
NM_024558chr141901 --1786 1973
NM_024665chr364606 4587 4548 3015 86 61 --13052 --
NM_024674chr162593 2116 2047 1984 952 642 ----22708 504
NM_024742chr1671500 1291 523 483 477 391 202 1508 2592 466 --
NM_024761chr9135230 4748 3910 3292 3232 1970 1826 1703 1620 1558 928 789 665 1843 14153 --
NM_024770chr2116630 5111 4580 2294 2022 1207 1196 920 806 754 255 22583 1641 16307 --
NM_024947chr358079 7835 3544 2911 2479 18741 32862 1926 1057 13059
NM_024948chr10------2685 167
NM_024949chr4124729 4500 4347 3819 3651 3310 3084 1897 1465 1212 584 384 1499 1785 11618
NM_024963chr7165856 5832 5825 5411 5177 4755 4543 4092 2386 2189 1454 592 489 442 377 28 14871 25292 1607 --
NM_024989chr267856 2205 2011 1980 1417 350 22558 2394 25872 1839 --
NM_025054chr811286 ----13767
NM_025073chr164666 1728 1709 1126 693 590 --14188 23384 1366
NM_025146chr331984 885 314 1277 22300 2180 --
NM_025160chr124021 3578 --13508 11006
NM_025179chr183741 1440 1065 558 454 182 109 62 11904 24153 3255 14849
NM_025230chr1441787 736 425 284 ----21903 1744
NM_030579chr1643674 2300 1465 210 13421 --13278
NM_030625chr1031618 798 736 ----21066 467
NM_030647chr765938 5024 2281 1742 1493 76 1905 14245 --
NM_030648chr421365 209 12190 14720 1685
NM_030650chr263933 3913 3210 3049 2971 2881 --11196 --
NM_030755chr1411047 12259 --22358 446
NM_030799chr521404 558 ----22232 676
NM_030806chr1109093 7162 7155 7033 6398 5789 3392 2855 1457 122 28990 7483 22077 1430 --
NM_030884chr3112050 2013 1749 1684 773 722 634 164 61 52 41 --12334 --
NM_030918chr1125014 4359 4192 4143 3803 2120 2021 1092 984 716 223 200 12045 33912 2076 875 --
NM_031216chr1821592 278 ----1883
NM_031372chr451658 648 642 541 183 ------
NM_031426chr9112698 2526 2455 2332 2282 2276 2184 1124 1034 701 309 12516 1780 --
NM_031427chr1474708 3851 1996 1082 522 417 250 34412 3746 1687 ----
NM_031468chr7137794 7414 6237 5891 5563 5204 3027 2888 1993 1592 1553 880 685 26717 449 12757 --
NM_031483chr2053022 967 947 308 54 ------
NM_031890chr2292934 2753 2246 2238 1179 1111 953 477 437 12451 22920 393 --
NM_031904chr1162080 1604 1496 338 89 56 ----11729
NM_032012chr923684 1211 14125 24108 1291 11708
NM_032017chr182021 1762 1286 831 789 713 288 271 --11626 --
NM_032041chr852291 2171 2059 284 42 --12638 12515
NM_032182chr10--11332 11505 1226
NM_032199chr1073510 3331 3267 2371 896 598 123 --21023 720 13393
NM_032208chr222717 252 --1296 11413
NM_032287chr22124179 3598 3383 3377 3016 2881 1379 1286 1251 988 626 132 ----12832
NM_032329chr2104319 4172 3920 3757 3652 1536 1188 821 681 44 --24016 1392 --
NM_032373chr1055353 4292 1875 1644 1204 22312 1003 --31698 311 232
NM_032458chrX63356 2963 2555 1204 1141 286 ------
NM_032486chr1682566 2192 2032 1944 1733 1727 1073 282 --1603 --
NM_032595chr1781538 1331 1291 566 559 344 65 50 --11386 --
NM_032646chr1781318 1265 1168 1154 696 451 438 380 --21562 1279 --
NM_032711chr17163735 3710 3659 3627 3609 3310 3301 2887 2785 2779 1633 674 382 375 357 70 --13809 --
NM_032900chr1063256 3243 2930 2392 1194 216 --33779 999 381 --
NM_032932chr17125863 5476 5401 5313 5287 4425 4217 4098 2391 1047 474 107 14350 12344 --
NM_032971chrY1766 --2954 170 1882
NM_032972chrY1766 --2954 170 1882
NM_033055chr11309 ----1892
NM_033143chr454510 4386 4117 1432 225 24622 2873 ----
NM_033181chr673181 2908 2657 1108 961 439 75 1248 13021 --
