TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1303
miRNA Sequence: UUUAGAGACGGGGUCUUGCUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5------11336
NM_000038chr52357 285 22024 82 ----
NM_000044chrX--1286 ----
NM_000045chr61413 187 ----
NM_000051chr11103508 2952 2609 2561 866 686 356 206 193 83 13588 22426 841 --
NM_000052chrX123414 3321 3251 3188 3130 3109 2879 2802 2637 2486 847 684 23274 178 ----
NM_000067chr81111 1493 1687 --
NM_000080chr172701 630 --1280 --
NM_000081chr141409 1362 329 36 11601 --11317
NM_000084chrX126921 6667 6275 5372 5357 4998 2728 2016 853 499 180 161 21230 637 14631 25040 1967
NM_000090chr22275 64 2715 670 ----
NM_000092chr233788 3497 2921 1510 24472 3135 21341 1188
NM_000093chr932202 1959 900 22470 851 --1388
NM_000097chr33783 768 488 ----1881
NM_000108chr7198 31187 589 518 21858 321 11611
NM_000109chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_000110chr151114 1000 932 789 451 --3469 398 356 1117
NM_000125chr663800 2720 439 400 376 125 --23733 1576 12936
NM_000129chr631183 242 66 1424 11303 --
NM_000135chr161799 ----1966
NM_000138chr1532449 2143 1996 --11892 --
NM_000139chr1172393 2369 2278 1061 241 85 25 ----22618 2197
NM_000142chr441186 1129 1114 609 ------
NM_000161chr14101831 1825 1729 1688 1473 1393 1376 713 610 146 ------
NM_000163chr542352 2227 1924 623 3829 744 126 ----
NM_000165chr631700 1086 520 ------
NM_000167chrX51778 1700 474 381 297 --11580 --
NM_000170chr94530 439 132 123 ------
NM_000173chr171411 ------
NM_000176chr541515 1446 689 383 33359 2453 647 11131 13462
NM_000192chr1221509 1227 1335 ----
NM_000208chr19104511 4370 3556 1587 1370 1363 1328 1034 830 546 ------
NM_000210chr232352 851 45 12172 1403 137
NM_000212chr1752387 1811 1764 1700 842 --11660 --
NM_000214chr2011234 ----156
NM_000216chrX103552 3310 3272 3094 2850 2586 1509 594 574 287 23641 3572 12675 --
NM_000217chr1285042 4806 4746 3609 2077 1856 1524 1412 24507 959 55230 2107 679 662 352 23536 254
NM_000220chr11------2838 38
NM_000222chr422135 1766 ----11466
NM_000227chr181347 ------
NM_000232chr471017 914 672 643 449 355 173 2945 429 12268 2297 220
NM_000237chr841868 1819 755 419 --11446 11524
NM_000242chr1052162 1948 1926 598 480 12591 32058 2013 501 --
NM_000244chr11163 ----1276
NM_000245chr742149 1967 1463 147 168 11803 --
NM_000248chr362663 1189 937 527 511 99 1660 1872 --
NM_000259chr1565216 4566 4438 1515 1156 202 46313 6159 6152 4208 11994 25769 4523
NM_000264chr962950 2388 1245 712 683 170 11034 1578 33016 2917 1268
NM_000267chr1743520 3434 2925 721 --21155 194 --
NM_000268chr2253787 3738 2457 1308 935 --22391 219 --
NM_000276chrX82005 1816 1726 1415 598 590 573 240 12030 21911 843 --
NM_000280chr111712 ------
NM_000284chrX71934 1908 1897 1501 520 407 242 ------
NM_000286chr171872 1120 --2186 142
NM_000297chr491920 1890 1826 1655 1622 1616 1301 662 140 --2721 29 1512
NM_000307chrX2329 92 ------
NM_000314chr1053093 2982 2043 591 482 22917 2813 12561 --
NM_000319chr1251104 962 907 446 251 --1204 --
NM_000321chr1331769 1217 1163 ------
NM_000325chr41561 --2505 217 --
NM_000328chrX1325 ----198
NM_000332chr6107075 6904 6372 4413 1892 1762 1663 1000 435 122 36535 2023 1193 76988 6656 6084 5473 1647 1115 292 22738 2013
NM_000337chr5126004 5971 5080 4237 4162 2343 2289 1379 1212 889 838 467 14965 34140 1153 1080 --
NM_000338chr1541140 939 852 759 --1823 --
NM_000340chr331413 277 256 1295 31454 1359 96 11500
NM_000346chr1741869 1580 433 361 --11296 --
NM_000361chr2042060 1994 851 456 11538 11933 --
NM_000362chr2233659 2385 298 13637 11282 --
NM_000368chr964274 3504 3346 1413 490 243 34826 3827 994 23400 3015 --
NM_000378chr113375 278 183 1887 ----
NM_000390chrX73278 3098 3018 2574 1355 521 416 ------
NM_000396chr12445 360 ------
NM_000399chr1021137 393 1295 --2821 737
NM_000408chr252690 2291 2097 1058 140 72529 2151 816 657 326 315 84 --12167
NM_000421chr17----1288 --
NM_000430chr1752532 2523 1349 744 50 13501 --13130
NM_000436chr521577 441 11656 21561 157 --
NM_000449chr13988 946 169 ----1437
NM_000451chrX42013 1946 589 443 ------
NM_000459chr94728 673 181 175 ------
NM_000461chr3113849 3438 3147 3103 1764 1165 1159 955 938 897 515 34649 3654 220 --43857 2812 1702 1193
NM_000476chr941382 475 302 193 21499 1104 1164 --
NM_000480chr1131182 557 155 1113 ----
NM_000484chr214831 382 218 204 124 1959 --
NM_000489chrX83340 3117 2650 2482 2106 697 537 385 21059 613 --1299
NM_000492chr711253 1319 11121 --
NM_000493chr62345 206 --4785 405 230 49 --
NM_000495chrX3714 207 196 ------
NM_000506chr11------164
NM_000508chr43945 290 88 --2900 754 2652 203
NM_000518chr11127 ------
NM_000522chr721239 191 --1162 --
NM_000530chr111072 ------
NM_000533chrX51302 1228 477 288 42 --128 --
NM_000553chr83615 249 107 ------
NM_000554chr1973317 2586 2450 1113 1090 1067 921 ----12241
NM_000555chrX156520 6180 5886 5854 5641 5529 4788 2987 2443 2358 2023 1360 1235 843 447 47507 6945 1627 787 22297 1338 16689
NM_000572chr17921 724 381 180 159 139 31 ------
NM_000575chr2--21051 124 11150 --
NM_000578chr231290 545 236 ------
NM_000590chr51132 --152 --
NM_000596chr71182 164 ----
NM_000598chr731528 1405 1079 1442 ----
NM_000599chr274364 4275 4107 3910 3698 1696 572 34337 679 227 23938 157 11323
NM_000602chr71313 --11497 21507 1457
NM_000603chr7------1338
NM_000609chr1073090 2776 2633 2071 649 456 291 23049 48 22926 321 --
NM_000610chr1162642 2572 2451 790 294 130 1500 11982 2725 162
NM_000615chr1132791 2038 567 22465 154 1137 12506
NM_000617chr1241759 902 579 52 --12309 --
NM_000618chr12146600 5156 5028 4994 4437 2516 2211 2060 1831 1690 1264 573 433 170 56499 6085 5952 5241 4090 11910 34531 2394 354
NM_000618chr12146600 5156 5028 4994 4437 2516 2211 2060 1831 1690 1264 573 433 170 56499 6085 5952 5241 4090 11910 34531 2394 354
NM_000621chr1331292 1113 970 ----2453 257
NM_000633chr1853943 3803 3680 3623 3399 21808 1391 --14366
NM_000635chr191327 11387 11217 11566
NM_000639chr11731 ------
NM_000683chr4------1513
NM_000684chr102812 304 --2533 344 --
NM_000685chr3--2868 156 --2822 148
NM_000685chr3--2868 156 --2822 148
NM_000693chr15--1258 11595 --
NM_000702chr132258 2184 2150 --11684 --
NM_000719chr1296630 6309 5467 5117 4932 4669 1802 1767 1344 35025 5014 4752 12488 15369
NM_000724chr1021972 532 --11399 --
NM_000726chr221446 1071 --11336 11116
NM_000783chr102527 397 ----2140 90
NM_000788chr44930 574 402 88 21457 1318 ----
NM_000791chr51144 22001 44 22816 108 --
NM_000793chr1494052 3776 3732 3707 3653 3278 1127 1094 658 33990 3463 1971 34096 1962 141 11146
NM_000801chr201817 1700 1746 --
NM_000806chr541986 1258 525 463 31521 696 362 ----
NM_000809chr4259288 9275 9183 9018 8148 8052 7423 7062 6969 6887 6818 6791 6784 6512 6147 6023 6009 5792 5631 3520 2580 1796 1543 857 86 22234 1521 67744 7415 3412 3335 759 634 29161 3628
NM_000810chr151158 ------
NM_000813chr595485 5053 4332 3997 3607 2042 1747 1569 1538 25287 1150 --25463 519
NM_000814chr15123989 3567 2887 2798 2762 2699 1676 1520 928 876 740 561 --11314 11476
NM_000816chr53591 117 65 1457 ----
NM_000817chr251094 1033 997 925 242 ------
NM_000818chr10----1128 2531 35
NM_000824chr42360 187 ------
NM_000826chr452489 2057 848 770 342 12031 1787 --
NM_000827chr562115 1825 1712 1040 776 591 12382 1290 --
NM_000829chr1132047 1780 1490 --1635 --
NM_000831chr1156314 6115 6073 5987 5671 5627 5595 5326 5113 4304 4156 1824 1454 774 716 11439 21719 727 1218
NM_000833chr1621559 1285 --1407 --
NM_000838chr662796 2360 1873 1736 1055 239 22557 2191 --12059
NM_000840chr72410 170 ------
NM_000849chr121246 676 --22234 2034 2991 621
NM_000857chr41183 ----1490
NM_000859chr531724 1087 488 31451 291 45 11116 --
NM_000865chr61192 ------
NM_000866chr31373 ------
NM_000868chrX11716 --164 11613
NM_000870chr571199 1148 427 327 269 249 155 --21218 279 --
NM_000872chr1041367 1261 1072 546 ------
NM_000875chr15167042 6962 6467 6420 6024 5744 4573 2801 2392 1525 1131 1110 519 342 242 153 35007 4784 2415 46622 2386 1510 1204 --
NM_000876chr61101 ------
NM_000882chr31131 1436 ----
NM_000891chr1763260 3140 3131 2950 2702 325 12735 --13699
NM_000899chr1274077 3721 2854 1571 1440 421 122 74404 4235 3694 3618 2814 877 82 44020 3282 1726 1689 --
NM_000901chr462577 2512 1003 652 540 284 12348 1793 12073
NM_000902chr322143 1200 --62514 2161 1028 676 345 67 22465 245
NM_000912chr893465 3051 2967 2838 2333 1080 1050 995 254 33500 3282 2549 43347 2759 2726 219 13439
NM_000919chr53519 209 165 ------
NM_000921chr121220 ------
NM_000922chr113983 804 779 11018 ----
NM_000926chr11159492 9449 9288 8762 3681 3096 3049 2538 2410 1537 1299 977 727 387 156 75742 3418 2630 2465 2315 1923 434 58096 6897 5732 2324 1672 39427 6152 2526
NM_000933chr202519 482 11388 21446 1197 --
NM_000935chr34454 262 245 188 --21233 1136 --
NM_000944chr432045 654 103 ------
NM_000945chr272059 1855 1402 378 355 112 84 1202 --152
NM_000949chr53954 923 878 1643 ----
NM_000950chrX43503 143 58 25 23353 2523 22240 472 1795
NM_000956chr142764 350 --1425 11026
NM_000958chr52484 269 11026 1905 1976
NM_000961chr2063871 3671 1360 1144 668 652 13191 --12585
NM_000962chr962934 2417 2220 2197 1941 137 1793 --23139 754
NM_000965chr331249 945 361 ------
NM_000966chr1221078 146 1265 1362 --
NM_000983chr171618 1574 1309 1265 653 414 81 1609 1405 --
NM_000989chr8158 ------
NM_001001132chr2141444 1082 939 578 ------
NM_001001323chr1292801 2672 2586 2574 2280 1938 1019 865 286 12378 ----
NM_001001330chr104958 830 499 61 21147 813 --1475
NM_001001344chrX32415 2191 344 11967 --12009
NM_001001389chr1162642 2572 2451 790 294 130 1500 11982 2725 162
NM_001001390chr1162642 2572 2451 790 294 130 1500 11982 2725 162
NM_001001391chr1162642 2572 2451 790 294 130 1500 11982 2725 162
NM_001001392chr1162688 2618 2497 836 340 176 1546 12028 2771 208
NM_001001395chr122784 462 3883 739 660 12406 --
NM_001001396chr193523 3220 2849 2733 1530 1051 806 259 147 33831 3651 3368 21565 298 --
NM_001001419chr585237 5231 4795 3655 1700 1408 582 118 44858 4604 3823 3576 13667 14478
NM_001001420chr585237 5231 4795 3655 1700 1408 582 118 44858 4604 3823 3576 13667 14478
NM_001001433chr2072948 2669 2189 1961 726 525 486 12741 12923 1413
NM_001001436chr162839 612 ------
NM_001001481chr873497 2547 2236 1298 1093 1067 81 23228 489 --2733 569
NM_001001483chr11------1343
NM_001001484chr1041681 1523 342 177 --32476 421 150 2964 249
NM_001001485chr31504 ----2449 187
NM_001001486chr31446 ----2391 129
NM_001001487chr31446 ----2391 129
NM_001001549chr762608 2376 2101 1953 1747 712 1832 --12397
NM_001001550chr762608 2376 2101 1953 1747 712 1832 --12397
NM_001001555chr762608 2376 2101 1953 1747 712 1832 --12397
NM_001001556chr1521076 158 ----11630
NM_001001664chr273360 2547 1327 658 545 251 65 21351 180 --1435
NM_001001665chr273387 2677 2091 1327 949 687 158 13241 31069 445 378 --
NM_001001668chr1944056 3747 3133 674 ----13249
NM_001001701chr462356 2194 2139 1902 1749 1476 ------
NM_001001715chr132595 402 ------
NM_001001787chr12438 358 199 ----
NM_001001890chr2144099 3648 3143 2699 13671 23595 635 --
NM_001001924chr852097 1771 1305 843 684 --11681 130
NM_001001925chr852097 1771 1305 843 684 --11681 130
NM_001001931chr852097 1771 1305 843 684 --11681 130
NM_001001974chr1042357 1525 783 131 ----1187
NM_001001995chrX41786 1219 182 42 --21660 149 --
NM_001002233chr842045 741 593 229 1412 1655 1632
NM_001002243chr23880 78 24 ------
NM_001002255chr62329 123 ----142
NM_001002257chr263283 3119 3033 1360 923 890 22992 54 163 23249 184
NM_001002259chr12140 ------
NM_001002275chr12458 450 ------
NM_001002295chr1021116 945 --1248 --
NM_001002814chr863651 2370 1124 741 593 229 22806 412 1655 1632
NM_001002838chrX41691 1448 615 281 21800 1683 11703 1408
NM_001002843chr151370 ------
NM_001002860chr14114648 4452 4083 3332 1835 1710 1246 1231 938 318 275 24024 788 11669 13547
NM_001002906chrY----1546 --
NM_001002909chr1711407 --42266 2136 907 238 --
NM_001002919chr2177 ------
NM_001003406chr2273197 3171 3030 1128 702 494 52 1556 ----
NM_001003407chr10154675 4213 4143 4076 3677 3625 3500 3483 2013 1796 1075 975 942 618 209 33955 1692 1263 34794 3704 1740 34439 3798 3657
NM_001003408chr10154675 4213 4143 4076 3677 3625 3500 3483 2013 1796 1075 975 942 618 209 33955 1692 1263 34794 3704 1740 34439 3798 3657
NM_001003652chr18167542 6442 6288 6134 5710 5640 5256 3165 2979 2941 2886 2613 1953 1660 1618 456 57667 6144 3256 3144 2516 58249 7309 5571 2991 2849 --
NM_001003674chr1877000 6563 5621 4523 2637 2516 2483 15309 --16246
NM_001003675chr1877000 6563 5621 4523 2637 2516 2483 15309 --16246
NM_001003679chr122071 772 2423 395 ----
NM_001003683chr22280 40 ------
NM_001003688chr431194 991 355 ------
NM_001003712chr1273481 3356 3170 2965 2793 228 79 24070 1306 34027 3973 1162 23622 3390
NM_001003760chr652790 2472 702 423 69 23120 153 --33530 3268 2744
NM_001003792chr3--1806 ----
NM_001003793chr3--1806 ----
NM_001003800chr953532 2909 1311 1047 298 ------
NM_001003940chr1573588 2852 2825 470 338 273 180 --32629 651 140 --
NM_001003942chr1573588 2852 2825 470 338 273 180 --32629 651 140 --
NM_001003943chr1573592 2856 2829 474 342 277 184 --32633 655 144 --
NM_001004065chr943796 3217 3033 339 --12512 13617
NM_001004127chr13------173
NM_001004303chr1--1678 ----
NM_001004303chr1--1678 ----
NM_001004317chr683802 3795 3356 1632 664 605 318 151 11456 34226 3893 3705 11055
NM_001004329chr1271498 1347 494 290 263 147 60 --2949 351 11130
NM_001004330chr1261265 629 586 473 239 194 11655 ----
NM_001004342chr1135801 5444 5093 4827 4684 4623 4523 4417 3815 1819 1752 1195 528 14985 25955 4749 --
NM_001004346chr421197 96 --11053 --
NM_001004354chr93995 667 47 ------
NM_001004360chr2--11569 --2696 623
NM_001004419chr12104435 4428 4255 4114 3578 3259 1408 677 522 103 --34030 1430 714 14095
NM_001004441chr54544 512 467 237 ----1429
NM_001004720chr23976 119 105 ----1303
NM_001004722chr231145 288 274 ----1472
NM_001005266chr151717 --1733 --
NM_001005267chr151717 --1733 --
NM_001005268chr151717 --1733 --
NM_001005269chr151717 --1733 --
NM_001005368chr10254 28 ------
NM_001005375chrY31690 1416 649 21810 1677 21310 227 11512
NM_001005386chr271556 496 377 328 307 254 103 ----12367
NM_001005404chr17143839 3669 3620 3362 3329 3320 1191 959 758 734 716 396 228 179 1165 22833 545 --
NM_001005463chr101446 12179 --11713
NM_001005473chr5116525 6350 5543 5418 5288 2348 1333 1281 638 318 77 65331 4824 4320 1508 1140 827 24860 2439 46173 1272 841 103
NM_001005474chr321135 108 11151 21159 370 11580
NM_001005476chr21708 --2188 37 --
NM_001005502chr12133947 3693 3481 3383 3218 1995 1616 1609 1395 1032 907 524 84 15207 35124 3227 2048 14355
NM_001005527chr32233 171 ----1982
NM_001005609chrX73660 3571 3472 2926 1040 910 70 22689 1078 ----
NM_001005732chr212641 69 ------
NM_001005733chr212598 69 ------
NM_001005739chr22604 246 ----1650
NM_001005746chr221446 1071 --11336 11116
NM_001005747chr221446 1071 --11336 11116
NM_001005781chr21164 ------
NM_001005845chr81757 11294 ----
NM_001005849chr171120 1533 1512 142
NM_001005861chr32791 186 1405 2836 701 --
NM_001006600chr532305 1814 569 12044 11981 --