NM_033221chr962917 2431 1981 1018 579 239 --2763 637 12590
NM_033224chr777942 7284 6213 5834 5237 2169 909 36443 5353 200 26546 262 --
NM_033225chr852866 2291 988 536 371 13072 12420 --
NM_033360chr1233611 1179 670 --1615 13721
NM_033389chr1774742 4366 3816 3730 1016 836 406 --24780 571 --
NM_033505chr264488 1990 926 796 790 249 ------
NM_033512chr852902 2661 2126 2034 672 12708 ----
NM_033551chr563264 2617 1316 1180 558 75 --22912 466 --
NM_033637chr1093681 2946 2921 2656 2614 733 648 477 323 ------
NM_033642chrX11188 ----11152
NM_033656chr2145336 3857 1821 1598 ----14912
NM_052834chr1852546 2363 1606 88 68 12252 ----
NM_052845chr1272858 2447 2324 2084 2014 938 195 --43218 3012 2788 127 --
NM_052847chr1953611 2481 2363 64 58 --41333 1284 1176 71 --
NM_052851chr1322028 503 ----1921
NM_052869chr1781318 1265 1168 1154 696 451 438 380 --21562 1279 --
NM_052885chr1284519 4081 3455 3096 1684 1504 1251 921 1796 ----
NM_052901chr93205 173 100 ----11106
NM_052907chr1223695 503 13787 13517 13374
NM_053016chr998005 7788 7696 6753 6170 5529 688 398 369 --37122 2661 1529 16869
NM_057169chr1252987 2967 2914 2114 416 --32525 2160 2001 --
NM_057170chr1252987 2967 2914 2114 416 --32525 2160 2001 --
NM_080632chrX3807 730 26 ----1570
NM_080669chr1784370 3663 3610 3429 3310 3081 1531 1000 --43279 1287 1217 1164 --
NM_080676chr2042036 970 153 102 11273 --1579
NM_080717chr1251505 1489 631 387 249 ----1214
NM_080743chr632346 1040 434 ----1509
NM_080867chr1453658 3491 1840 790 391 24401 1707 13329 --
NM_080872chr853207 2788 1392 1161 570 --23724 2880 --
NM_080927chr361203 1014 770 746 646 218 11062 1661 --
NM_133170chr2088046 6979 6656 5467 1735 1698 1023 539 11475 32253 1981 143 --
NM_133264chr1783943 2966 2950 2926 2711 1141 990 140 11346 ----
NM_133265chrX--23616 948 12814 12613
NM_133334chr496409 6238 4707 4426 3967 3894 2082 1773 750 --11793 --
NM_133372chr532343 2253 2159 --1354 12748
NM_133443chr1641956 1646 1500 32 11760 1804 11382
NM_133646chr235391 4108 557 25159 3418 13547 1677
NM_138270chrX1535 23381 3286 33138 2721 2333 --
NM_138381chr341985 1828 1763 60 --32353 729 251 --
NM_138444chr1354058 1756 695 470 87 11216 177 --
NM_138468chr275610 4999 4533 4291 2296 1520 1250 33997 2082 1636 35662 1804 1062 --
NM_138473chr12105094 5029 4384 4332 1970 1627 1599 815 728 162 --14287 --
NM_138576chr1494705 4460 4104 3996 3616 1260 542 161 109 24372 707 ----
NM_138621chr253714 2941 2922 1051 653 --12827 13176
NM_138713chr1668062 5904 5107 3151 62 45 --11428 --
NM_138714chr1668062 5904 5107 3151 62 45 --11428 --
NM_138970chr1452004 1813 933 742 218 --1383 --
NM_138971chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_138971chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_138972chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_138972chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_138973chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_138973chr11103386 3077 3034 2816 1388 879 839 670 393 173 ------
NM_139057chr1542746 2636 2575 1787 --12522 1691
NM_139135chr12211 204 --21313 1055 --
NM_139156chr18755 625 252 140 122 107 91 54 --1279 --
NM_139276chr1742273 752 308 113 ----1875
NM_139279chr262192 942 914 718 626 325 --12390 1830
NM_139312chr1021249 599 --1389 11093
NM_139321chr2032877 1189 723 --1183 1340