NM_001006610chr161384 ------
NM_001006612chrX3403 180 87 ------
NM_001006613chrX3403 180 87 ------
NM_001006614chrX3403 180 87 ------
NM_001006623chr252106 835 753 508 364 1872 1435 1171
NM_001006641chr931781 1466 711 ------
NM_001006642chr931781 1466 711 ------
NM_001006643chr931781 1466 711 ------
NM_001006665chr1----1807 --
NM_001006684chrX--1561 ----
NM_001006935chrX3371 308 37 ------
NM_001006936chrX3371 308 37 ------
NM_001006937chrX3371 308 37 ------
NM_001006938chrX4789 591 139 50 --181 --
NM_001006946chr231376 1261 529 11541 1182 --
NM_001007023chr1494052 3776 3732 3707 3653 3278 1127 1094 658 33990 3463 1971 34096 1962 141 11146
NM_001007024chr17104140 4103 3838 3439 3092 999 883 481 368 179 --1194 22982 1560
NM_001007025chr17104140 4103 3838 3439 3092 999 883 481 368 179 --1194 22982 1560
NM_001007027chr11159 ------
NM_001007067chr841081 674 257 121 1795 1402 --
NM_001007068chr841081 674 257 121 1795 1402 --
NM_001007069chr841081 674 257 121 1795 1402 --
NM_001007070chr841081 674 257 121 1795 1402 --
NM_001007075chr411044 1379 ----
NM_001007097chr994617 3849 3841 1525 1420 1037 977 497 489 23891 984 13882 --
NM_001007098chr13853 739 199 --1715 --
NM_001007099chr1----1812 --
NM_001007100chr1----1812 --
NM_001007102chr621432 668 21227 40 11289 --
NM_001007156chr1561778 682 260 145 73 56 --11976 --
NM_001007214chr141859 1576 528 119 ------
NM_001007226chr1731428 1110 499 ------
NM_001007227chr1731428 1110 499 ------
NM_001007228chr1731428 1110 499 ------
NM_001007229chr1731428 1110 499 ------
NM_001007230chr1731428 1110 499 ------
NM_001007232chr11180 ------
NM_001007237chr172737 2476 2438 2104 920 442 58 --1940 --
NM_001007245chr73185 47 35 170 129 --
NM_001007246chr2121589 121 ----31710 406 336
NM_001007248chr194936 822 613 39 ------
NM_001007257chr121285 1023 1978 ----
NM_001007267chr23829 229 161 ----2865 327
NM_001007466chr6105131 4596 4479 3605 3503 3290 1225 1057 674 171 44042 3860 3487 1143 11329 13338
NM_001007527chr51259 ------
NM_001007538chr1331789 1670 1645 --21171 733 --
NM_001007544chr1134 --1441 1468
NM_001007559chr1842073 1539 1413 211 1218 11314 --
NM_001007565chr31269 ------
NM_001007794chr12520 127 --1768 --
NM_001008222chrX2215 124 --11341 --
NM_001008225chr71185 --2680 243 --
NM_001008226chr1521781 1402 21392 1251 1199 --
NM_001008239chr1883689 3663 3078 2755 2718 2357 930 873 11020 ----
NM_001008391chr113719 695 164 --1124 1184
NM_001008392chr3113391 3031 2821 2667 2624 2491 2325 608 516 440 291 --13167 --
NM_001008401chr1911459 --21296 1284 11096
NM_001008408chr776178 5495 5335 5259 4833 1903 369 45032 4927 1538 1211 34765 3908 2237 12082
NM_001008410chr222249 809 2832 462 1257 --
NM_001008495chr852016 727 323 211 87 1872 --12153
NM_001008539chr885066 4236 3849 3790 3654 3433 1270 1100 54447 4137 3463 3399 834 11552 23878 958
NM_001008540chr21131 ------
NM_001008541chr1032010 1698 332 11481 --1100
NM_001008541chr1032010 1698 332 11481 --1100
NM_001008564chr1332131 619 373 --31935 859 65 11750
NM_001008660chr1121529 1280 1999 11188 11108
NM_001008701chr1962888 2848 2804 2253 1950 159 ----1605
NM_001008707chr1431895 1781 297 11185 ----
NM_001008708chr21242 ------
NM_001008726chr1431601 376 187 2265 169 1572 11086
NM_001008738chr532399 2182 279 42511 2464 713 632 32842 1042 408 1906
NM_001008783chr62902 626 ------
NM_001008801chr1942141 1984 1976 1678 --11772 --
NM_001008895chr1351365 1300 547 204 86 2401 296 11288 --
NM_001008925chr483147 2421 1101 997 744 527 499 60 1667 52739 2568 2459 1214 644 --
NM_001009185chr51161 --2571 147 1529
NM_001009554chr4114755 4425 4026 3709 3651 3617 1765 1317 907 752 266 43272 3069 1396 132 44324 3223 3149 2974 13282
NM_001009554chr4114755 4425 4026 3709 3651 3617 1765 1317 907 752 266 43272 3069 1396 132 44324 3223 3149 2974 13282
NM_001009555chr451700 1480 1138 1114 589 ------
NM_001009566chr131478 579 225 ----11233
NM_001009881chr12471 186 ------
NM_001009882chr12471 186 ------
NM_001009894chr122107 35 --1191 21268 502
NM_001009899chr395840 5511 5257 5100 4786 4271 4047 1179 655 42349 1240 983 334 45830 5728 5395 2382 1584
NM_001009909chr1153251 3086 1522 1320 960 22699 798 11275 23305 89
NM_001009959chr2102510 1940 1732 1707 1699 1635 1020 853 500 75 1198 ----
NM_001009960chr742554 2353 1788 789 1165 ----
NM_001009993chr273741 3665 3504 2881 1581 847 791 13446 --13689
NM_001010000chr1883005 2845 2173 1192 529 453 346 274 12962 33252 3043 1148 43402 2755 502 485
NM_001010853chr632985 2396 2153 23024 880 32961 2081 458 --
NM_001010861chr182775 2671 2553 1862 1800 619 502 341 11881 ----
NM_001010862chrX42858 2101 860 495 139 12476 --
NM_001010867chr186055 5874 5548 4478 2047 1908 1270 317 24951 1553 --35037 2242 1220
NM_001010888chrX143892 3837 3816 3762 3712 3326 3170 3017 2956 1699 1015 478 413 24 31867 1729 268 21633 827 23801 2909
NM_001010891chr596747 6739 5973 5508 4600 1683 1080 919 128 55798 1975 1424 524 111 36447 2346 1413 --
NM_001010895chr921466 108 21780 169 41597 1560 583 537 --
NM_001010908chr101705 ----1667
NM_001010923chr631270 289 243 --31644 1403 1247 11670
NM_001010924chr102811 313 21261 864 1926 --
NM_001010935chr12272 24 2891 834 1863 --
NM_001010942chr124324 168 128 25 ------
NM_001010980chr1103203 2984 2659 2563 2261 1087 947 668 521 74 --1136 --
NM_001010984chr132594 2297 779 --2594 256 --
NM_001010986chrX11587 ----12454
NM_001010989chr163466 226 210 1516 ----
NM_001010990chr163466 226 210 1516 ----
NM_001011513chr493785 3487 2975 2905 2857 2669 1250 1006 638 1139 24068 4027 43167 3037 1120 451
NM_001011515chr441041 745 391 117 --31135 715 128 --
NM_001011516chr441041 745 391 117 --31135 715 128 --
NM_001011537chr342139 1843 425 37 11943 11590 --
NM_001011546chr201320 --1800 --
NM_001011551chrX4453 435 358 349 --2380 109 1183
NM_001011553chr77875 856 820 759 630 400 213 ------
NM_001011645chrX--1286 ----
NM_001011666chr7156530 6277 6005 5691 5580 4956 4795 4735 4536 4439 4394 4236 2583 2408 2245 36126 5813 2384 35142 4724 1794 16098
NM_001011668chr81774 --21122 52 --
NM_001011671chr81774 --21122 52 --
NM_001011708chr232243 2028 1792 --12713 11957
NM_001011713chr1431474 1442 1384 11624 3645 610 375 --
NM_001011885chr1531529 1159 404 --11419 --
NM_001012270chr1721428 571 11312 11750 --
NM_001012271chr1731531 1276 674 11415 11853 --
NM_001012279chr61524 ----1138
NM_001012321chr3167 ------
NM_001012333chr111117 ------
NM_001012334chr111117 ------
NM_001012393chr1194509 3621 3378 1708 1609 1435 949 55 22 24962 3202 45148 4591 997 894 21248 1145
NM_001012398chr162867 145 --21055 172 --
NM_001012418chr663958 3384 3186 3121 2887 2686 11215 --14231
NM_001012420chr1531058 1020 178 32573 2430 2005 1129 12640
NM_001012423chr1541990 1058 1020 178 32573 2430 2005 1129 12640
NM_001012426chr673421 3149 3078 2740 2538 1375 888 ------
NM_001012427chr673421 3149 3078 2740 2538 1375 888 ------
NM_001012732chr421155 47 --21219 1097 --
NM_001012751chr1011317 1729 ----
NM_001012755chrX104555 4446 4365 3179 3136 1167 1123 361 343 286 2251 38 24341 1500 24687 4078
NM_001012761chr552376 2335 2085 824 650 22699 1917 11034 12539
NM_001012968chrX82714 2688 2435 1890 1054 586 531 521 22470 1106 42637 2239 951 828 --
NM_001012969chr151271 161 ----
NM_001012977chrX11327 --11318 --
NM_001012989chrX2472 457 ------
NM_001013031chr1093202 2974 2622 2599 546 486 454 172 146 33372 1072 344 --13316
NM_001013398chr731528 1405 1079 1442 ----
NM_001013399chr62930 217 1441 1156 --
NM_001013406chr731556 507 201 11320 11494 --
NM_001013415chr421258 302 11541 1444 1276
NM_001013437chr18----1100 --
NM_001013438chr31250 --166 --
NM_001013439chr32336 96 ------
NM_001013620chr12238444 8278 7189 6866 6794 6501 6267 5692 5658 5467 5343 3365 2995 2732 2469 1981 1785 1595 1574 995 872 535 53 68389 6965 5247 2307 1258 711 25796 2363 58488 8363 7062 6941 2300
NM_001013635chr122346 257 --1390 --
NM_001013699chr12--1466 ----
NM_001013703chr152131 98 --1416 --
NM_001014286chr13168 ------
NM_001014380chr1374811 3978 1359 1090 1061 660 654 21162 1046 25320 3592 25534 4824
NM_001014434chr15810 282 192 101 58 1665 ----
NM_001014443chr1--136 ----
NM_001014797chr10128087 7952 7917 6108 5743 2901 1571 1542 1393 1180 831 369 38130 1507 1371 ----
NM_001014831chr192668 632 ------
NM_001014832chr192668 632 ------
NM_001014834chr192668 632 ------
NM_001014835chr192668 632 ------
NM_001015048chr1443150 2959 1196 1047 32250 1249 810 ----
NM_001015049chr1443150 2959 1196 1047 32250 1249 810 ----
NM_001015877chrX52940 2607 2580 1174 1120 --12158 177
NM_001015880chr1051688 1658 1370 263 51 21552 466 11502 --
NM_001017368chr1762576 2185 2165 1118 1003 461 22307 1796 ----
NM_001017369chr441001 843 163 136 1724 --1346
NM_001017392chr1951207 991 221 139 130 1503 --1513
NM_001017395chr393400 2856 2728 2481 2409 1250 523 268 89 42820 2783 679 81 22297 823 --
NM_001017405chr41961 ----1272
NM_001017415chr1180 --1121 --
NM_001017416chr1180 --1121 --
NM_001017424chr13742 58 49 --21323 507 11691
NM_001017425chr13742 58 49 --21323 507 11691
NM_001017440chr7108062 6253 2072 1555 1452 1013 795 622 426 218 47228 6242 5912 292 58190 7430 7339 6835 234 26573 1411
NM_001017523chr1221897 616 1698 11333 1554
NM_001017916chr1731572 564 225 --21883 610 1301
NM_001017917chr1731572 564 225 --21883 610 1301
NM_001017923chr1431692 1040 593 1340 ----
NM_001017924chr101169 21423 48 11034 --
NM_001017926chr82674 272 --21766 1242 --
NM_001017928chr3198 ------
NM_001017977chr12343 70 --1375 --
NM_001017999chr192189 2024 1835 897 761 646 605 249 152 11749 ----
NM_001017999chr192189 2024 1835 897 761 646 605 249 152 11749 ----
NM_001018000chr192189 2024 1835 897 761 646 605 249 152 11749 ----
NM_001018000chr192189 2024 1835 897 761 646 605 249 152 11749 ----
NM_001018001chr192189 2024 1835 897 761 646 605 249 152 11749 ----
NM_001018009chr33829 767 118 2846 109 1988 21057 910
NM_001018037chr93380 321 261 --11411 1232
NM_001018053chr171903 1547 1435 670 551 413 256 ------
NM_001018054chr131246 207 87 11071 ----
NM_001018056chr92405 240 ------
NM_001018064chr951835 1529 1341 521 110 ------
NM_001018065chr995976 5688 5436 4813 4778 4203 3858 225 192 33983 1776 1501 1309 1690
NM_001018066chr995976 5688 5436 4813 4778 4203 3858 225 192 33983 1776 1501 1309 1690
NM_001018067chr155022 4535 1509 1349 614 34726 1542 1034 15235 11181
NM_001018068chr155022 4535 1509 1349 614 34726 1542 1034 15235 11181
NM_001018069chr155022 4535 1509 1349 614 34726 1542 1034 15235 11181
NM_001018072chr1221897 616 1698 11333 1554
NM_001018074chr541515 1446 689 383 33359 2453 647 11131 13462
NM_001018075chr541515 1446 689 383 33359 2453 647 11131 13462
NM_001018076chr541515 1446 689 383 33359 2453 647 11131 13462
NM_001018077chr541515 1446 689 383 33359 2453 647 11131 13462
NM_001018090chr1552715 2550 2526 2440 2154 11738 2287 58 22265 1094
NM_001018091chr1562825 2660 2636 2550 2264 100 11848 2397 168 12375
NM_001018100chr153701 144 133 ------
NM_001018102chr1552715 2550 2526 2440 2154 11738 2287 58 22265 1094
NM_001018115chr35664 612 508 448 36 --1571 --
NM_001018676chr81176 1195 ----
NM_001018677chr81176 1195 ----
NM_001020658chr121676 1167 2634 370 --21660 1252
NM_001020658chr121676 1167 2634 370 --21660 1252
NM_001023560chr641091 938 846 277 ------
NM_001023567chr1552085 2007 1738 1658 178 --1129 1630
NM_001023587chr32993 987 ------
NM_001024094chr541515 1446 689 383 33359 2453 647 11131 13462
NM_001024218chr14------1331
NM_001024372chr832070 2000 1740 21842 608 --11786
NM_001024455chrX31906 1653 1027 --1391 --
NM_001024460chr621033 395 ------
NM_001024465chr6162 ------
NM_001024596chr1973609 3525 3519 2870 1449 506 186 11125 22225 880 43585 2449 989 698
NM_001024647chr12177447 6527 6488 6039 5851 5248 5039 4696 1798 1564 980 805 552 464 308 182 129 25501 438 26933 5781 22336 1857
NM_001024649chr512789 21938 157 22584 322 --
NM_001024660chr351653 1430 1358 1110 360 --21038 512 21220 111
NM_001024666chrX2257 251 ------
NM_001024680chr271669 1503 1351 1294 482 474 80 21388 361 ----
NM_001024688chr851799 1720 1598 1492 796 1271 11515 --
NM_001024808chr1282638 2130 2020 1125 893 825 321 209 ----12209
NM_001024847chr362127 2114 1980 1532 980 933 11770 2782 501 1958
NM_001024916chr9151 1110 ----
NM_001024934chr61629 --1145 --
NM_001024935chr61629 --1145 --
NM_001024936chr61629 --1145 --
NM_001024948chr153489 2842 2757 2261 328 21213 389 13409 13259
NM_001025068chr32668 338 1683 11696 1727
NM_001025069chr32668 338 1683 11696 1727
NM_001025076chr10165983 5887 5525 5068 4947 4804 4562 4532 4044 3963 2453 2139 2068 1546 1443 1410 25241 1970 56156 1950 1923 1292 449 35476 4407 505
NM_001025077chr10197341 7245 6883 6426 6305 6162 5920 5890 5402 5321 5113 4783 2904 2801 2768 950 859 390 207 26599 397 37514 2650 1807 46834 5765 1863 982
NM_001025079chr354008 2620 1393 909 329 23689 2894 ----
NM_001025105chr51246 --21415 1354 11248
NM_001025107chr152335 2100 1799 947 257 11846 12157 --
NM_001025107chr152335 2100 1799 947 257 11846 12157 --
NM_001025108chr242891 1260 634 357 --24184 3052 --
NM_001025201chr21585 --1530 --
NM_001025233chr12102381 2282 2145 1913 1711 788 728 458 314 136 1490 12434 22234 283
NM_001025252chr872045 1184 1050 758 472 393 89 ------
NM_001025253chr872045 1184 1050 758 472 393 89 ------
NM_001025266chr394713 4212 4021 3045 1653 1568 1529 224 94 13007 13363 --
NM_001025356chr1231151 927 28 1297 12015 22035 831
NM_001025389chr1131182 557 155 1113 ----
NM_001025390chr1131182 557 155 1113 ----
NM_001025580chrX53850 1090 958 455 35 34304 3130 1603 43905 3542 2784 2618 12907
NM_001025595chr451651 522 197 153 130 --1425 147
NM_001025596chr113472 457 332 --1129 --
NM_001025603chr13988 946 169 ----1437
NM_001029839chr321096 591 ------
NM_001029840chr321096 591 ------
NM_001029858chr652122 621 411 183 62 12190 22824 676 12157
NM_001029863chr672096 1307 1161 1095 803 487 365 23062 562 ----
NM_001029875chr552818 2061 818 529 108 12138 12706 1418
NM_001029884chr611730 22582 928 2881 689 --
NM_001029989chr152819 258 1370 --1694
NM_001030006chr171290 ------
NM_001030007chr16153861 3808 3518 3222 2930 2733 2448 1451 1115 785 535 412 398 372 26 2858 835 ----
NM_001030055chr14134777 4702 4661 4367 3853 3482 1859 1834 1813 1758 711 573 322 --43800 3693 3430 1619 1945
NM_001031623chr671747 1699 1383 1163 1119 588 233 --21826 344 175
NM_001031679chr1273577 3158 2878 2337 2271 2228 786 13392 22813 2243 12429
NM_001031684chr221471 1124 --21212 235 --
NM_001031685chr13340 281 42 1737 --1136
NM_001031690chr752311 1949 995 664 451 32416 964 182 1740 --
NM_001031695chr2295394 5315 4578 3852 3610 1482 1245 832 207 1194 25191 4873 --
NM_001031700chr492295 2064 2008 1807 1625 713 579 457 133 1761 22492 229 1826
NM_001031710chr73805 727 690 2343 37 1864 1926
NM_001031711chr551769 1726 1457 1434 621 ------
NM_001031723chr4138 2490 162 ----
NM_001031732chr452621 1107 1058 1030 382 12401 23587 955 23619 2288
NM_001031804chr1633386 2995 1467 13690 12862 14125
NM_001031812chr531886 1757 72 2813 207 21441 183 --
NM_001032280chr631405 684 637 --1608 21153 395
NM_001032282chr82490 475 1369 ----