NM_144571chr485932 5620 4837 4818 2684 1604 728 685 11457 11538 --
NM_144583chr211310 11692 126 1194
NM_144590chr1052862 2392 2009 1972 536 --11066 42419 2093 411 376
NM_145112chr1471225 1084 1072 325 233 49 39 ------
NM_145113chr1471497 1356 1344 597 505 321 311 ------
NM_145117chr1162502 2040 1095 1052 778 475 ----1664
NM_145166chr3112720 2626 2443 2344 2170 1903 1859 1066 854 763 442 ------
NM_145176chr612726 1204 1312 11375
NM_145206chr1033209 980 481 ----22931 1063
NM_145259chr244401 2796 691 640 --25284 558 26351 5532
NM_145284chrX41842 1726 909 415 ----12130
NM_145320chr773168 2826 2543 2290 2253 842 640 23194 2757 1881 --
NM_145321chr773168 2826 2543 2290 2253 842 640 23194 2757 1881 --
NM_145322chr773168 2826 2543 2290 2253 842 640 23194 2757 1881 --
NM_145698chr1032100 1777 613 ----12016
NM_145735chr1352537 605 119 82 75 1508 ----
NM_145800chrX3854 214 118 ----2280 129
NM_145802chrX3803 163 67 ----2229 78
NM_148955chr15125857 4554 2521 2389 2265 2180 2123 919 731 141 125 56 1588 12564 14711
NM_152375chr142553 2222 2194 743 --22278 2081 1236
NM_152388chr243063 1461 1261 785 --144 11482
NM_152409chr512936 11175 32652 1278 270 --
NM_152437chr1252316 696 654 531 227 --1169 --
NM_152455chr1562861 2788 1747 743 267 137 1641 ----
NM_152470chr18103488 3294 2648 2595 1328 1230 993 942 343 207 --24097 2588 --
NM_152475chr1982452 2410 2188 1803 919 364 160 44 21993 1679 1938 1475
NM_152529chr253220 1378 1015 284 116 --12961 11494
NM_152558chr793901 3418 3307 3294 3147 1578 1483 765 134 1852 11230 21794 526
NM_152622chr523502 313 --13324 11223
NM_152624chr565971 4628 1746 1408 776 63 35464 2560 929 25065 28 12575
NM_152629chr974058 2692 2591 1606 1358 1249 1086 21390 496 ----
NM_152636chr1152716 2288 2154 921 541 ----22570 839
NM_152641chr1232891 2418 1970 --1685 11982
NM_152678chr31202 11708 2479 434 11054
NM_152756chr564233 3652 3483 1561 446 123 13646 13352 --
NM_152758chr842321 978 946 228 ----12300
NM_152787chrX33831 3333 3291 13101 12502 --
NM_152826chr15125857 4554 2521 2389 2265 2180 2123 919 731 141 125 56 1588 12564 14711
NM_152902chr131819 691 490 --1284 12020
NM_152924chr1596792 5972 2666 2557 1161 820 563 406 145 11834 22401 894 --
NM_153029chr16153998 3809 3396 3108 2783 2736 2714 1472 1306 1286 1084 1075 923 665 620 --1438 --
NM_153050chr22104215 4185 4031 3904 3159 1053 952 701 174 41 --11539 --
NM_153051chr22104215 4185 4031 3904 3159 1053 952 701 174 41 --11539 --
NM_153207chr1233021 2924 1608 22989 1592 ----
NM_153234chr542759 2543 2443 220 --1509 --
NM_153331chr32622 177 ----1475
NM_153343chr431873 1569 462 --2363 21 12126
NM_153367chr1073161 1416 1383 1040 541 302 249 --23688 836 1511
NM_153607chr511126 ----23175 718
NM_153687chr1221608 330 --1401 11109
NM_170665chr1273721 3523 3511 3052 1821 1246 713 11277 1687 --
NM_170679chr541325 1001 897 137 --11337 21300 42
NM_170706chr1104132 3328 3256 3134 3120 1630 1585 1575 1531 1219 --24071 3521 --
NM_170750chrX2290 190 --1200 147
NM_172071chr157201 6211 4587 4529 2817 12125 12872 --
NM_172127chr42797 161 --31410 830 243 --
NM_172128chr42753 117 --31366 786 199 --
NM_172375chr14------2890 354
NM_173214chr1668062 5904 5107 3151 62 45 --11428 --
NM_173511chr253797 2526 1487 508 239 ----13625
NM_173536chr444784 4613 1640 1279 --13452 15133
NM_173562chr653247 2416 2159 538 145 --3999 592 81 --