NM_001032288chr2051527 629 426 372 83 11060 1528 --
NM_001032289chrX2875 111 ------
NM_001032293chr171103 ------
NM_001032363chr142116 1560 788 182 21989 121 2331 269 --
NM_001032363chr142116 1560 788 182 21989 121 2331 269 --
NM_001032380chr1031980 1309 727 ------
NM_001032394chr672808 2682 2327 2161 1900 1077 1050 --32081 789 142 12711
NM_001032395chr672675 2549 2194 2028 1767 944 917 --21948 656 12578
NM_001032999chr2075260 4100 4008 3948 3343 202 164 --22046 803 --
NM_001033025chr161525 1113 412 360 329 112 1980 ----
NM_001033044chr151610 1567 1414 1154 449 1558 21665 1520 --
NM_001033045chr283941 3571 3169 2953 1561 1126 721 460 13520 21657 102 14295
NM_001033047chr452177 1819 865 705 510 1943 --22607 1694
NM_001033049chr2172253 2197 1954 1841 1702 790 236 31595 937 732 ----
NM_001033056chr151610 1567 1414 1154 449 1558 21665 1520 --
NM_001033057chr341833 366 277 44 ----11753
NM_001033059chr681884 1443 504 479 465 410 224 63 11505 --21591 777
NM_001033085chr22122 73 ------
NM_001033087chr2082895 2820 2697 2650 2160 784 204 130 33210 2343 1122 12006 --
NM_001033112chr52612 567 1342 ----
NM_001033117chr3104805 4309 4291 4054 3928 3888 3717 3513 3299 334 ----13661
NM_001033503chr51512 --1203 --
NM_001033507chr121507 1255 --2771 204 11432
NM_001033557chr231310 1301 1243 2174 53 11142 --
NM_001033566chr173605 309 63 --1320 --
NM_001033568chr173605 309 63 --1320 --
NM_001033576chr1762495 2440 2267 2027 957 331 11791 22150 146 --
NM_001033578chr842186 1862 709 305 21906 957 ----
NM_001033581chr1145 ------
NM_001033581chr1145 ------
NM_001033582chr1145 ------
NM_001033602chr1341046 519 495 141 --3802 599 454 --
NM_001033659chr1731395 568 157 --11414 1402
NM_001033723chr831979 797 554 ----22488 1811
NM_001033925chr1031495 545 219 21696 62 --11668
NM_001034194chr4--1145 ----
NM_001034837chr54794 661 151 137 --1183 --
NM_001034838chr54794 661 151 137 --1183 --
NM_001034841chr1685528 4355 3628 2113 1673 1359 482 378 13350 11148 21549 462
NM_001034850chr531163 338 103 11059 1667 21601 1332
NM_001035chr151323 530 521 367 66 123 ----
NM_001035254chr952403 2315 963 394 41 21752 232 12463 --
NM_001035260chr101488 ----21378 1159
NM_001035511chr151777 1760 1738 1470 1387 ----192
NM_001035512chr151884 1867 1845 1577 1494 ----1199
NM_001035513chr151884 1867 1845 1577 1494 ----1199
NM_001035521chr21159 ----1798
NM_001037132chr731889 1738 694 11989 --2450 36
NM_001037133chr731889 1738 694 11989 --2450 36
NM_001037164chr7142 1314 ----
NM_001037165chr798944 8848 7901 7667 7378 6042 5981 3133 1867 48507 7719 7636 6565 68798 7157 6316 3018 2476 1843 --
NM_001037172chr341407 1338 1238 509 1897 1985 --
NM_001037281chr161119 ------
NM_001037317chr182775 2671 2553 1862 1800 619 502 341 11881 ----
NM_001037334chr1831774 1523 60 1571 1631 --
NM_001037339chr12678 612 11857 --1432
NM_001037340chr12678 612 11857 --1432
NM_001037341chr12678 612 11857 --1432
NM_001037341chr12678 612 11857 --1432
NM_001037442chr41510 --1181 1501
NM_001037494chr121212 1261 ----
NM_001037495chr121212 1261 ----
NM_001037533chr12588 260 ----1321
NM_001037535chrX2539 228 --11097 2240 172
NM_001037536chrX2539 228 --11097 2240 172
NM_001037540chrX2539 228 --11097 2240 172
NM_001037631chr2196 --1159 --
NM_001037872chr21520 2744 465 129 --
NM_001037954chr11113190 3160 2914 2774 2286 1386 999 875 720 259 98 --1732 12574
NM_001038493chr231478 1167 359 11184 ----
NM_001038702chr531831 1737 258 32514 1080 84 --11814
NM_001038707chr172183 2155 1775 608 595 573 532 32069 2045 1651 22245 295 --
NM_001038707chr172183 2155 1775 608 595 573 532 32069 2045 1651 22245 295 --
NM_001039029chr1211946 ----11902
NM_001039199chr20114972 4810 4331 4166 4023 3577 1960 1661 1579 1370 176 21919 1045 84985 4838 4796 3290 1793 1255 1242 27 35055 3870 3817
NM_001039348chr22188 103 1732 1858 --
NM_001039349chr22188 103 1732 1858 --
NM_001039350chr72612 37 21531 1344 ----
NM_001039465chr14--1415 1481 --
NM_001039479chr1492202 2045 2038 1912 1617 975 572 162 38 --12118 --
NM_001039538chr2103410 2915 2718 2488 1225 844 796 146 89 66 --22430 1334 12295
NM_001039547chr3137735 7487 6386 6303 6181 6167 5592 5219 4992 3196 2505 828 653 --66984 6838 5130 1831 419 411 16577
NM_001039569chr263345 3289 3002 2668 1245 707 2779 234 1897 2430 414
NM_001039573chr17------1489
NM_001039574chr1------1941
NM_001039577chr184147 3304 2798 1795 1502 1244 1051 363 31093 242 97 31694 1535 150 1432
NM_001039580chr4104436 3302 1744 1442 1325 1303 1142 1110 945 545 43932 3606 3283 658 34743 3915 3332 --
NM_001039585chr142898 2761 1234 124 23668 1310 24248 1637 22578 969
NM_001039590chrX63276 2725 2507 1091 859 579 32971 1021 535 23575 3118 --
NM_001039591chrX63276 2725 2507 1091 859 579 32971 1021 535 23575 3118 --
NM_001039618chr1185880 4853 3965 1903 1109 993 342 21 25821 5319 33944 2092 206 12193
NM_001039690chr1632018 1606 834 --12397 11977
NM_001039693chr2104148 3955 3718 3640 3452 2908 2577 1549 1337 1197 2788 559 43899 3328 2698 187 --
NM_001039709chr2075260 4100 4008 3948 3343 202 164 --22046 803 --
NM_001039762chr1052378 1711 1590 728 35 --12014 1546
NM_001039840chrX65589 2251 2017 1278 364 106 33730 3688 1811 11720 45261 4743 4729 347
NM_001039888chr13716 608 523 ------
NM_001039937chr1363478 3037 2938 2889 2754 1073 63907 3498 937 797 319 209 22740 1570 --
NM_001039960chr124623 448 333 272 11523 --1325
NM_001040001chr611927 1665 1104 21693 129
NM_001040057chr72515 371 --1340 --
NM_001040100chr34491 402 170 117 ----1978
NM_001040102chr1052615 2172 1992 753 153 ------
NM_001040103chr1052615 2172 1992 753 153 ------
NM_001040110chr721609 30 11739 --11429
NM_001040113chr161152 ------
NM_001040142chr262404 2279 2247 2100 523 214 --21536 954 --
NM_001040143chr262404 2279 2247 2100 523 214 --21536 954 --
NM_001040144chr1632018 1606 834 --12397 11977
NM_001040146chr1632018 1606 834 --12397 11977
NM_001040147chr182708 257 --1225 --
NM_001040152chr765098 5059 4912 1566 1176 192 33854 3757 3222 --11275
NM_001040153chr13--1357 ----
NM_001040158chr51409 1169 ----
NM_001040159chr441211 1126 435 364 1101 21351 38 --
NM_001040172chr571199 1148 427 327 269 249 155 --21218 279 --
NM_001040173chr571199 1148 427 327 269 249 155 --21218 279 --
NM_001040181chr331011 932 191 11057 ----
NM_001040182chr331011 932 191 11057 ----
NM_001040183chr331011 932 191 11057 ----
NM_001040199chr331011 932 191 11057 ----
NM_001040200chr331011 932 191 11057 ----
NM_001040202chr422479 660 1603 175 1847
NM_001040214chr672248 2048 1927 1547 1488 949 815 2825 649 1213 --
NM_001040260chr4--11101 ----
NM_001040261chr4--11101 ----
NM_001040272chr962091 1747 1686 932 761 626 12348 ----
NM_001040284chr16135910 5893 5392 4396 4141 3967 1985 1305 1225 1157 879 844 30 15313 35277 4639 1065 22356 751
NM_001040402chr463027 2579 2546 845 624 356 42849 2733 2155 2012 32461 2403 760 22319 2038
NM_001040409chr24759 712 690 319 ------
NM_001040429chr1372975 2836 2735 2424 2384 457 115 33514 3204 839 23385 3134 --
NM_001040432chr32131 47 173 ----
NM_001040440chr51453 ----184
NM_001040441chr195121 4926 3728 3532 1745 890 533 496 69 43916 2002 349 111 24568 1110 1766
NM_001040446chr582640 2618 2391 2301 2097 1800 876 525 1172 ----
NM_001040450chr15112759 2472 2032 1947 1805 1146 993 881 747 342 184 ------
NM_001040453chr15112759 2472 2032 1947 1805 1146 993 881 747 342 184 ------
NM_001040455chr1141341 1029 1009 458 ------
NM_001040619chr11415 1552 11044 173
NM_001040624chr83991 286 278 22048 293 1557 --
NM_001040625chr83991 286 278 22048 293 1557 --
NM_001040626chr83991 286 278 22048 293 1557 --
NM_001040627chr83991 286 278 22048 293 1557 --
NM_001040628chr83991 286 278 22048 293 1557 --
NM_001040629chr83991 286 278 22048 293 1557 --
NM_001040630chr83991 286 278 22048 293 1557 --
NM_001040653chr352568 1927 822 816 79 1397 --12468
NM_001040665chr7104934 4671 4236 3300 1845 1436 1226 943 676 197 43958 3516 1560 1143 33607 1887 766 44342 4265 4107 1751
NM_001040666chr71636 ----144
NM_001040709chr172406 2194 2104 1786 899 551 341 1790 1289 --
NM_001040712chr983607 3467 3359 3202 3009 2991 2754 1236 --32290 1228 547 11078
NM_001040876chr411212 3669 227 157 1719 11709
NM_001042355chr16155321 5186 4982 4782 4221 4131 3924 1892 1614 1607 1296 608 506 370 263 1201 45277 4311 1207 1163 24014 1874
NM_001042357chr1031496 1465 464 --21480 1280 1140
NM_001042358chr1031496 1465 464 --21480 1280 1140
NM_001042360chr1031496 1465 464 --21480 1280 1140
NM_001042363chr1031496 1465 464 --21480 1280 1140
NM_001042388chr183911 748 212 --1811 --
NM_001042389chr1031496 1465 464 --21480 1280 1140
NM_001042390chr1031496 1465 464 --21480 1280 1140
NM_001042392chr1031496 1465 464 --21480 1280 1140
NM_001042395chr1031496 1465 464 --21480 1280 1140
NM_001042399chr12------1493
NM_001042403chr121347 1961 ----
NM_001042404chr1----11379 11555
NM_001042406chr621240 86 --11164 --
NM_001042412chr16155321 5186 4982 4782 4221 4131 3924 1892 1614 1607 1296 608 506 370 263 1201 45277 4311 1207 1163 24014 1874
NM_001042413chr963651 3045 2929 1408 762 202 23975 3593 --13104
NM_001042425chr631405 684 637 --1608 21153 395
NM_001042453chrX21725 314 1433 ----
NM_001042454chr161355 ------
NM_001042459chr33313 279 250 ------
NM_001042473chr1042005 1702 1604 220 ----1404
NM_001042479chrX41835 611 396 56 1370 41729 1650 390 341 --
NM_001042480chrX41835 611 396 56 1370 41729 1650 390 341 --
NM_001042481chr1472182 2034 1919 1869 169 120 70 11805 12250 --
NM_001042492chr1743520 3434 2925 721 --21155 194 --
NM_001042494chr1563874 2701 1334 1079 823 515 ------
NM_001042495chr1563874 2701 1334 1079 823 515 ------
NM_001042496chr1563874 2701 1334 1079 823 515 ------
NM_001042497chr1563874 2701 1334 1079 823 515 ------
NM_001042506chrX--11464 ----
NM_001042510chr872061 724 635 580 433 351 195 11489 31960 845 84 --
NM_001042511chr872061 724 635 580 433 351 195 11489 31960 845 84 --
NM_001042517chr135870 769 252 207 163 155 2849 343 --
NM_001042533chr353071 2746 2275 2216 729 2674 355 12441 1336
NM_001042537chrX82474 2328 2308 2034 1590 969 498 184 ----193
NM_001042543chr461525 1315 1121 1099 575 61 11457 11508 --
NM_001042548chr23716 701 155 ------
NM_001042550chr961836 1644 678 669 615 127 ----1396
NM_001042555chr12104452 4278 4160 3525 1783 1754 1271 1198 1128 643 11099 23973 140 21570 80
NM_001042599chr2197316 7295 6176 6150 5856 5756 5518 5329 5043 2695 2083 1388 965 795 706 667 494 225 69 12166 65585 5446 2549 2378 1791 713 46582 5164 2607 811
NM_001042601chr342838 1260 1148 532 33300 2846 903 --23020 583
NM_001042603chr1265365 1687 1563 1481 284 176 24421 1318 34526 1166 1016 34299 1952 1157
NM_001042604chr3184776 4688 4401 4306 3661 3619 3297 3135 1565 1266 1190 933 792 739 553 544 315 191 31729 685 611 --13627
NM_001042635chr14150 ------
NM_001042646chr331447 815 107 ----11674
NM_001042678chr11141 ------
NM_001042679chr11141 ------
NM_001042681chr172521 2196 2148 2028 1848 689 117 1107 ----
NM_001042682chr172521 2196 2148 2028 1848 689 117 1107 ----
NM_001042682chr172521 2196 2148 2028 1848 689 117 1107 ----
NM_001042728chr1221078 146 1265 1362 --
NM_001042749chrX31802 727 627 1485 2103 41 --
NM_001042750chrX31802 727 627 1485 2103 41 --
NM_001042751chrX31802 727 627 1485 2103 41 --
NM_001042762chr74247 103 46 29 --1237 --
NM_001042784chr4122 ------
NM_001043318chr1453743 3005 2946 1390 130 --43783 3245 1015 971 24149 2921
NM_001044305chr641393 462 350 304 ------
NM_001044387chr1933117 376 66 2970 918 --14075
NM_001044388chr1933117 376 66 2970 918 --14075
NM_001044722chr531886 1757 72 2813 207 21441 183 --
NM_001044723chr531886 1757 72 2813 207 21441 183 --
NM_001046chr552636 2129 678 421 222 1438 12969 22106 786
NM_001048183chr183342 3330 2766 2354 1279 1034 839 484 1409 ----
NM_001069chr6164 1141 ----
NM_001071775chr1371542 1479 1402 412 290 281 229 11209 1298 11822
NM_001079874chr122030 677 ----21419 165
NM_001083620chr452487 2055 847 769 341 12029 1786 --
NM_001083621chr163374 3226 1737 1702 830 811 --14608 11646
NM_001099678chr395566 4848 3961 2115 1759 1322 1180 1066 995 35132 4031 967 45428 2445 786 493 --
NM_001100108chr1178322 7878 7628 6872 6165 5731 5232 5194 5144 3184 2757 1796 1280 1157 1087 989 809 33014 2867 674 48227 7894 6795 6005 28007 2913
NM_001106chr3168529 8101 7927 7273 7260 7166 6612 3388 2805 2542 2511 2449 1733 1472 1261 1239 68880 7719 5912 3878 2476 1225 12465 --
NM_001109977chr43680 99 93 --1164 --
NM_001111chr152335 2100 1799 947 257 11846 12157 --
NM_001113490chrX52791 2481 2388 2235 1054 2231 204 12780 --
NM_001117chr1852227 2009 1649 559 166 ------
NM_001121chr1041629 1212 465 123 1456 11197 --
NM_001122631chr112260 230 1674 ----
NM_001122679chr5------11336
NM_001123chr101168 --1543 --
NM_001126chr131089 703 195 1780 1760 --
NM_001128chr16153861 3808 3518 3222 2930 2733 2448 1451 1115 785 535 412 398 372 26 2858 835 ----
NM_001144chr1621066 181 ------
NM_001146chr862306 1900 1577 688 524 187 31943 789 250 --12290
NM_001149chr1021362 515 --11311 --
NM_001153chr23872 278 65 4794 641 365 185 ----
NM_001154chr41338 --1178 --
NM_001156chr103189 172 37 1429 ----
NM_001157chr101205 --180 --
NM_001159chr24733 235 137 65 1535 ----
NM_001160chr123527 186 60 1486 --32657 1817 475
NM_001167chrX85289 4132 2654 2326 1918 1812 834 72 22495 2312 44583 1762 981 301 26787 4500
NM_001173chr14134777 4702 4661 4367 3853 3482 1859 1834 1813 1758 711 573 322 --43800 3693 3430 1619 1945
NM_001177chr1232401 705 465 12380 12267 --
NM_001186chr21103310 2194 2163 2055 1093 727 581 267 166 138 42428 2252 663 238 33121 2442 412 13299
NM_001187chr21--189 --1390
NM_001198chr6----21601 557 --
NM_001200chr2031154 973 100 --21062 998 --
NM_001201chr4103848 3547 3391 2745 1529 1439 1204 649 458 123 1889 1929 13598
NM_001204chr2107738 7638 5568 5496 4934 4729 2000 1659 1572 910 66866 6748 2364 1493 729 137 --46008 2878 1556 1047
NM_001206chr963012 2840 2503 2252 1971 598 --2806 244 1233
NM_001218chr1592500 1752 1716 1018 506 478 418 98 68 ----12577
NM_001219chr74604 341 275 198 --1158 12289
NM_001221chr4--134 ----
NM_001233chr73650 323 99 1570 3939 834 175 12414
NM_001237chr41785 1360 21071 27 --
NM_001237chr41785 1360 21071 27 --
NM_001239chr51117 ------
NM_001241chr252427 1621 737 341 276 ------
NM_001241chr252427 1621 737 341 276 ------
NM_001256chr1772900 2334 1052 772 640 434 80 1718 32754 977 267 --
NM_001257chr1641233 1173 198 142 ------
NM_001259chr7235686 5465 5351 5175 5108 4763 4627 4577 4521 4063 2474 2412 2078 2036 2001 1683 1649 1621 1559 1532 1459 1441 367 25092 3956 43947 1300 1028 302 14981
NM_001263chr4------2469 132
NM_001267chr171531 ------
NM_001271chr1593097 3001 2026 1198 1028 766 665 462 179 12375 ----
NM_001278chr1021193 136 2862 197 --21060 456
NM_001282chr171290 ------
NM_001284chr52552 234 1494 ----
NM_001290chr42270 65 --2826 165 1124
NM_001293chr112562 438 ------
NM_001294chr191397 ------
NM_001299chr191493 ------
NM_001304chr1763281 3177 2440 884 580 141 53741 665 426 197 189 2857 469 11165
NM_001310chr12102652 2118 2060 2035 1089 591 516 176 135 118 12074 --12642
NM_001315chr642116 914 908 813 32038 1918 1399 --12182
NM_001316chr201144 ------
NM_001326chr111198 1482 ----
NM_001329chr1031483 1231 613 11047 ----
NM_001331chr1162846 2436 2289 1947 1793 872 ------
NM_001332chr551535 1251 640 426 242 1586 ----
NM_001338chr2111185 1939 1233 1258
NM_001343chr521624 1529 21580 212 1237 1512
NM_001346chr342680 2306 2018 340 12616 32191 1962 122 --
NM_001351chr321663 1390 21792 1650 21284 139 --
NM_001356chrX21763 318 11700 2661 582 --
NM_001357chr1--1256 1234 --
NM_001358chr41129 2301 43 ----
NM_001364chr11104694 3644 3282 3274 3235 1366 1092 746 339 257 23375 355 34472 3329 3204 --
NM_001378chr21476 ----1317
NM_001385chr8--1267 ----
NM_001386chr841995 1976 1787 832 22308 2224 1786 --
NM_001387chr552719 2711 2101 2088 2049 22594 897 12626 --
NM_001391chr1831033 885 53 ------
NM_001395chrX----1983 --
NM_001396chr2122656 290 1497 --12821
NM_001399chrX73660 3571 3472 2926 1040 910 70 22689 1078 ----
NM_001400chr171243 1139 508 429 239 77 36 --11064 --
NM_001401chr9----11210 --
NM_001402chr632060 1799 1680 ------
NM_001406chr1771624 1486 1266 667 621 392 85 --31660 424 279 --
NM_001407chr341644 1611 1386 557 11103 11302 --
NM_001412chrX63617 3581 3228 2833 2640 1216 --21414 131 --
NM_001415chrX11552 22016 1626 --11714
NM_001417chr121393 1175 --11981
NM_001418chr112488 481 --1213 --
NM_001418chr112488 481 --1213 --
NM_001419chr19114821 4450 3874 3853 3194 3008 956 758 316 309 225 ------
NM_001420chr1911194 --12237 12780
NM_001423chr1252053 1662 1554 1496 163 ----21301 770
NM_001424chr162677 91 1114 1764 --
NM_001427chr732134 2035 1770 ------
NM_001429chr221973 ----1446
NM_001430chr231449 564 273 --189 11600
NM_001438chr183304 1359 1328 1260 749 348 239 187 22586 2369 1557 1394
NM_001439chr161525 1113 412 360 329 112 1980 ----
NM_001440chr862816 2496 2293 1871 897 774 --1469 --
NM_001448chrX31651 1477 63 ------
NM_001449chrX11258 1920 --1110
NM_001451chr16--11341 ----
NM_001452chr61589 ------
NM_001453chr611777 1595 ----
NM_001455chr633063 1434 1086 33959 3050 219 --44378 3930 1925 634
NM_001458chr71671 ------
NM_001463chr21230 ------
NM_001483chr74796 744 723 349 ----1143
NM_001491chr662622 2249 1679 980 905 611 1485 --11663
NM_001494chr102527 240 --1151 --
NM_001497chr952597 1965 752 615 60 12771 --1359
NM_001498chr641168 985 891 518 1928 --1417
NM_001518chr74910 425 416 123 ------
NM_001521chr21159 ----1798
NM_001530chr1441071 743 143 74 --1183 --
NM_001542chr172737 2476 2438 2104 920 442 58 --1940 --
NM_001543chr584581 4308 4011 3290 3269 1827 1657 1491 11608 13536 --
NM_001550chr73185 47 35 170 129 --
NM_001584chr112988 323 --157 11182
NM_001587chrX82005 1816 1726 1415 598 590 573 240 12030 21911 843 --
NM_001604chr111712 ------
NM_001609chr1033511 3070 752 13715 13314 --
NM_001614chr171646 ------
NM_001614chr171646 ------
NM_001616chr272623 2610 1246 1075 1014 571 452 21273 41 ----
NM_001620chr112772 542 ------
NM_001621chr792782 2086 1877 1031 930 779 578 563 333 12366 12336 11083
NM_001621chr792782 2086 1877 1031 930 779 578 563 333 12366 12336 11083
NM_001634chr681884 1443 504 479 465 410 224 63 11505 --21591 777
NM_001635chr73974 320 312 21007 286 ----
NM_001642chr1131351 1259 850 ------
NM_001650chr1863839 3277 1108 1071 590 354 11043 12554 13629
NM_001655chr1141873 778 729 132 11778 22189 1921 11521
NM_001656chr51554 2774 162 2821 191 --
NM_001659chr1252670 2515 2436 676 448 --22234 1884 1786
NM_001660chr3--1279 ----
NM_001663chr1432733 563 237 11988 22463 2223 22033 704
NM_001664chr33902 286 211 ------
NM_001668chr112166 --22059 167 --
NM_001676chr132210 191 1172 ----
NM_001677chr141076 996 866 398 1737 ----
NM_001678chr1741779 1362 740 270 41568 1488 1449 588 21710 1638 --
NM_001682chr1282515 2386 2300 2288 1994 1051 733 579 12092 11045 --
NM_001684chr173240 2937 2566 1686 1247 768 523 33548 3368 3085 11282 --
NM_001690chr382344 2227 2096 1637 433 392 322 96 1983 ----
NM_001693chr851104 968 806 380 55 --11194 2842 359
NM_001695chr8103893 3869 3861 3307 3299 1272 1264 1256 1244 88 33460 1665 941 --23927 3817
NM_001699chr19131604 1544 1528 1408 1291 1234 1218 1206 1191 734 387 337 162 51561 1320 1131 727 268 51552 1461 1418 1176 362 11498
NM_001701chr931306 1115 43 1262 ----
NM_001704chr65556 543 514 246 77 1461 --1534
NM_001709chr1142707 2551 1994 310 ------
NM_001718chr611381 --11314 11004
NM_001730chr1311303 11130 ----
NM_001730chr1311303 11130 ----
NM_001731chr124924 893 666 342 1609 1693 --
NM_001742chr721482 1209 --1543 11843
NM_001744chr51147 ------
NM_001746chr512789 21938 157 22584 322 --
NM_001752chr111134 --1418 --
NM_001753chr721669 1529 ------
NM_001754chr2144099 3648 3143 2699 13671 23595 635 --
NM_001755chr164433 355 280 81 --2421 236 12213
NM_001759chr12124803 4410 4271 4192 4017 3498 3487 3471 1984 1954 1253 591 35010 4544 4331 14302 --
NM_001760chr63664 365 251 1376 ----
NM_001769chr121374 1310 --1348
NM_001777chr354008 2620 1393 909 329 23689 2894 ----
NM_001785chr1----1309 --
NM_001788chr77875 856 820 759 630 400 213 ------
NM_001792chr1831149 292 83 ------
NM_001795chr1661605 1505 1386 1060 460 362 ------
NM_001797chr162769 633 ------
NM_001798chr1221074 789 1101 --2906 326
NM_001801chr53508 263 32 ------
NM_001802chr162705 684 182 1178 11000
NM_001806chr1932928 2451 1104 2754 443 ----
NM_001822chr21585 --1530 --
NM_001825chr51118 ------
NM_001829chr42916 396 --168 1924
NM_001830chrX83735 3495 3360 2799 1349 1102 672 198 33621 1081 154 12608 --
NM_001839chr11489 ----1602
NM_001842chr9180 ------
NM_001845chr131378 --11219 11252
NM_001854chr151243 1044 541 485 460 ------
NM_001855chr92633 122 ------
NM_001858chr675031 5009 4221 3909 3581 3110 955 33217 1205 1190 --34924 1945 1309
NM_001859chr963676 3245 3207 2522 1325 624 11171 23295 209 2858 175
NM_001865chr62138 48 ------
NM_001874chr12133947 3693 3481 3383 3218 1995 1616 1609 1395 1032 907 524 84 15207 35124 3227 2048 14355
NM_001875chr241086 405 359 351 1424 1743 --
NM_001881chr101377 1496 --1348
NM_001882chr51442 ------
NM_001884chr51444 --1527 2552 505
NM_001890chr42371 255 ----126
NM_001891chr4----1326 --
NM_001892chr51246 --21415 1354 11248
NM_001894chr222888 491 ----156
NM_001901chr641084 1056 982 875 --1113 --
NM_001904chr33786 312 226 --1736 --
NM_001908chr852307 1594 1017 818 688 11815 3535 510 67 --
NM_001913chr74656 636 587 290 --1675 --
NM_001915chr1731572 564 225 --21883 610 1301
NM_001918chr1159283 9129 8536 7872 7071 6549 6205 6181 3482 2733 2470 1727 1274 671 81 22344 1028 68276 7261 6617 6487 3728 1343 48387 6710 2635 2073
NM_001921chr421155 47 --21219 1097 --
NM_001931chr1141294 1199 1044 288 --1805 --
NM_001935chr2----1331 2365 95
NM_001936chr72612 37 21531 1344 ----
NM_001938chr161749 1240 1229 1206 329 21 1341 11720 --
NM_001939chrX82678 1444 1224 828 616 446 254 227 --11154 --
NM_001942chr1831558 1454 1339 ----11539
NM_001946chr123790 751 333 21004 888 ----
NM_001949chr642749 2455 1232 687 --13200 --
NM_001951chr84516 181 143 36 ------
NM_001955chr61753 1872 1426 11052
NM_001957chr442228 1431 1420 415 1648 2196 90 --
NM_001961chr191412 ------
NM_001962chr51148 1579 ----
NM_001963chr42781 106 ------
NM_001967chr31195 1424 ----
NM_001968chr42831 352 ------
NM_001969chr1453675 3045 1146 956 515 2360 324 22529 2417 23637 2453
NM_001973chr1--1277 ----
NM_001977chr441346 441 243 219 51387 505 284 152 52 ----
NM_001981chr152260 2224 2192 1571 956 11541 12322 --
NM_001987chr1263521 3373 3313 2967 1480 1117 14145 14182 --
NM_001991chr173727 597 248 12216 ----
NM_001995chr431456 1440 1092 2444 408 2361 332 11010
NM_001999chr51469 ------
NM_002006chr4195749 5419 5249 5089 5034 4924 4572 4363 3840 3753 3666 3625 2237 2021 1757 1422 1400 558 466 11490 25722 1437 1416
NM_002009chr1552505 2342 2278 530 500 --42814 796 642 48 --
NM_002015chr1383330 3195 2595 2167 2107 910 730 673 --23309 2404 21182 384
NM_002017chr111314 --11171 1136
NM_002024chrX31685 1535 1381 12086 --1265
NM_002025chrX149217 7777 7764 6953 6677 6396 6173 5822 2374 2365 2092 1561 1121 778 69015 6135 5802 2741 2024 850 21246 21 11267
NM_002026chr24982 908 270 39 --1997 1829
NM_002027chr81176 1195 ----
NM_002031chr61568 ------
NM_002033chr1194083 3081 3025 2945 1471 1298 987 831 821 23920 3413 11142 --
NM_002035chr18203638 3573 3565 3504 3441 3238 3122 3096 1411 1356 1193 742 496 488 480 472 464 456 318 225 23894 3748 ----
NM_002040chr2163154 2852 765 728 401 99 1933 21032 350 13058
NM_002044chr1521076 158 ----11630
NM_002051chr1021116 945 --1248 --
NM_002054chr21297 ------
NM_002056chr2--1697 --3876 328 265
NM_002063chrX41030 872 245 72 ------
NM_002065chr151610 1567 1414 1154 449 1558 21665 1520 --
NM_002069chr741676 683 236 62 --11397 1587
NM_002072chr92335 227 ------
NM_002073chr2221578 1268 1243 ----
NM_002074chr131645 1240 197 --1555 11250
NM_002077chr941971 1945 1511 295 11337 21719 574 --
NM_002086chr1762227 1783 744 598 377 79 ------
NM_002089chr41549 1567 ----
NM_002090chr41104 ------
NM_002092chr495062 4071 3815 3786 1726 1032 621 409 143 1858 1641 21474 355
NM_002104chr51168 1189 ----
NM_002107chr1----1431 --
NM_002111chr453664 2569 2407 609 147 --13573 --
NM_002126chr17113612 3595 3560 3396 2869 2647 1251 1021 527 389 282 11666 33984 1619 1174 --
NM_002128chr1352116 1886 813 440 170 11636 31574 840 332 --
NM_002129chr42385 143 1426 ----
NM_002130chr51442 1670 --1556
NM_002137chr76937 917 858 847 688 285 2511 443 --12025
NM_002140chr931080 992 794 --157 --
NM_002141chr7127 ------
NM_002145chr172402 255 1161 1340 --
NM_002146chr17--41299 1241 583 452 ----
NM_002148chr2--1451 ----
NM_002151chr19------1264
NM_002154chr53510 373 45 4410 385 166 65 ----
NM_002158chr22607 42 --23761 497 --
NM_002163chr1631299 413 248 --11235 --
NM_002166chr21262 --1497 --
NM_002190chr631254 533 257 ------
NM_002193chr231799 712 156 31315 392 221 ----
NM_002196chr2041045 783 407 400 1743 --1910
NM_002196chr2041045 783 407 400 1743 --1910
NM_002199chr45856 766 760 669 207 2827 655 2170 81 --
NM_002202chr53820 402 371 167 ----
NM_002210chr233356 1304 1049 33500 2255 1225 --12263
NM_002211chr102854 301 ------
NM_002214chr7105730 5568 5423 5162 4944 4691 4682 4651 3466 440 35169 3729 287 25645 3658 24076 1625
NM_002222chr331345 1169 880 1155 ----
NM_002223chr12103718 3085 2980 2898 1455 1426 724 651 584 548 ----23863 1364
NM_002226chr143366 144 95 --1155 --
NM_002232chr131254 1078 272 --1951 --
NM_002233chr111436 ------
NM_002234chr122759 164 ------
NM_002239chr2--1931 1357 --
NM_002240chr21197 ------
NM_002242chr271671 1455 497 448 333 107 62 ------
NM_002245chr12642 109 ------
NM_002247chr1021997 527 ----22247 1691
NM_002252chr22173 163 2431 331 ----
NM_002264chr3144947 4165 3706 3150 1958 1665 1123 1094 646 521 400 356 199 180 --13337 --
NM_002266chr173192 174 65 --1186 --
NM_002267chr1331860 1747 474 21643 127 11790 --
NM_002268chr331586 1361 1245 11270 ----
NM_002270chr575062 4678 4543 1751 1611 1401 830 25391 1270 --24555 2005
NM_002271chr1351887 842 335 245 183 11897 --12351
NM_002285chr242891 1260 634 357 --24184 3052 --
NM_002293chr172694 2471 985 670 503 400 33 ----11714
NM_002294chrX2147 109 --1170 --
NM_002295chr3167 ------
NM_002296chr1--1590 --21490 453
NM_002310chr595029 4754 4358 4184 2073 1620 791 492 458 46537 5063 4811 2020 25281 2129 --
NM_002312chr13131 3707 376 362 ----
NM_002313chr10154675 4213 4143 4076 3677 3625 3500 3483 2013 1796 1075 975 942 618 209 33955 1692 1263 34794 3704 1740 34439 3798 3657
NM_002317chr5------1378
NM_002333chr19165 ------
NM_002336chr12104986 4831 3250 3100 1804 1692 1311 1266 672 21 13160 33093 722 549 2824 589
NM_002349chr231324 547 270 11251 21491 21 --
NM_002350chr831234 1105 871 3980 901 159 --21034 879
NM_002351chrX21228 33 1636 --1105
NM_002355chr1221095 578 --21153 375 31316 893 197
NM_002356chr621930 326 --12672 --
NM_002359chr1754302 3860 2898 491 436 ------
NM_002370chr1----198 --
NM_002373chr1531366 1227 376 ------
NM_002374chr2103410 2915 2718 2488 1225 844 796 146 89 66 --22430 1334 12295
NM_002376chr141165 1104 1560 --
NM_002380chr81211 ------
NM_002381chr21287 1928 2971 231 11056
NM_002382chr1441205 418 311 102 --1956 1526
NM_002384chr181952 --1959 --
NM_002391chr111117 ------
NM_002392chr122231 126 --134 --
NM_002395chr661446 1427 1237 545 536 116 --121 31346 246 43
NM_002397chr531867 1790 377 11390 ----
NM_002398chr211386 21104 455 ----
NM_002399chr1521360 918 ------
NM_002402chr741211 1038 810 173 11052 1472 1346
NM_002408chr142754 99 ------
NM_002409chr2233160 2296 661 1734 11166 --
NM_002430chr2221994 751 22228 298 1139 11620
NM_002436chrX4450 403 118 69 1314 ----
NM_002442chr1231531 1187 503 ------
NM_002444chrX51388 1362 1233 569 231 ------
NM_002448chr42651 104 ------
NM_002455chr1133 ------
NM_002467chr83421 296 29 ------
NM_002469chr121508 ------
NM_002480chr1211006 2976 505 ----
NM_002484chr163207 182 154 ------
NM_002485chr851799 1720 1598 1492 796 1271 11515 --
NM_002486chr942155 1763 761 244 1473 21625 547 --
NM_002487chr152638 144 1542 --1744
NM_002489chr73293 137 125 198 ----
NM_002492chr32103 37 1410 ----
NM_002500chr21204 ----1869
NM_002501chr19103949 3930 3839 1651 1279 1272 1250 878 597 35 ------
NM_002508chr121606 513 21891 502 1181 --
NM_002514chr841186 858 457 265 ------
NM_002515chr1441842 1322 248 212 ----21850 1610
NM_002518chr251103 938 340 149 37 ----11031
NM_002519chr1141354 1269 1222 1105 11331 ----
NM_002522chr1773885 3406 2539 1587 588 529 207 --13162 1630
NM_002526chr651251 645 627 103 23 --1311 --
NM_002527chr12--138 ----
NM_002536chrX3646 571 266 ------
NM_002537chr151726 1708 11027 1255
NM_002538chr52132 47 1216 --1444
NM_002544chr172300 134 --1128 --
NM_002545chr1194509 3621 3378 1708 1609 1435 949 55 22 24962 3202 45148 4591 997 894 21248 1145
NM_002546chr81733 --1582 --
NM_002547chrX84267 3812 3682 3364 1565 1450 378 142 --11513 13531
NM_002568chr82425 330 --1315 --
NM_002569chr1511355 1366 ----
NM_002576chr1161226 1195 1050 910 402 284 ----1211
NM_002577chr373193 3129 1137 826 723 198 40 23207 1446 13815 23729 139
NM_002581chr9105496 4871 1981 1556 1414 1283 1151 792 525 135 25665 2090 35585 5122 4295 14698
NM_002583chr122484 124 ------
NM_002586chr62190 146 --11184 --
NM_002588chr511746 ------
NM_002589chr4153 --1385 --
NM_002594chr2062272 2084 1642 1555 723 243 21656 236 11623 21972 460
NM_002595chr122528 218 --11585 --
NM_002599chr1151229 1154 1068 777 264 ------
NM_002600chr12678 612 11857 --1432
NM_002605chr154977 833 777 402 1823 --1928
NM_002607chr711153 ------
NM_002610chr263019 2632 2316 609 553 296 12171 1645 1361
NM_002613chr16135276 5141 5115 4972 4510 4183 3666 3551 2066 1498 754 431 232 24261 1265 --13327
NM_002623chr201275 ------
NM_002628chr32784 97 --2335 109 --
NM_002634chr171723 --1157 --
NM_002639chr1831218 822 84 ------
NM_002642chr11252 ------
NM_002645chr1173042 2860 2690 2379 2335 1030 335 ----1570
NM_002646chr131371 834 542 --22197 599 21968 1784
NM_002649chr711355 11211 --21229 412
NM_002655chr894895 4490 4278 4258 1354 997 828 610 596 34885 457 83 11545 31965 1789 1674
NM_002660chr2021042 983 1442 ----
NM_002670chr341545 1336 1005 480 --11050 11185
NM_002687chr143857 435 337 --1321 --