NM_173582chr1185709 4502 2058 1949 1398 1346 744 266 15537 11803 --
NM_173595chr1294862 4363 2017 1852 1737 1560 1443 499 357 --14856 1249
NM_173602chr1243210 2601 2553 1075 13615 12920 --
NM_173808chr153037 2724 1030 644 213 11777 ----
NM_173825chr3113012 3004 2874 2676 934 857 556 509 212 197 182 ------
NM_173827chr463288 2582 2494 2060 702 539 --12236 --
NM_173832chr8133643 3585 3383 3176 2962 2800 2549 2490 1463 938 784 561 115 --23544 77 --
NM_173854chr172115 2043 848 821 798 71 63 --1955 --
NM_175624chr1286500 6243 5781 5341 5081 4976 2983 2427 ------
NM_175625chr1286500 6243 5781 5341 5081 4976 2983 2427 ------
NM_175736chr12147748 7125 6765 6342 5432 5330 5202 2780 1884 1878 898 580 442 42 12156 36298 1940 1709 16268
NM_175884chr72927 156 --1163 11287
NM_175907chr1832742 2119 265 12535 41111 912 280 55 --
NM_177402chr15930 658 240 229 122 1877 ----
NM_178006chr1322028 503 ----1921
NM_178007chr1322028 503 ----1921
NM_178037chr1261366 1266 1211 1048 907 712 --22983 2941 1322
NM_178038chr1261366 1266 1211 1048 907 712 --22983 2941 1322
NM_178151chrX117289 6572 5757 5623 4766 2943 2756 2629 2188 2176 1616 --17484 --
NM_178152chrX117289 6572 5757 5623 4766 2943 2756 2629 2188 2176 1616 --17484 --
NM_178153chrX117289 6572 5757 5623 4766 2943 2756 2629 2188 2176 1616 --17484 --
NM_178426chr172379 2221 1633 724 509 366 246 1768 ----
NM_178427chr172279 2121 1533 624 409 266 146 1668 ----
NM_178498chr1163894 3816 2652 2561 600 172 13386 1816 12768
NM_178539chr1251432 413 404 393 385 --21918 1707 --
NM_178585chr443211 3001 798 274 --22523 61 1920
NM_181077chr152931 698 ----11670
NM_181357chr1441787 736 425 284 ----21903 1744
NM_181358chr173555 3201 2882 2809 1591 1412 334 --1169 --
NM_181481chr1865131 4718 4544 2343 1941 862 --25827 2179 11909
NM_181482chr1865131 4718 4544 2343 1941 862 --25827 2179 11909
NM_181483chr1865131 4718 4544 2343 1941 862 --25827 2179 11909
NM_181486chr1251505 1489 631 387 249 ----1214
NM_181521chr16157099 6742 6228 6087 5938 5542 5403 4611 2783 2231 1523 541 107 71 44 16661 11653 --
NM_181712chr111773 --1435 11665
NM_182314chrX31545 1425 1202 11283 --1604
NM_182503chr664152 1883 1500 1203 1082 126 --23514 2251 12015
NM_182515chr1926566 5063 25246 1931 12360 24821 121
NM_182522chr341205 1027 408 383 ----1364
NM_182526chr14103103 3085 3019 2777 2693 2581 2241 848 418 324 --23151 2329 --
NM_182580chr172544 2443 2421 1722 1710 1704 1610 --1553 --
NM_182685chr11721 ----1766
NM_182765chr1012239 ----186
NM_182898chr755067 4739 4509 2464 1358 36258 5190 1557 25126 4882 --
NM_182899chr755067 4739 4509 2464 1358 36258 5190 1557 25126 4882 --
NM_182948chr11840 12698 22884 728 12791
NM_182964chr1162502 2040 1095 1052 778 475 ----1664
NM_182970chr20113907 3894 3789 3613 1725 1717 1708 1533 1450 1399 771 ------
NM_183004chr1433119 3049 2901 12500 33465 2591 620 --
NM_183078chr643315 2985 2896 443 23277 1021 23168 2802 --
NM_183393chr32279 54 1748 1867 11053
NM_183394chr32279 54 1748 1867 11053
NM_194247chr274247 4199 3958 3771 3297 2825 811 190 12885 14128
NM_194282chr422722 697 ----12876
NM_194283chr573163 2966 1698 1224 698 576 32 24037 1340 --13509
NM_194285chr1152512 1297 1100 353 319 21247 1204 --1480
NM_194286chr12136217 6112 6089 5468 5361 4408 4217 4211 2445 2121 1503 565 113 12386 25283 4463 --
NM_194314chr154248 4183 3873 339 148 25417 2172 15334 --