NM_002693chr153382 345 153 ------
NM_002697chr1----1268 --
NM_002698chr1932811 2546 1059 12139 ----
NM_002699chr141472 1335 600 272 ------
NM_002703chr4--21849 302 21650 1428 1480
NM_002709chr283026 2599 2536 2398 2291 726 433 117 11422 1156 13473
NM_002710chr123974 357 219 1388 ----
NM_002711chr71616 --1719 --
NM_002713chr11291 --1848 --
NM_002715chr51816 --1281 11127
NM_002716chr11103298 2839 2779 1332 1194 992 856 743 397 51 --12915 32433 734 161
NM_002718chr342212 2036 942 307 12616 1533 --
NM_002719chr1432018 1843 954 2715 395 2869 569 --
NM_002720chr161296 ------
NM_002721chr91188 ------
NM_002726chr6------1358
NM_002729chr101112 2341 263 ----
NM_002731chr152239 2139 2113 817 130 12124 42739 1264 909 444 2827 304
NM_002734chr17--42174 2122 2007 452 ----
NM_002736chr751632 1366 753 487 172 --1858 31966 770 186
NM_002737chr17106623 5452 4461 4138 4075 1124 1033 803 508 258 14413 31392 1379 1071 36306 6094 5467
NM_002738chr1631134 739 171 21036 881 --1721
NM_002740chr362387 2195 1829 1024 705 467 --32628 2525 2304 12832
NM_002744chr1145 ------
NM_002745chr2274448 3105 1462 1334 453 401 340 13344 23029 1245 21017 683
NM_002747chr182180 93 --11756 --
NM_002748chr151157 ------
NM_002755chr154890 644 174 84 --1694 --
NM_002763chr11426 ------
NM_002767chr17------1516
NM_002788chr14136 ------
NM_002815chr171179 1249 ----
NM_002822chr123619 600 178 31584 656 593 2681 412 11198
NM_002823chr21686 1251 ----
NM_002828chr182996 672 1187 --1626
NM_002829chr941194 1080 219 71 2137 122 ----
NM_002835chr7125 --2694 83 --
NM_002837chr1284479 4213 3729 2887 2871 1710 1566 373 34637 4469 3740 13645 --
NM_002839chr983607 3467 3359 3202 3009 2991 2754 1236 --32290 1228 547 11078
NM_002843chr1142689 2546 1145 507 33312 2359 2342 13356 --
NM_002844chr641367 1024 475 351 ----21274 376
NM_002845chr181438 ----1150
NM_002847chr741508 1470 1441 71 --11577 --
NM_002849chr122687 393 3794 764 109 ----
NM_002851chr71572 --1234 --
NM_002855chr1172732 904 817 766 705 690 416 --11026 --
NM_002857chr152070 1832 1691 427 372 12636 62548 2537 2316 605 172 24 22425 537
NM_002858chr121016 529 1963 ----
NM_002865chr81219 ------
NM_002868chr1242093 1743 972 889 --21714 1671 11664
NM_002869chr1142023 1533 843 513 1248 ----
NM_002874chr952425 2003 654 405 253 ------
NM_002880chr32577 167 --2763 730 --
NM_002881chr221085 468 21193 1036 21121 1105 21170 130
NM_002884chr12272 24 2891 834 1863 --
NM_002886chr384380 4027 3416 3240 1394 1199 460 410 44978 4718 4539 1217 24200 3313 23527 62
NM_002892chr141238 11477 ----
NM_002894chr181193 1163 ----
NM_002897chr21593 ------
NM_002898chr123418 171 26 1544 --1646
NM_002902chr151525 1453 ----
NM_002906chr1131612 1554 1538 21988 1762 22374 680 12192
NM_002912chr61758 2769 712 --1171
NM_002930chr182178 89 ----134
NM_002931chr61214 ------
NM_002938chr441861 1634 1567 209 ------
NM_002940chr411212 3669 227 157 1719 11709
NM_002941chr331307 1293 442 --11250 --
NM_002942chr31470 31004 73 33 11103 --
NM_002945chr172769 716 ------
NM_002953chr1----1807 --
NM_002956chr1221425 947 1334 ----
NM_002957chr952466 1132 743 597 96 1450 12554 23839 2563
NM_002958chr32791 186 1405 2836 701 --
NM_002959chr174363 4235 4032 3645 3082 2861 206 13051 1235 11269
NM_002968chr163698 352 171 --21047 413 --
NM_002970chrX168 ------
NM_002971chr321161 767 ------
NM_002977chr273356 2686 2169 1332 772 634 134 13126 1194 12615
NM_002979chr1----1812 --
NM_002994chr431954 1626 677 11590 --41990 1582 620 70
NM_002997chr231376 1261 529 11541 1182 --
NM_002998chr862069 1724 538 163 119 21 11918 --12019
NM_003001chr151884 1867 1845 1577 1494 ----1199
NM_003010chr1742147 1946 631 315 125 ----
NM_003011chr961660 1250 422 389 206 139 --11137 --
NM_003013chr43792 683 619 2770 292 ----
NM_003014chr741185 1058 501 462 21026 287 11439 --
NM_003015chr10----1725 --
NM_003016chr1721568 478 1284 2715 581 1402
NM_003017chr631290 1219 172 1296 --1428
NM_003022chrX31218 1009 21 31293 1180 1087 ----
NM_003027chr152155 132 --197 --
NM_003030chr341860 1776 1747 1414 ------
NM_003031chr161384 ------
NM_003034chr12218103 7957 7924 7911 7807 6897 6822 5969 5465 5455 5400 5286 5273 5035 3147 3051 2607 2216 945 911 52 12074 37582 7490 5318 24931 1869
NM_003036chr131003 276 177 1366 ----
NM_003038chr23822 625 205 --22607 724 22318 1924
NM_003042chr322055 1844 --22241 1805 --
NM_003045chr1374885 4854 3215 1930 1202 1046 624 14019 24777 2022 1264
NM_003046chr885066 4236 3849 3790 3654 3433 1270 1100 54447 4137 3463 3399 834 11552 23878 958
NM_003069chrX4763 584 300 242 1506 ----
NM_003070chr93285 101 59 ------
NM_003074chr361677 1535 758 655 325 291 --21985 164 11548
NM_003075chr122338 304 ------
NM_003079chr171216 2363 27 ----
NM_003081chr202457 230 2748 407 ----
NM_003095chr12137 ------
NM_003099chr15136523 5927 5620 4755 2003 1981 1513 1085 811 613 499 215 153 36499 1760 953 1797 --
NM_003100chr53359 327 168 ------
NM_003101chr131617 610 499 --11150 --
NM_003107chr642221 2077 899 426 12037 ----
NM_003108chr2157315 6304 6073 5264 5216 5078 5009 4486 2208 2132 2001 1808 1614 822 521 --24971 4417 14453
NM_003110chr171760 1264 --1777
NM_003112chr782786 2642 2435 1078 952 590 414 27 22180 801 1123 22104 518
NM_003131chr652199 1881 1702 374 75 ------
NM_003133chr11280 --1846 1359
NM_003137chr6112208 2159 1794 1725 1635 1534 628 507 380 365 109 1297 ----
NM_003144chr682227 1997 1602 747 658 619 294 30 1502 --1181
NM_003149chr351664 1156 1044 592 468 --11547 --
NM_003150chr1772389 2103 2046 1725 1583 927 701 --21853 235 11828
NM_003155chr862810 2062 1945 1093 652 116 21844 679 2690 507 12122
NM_003161chr1763009 2603 1120 1082 1069 791 1583 12591 23449 2672
NM_003162chr22835 272 1700 1826 1168
NM_003176chr12327 320 ------
NM_003176chr12327 320 ------
NM_003182chr71484 ----1424
NM_003182chr71484 ----1424
NM_003183chr21606 ----1623
NM_003184chr841003 960 836 140 21100 863 ----
NM_003185chr2041133 1036 496 96 ----1128
NM_003188chr61766 ------
NM_003189chr163344 3256 2761 2641 1067 382 31262 600 96 --13410
NM_003193chr11163 ------
NM_003194chr61397 180 1439 --
NM_003199chr1855402 3693 1715 1625 1495 25638 4898 45456 5177 1705 233 --
NM_003201chr101851 --1663 --
NM_003204chr1731763 1555 1379 ------
NM_003205chr1531970 1671 1610 11956 2871 837 1698
NM_003211chr1231264 634 106 11571 ----
NM_003216chr22113171 3007 2975 2170 2046 914 687 669 576 376 256 12869 13093 --
NM_003217chr1281943 1910 1895 1786 1700 1602 1362 551 --11533 --
NM_003220chr631405 684 637 --1608 21153 395
NM_003221chr644132 3283 3244 1307 177 33893 3885 3339 23849 1138
NM_003222chr2031195 1090 241 --1181 1287
NM_003234chr342323 348 141 49 1799 22138 2119 2329 240
NM_003242chr362127 2114 1980 1532 980 933 11770 2782 501 1958
NM_003246chr1541976 1849 1717 1319 12024 1342 --
NM_003247chr642035 1555 1419 124 --192 11868
NM_003253chr2131724 1643 613 11394 ----
NM_003257chr1511116 --11216 21415 1041
NM_003259chr191130 ------
NM_003262chr394362 4160 1969 1525 1449 1134 1006 882 51 31997 1076 353 21387 419 1101
NM_003269chr621104 1023 ------
NM_003270chrX61082 928 442 245 38 31 3999 485 299 1812 --
NM_003274chr2152773 2586 2415 819 504 22978 812 12084 12718
NM_003275chr93459 199 122 ------
NM_003286chr201822 ------
NM_003288chr2031366 560 356 1964 ----
NM_003297chr12--2211 103 ----
NM_003298chr3135820 5712 5701 5610 5308 4830 4820 4684 4027 2436 2166 1697 1262 34152 1898 782 64796 4362 2454 2034 758 425 25343 4728
NM_003300chr14------1452
NM_003304chr31419 21520 276 --1126
NM_003305chr4--1128 158 --
NM_003309chr651883 1713 527 517 358 21382 333 --11274
NM_003311chr111258 ------
NM_003317chr141841 --1263 --
NM_003336chrX51009 919 825 770 297 ------
NM_003337chr531726 1444 340 21451 565 21197 480 11616
NM_003338chr1031964 1393 600 21897 1327 11456 11251
NM_003339chr531582 1554 89 151 ----
NM_003340chr431060 341 303 151 ----
NM_003341chr31108 ------
NM_003342chr1792695 2377 2365 2023 986 912 434 371 219 --12979 --
NM_003344chr72607 312 21562 1178 ----
NM_003347chr2232120 1851 137 --12314 --
NM_003348chr1231381 471 458 --11353 --
NM_003349chr2051527 629 426 372 83 11060 1528 --
NM_003350chr81759 ----1325
NM_003358chr9----1125 --
NM_003360chr41106 ------
NM_003367chr191486 ------
NM_003368chr1180 --1121 --
NM_003369chr1132674 667 244 ------
NM_003370chr191597 ------
NM_003372chrX----2592 332 --
NM_003373chr1021284 267 11666 ----
NM_003374chr51145 ------
NM_003375chr101171 ------
NM_003379chr631011 421 73 1793 ----
NM_003383chr92405 240 ------
NM_003387chr252702 1801 509 411 405 12221 21985 568 --
NM_003392chr3124354 4081 3940 3924 3340 2970 2935 2661 1523 1214 664 460 24137 3712 11042 --
NM_003400chr24845 318 199 30 ------
NM_003403chr142300 92 ------
NM_003404chr2021760 596 11322 ----
NM_003405chr22--1760 --1551
NM_003406chr831455 418 131 31726 1684 34 11310 11760
NM_003409chr1811320 1435 ----
NM_003410chrX31187 1148 331 42649 2408 2157 371 ----
NM_003411chrY31239 316 142 21743 1714 1187 --
NM_003412chr342934 2146 1948 326 --22275 2101 12681
NM_003413chrX51918 1903 1825 265 231 --1694 --
NM_003432chr53579 497 399 ------
NM_003436chr195846 728 201 187 60 ------
NM_003439chr773364 3152 2356 1070 885 589 303 22227 1032 --21140 44
NM_003453chr13164 ------
NM_003454chr1621319 491 --11357 --
NM_003457chr171103 ------
NM_003458chr393856 3786 3550 3246 2938 2521 1019 281 62 12894 23176 1351 --
NM_003462chr141300 471 373 303 --31753 508 482 --
NM_003463chr622960 727 22998 2430 2836 679 --
NM_003466chr251724 961 576 412 85 11535 ----
NM_003467chr21131 ------
NM_003468chr242940 1305 1031 226 --23408 529 21316 421
NM_003469chr22446 163 ----1108
NM_003470chr1681657 1400 1336 1262 1214 315 158 83 ------
NM_003471chr381670 1520 1439 780 727 634 573 115 11606 ----
NM_003472chr641131 434 269 186 --11074 193
NM_003473chr1021090 823 --21073 890 --
NM_003474chr1042166 1735 1520 793 ----11793
NM_003477chr113734 600 202 1642 ----
NM_003478chr112941 121 12531 43177 2940 2262 643 --
NM_003483chr1262818 2799 2706 2471 1029 23 --22879 2238 1596
NM_003489chr2162813 2631 2557 1344 1029 782 1689 11076 2630 424
NM_003498chr1652783 2763 2491 2016 590 --11057 --
NM_003505chr721690 1639 11342 ----
NM_003506chr821209 271 11095 1510 --
NM_003507chr211381 12012 --11460
NM_003518chr6--122 ----
NM_003525chr6146 ------
NM_003559chr1733088 2992 844 43907 3548 2831 1305 ----
NM_003563chr1731428 1110 499 ------
NM_003566chr1252713 2639 2386 1264 1123 22745 567 1924 23499 3347
NM_003567chr11285 ----1398
NM_003569chr61573 --1177 1196
NM_003573chr191268 ------
NM_003574chr1875333 5243 2322 2038 1903 1127 141 21472 351 35322 5097 3943 14522
NM_003580chr84575 489 467 376 ----2598 142
NM_003581chr23976 119 105 ----1303
NM_003583chr12113574 3228 2907 2556 2471 800 785 682 548 517 191 2616 226 12867 21344 1075
NM_003589chr1351365 1300 547 204 86 2401 296 11288 --
NM_003590chr2103140 2710 2581 1608 1602 1466 700 474 264 219 33940 906 462 --32852 2817 2632
NM_003592chr71492 ------
NM_003597chr22419 326 ----11904
NM_003601chr4--133 148 --
NM_003603chr452135 1979 1972 1591 232 21513 584 ----
NM_003607chr183884 3792 3319 1477 1003 896 848 769 12726 11589 21617 1069
NM_003613chr15------1216
NM_003615chr383395 2490 1520 983 818 568 477 302 --33469 3045 2743 12785
NM_003618chr221207 389 131 ----
NM_003622chr12145 --1426 22097 503
NM_003626chr1131282 1088 986 --195 --
NM_003628chr21708 --2188 37 --
NM_003629chr163036 2490 2233 80 43 30 2633 345 33025 830 185 --
NM_003631chr103897 648 219 --21005 414 --
NM_003632chr172805 299 ----1838
NM_003633chr541902 611 160 70 1629 2537 412 --
NM_003642chr22122 73 ------
NM_003644chr17105729 5421 4395 4235 2545 2435 2150 1864 1358 502 25684 263 46238 1597 416 219 --
NM_003645chr15175 ------
NM_003651chr121501 --1175 --
NM_003653chr171166 1198 ----
NM_003655chr171659 1489 --1715
NM_003659chr21158 ------
NM_003663chr3103058 2438 1314 1261 1143 925 907 851 777 435 33412 2886 2754 13425 2767 256
NM_003668chr12----150 --
NM_003671chr953295 2999 2798 2246 37 13082 43418 2767 2229 1418 --
NM_003672chr131875 633 104 2739 349 1485 11522
NM_003676chr12724 623 2766 284 ----
NM_003679chr1123163 3150 3013 2805 2729 2479 1355 1327 649 235 141 38 1938 22988 1207 2327 275
NM_003688chrX1224 ----1241
NM_003692chr93694 246 233 ------
NM_003702chr81118 1613 --1817
NM_003711chr51298 1103 --142
NM_003714chr553040 2484 2422 2359 613 --11205 --
NM_003716chr3------1235
NM_003718chr7150 1191 ----
NM_003722chr342547 1041 768 190 31737 1712 578 ----
NM_003725chr122339 310 ------
NM_003735chr511746 ------
NM_003736chr511746 ------
NM_003743chr221911 1829 21850 876 1520 --
NM_003746chr121212 1261 ----
NM_003749chr1332195 907 815 ------
NM_003757chr12367 130 ------
NM_003758chr1551500 1264 1018 1009 29 11058 11588 --
NM_003758chr1551500 1264 1018 1009 29 11058 11588 --
NM_003759chr484231 4058 3103 3074 2791 1521 775 273 --21088 1043 11113
NM_003760chr12722 710 ------
NM_003762chr1--11210 1177 --
NM_003763chr2072948 2669 2189 1961 726 525 486 12741 12923 1413
NM_003768chr151855 1745 1513 1375 274 ----1337
NM_003769chr12126 ------
NM_003784chr182708 257 --1225 --
NM_003787chr1841702 1498 638 179 1187 ----
NM_003794chr33873 772 311 --21008 130 --
NM_003795chr63536 202 66 ------
NM_003796chr191183 2510 446 1530 1211
NM_003799chr1864391 4047 3238 410 241 85 1106 13051 1216
NM_003800chr611547 --11912 1637
NM_003816chr81371 1502 ----
NM_003821chr8153 1506 ----
NM_003822chr122115 995 2130 93 32998 2844 2416 --
NM_003825chr152101 21 11309 --11147
NM_003829chr92829 774 21154 338 1492 --
NM_003831chr1841728 1552 703 505 1486 1229 --
NM_003861chr1442712 805 618 244 --22744 604 --
NM_003864chr41132 ------
NM_003870chr15102106 1977 1776 1505 1436 606 556 280 158 61 ------
NM_003872chr272634 2405 2003 634 529 485 243 32437 1881 893 2942 440 --
NM_003873chr1032394 2273 1716 32454 2121 912 1828 --
NM_003877chr12--1700 1109 --
NM_003884chr361794 1319 716 498 432 246 1614 31717 1522 388 11672
NM_003885chr1721697 618 11032 22162 1985 11013
NM_003887chr21550 2474 439 1114 --
NM_003888chr1531484 59 50 --11361 --
NM_003895chr2182231 2067 1738 1650 1581 698 543 537 21409 446 --11533
NM_003901chr1062678 2401 1781 445 337 320 --22688 283 1275
NM_003908chr2061386 900 446 391 328 188 ------
NM_003909chr873034 2812 925 831 692 151 120 ----12321
NM_003913chr664269 3949 3785 3360 1099 556 11150 34324 3813 1135 --
NM_003916chrX--1491 11097 --
NM_003919chr7------1251
NM_003922chr15--1145 ----
NM_003927chr18--1357 2868 679 11116
NM_003929chr131625 1380 562 --11328 --
NM_003930chr742288 826 709 162 ------
NM_003931chr61629 --1145 --
NM_003932chr2261892 1642 1471 373 300 91 21736 232 --21598 495
NM_003934chr91471 --11106 1151
NM_003947chr371370 1299 1233 472 432 208 103 11385 11002 1406
NM_003951chrX3162 68 41 ------
NM_003953chr131108 880 627 --12791 1941
NM_003956chr101329 3510 400 348 ----
NM_003958chr683879 3418 3202 3189 2939 2783 2765 839 41401 1155 390 95 33032 2514 74 --
NM_003971chr171517 ------
NM_003972chr103896 419 311 --170 --
NM_003980chr631325 102 46 1227 1174 2915 284
NM_003983chr1674458 1045 936 915 685 652 531 24108 428 1404 --
NM_003994chr1274077 3721 2854 1571 1440 421 122 74404 4235 3694 3618 2814 877 82 44020 3282 1726 1689 --
NM_003998chr4--1633 2499 482 --
NM_004001chr12458 450 ------
NM_004006chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004007chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004009chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004010chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004011chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004012chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004013chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004014chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004015chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004016chrX72332 2076 1994 1850 1723 652 258 12162 1142 --
NM_004017chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004018chrX72332 2076 1994 1850 1723 652 258 12162 1142 --
NM_004019chrX1400 ------
NM_004020chrX72418 2162 2080 1936 1809 738 344 12248 1228 --
NM_004021chrX72332 2076 1994 1850 1723 652 258 12162 1142 --
NM_004022chrX72332 2076 1994 1850 1723 652 258 12162 1142 --
NM_004023chrX72332 2076 1994 1850 1723 652 258 12162 1142 --
NM_004024chr11324 1461 1953 173
NM_004028chr1863839 3277 1108 1071 590 354 11043 12554 13629
NM_004034chr103189 172 37 1429 ----
NM_004035chr1774412 4208 3906 3321 1820 1064 539 ----11079
NM_004056chr8------1898
NM_004061chr54578 518 491 162 ------
NM_004064chr12--2848 192 --21021 435
NM_004067chr711170 1304 1275 --
NM_004071chr21255 ------
NM_004077chr1221000 375 2154 83 --1295
NM_004080chr721209 1114 --11287 --
NM_004081chrY31690 1416 649 21810 1677 21310 227 11512
NM_004086chr143682 631 278 1153 ----
NM_004094chr147891 591 540 491 372 313 136 22790 261 3967 248 119 13072
NM_004098chr1031243 1136 361 11040 ----
NM_004100chr662193 2031 1859 1836 708 218 11963 12578 12215
NM_004103chr81841 ------
NM_004105chr22188 103 1732 1858 --
NM_004111chr112114 104 1729 ----
NM_004112chr1731405 557 401 11228 ----
NM_004113chr342004 1663 1599 817 1354 --11949
NM_004114chrX21262 472 ------
NM_004124chr1453516 3457 2324 702 266 42608 2584 1279 815 1902 122
NM_004132chr1031191 371 124 ------
NM_004133chr832108 1079 876 --12160 12717
NM_004134chr53601 578 185 ------
NM_004136chr1553052 2917 2711 2304 1302 2899 429 12641 --
NM_004145chr192863 380 1319 ----
NM_004161chr2--11142 ----
NM_004162chr3--1418 1127 --
NM_004170chr931313 402 138 ------
NM_004171chr11249597 8885 8770 8595 8575 7219 7097 6983 6829 6714 6703 6550 6193 6003 3703 3392 3166 2885 2251 1855 1544 1439 646 107 1465 89533 7397 7313 6416 2320 2032 1647 569 2714 82
NM_004172chr521703 593 --31328 1275 776 --
NM_004175chr222457 109 ------
NM_004180chr22602 397 ------
NM_004181chr4--1263 ----
NM_004185chr12638 268 ------
NM_004187chrX2990 230 ----11205
NM_004200chr1123213 161 --21161 351 --
NM_004209chr1611173 ------
NM_004219chr5----154 --
NM_004225chr831106 603 457 --1611 --
NM_004229chrX62199 1714 1693 1618 671 106 2571 123 22174 600 11928
NM_004232chr1873393 3179 2924 2773 2458 1477 913 73437 3429 2693 1561 1463 1200 513 1611 2601 192
NM_004235chr92738 630 1234 ----
NM_004236chr151189 ----1481
NM_004238chr21219 --165 --
NM_004239chr14--136 --1127
NM_004241chr10183 ------
NM_004242chr61323 ------
NM_004251chrX2287 25 --1237 --
NM_004252chr171136 ------
NM_004272chr511264 --41816 792 650 550 11677
NM_004274chr1442975 2187 1040 219 --12470 33193 2240 350
NM_004277chr641484 1335 94 86 ----1249
NM_004280chr61165 2361 62 ----
NM_004281chr102491 80 ------
NM_004285chr1116418 6110 5737 5248 5194 1988 1813 1753 1729 1579 1461 15358 15628 15329
NM_004287chr1772385 2246 2049 2010 1647 851 713 --1866 1652
NM_004288chr24978 769 385 299 1864 1196 149
NM_004293chr933706 545 247 43049 2887 1019 785 52768 2404 1439 1304 1096 11065
NM_004296chr1473973 3907 3170 2975 2729 1099 513 23625 1130 ----
NM_004301chr31145 ----1240
NM_004311chr1042782 2053 1200 881 --1180 1927
NM_004316chr1241086 810 391 72 1469 ----
NM_004323chr9122589 2556 2186 2172 2089 2076 2070 2053 1684 315 206 61 21791 1057 12019 --
NM_004327chr2291970 1900 1853 1677 814 805 510 366 335 12141 ----
NM_004329chr1031356 955 199 2185 30 11259 --
NM_004330chr151927 --1202 1441
NM_004331chr851943 1700 891 867 730 42514 1001 994 985 31651 906 318 --
NM_004338chr1877000 6563 5621 4523 2637 2516 2483 15309 --16246
NM_004341chr22236 29 ------
NM_004342chr772142 2133 1983 1448 1441 645 255 ----2517 223
NM_004344chrX2121 21 ------
NM_004349chr841227 1195 422 232 --11268 --
NM_004362chr42558 77 --1101 --
NM_004368chr191372 ------
NM_004370chr621840 783 --11881 --
NM_004379chr221624 105 1525 11097 189
NM_004380chr1632291 793 494 1381 21998 649 --
NM_004384chr531886 1757 72 2813 207 21441 183 --
NM_004385chr52252 244 --1441 --
NM_004389chr22635 334 ------
NM_004392chr1312577 --31819 541 327 32487 1912 132
NM_004393chr392410 1787 1706 1503 666 402 379 365 158 1282 ----
NM_004396chr17147 ------
NM_004397chr1152979 2702 1340 1188 606 23116 3066 --33708 3572 1364
NM_004403chr71409 ----1174
NM_004407chr41848 --1920 1880
NM_004411chr75716 658 584 210 204 1154 ----
NM_004414chr2131231 393 167 --1369 --
NM_004415chr62655 645 --1310 --
NM_004417chr52661 599 --1140 --
NM_004419chr10----11020 --
NM_004422chr171322 ------
NM_004423chr392607 2601 2391 2252 1814 1086 1076 666 267 12078 22703 2147 --
NM_004426chr1271413 709 685 427 263 225 197 ------
NM_004428chr12729 271 ------
NM_004430chr852372 2174 1934 1698 908 2969 708 ----
NM_004432chr911671 ------
NM_004433chr111606 --1682 1527
NM_004434chr1431895 1781 297 11185 ----
NM_004437chr1103238 3102 2954 2426 2337 920 855 310 204 142 23534 115 --13333
NM_004438chr243169 3017 295 59 2797 101 --12649
NM_004440chr661664 1622 1339 1227 686 573 11636 1274 --
NM_004441chr311198 ------
NM_004451chr111744 ------
NM_004454chr351934 1797 1610 396 140 ----11816
NM_004457chr21609 ------
NM_004458chrX32258 1065 169 52204 928 460 109 60 22461 2231 12313
NM_004459chr172790 554 22022 539 ----
NM_004464chr473846 3556 2951 1623 1005 603 50 13045 12735 --
NM_004468chr1------164
NM_004480chr144748 675 261 91 --1183 --
NM_004481chr142662 2457 584 504 --1985 --
NM_004484chrX2324 84 ------
NM_004491chr1964106 3932 3508 2791 1524 386 --24243 44 --
NM_004496chr1421200 919 21361 1219 ----
NM_004500chr1432050 253 42 2755 534 11720 1574
NM_004501chr173653 2693 1543 1339 1165 491 68 14003 --33852 2897 1004
NM_004502chr17----1377 --
NM_004504chr242987 1895 338 186 32472 2246 99 23052 928 32441 505 118
NM_004505chr1721684 130 ------
NM_004506chr6----1231 --
NM_004514chr1771958 1043 1032 927 873 484 441 12478 32444 1929 23 12459
NM_004520chr51277 ------
NM_004523chr1051593 1510 967 522 223 ------
NM_004525chr231534 1343 949 --11097 --
NM_004528chr1------176
NM_004529chr941060 575 431 342 ----2969 169
NM_004537chr1241450 1363 1213 442 ------
NM_004539chr181124 ----154
NM_004561chr111502 21666 1644 1649 --
NM_004571chr2162889 2737 2729 2397 2253 659 --169 33418 325 233
NM_004575chr421127 1080 1447 --2586 485
NM_004576chr53289 166 97 ------
NM_004577chr72587 549 1130 ----
NM_004580chr1531901 1677 55 3729 451 153 1188 --
NM_004583chr173638 268 66 ------
NM_004586chrX85117 4726 4306 3656 1595 1152 951 878 75304 3930 3901 3672 2051 1867 168 35157 4687 503 15447
NM_004588chr1173455 2890 2756 2746 2632 1524 1228 --13717 --
NM_004592chr121244 ------
NM_004593chr32303 271 ------
NM_004598chr562860 2353 1181 901 871 114 --42492 1145 1107 1078 --
NM_004599chr221455 ------
NM_004612chr9144613 4532 4449 4097 4075 3955 3524 3247 1661 1583 1175 1092 996 700 33855 3653 979 34461 669 330 11027
NM_004616chr12--143 ----
NM_004626chr112602 555 ------
NM_004627chr212711 178 --1455 --
NM_004631chr131246 207 87 11071 ----
NM_004654chrY31195 550 65 11130 --1982
NM_004655chr17--21135 424 11121 --
NM_004657chr21221 --31465 1025 428 --
NM_004660chrY4778 447 316 215 --1657 --
NM_004663chr1511593 ----1515
NM_004664chr121267 ------
NM_004670chr1051688 1658 1370 263 51 21552 466 11502 --
NM_004673chr13452 361 100 --11104 1255
NM_004677chrY----1546 --
NM_004681chrY----136 1156
NM_004684chr42269 48 ------
NM_004685chr1343020 3011 1087 509 22556 902 1479 --
NM_004690chr6--1686 ----
NM_004701chr15------1125
NM_004703chr1732352 1888 52 12427 12238 --
NM_004714chr191226 ------
NM_004715chr18----1695 --
NM_004717chr741338 970 571 437 2987 482 1534 --
NM_004719chr1282444 2264 1985 883 426 409 337 253 42729 2213 2055 150 22896 470 --
NM_004725chr1021323 1246 31487 1024 422 11056 --
NM_004726chrX145306 5170 4854 4815 4342 3840 3580 1660 1087 997 813 652 623 347 45049 5025 4704 4662 34303 979 570 13872
NM_004730chr552122 1623 1469 539 357 --11989 --
NM_004734chr1363080 2780 1201 925 437 154 12225 32770 2707 2587 22292 2161
NM_004736chr151864 1718 344 204 74 12158 ----
NM_004738chr203970 839 239 1125 --12434
NM_004742chr371810 1568 700 668 382 172 112 --11487 --
NM_004744chr4113765 3757 2751 2689 2434 1590 1578 1046 743 580 452 21016 734 23687 1072 13452
NM_004745chr8116962 6635 5453 5429 5199 4431 2156 1968 1276 347 248 44946 4873 4468 2082 46001 4794 863 832 --
NM_004747chr1041423 270 222 67 --21505 334 --
NM_004748chr15113872 3748 3058 2905 1247 988 683 557 515 395 304 1365 33978 3394 63 --
NM_004756chr1941499 1338 1146 977 ------
NM_004757chr42623 278 --1704 --
NM_004759chr192171 1568 1540 1419 673 454 401 360 292 --171 --
NM_004760chr732218 2010 33 1669 12435 21798 315
NM_004768chr12350 109 ------
NM_004772chr561536 1265 630 601 448 119 ------
NM_004774chr1742880 2537 1149 865 22971 641 ----
NM_004775chr1832028 801 187 1620 1108 11479
NM_004776chr2042747 1024 659 485 12273 ----
NM_004779chr54906 890 406 246 1197 1385 21086 976
NM_004781chr121621 133 11417 11495 31125 633 99
NM_004781chr121621 133 11417 11495 31125 633 99
NM_004783chr161689 ------
NM_004788chr1152601 1045 1032 737 537 22184 2100 12206 11982
NM_004789chr92376 51 ----135
NM_004791chr131121 1708 ----
NM_004796chr1442300 2265 1641 44 ----2746 190
NM_004797chr343123 3007 2859 1246 33622 1159 161 2743 691 12758
NM_004798chr2093583 3326 3121 3101 2878 2564 921 361 349 33645 3304 839 42725 2447 931 693 1719
NM_004799chr1--174 ----
NM_004801chr241594 1009 483 259 --11572 1280
NM_004808chr1093019 2825 2546 2485 826 640 317 166 28 23269 2566 12299 1701
NM_004815chr133894 1571 1201 11843 --34158 677 215
NM_004821chr53746 637 595 ------
NM_004824chr61289 1182 ----
NM_004831chr193812 395 159 --1446 --
NM_004834chr2--22160 741 13010 21355 334
NM_004835chr3--2868 156 --2822 148
NM_004835chr3--2868 156 --2822 148
NM_004840chrX21881 849 --12408 11660
NM_004841chr131046 806 203 --11132 11021
NM_004842chr651616 572 512 103 28 ------
NM_004844chr33829 767 118 2846 109 1988 21057 910
NM_004845chrX63928 3601 3379 1351 1317 250 11088 13813 13918
NM_004850chr241622 1461 493 337 --1422 --
NM_004857chr1464137 3236 3034 2917 747 343 --44047 3900 3880 1202 1107
NM_004859chr1753001 2475 593 344 53 --22686 137 1267
NM_004863chr14175197 5138 4770 4083 3964 3958 3605 2016 1765 1628 1264 970 945 725 532 309 181 33387 210 147 25191 5124 14101
NM_004866chr554981 4208 3169 1714 357 --43923 1698 1346 587 --
NM_004867chrX160 1125 ----
NM_004869chr1821698 456 ----1589
NM_004871chr17104140 4103 3838 3439 3092 999 883 481 368 179 --1194 22982 1560
NM_004872chr11425 ------
NM_004873chr1443150 2959 1196 1047 32250 1249 810 ----
NM_004883chr5----146 --
NM_004893chr51409 1169 ----
NM_004895chr11403 --1504 --
NM_004896chr101403 ----21293 1074
NM_004898chr432849 1951 537 ------
NM_004904chr7156530 6277 6005 5691 5580 4956 4795 4735 4536 4439 4394 4236 2583 2408 2245 36126 5813 2384 35142 4724 1794 16098
NM_004905chr15897 678 273 179 170 1643 ----
NM_004906chr61564 ------
NM_004912chr731556 507 201 11320 11494 --
NM_004915chr212206 199 ------
NM_004926chr1421773 1498 11584 ----
NM_004929chr821049 157 11141 41152 447 435 334 1320
NM_004930chr11617 ------
NM_004932chr561692 1514 533 157 92 60 1393 11416 --
NM_004937chr1721777 536 --22058 246 21976 511
NM_004947chr342376 1851 997 235 ------
NM_004949chr1841597 727 587 219 22044 1363 11636 1231
NM_004952chr11636 --1676 --
NM_004956chr764351 3811 3496 3370 3103 461 24479 1718 21841 976 33877 1598 635
NM_004964chr1284 76 ------
NM_004966chr101991 ------
NM_004969chr102445 82 ------
NM_004972chr91903 --31169 801 459 --
NM_004976chr1164632 1637 1579 983 690 667 1649 33961 1374 316 --
NM_004978chr11481 ----21604 596
NM_004985chr1273158 2965 2751 1553 603 417 179 33691 1407 886 11323 13938
NM_004992chrX147982 7777 7243 7228 7078 6686 5199 3063 2434 2303 1173 1026 507 81 11575 --28250 254
NM_004992chrX147982 7777 7243 7228 7078 6686 5199 3063 2434 2303 1173 1026 507 81 11575 --28250 254
NM_004993chr1421019 453 --21248 555 21319 236
NM_004994chr20----2187 169 --
NM_004996chr1621464 455 --21792 1515 --
NM_004999chr694304 3941 3431 3135 1732 1615 1229 1179 1103 14360 33656 315 236 14474
NM_005006chr22788 361 1751 ----
NM_005010chr731889 1738 694 11989 --2450 36
NM_005011chr721609 30 11739 --11429
NM_005016chr121121 ------
NM_005023chr531277 435 162 11369 1243 21388 619
NM_005028chr1062362 2314 2272 1634 777 597 ------
NM_005030chr161246 ------
NM_005032chrX11048 11055 --1826
NM_005033chr4--1145 ----
NM_005044chrX114228 3812 3439 3025 3011 2863 1415 1276 905 628 125 31829 1153 660 ----
NM_005045chr72969 676 2936 683 ----
NM_005054chr231771 316 247 1409 --31414 1273 557
NM_005056chr1265609 1931 1807 1725 528 420 24665 1562 34770 1410 1260 44543 2196 1401 34
NM_005063chr1053819 3276 1474 1256 796 43836 2832 1163 528 42953 2893 2615 830 --
NM_005065chr1445230 4447 3450 1402 --24277 369 25324 983
NM_005068chr661485 1373 1293 1227 1219 221 11120 128 139
NM_005077chr9--183 ----
NM_005079chr872045 1184 1050 758 472 393 89 ------
NM_005086chr1291773 1572 1491 1294 488 411 279 169 117 31706 1652 709 ----
NM_005087chr32336 96 ------
NM_005088chrX2697 253 1233 1581 --
NM_005093chr2075260 4100 4008 3948 3343 202 164 --22046 803 --
NM_005096chrX3441 418 261 --1146 11259
NM_005097chr10137 ------
NM_005102chr23716 701 155 ------
NM_005105chr152025 1995 772 490 159 22147 201 11378 --
NM_005109chr362231 1014 930 420 132 53 --21972 582 12358
NM_005112chr43999 149 76 ------
NM_005113chr14140 1175 --1192
NM_005114chr42236 171 ------
NM_005116chr2063363 3195 3056 1449 765 447 --24476 3459 --
NM_005119chr131227 866 347 --1840 --
NM_005121chr1763512 1494 1410 1131 820 196 1539 13067 12884
NM_005124chr6----1116 1828
NM_005126chr372262 2151 2073 2041 1889 131 103 12301 21446 682 12058
NM_005128chr211247 167 --1663
NM_005134chr183911 748 212 --1811 --
NM_005135chr1563874 2701 1334 1079 823 515 ------
NM_005151chr1831774 1523 60 1571 1631 --
NM_005153chr163180 88 77 --1753 --
NM_005154chr152630 603 1610 ----
NM_005156chr994915 4786 4709 4673 3572 1307 1152 216 111 2625 396 35343 1007 641 25247 355
NM_005159chr1552065 2045 1967 894 138 21948 673 21512 1415 21402 438
NM_005160chr22106517 6439 6405 5476 4705 2034 1572 1297 584 398 34894 2096 1987 --25986 5254
NM_005168chr261494 1240 1174 612 499 474 1312 ----