NM_194328chr973026 2832 2331 1311 1075 1065 36 1756 ----
NM_194329chr973026 2832 2331 1311 1075 1065 36 1756 ----
NM_194330chr973026 2832 2331 1311 1075 1065 36 1756 ----
NM_194332chr973026 2832 2331 1311 1075 1065 36 1756 ----
NM_194434chr1824992 3491 1744 31987 1232 564 15512
NM_197941chr542699 1078 1070 91 --12966 --
NM_198081chr652498 2358 566 367 279 11890 12305 1987
NM_198212chr7----1945 11514
NM_198268chr173555 3201 2882 2809 1591 1412 334 --1169 --
NM_198269chr173555 3201 2882 2809 1591 1412 334 --1169 --
NM_198391chr2011509 11501 --1506
NM_198400chr1532276 1982 319 ----12581
NM_198468chr644155 1668 999 949 21025 650 21276 58 13091
NM_198485chr351938 1694 578 406 399 --1526 --
NM_198560chr3103729 3533 2463 2447 2419 1086 1024 496 336 47 13109 21114 840 --
NM_198569chr61927 --21648 747 11003
NM_198581chr257055 5165 4617 2860 1069 25795 5683 12633 --
NM_198715chr176200 6118 6021 5970 5735 1131 841 ------
NM_198900chr12147748 7125 6765 6342 5432 5330 5202 2780 1884 1878 898 580 442 42 12156 36298 1940 1709 16268
NM_198968chr1323840 3081 ----23189 1234
NM_198990chr722318 1256 22141 1156 --1776
NM_199040chr1243437 2826 2607 39 33710 3276 1451 11013 --
NM_199169chr20103175 2976 2924 2725 2636 2601 2314 1122 943 797 ------
NM_199170chr20103175 2976 2924 2725 2636 2601 2314 1122 943 797 ------
NM_199171chr20103175 2976 2924 2725 2636 2601 2314 1122 943 797 ------
NM_199245chr1262343 2247 2165 570 456 348 ----12178
NM_199324chr463776 2808 2705 2665 2426 238 --13218 --
NM_199413chr1551028 835 677 189 117 ----1769
NM_199421chr1453658 3491 1840 790 391 24401 1707 13329 --
NM_199454chr1104345 4128 3808 1906 1626 1093 985 666 194 88 11752 33665 3611 3421 --
NM_199461chr1053320 3238 2513 1180 1090 --1636 1348
NM_199464chr13140 ----1540
NM_201263chr112029 11515 --1625
NM_201432chr17146590 6322 6069 5791 5727 5563 4342 1085 1000 884 794 413 374 216 15400 45951 4870 1177 682 --
NM_201433chr17146590 6322 6069 5791 5727 5563 4342 1085 1000 884 794 413 374 216 15400 45951 4870 1177 682 --
NM_201599chrX71255 1189 1040 892 380 58 45 ------
NM_203305chr9112505 2121 2106 2087 1814 712 659 564 551 467 404 --12514 --
NM_203327chr20114587 4147 3913 3580 2845 1683 1627 1620 988 260 177 --11293 --
NM_203351chr17101948 1900 1696 878 715 619 557 533 307 231 --1968 --
NM_203404chr18755 625 252 140 122 107 91 54 --1279 --
NM_203458chr153692 3661 3087 3059 2721 --33376 2349 440 --
NM_203463chr284532 3530 3489 3029 1647 844 153 44 123 ----
NM_203464chr12824 220 --1443 21226 234
NM_203506chr1792025 1713 1600 1453 1388 790 596 427 325 21920 905 ----
NM_206832chr172322 68 ----1258
NM_206853chr653699 2963 1628 1514 63 ------
NM_206854chr674960 4224 3409 1324 601 548 539 --1664 --
NM_206855chr6105925 5189 4374 3854 2289 1566 1513 1504 733 280 14051 11629 --
NM_206876chr233308 2977 1022 ----12897
NM_206909chr8118267 7957 7834 7247 7035 6618 6255 2958 1605 1029 961 15783 21317 1188 --
NM_207012chr1032900 2545 341 ----22831 435
NM_207043chr142193 2184 735 445 --11958 1323
NM_207044chr142193 2184 735 445 --11958 1323
NM_207047chr142193 2184 735 445 --11958 1323
NM_207352chr412169 1419 1224 12678
NM_207372chr1052399 2241 843 834 176 --32340 1776 959 12174
NM_207406chr496089 4109 2498 1960 1489 1445 1139 1031 61 148 36050 5648 2260 12285
NM_213606chr1052762 1934 761 373 358 --22474 352 --