NM_005171chr1231060 1050 817 1435 --1266
NM_005180chr1041220 545 242 75 11088 11647 11554
NM_005181chr82692 218 ------
NM_005188chr11248184 7889 7834 7317 6802 6791 5932 5908 5693 5440 3284 3056 2261 2167 2034 1920 1789 1712 1409 1237 1003 836 715 118 22664 912 27197 5208 --
NM_005190chr62930 217 1441 1156 --
NM_005194chr201508 ------
NM_005197chr1496046 5729 5379 4384 4340 1741 1716 1709 757 12261 22180 65 12222
NM_005201chr3--1231 ----
NM_005204chr102728 228 122 ----
NM_005207chr2233305 1253 945 3954 887 468 13509 13486
NM_005214chr2159 --1122 --
NM_005219chr591590 1349 1162 1123 731 482 414 291 134 11285 1354 --
NM_005220chr1711481 1299 ----
NM_005222chr72347 223 ----1634
NM_005229chrX41093 405 202 107 ----11256
NM_005233chr32670 164 12499 ----
NM_005235chr2197316 7295 6176 6150 5856 5756 5518 5329 5043 2695 2083 1388 965 795 706 667 494 225 69 12166 65585 5446 2549 2378 1791 713 46582 5164 2607 811
NM_005238chr1132335 627 511 169 12582 --
NM_005243chr221230 ------
NM_005244chr202631 461 ------
NM_005249chr141149 --2291 131 1711
NM_005252chr141699 ------
NM_005254chr1551347 1286 901 477 144 ----1497
NM_005256chr113841 814 294 ------
NM_005257chr1861259 1026 1007 886 528 456 ------
NM_005259chr2--1333 --1348
NM_005261chr82989 236 ------
NM_005264chr103879 815 806 ------
NM_005271chr1031178 960 394 1248 11198 --
NM_005277chr431609 205 22 21332 77 21437 1300 31751 1696 577
NM_005279chr22810 51 ------
NM_005295chr7--1312 ----
NM_005308chr102529 348 ------
NM_005311chr762608 2376 2101 1953 1747 712 1832 --12397
NM_005313chr152868 363 1322 1274 1151
NM_005316chr111920 --1960 --
NM_005318chr221399 11282 ----
NM_005324chr1731702 1302 720 2769 466 ----
NM_005327chr43578 529 22 ----1234
NM_005328chr84706 556 209 51 ------
NM_005329chr1662277 1687 1646 899 796 426 --12132 --
NM_005336chr231966 1890 909 12292 ----
NM_005338chr773889 3556 2630 2509 1353 1080 201 33408 3249 3159 --33125 2950 2912
NM_005339chr494077 3363 2760 1705 1211 1123 665 650 214 14084 11432 14071
NM_005342chrX42685 2160 2047 865 1151 12544 --
NM_005347chr941208 638 376 312 --11448 --
NM_005358chr1351857 1676 584 316 134 1438 11599 --
NM_005359chr1885307 5237 5059 2496 2397 2391 1160 780 35300 4203 303 35179 5009 4312 34441 1955 1824
NM_005370chr191862 --11262 --
NM_005373chr131465 378 57 1468 11506 11685
NM_005376chr121199 1124 1349 ----
NM_005387chr112482 262 ------
NM_005388chr941306 1281 337 255 21714 1357 ----
NM_005392chr931341 1276 274 --11781 --
NM_005398chr1041464 1437 1412 555 1390 ----
NM_005399chr1154437 4371 4270 3745 3375 3337 3296 3105 3096 2927 2815 582 487 129 22 33212 1158 757 21087 619 --
NM_005400chr232295 2171 520 12837 1727 --
NM_005402chr731523 535 94 1165 ----
NM_005406chr18----41583 1517 1379 63 --
NM_005407chr143458 387 239 --2990 102 --
NM_005409chr43351 258 113 --11079 1423
NM_005410chr52676 270 1621 1599 --
NM_005413chr21343 --1434 --
NM_005414chr3----1279 --
NM_005415chr22315 268 --1673 --
NM_005426chr13340 281 42 1737 --1136
NM_005429chr4133 ----1245
NM_005433chr1852151 822 176 93 64 11922 22262 489 --
NM_005435chr73553 458 446 --1504 --
NM_005436chr1073415 3012 2872 1435 746 555 79 22833 2798 23478 1421 --
NM_005440chr1753271 2262 1049 602 434 --12776 12444
NM_005443chr43554 441 66 1542 ----
NM_005455chr1--21615 1419 ----
NM_005458chr942264 2188 1883 898 12373 ----
NM_005460chr51521 --1588 --
NM_005461chr2031575 1452 679 ------
NM_005465chr152056 1796 1405 410 268 --11871 --
NM_005467chr111638 193 --1167
NM_005471chr541324 1255 1246 65 --189 --
NM_005475chr12133067 3027 2704 2499 2466 2335 2275 2052 2024 1261 1134 986 378 ----1595
NM_005476chr94942 919 519 65 11421 ----
NM_005477chr1562463 2430 2305 2213 806 513 ------
NM_005477chr1562463 2430 2305 2213 806 513 ------
NM_005486chr172650 478 1588 --153
NM_005493chr6--1272 2200 166 --
NM_005494chr72501 231 1617 --1214
NM_005497chr1785870 5579 5438 5239 4335 3927 1574 1457 35092 2018 714 36140 3963 1431 11984
NM_005502chr963255 2984 2944 2252 2202 645 --13169 --
NM_005504chr12126574 5620 5192 4553 4377 2122 2010 1444 859 805 787 432 46440 1739 1325 897 24276 329 15960
NM_005506chr432926 2404 328 1211 12647 1525
NM_005509chr52310 78 11735 ----
NM_005513chr321236 1031 11406 130 11256
NM_005520chr51238 --1181 --
NM_005522chr731055 557 544 --1115 --
NM_005524chr3--164 1137 --
NM_005530chr151254 3457 281 37 --1528
NM_005542chr71525 ----11673
NM_005544chr221019 59 182 ----
NM_005552chr144588 536 149 123 --1581 --
NM_005562chr141711 1535 1338 1095 ------
NM_005563chr13752 579 250 --1219 1203
NM_005565chr5--1140 ----
NM_005573chr52664 46 ------
NM_005575chr54851 758 552 258 ------
NM_005576chr152299 199 ------
NM_005578chr3124512 3911 3719 3347 3202 1664 1652 1285 1272 1246 918 97 13640 13417 44398 2050 956 715
NM_005584chr13--2613 116 1655 --
NM_005587chr152966 633 ------
NM_005591chr1152682 2319 1038 249 126 11106 12025 --
NM_005593chr121202 --1442 --
NM_005594chr12173 ------
NM_005595chr11869 1893 ----
NM_005596chr9156176 5952 5762 5705 5500 4800 4785 4580 1774 1596 814 620 585 421 394 35246 4236 943 35920 4954 2196 1593
NM_005599chr151521 1467 1363 1008 157 --1434 11056
NM_005602chr321160 1044 1104 1199 1312
NM_005603chr1851971 1706 613 320 128 12053 ----
NM_005604chr6--22412 191 52176 1843 822 684 86 --
NM_005607chr8--1323 2251 50 --
NM_005610chr12943 227 ----1158
NM_005611chr1621101 54 ------
NM_005613chr152152 1809 1374 830 651 21610 404 31889 1787 870 --
NM_005625chr841081 674 257 121 1795 1402 --
NM_005627chr62678 116 1302 --1236
NM_005637chr1842073 1539 1413 211 1218 11314 --
NM_005638chrX31521 1226 511 ------
NM_005639chr123531 304 45 21834 1280 ----
NM_005647chrX93304 3024 2749 2357 2326 535 528 132 36 1117 13069 --
NM_005650chr2221159 537 ------
NM_005651chr43301 122 57 ------
NM_005655chr82490 475 1369 ----
NM_005659chr22--1440 ----
NM_005668chr594189 3830 3581 3496 1718 1149 612 485 197 31064 989 176 13693 22849 1236
NM_005688chr331080 406 32 1234 1487 --
NM_005704chr11752 ----21134 989
NM_005708chr132451 112 ------
NM_005711chr5--1934 --1884
NM_005715chr662444 2249 2160 1019 880 671 ----21776 746
NM_005717chr12851 167 21133 832 --11022
NM_005721chr24831 779 352 200 --1823 1883
NM_005722chr271556 496 377 328 307 254 103 ----12367
NM_005724chr151239 ------
NM_005725chr142469 2253 1828 1632 11939 11892 --
NM_005730chr1233065 981 646 22759 1326 12746 23298 798
NM_005731chr21428 ------
NM_005733chr51207 ------
NM_005734chr112512 284 2220 142 ----
NM_005735chr2159 ------
NM_005737chr262880 2864 2819 2256 1855 158 12426 22765 2592 12191
NM_005738chr7142 1314 ----
NM_005739chr1531839 582 343 31774 113 100 ----
NM_005742chr23684 534 79 --2635 279 --
NM_005746chr732723 2074 776 ----11821
NM_005748chr1293481 3205 2776 2549 2299 859 318 296 207 --12981 --
NM_005749chr17--1491 --1749
NM_005754chr531170 1095 391 1954 ----
NM_005756chrX1465 --11557 11080
NM_005759chr274292 3248 3004 1877 1331 1041 670 ----14001
NM_005765chrX2157 129 179 ----
NM_005766chr1341289 1278 508 227 --31172 978 549 --
NM_005776chr142758 620 3875 298 119 ----
NM_005779chr573295 2617 1398 1342 801 393 320 --12506 12656
NM_005780chr1351018 962 703 260 100 --1798 --
NM_005783chr23633 227 148 ------
NM_005789chr1732046 1331 117 12153 --11664
NM_005795chr262848 2570 2498 825 583 461 ----23018 2564
NM_005802chr91787 1609 ----
NM_005808chr3113391 3031 2821 2667 2624 2491 2325 608 516 440 291 --13167 --
NM_005813chr282670 2501 1839 1685 894 709 315 275 1654 12311 12227
NM_005822chr642310 2283 1771 39 21912 85 ----
NM_005826chr1--149 196 --
NM_005828chr1764975 4679 3417 3293 354 141 34665 1545 697 ----
NM_005832chr321052 171 1433 11109 --
NM_005839chr1--1301 --1973
NM_005840chrX237142 6883 6866 6844 6236 5854 5814 5716 5687 5498 5427 3009 2919 2449 2407 1928 664 634 622 487 400 356 212 45960 4729 4648 2974 34718 2497 683 27035 2701
NM_005841chr431059 909 86 ----1298
NM_005842chr131527 --1588 --
NM_005843chr241736 1512 1476 266 1524 --11541
NM_005853chr16----131 --
NM_005859chr5--11492 ----
NM_005862chr31788 ------
NM_005863chr1011424 --1311 --
NM_005868chr742062 836 384 259 1775 22039 997 1583
NM_005870chr131900 2103 96 ----
NM_005871chr102371 28 ----170
NM_005872chr11222 1390 ----
NM_005875chr3------149
NM_005880chr1611416 11604 ----
NM_005882chr41961 ----1272
NM_005884chr192668 632 ------
NM_005885chr5--11587 --1276
NM_005891chr61146 ------
NM_005895chr1273854 3579 2925 1370 971 306 119 24111 1001 2860 87 13757
NM_005896chr23291 227 136 1683 ----
NM_005898chr1152721 2387 2301 2200 163 23031 2090 32731 1245 916 --
NM_005899chr17149 --1976 1583
NM_005900chr431194 991 355 ------
NM_005901chr18167542 6442 6288 6134 5710 5640 5256 3165 2979 2941 2886 2613 1953 1660 1618 456 57667 6144 3256 3144 2516 58249 7309 5571 2991 2849 --
NM_005902chr1544615 4386 4234 3995 24269 1715 24511 457 21014 687
NM_005903chr585237 5231 4795 3655 1700 1408 582 118 44858 4604 3823 3576 13667 14478
NM_005904chr1831442 1379 1120 --11138 11476
NM_005906chr631234 538 90 21704 1253 ----
NM_005907chr661648 683 662 378 356 250 21056 542 ----
NM_005909chr563907 3596 1187 845 543 248 22642 782 --33339 610 76
NM_005911chr231202 131 63 --21091 515 --
NM_005917chr2--1189 ----
NM_005920chr173386 2906 2756 1476 1222 739 532 23090 452 1849 --
NM_005923chr63526 432 186 4689 660 107 36 ----
NM_005927chr521073 398 1430 3815 456 180 --
NM_005930chr143822 692 305 1285 ----
NM_005935chr4105218 4352 4241 3826 3713 3219 1515 687 510 298 31402 364 101 34925 3414 845 15269
NM_005937chr1753928 3295 3013 1115 947 ----14024
NM_005938chrX2428 66 ------
NM_005941chr854197 4118 3136 2988 1678 32949 1433 456 2557 340 2949 815
NM_005952chr161111 ------
NM_005953chr161104 ------
NM_005955chr175106 4856 4718 1536 1045 732 140 25473 318 33604 3372 1632 13907
NM_005962chr1032010 1698 332 11481 --1100
NM_005962chr1032010 1698 332 11481 --1100
NM_005964chr1731467 1341 382 21284 470 11232 --
NM_005966chr242063 1880 954 25 ----12027
NM_005967chr12----1486 --
NM_005969chr11131 ------
NM_005977chr1321029 977 1242 1695 --
NM_005986chr1322049 1889 1737 22291 2011 22263 721
NM_005990chr542787 2752 365 62 --22562 1813 11944
NM_005994chr172625 273 ------
NM_006003chr192253 39 ------
NM_006007chr934410 1056 312 14171 1456 --
NM_006011chr1593998 3886 3610 3484 3458 2904 1266 1131 921 23850 1692 ----
NM_006015chr121299 1034 --11118 --
NM_006016chr672254 1979 1676 1448 1417 683 519 ----1112
NM_006022chr1321030 946 ------
NM_006024chr72246 198 1218 ----
NM_006032chr141208 ------
NM_006037chr274377 4260 3527 3396 505 449 41 1586 11447 --
NM_006038chr2052164 1881 1874 856 341 1324 11931 --
NM_006040chr1641108 524 514 380 ----1538
NM_006041chr172194 146 ------
NM_006047chr2032697 2221 1304 33352 1332 952 1688 --
NM_006054chr111156 --1531 --
NM_006060chr774039 3392 1486 1254 1193 1088 835 --13533 --
NM_006063chr2158 --1201 --
NM_006070chr31269 ------
NM_006076chr732460 948 89 --1657 --
NM_006080chr742907 2751 2377 2301 22448 2085 3934 890 695 1858
NM_006088chr9146 ------
NM_006089chrX2589 273 --11171 1225
NM_006090chr12520 127 --1768 --
NM_006091chr1541339 646 160 46 11235 124 --
NM_006094chr842378 827 812 47 ----1284
NM_006095chr4114503 4427 4152 3925 3484 3075 2869 1739 1703 1377 556 34104 3097 380 33010 2919 39 2859 490
NM_006096chr83660 39 33 --1415 --
NM_006099chr13228 147 79 ----1881
NM_006106chr1143151 2522 664 134 32942 207 26 23308 2404 22927 2799
NM_006108chr1142399 1807 1751 847 134 11538 11654
NM_006113chr122030 677 ----21419 165
NM_006134chr2161439 1195 574 323 163 117 ------
NM_006135chr14966 499 182 126 21483 1009 1464 1544
NM_006136chr72517 186 ------
NM_006141chr1622764 1951 1124 42790 2666 623 310 12376
NM_006143chr12147 ------
NM_006145chr193980 724 66 ------
NM_006153chr31255 ----1107
NM_006154chr1572646 2123 1905 1018 914 597 218 12908 --1857
NM_006157chr11--1414 ----
NM_006158chr851540 1464 1249 735 175 11158 ----
NM_006161chr52569 513 1116 ----
NM_006164chr2--1149 ----
NM_006166chr1242544 2467 2149 493 ----11969
NM_006180chr951835 1529 1341 521 110 ------
NM_006186chr231209 1172 459 ------
NM_006191chr125695 400 311 301 291 1225 ----
NM_006194chr1441195 888 483 455 21012 363 ----
NM_006195chr911334 1923 11365 --
NM_006196chr21112 ------
NM_006203chr595385 4259 4086 3477 1972 1963 1202 876 338 33611 2096 1985 44816 1178 676 491 11708
NM_006206chr472941 2653 2481 2198 1795 804 370 2953 150 ----
NM_006207chr81286 --1198 --
NM_006223chrX2451 146 ----147
NM_006226chr22888 441 1396 --174
NM_006237chr1331676 1490 730 --1157 --
NM_006241chr351957 1827 1723 973 764 31932 1673 791 ----
NM_006251chr582872 2227 2216 2133 1285 1154 1145 910 --12246 --
NM_006252chr177013 6999 6091 6023 4974 1061 908 56482 6138 5389 4791 2424 77607 6237 5305 2146 1261 535 234 31872 1575 56
NM_006256chr162456 2416 2282 1854 156 75 ------
NM_006258chr103293 265 183 ------
NM_006264chr42187 66 1403 1459 --
NM_006265chr811002 --11543 --
NM_006267chr22699 531 11649 --1524
NM_006275chr2042136 679 666 163 22515 531 1886 12002
NM_006277chr23635 607 546 --1704 --
NM_006281chr83888 353 194 ----1286
NM_006281chr83888 353 194 ----1286
NM_006282chr2074521 4251 4011 3866 2964 821 424 24272 1861 13349 12999
NM_006283chr8124387 4320 4267 3871 3333 3097 1616 1584 1130 766 315 293 --13614 --
NM_006287chr252614 2093 1725 116 69 2900 82 1166 --
NM_006290chr651722 1511 1283 741 667 31545 749 74 --11940
NM_006292chr111177 ------
NM_006296chr2--2153 114 ----
NM_006298chr693198 2791 2691 2332 1136 1071 551 493 148 ------
NM_006306chrX125937 4978 4795 4784 4568 2285 2094 1435 1392 731 635 59 25839 212 15087 24378 3996
NM_006311chr17----145 1315
NM_006313chr1241276 364 299 181 1610 ----
NM_006330chr851660 1535 1407 630 183 --188 --
NM_006333chr23545 254 171 ------
NM_006334chr9--1294 ----
NM_006335chr12331 144 --125 --
NM_006345chr421094 952 21201 393 ----
NM_006346chr131194 ------
NM_006348chr72772 149 ----1653
NM_006350chr51353 175 ----
NM_006352chr141795 1776 408 56 11957 ----
NM_006357chr2165 ------
NM_006359chrX82474 2328 2308 2034 1590 969 498 184 ----193
NM_006364chr141247 11033 ----
NM_006366chr611329 --1839 --
NM_006367chr171033 968 676 443 118 112 73 1716 ----
NM_006371chr384405 3806 3559 3350 2111 2059 647 103 --24135 139 13415
NM_006372chr62501 159 --1361 --
NM_006378chr921412 1072 ----11016
NM_006379chr742177 1967 370 250 1882 --11720
NM_006380chr1784211 4173 2965 2959 2899 685 525 459 --23765 2747 --
NM_006382chr171273 ------
NM_006386chr2242311 1944 1832 1524 2711 452 --11868
NM_006390chr1231590 1409 437 ------
NM_006391chr111235 2267 94 ----
NM_006393chr1073157 2932 984 941 873 302 33 14237 33382 2939 1334 53953 3626 3282 2922 1262
NM_006399chr14--1316 --1303
NM_006409chr7----1234 --
NM_006413chr1021210 221 11053 ----
NM_006415chr931190 1000 359 11243 ----
NM_006416chr61765 --1686 --
NM_006419chr41543 --1741 --
NM_006420chr2073415 3178 2671 2506 1337 296 237 1833 --12535
NM_006421chr841224 1166 1065 93 ----148
NM_006427chr141161 ------
NM_006431chr12138 ------
NM_006451chr521108 135 1312 1842 --
NM_006457chr493785 3487 2975 2905 2857 2669 1250 1006 638 1139 24068 4027 43167 3037 1120 451
NM_006459chr1051915 1684 1640 1618 728 ----1231
NM_006460chr172625 403 11194 1506 --
NM_006464chr2154426 4411 4345 3986 3806 3655 3243 3190 1811 1492 1074 1039 491 452 299 24039 172 33377 1554 1226 21834 119
NM_006465chr1542303 2205 600 484 --1724 --
NM_006467chr52376 193 41650 955 419 206 --12175
NM_006472chr14950 804 122 91 --1877 --
NM_006482chr12113574 3228 2907 2556 2471 800 785 682 548 517 191 2616 226 12867 21344 1075
NM_006483chr191226 ------
NM_006484chr191226 ------
NM_006489chr1441842 1322 248 212 ----21850 1610
NM_006494chr194617 340 214 148 --1225 --
NM_006495chr17157 ------
NM_006496chr161963 1776 493 428 410 135 --1701 --
NM_006497chr172815 745 ------
NM_006504chr1072853 2779 2043 2003 1910 550 524 2991 298 --12970
NM_006516chr141103 1080 562 491 ----11457
NM_006517chrX21870 401 --21504 281 --
NM_006519chr6152 1224 140 1288
NM_006520chrX31703 1564 510 1118 ----
NM_006527chr43751 589 103 ------
NM_006529chr461516 1306 1112 1090 566 52 11448 21499 688 --
NM_006534chr2043448 3347 2479 983 22811 2341 33214 2288 412 12865
NM_006536chr11647 --3963 875 670 2240 226
NM_006538chr254040 3693 3279 3229 1360 23836 1209 2552 194 --
NM_006540chr8--1609 --21447 599
NM_006544chr14146013 5572 5324 5282 5138 4765 4282 4258 3920 2415 1925 1649 1570 1408 11226 34528 2212 1322 1264
NM_006546chr17126529 5527 5171 4666 4597 4336 2515 2288 1879 1518 496 470 25395 2270 12012 --
NM_006547chr731607 310 159 21565 209 --31685 1486 187
NM_006548chr32564 388 1573 --11206
NM_006549chr1242971 2848 2795 125 21030 889 1872 --
NM_006557chr9125 --11602 --
NM_006558chr8172 ------
NM_006560chr113472 457 332 --1129 --
NM_006561chr10165983 5887 5525 5068 4947 4804 4562 4532 4044 3963 2453 2139 2068 1546 1443 1410 25241 1970 56156 1950 1923 1292 449 35476 4407 505
NM_006572chr1742788 2547 2301 1204 1295 11113 32541 2495 843
NM_006574chr3------1259
NM_006575chr1431349 246 98 11108 ----
NM_006578chr1511267 2375 277 --1703
NM_006591chr1171853 1827 1425 643 502 393 209 ----11725
NM_006593chr22702 191 2833 713 ----
NM_006595chr1131811 1397 181 2366 143 --11605
NM_006599chr16158153 7378 7174 6153 5821 2831 2675 2169 1608 1085 948 680 672 545 136 47896 7498 6350 81 35384 2786 1793 25955 2544
NM_006601chr122121 48 192 1863 --
NM_006602chr202850 285 1565 ----
NM_006603chrX31802 727 627 1485 2103 41 --
NM_006609chr272632 2565 2507 2448 2314 2286 529 12944 32893 596 62 12521
NM_006614chr332871 2851 793 12755 33291 2564 389 1826
NM_006618chr12337 124 --31626 1534 1334 11083
NM_006620chr6104093 3327 3150 1675 1450 1057 878 691 671 179 13162 --24297 941
NM_006621chr191881 1816 1667 1389 676 336 269 217 184 21277 47 ----
NM_006624chr1022103 1837 31411 301 115 --1316
NM_006626chr972221 1937 967 795 423 367 150 --21983 324 --
NM_006628chr15134696 4368 4352 4323 4195 4014 1351 1282 595 537 497 371 274 33864 3099 482 --14145
NM_006629chr185669 649 640 552 356 ------
NM_006636chr24759 712 690 319 ------
NM_006644chr131163 2662 561 --1452
NM_006646chr1352731 555 368 81 59 --22366 1862 --
NM_006648chr9----1111 --
NM_006654chr12104452 4278 4160 3525 1783 1754 1271 1198 1128 643 11099 23973 140 21570 80
NM_006660chr152267 66 ----1365
NM_006667chrX--1452 --171
NM_006682chr772708 2257 1877 1014 440 284 269 12083 ----
NM_006699chr132497 913 656 21954 996 11670 32074 1892 1067
NM_006700chr121122 1716 1642 --
NM_006704chr132454 116 --1293 --
NM_006705chr9------1426
NM_006708chr631205 935 918 11304 11142 11199
NM_006711chr16166 1579 1246 --
NM_006713chr51534 ----179
NM_006716chr731373 428 148 ------
NM_006717chr9133306 2722 2655 2549 2173 2137 2090 1069 1058 791 785 586 121 12902 --12969
NM_006720chr10154675 4213 4143 4076 3677 3625 3500 3483 2013 1796 1075 975 942 618 209 33955 1692 1263 34794 3704 1740 34439 3798 3657
NM_006721chr101168 --1543 --
NM_006722chr362663 1189 937 527 511 99 1660 1872 --
NM_006726chr421075 982 ----11139
NM_006729chrX195424 5407 5326 4798 4695 4572 4542 4497 3684 3544 2222 2042 1801 1442 1344 1127 911 304 184 35254 4475 1639 45605 4314 3803 743 35191 3935 1629
NM_006731chr9175782 5373 5322 4826 4799 4660 4279 4192 4031 3910 3881 2240 1483 1086 987 967 745 25127 1818 55846 4987 4299 3758 1024 25673 2215
NM_006734chr651176 541 465 253 61 ----21609 993
NM_006735chr71121 ------
NM_006738chr1564608 3503 3433 3413 1867 1375 43938 2953 1043 586 11815 --
NM_006745chr441001 843 163 136 1724 --1346
NM_006746chrX2539 228 --11097 2240 172
NM_006749chr83968 461 124 1405 11111 --
NM_006750chr1697697 7029 6232 5847 5001 4905 1472 685 275 25063 203 67056 6650 6602 5342 2821 636 47226 5194 4964 1483
NM_006751chr21116 ----31040 995 100
NM_006754chr7----184 --
NM_006756chr821190 355 21201 62 ----
NM_006763chr142144 1942 1762 425 21958 1772 2613 528 11638
NM_006766chr8102659 2160 2076 1845 1810 1746 956 672 350 307 22450 2267 12418 22407 2346
NM_006769chr14744 681 527 134 ------
NM_006774chr73331 163 141 11056 2217 98 --
NM_006775chr653042 2789 2679 2541 721 22440 23 --22511 437
NM_006777chrX92886 2421 2271 1793 1017 896 777 722 692 52767 2617 2605 1864 1089 ----
NM_006778chr6128 21681 354 --1426
NM_006784chr1--145 1606 --
NM_006788chr1831545 1539 437 22135 580 1514 --
NM_006791chr15------1659
NM_006801chr192476 240 ------
NM_006803chr872090 1906 1823 1775 1718 321 282 11857 1817 11529
NM_006805chr561576 1280 616 554 436 133 21741 196 ----
NM_006807chr17--21141 157 ----
NM_006808chr91162 ------
NM_006811chr203868 277 208 2927 380 1991 --
NM_006812chr12------1629
NM_006825chr123964 390 189 --3981 401 261 --
NM_006826chr21400 ----11087
NM_006827chr1432812 833 472 13176 --12791
NM_006828chr63214 107 48 --1408 --
NM_006832chr143914 825 805 153 ----
NM_006837chr8--1108 --1148
NM_006838chr1211468 ----31607 1176 415
NM_006839chr21280 1126 ----
NM_006852chr1742533 1957 1912 264 11156 22447 826 22127 945
NM_006856chr121890 ------
NM_006857chr21355 --1737 --
NM_006870chr201320 --1800 --
NM_006874chr421140 939 197 ----
NM_006877chr61337 ------
NM_006884chr341860 1776 1747 1414 ------
NM_006885chr1664035 2850 2809 2698 1403 98 11543 --22762 1458
NM_006888chr1472904 2585 2269 2255 1024 722 114 135 13459 --
NM_006892chr20--1264 ----
NM_006892chr20--1264 ----
NM_006893chr12127 105 ------
NM_006896chr72938 24 --152 --
NM_006902chr172557 2107 1277 1231 822 633 621 21047 748 11024 12332
NM_006908chr721252 1112 1199 --1925
NM_006910chr16--1331 ----
NM_006914chr931157 1030 406 --11172 --
NM_006915chrX52510 2338 2329 2113 251 1979 22261 333 --
NM_006920chr211294 21844 1834 ----
NM_006922chr281649 1596 725 664 629 593 582 158 ------
NM_006924chr1783686 3498 3271 2956 2849 1221 1036 612 1996 23841 3815 11240
NM_006925chr14--1415 1481 --
NM_006930chr551739 1702 1267 541 133 ------
NM_006931chr1252134 1945 1809 1530 520 --1818 --
NM_006937chr171120 1533 1512 142
NM_006940chr125762 672 573 546 109 1580 ----
NM_006947chr411665 21233 398 11696 --
NM_006948chr2132066 722 210 21800 223 12047 2641 90
NM_006951chr101164 ------
NM_006955chr1043417 3067 550 457 23460 2907 11336 --
NM_006956chr721747 953 2753 646 21988 708 --
NM_006965chr1821043 363 ------
NM_006973chr10254 28 ------
NM_006979chr61547 ------
NM_006981chr942938 2923 2914 1917 --1268 --
NM_006982chr121249 ------
NM_006988chr211221 --11193 --
NM_006990chr172204 1899 1882 1543 877 750 553 4714 596 410 362 ----
NM_006991chr34634 254 100 74 1913 ----
NM_006997chr101452 ----1129
NM_006999chr542068 1799 826 471 11574 21655 612 11541
NM_007005chr931511 1058 548 21217 1010 2313 262 --
NM_007006chr163803 133 42 43247 2281 983 284 --1775
NM_007007chr1254736 3175 3141 690 675 33716 1247 543 --23876 3087
NM_007008chr22680 128 ----137
NM_007011chr1566248 5494 5090 1417 1244 824 32431 1544 991 35191 4705 1910 26742 5739
NM_007013chr83962 294 169 ------
NM_007017chr5------1840
NM_007026chr172446 237 ------
NM_007033chr162078 1956 1740 1478 881 496 ----11994
NM_007034chr12751 414 --1292 --
NM_007038chr21175647 5430 5000 4967 4896 4669 4662 4135 4033 3971 3814 3733 1560 976 456 318 149 26069 1028 25312 332 --
NM_007039chr1461473 612 422 360 304 292 --1189 12036
NM_007045chr63232 100 23 ------
NM_007050chr20117414 6867 6619 6564 6373 5051 2492 1314 981 746 93 --21785 1530 36985 6164 3157
NM_007054chr553774 3200 976 504 87 3952 849 818 23269 64 --
NM_007064chr351653 1430 1358 1110 360 --21038 512 21220 111
NM_007067chr1771589 1371 1212 1162 1084 347 76 1526 11223 --
NM_007073chr633354 2762 265 33046 2856 1058 ----
NM_007076chr121109 ------
NM_007084chr1341487 1473 596 549 ------
NM_007106chr1372742 2606 2117 1715 980 678 188 12360 ----
NM_007114chr363229 2594 2413 2385 2370 1314 43294 2915 2251 543 --32205 860 215
NM_007115chr21455 1158 --1105
NM_007118chr52865 568 ------
NM_007124chr641884 1602 1444 225 11782 1331 --
NM_007125chrY21471 291 ------
NM_007126chr9------1504
NM_007137chrX74035 3916 3843 1702 1051 584 315 11770 45543 4883 4360 3933 --
NM_007145chr1921400 112 ----11364
NM_007146chr1772820 2740 2398 2140 1033 616 584 22285 890 1334 --
NM_007150chrX11977 --22147 317 --
NM_007153chr1984297 3953 3453 3116 1798 1704 613 445 34411 2932 1330 ----
NM_007159chr3191 41417 341 144 38 ----
NM_007166chr1121529 1280 1999 11188 11108
NM_007172chr2251045 996 701 676 96 43222 2371 629 158 12704 13241
NM_007174chr1242119 1520 368 288 ------
NM_007175chr873227 2436 2227 896 657 153 44 22632 260 23182 94 33651 2452 2305
NM_007184chr31558 ----176
NM_007187chr13--1115 1936 --
NM_007191chr12--1577 1171 --
NM_007197chr1221041 866 ------
NM_007200chr1564608 3503 3433 3413 1867 1375 43938 2953 1043 586 11815 --
NM_007203chr943796 3217 3033 339 --12512 13617
NM_007207chr11606 1359 ----
NM_007212chr12573 446 22115 218 21780 52 --
NM_007214chr611002 11312 ----
NM_007218chr83881 857 368 --1172 --
NM_007222chr82674 272 --21766 1242 --
NM_007224chr121654 ------
NM_007231chrX102412 2123 1921 1522 869 767 620 593 344 249 --11539 1810
NM_007235chr121372 ----1449
NM_007236chr1562251 2063 1782 928 805 797 ------
NM_007245chr161799 ------
NM_007246chr44780 374 261 106 31033 678 385 ----
NM_007249chr13189452 9331 8502 8418 8222 6498 6425 5871 5735 3392 3289 2909 2696 2426 2120 1886 735 199 38724 3660 2608 58799 7299 6602 3348 2559 37642 2810 1418
NM_007250chrX1380 ------
NM_007257chr822513 221 148 41972 1964 802 64 32795 2339 657
NM_007269chr12619 440 1548 --1231
NM_007276chr71978 ----1286
NM_007282chr311024 134 ----
NM_007287chr322143 1200 --62514 2161 1028 676 345 67 22465 245
NM_007288chr322143 1200 --62514 2161 1028 676 345 67 22465 245
NM_007289chr322143 1200 --62514 2161 1028 676 345 67 22465 245
NM_007292chr1774412 4208 3906 3321 1820 1064 539 ----11079
NM_007294chr172992 317 1946 --3932 902 404
NM_007295chr172992 317 1946 --3932 902 404
NM_007296chr172992 317 1946 --3932 902 404
NM_007297chr172992 317 1946 --3932 902 404
NM_007298chr172992 317 1946 --3932 902 404
NM_007299chr172992 317 1946 --3932 902 404
NM_007300chr172992 317 1946 --3932 902 404
NM_007302chr172992 317 1946 --3932 902 404
NM_007303chr172992 317 1946 --3932 902 404
NM_007304chr172992 317 1946 --3932 902 404
NM_007305chr172992 317 1946 --3932 902 404
NM_007324chr1--174 ----
NM_007327chr91238 ------
NM_007331chr422681 971 21109 499 ----
NM_007347chr1542556 331 184 92 --13094 --
NM_007350chr1273660 3463 1610 546 348 265 65 --13441 1672
NM_007358chr161971 1914 1838 1832 247 35 --21875 303 11492
NM_007361chr144648 517 486 178 ------
NM_007363chrX2427 130 --1237 1783
NM_007365chr182088 2059 1894 1663 1482 822 558 238 2394 179 21907 322 11584
NM_007373chr10----3684 670 439 --
NM_007374chr141450 1378 --1477
NM_007375chr182595 2198 2151 1984 707 535 372 157 22794 1785 11831 155
NM_009585chr3--2868 156 --2822 148
NM_009585chr3--2868 156 --2822 148
NM_012062chr121876 ----2851 202
NM_012064chr1241144 1107 1001 108 ------
NM_012081chr512812 280 73 23023 1448 12568
NM_012082chr8152 ------
NM_012083chr1021213 72 ------
NM_012084chrX2573 383 ------
NM_012089chr131554 1410 35 1342 ----
NM_012090chr12935 370 ------
NM_012095chr1083546 3371 3270 3110 2778 2702 1052 172 22843 2393 12879 --
NM_012096chr353423 3359 1423 1236 47 12577 1607 --
NM_012102chr172521 2196 2148 2028 1848 689 117 1107 ----
NM_012117chr12184 ------
NM_012125chr153747 496 52 ------
NM_012129chr742181 724 386 374 1617 12028 --
NM_012137chr152735 2056 2022 596 135 12627 32658 2594 864 --
NM_012141chr1363478 3037 2938 2889 2754 1073 63907 3498 937 797 319 209 22740 1570 --
NM_012153chr114719 641 583 136 --32380 969 97 11020
NM_012154chr8--1311 1844 --
NM_012156chr2073408 3163 3116 2916 2552 2453 2331 11010 1474 --
NM_012158chr1331628 1491 350 11612 ----
NM_012164chr9107361 6926 6837 6309 4583 1936 1197 1157 972 792 32112 1877 596 37376 5181 844 37310 6336 1557
NM_012176chr5--1226 ----
NM_012180chr41151 3673 546 284 ----
NM_012193chr1174986 4521 3684 2038 1578 1421 676 34327 1135 1087 35392 3484 1910 --
NM_012197chr9--21207 231 --1356
NM_012199chr194482 4234 4013 3638 3305 3050 1763 1543 640 --21377 196 24437 3285
NM_012210chr951427 1052 1013 534 433 1203 ----
NM_012214chr2146440 6368 5008 4786 4748 4565 2128 1716 1370 1224 988 861 549 80 24058 2209 56005 5912 5347 3903 908 22268 303
NM_012218chr1933055 853 24 ----1320
NM_012223chr221310 1191 ------
NM_012224chr431056 344 177 --21156 405 --
NM_012228chr10--11121 ----
NM_012234chr333499 3015 1071 13718 ----
NM_012238chr1031406 1195 617 --1491 --
NM_012242chr101165 2745 734 --1262
NM_012247chr102869 267 ------
NM_012248chr164573 468 161 126 1596 ----
NM_012249chr283087 2559 2534 2497 2384 1289 588 425 12826 21279 930 1830
NM_012250chr11188 31136 385 228 --1432
NM_012252chr7145314 5132 4724 4708 4506 4213 3647 3546 3531 1622 1611 1112 697 285 33871 3354 664 15286 14991
NM_012255chr201136 ------
NM_012257chr741097 924 862 813 ------
NM_012259chr631433 1419 1296 ------
NM_012262chr164131 4053 3845 3692 1227 180 13499 24626 1424 14161
NM_012281chr771781 1769 1737 1511 982 969 179 12018 ----
NM_012286chrX1553 ----2652 89
NM_012287chr384094 2962 1402 1034 955 615 435 84 24493 854 32940 1683 271 11626
NM_012288chr6105536 5530 3883 3869 3772 3681 2042 1916 1471 1207 25268 1336 34465 3598 1022 --
NM_012290chr231388 1236 367 --31471 1318 427 21551 669
NM_012294chr793180 3017 2739 2558 1541 1153 784 775 579 11199 32478 1022 736 1476
NM_012295chr221269 --1416 --
NM_012297chr452513 2255 872 854 757 1491 1828 11031
NM_012300chr572295 1704 684 553 356 175 34 --11021 --
NM_012301chr742085 1935 1873 1429 12209 --1811
NM_012302chr141139 1024 840 120 1402 ----
NM_012304chr532531 2202 971 --11710 1450
NM_012307chr18185 ------
NM_012309chr11104587 4052 3882 1910 1679 1364 1110 909 701 210 21640 370 34523 1574 244 13554
NM_012311chr102629 563 ------
NM_012316chr1125615 4577 4275 4185 3872 3587 3479 1319 925 729 708 519 21926 1136 35450 4724 277 14596
NM_012322chr7----179 --
NM_012323chr2221332 97 ----11597
NM_012325chr2011636 11643 --11654
NM_012328chr751329 1210 934 551 254 2328 108 11388 1221
NM_012329chr172533 382 21407 236 11442 1314
NM_012330chr1021816 244 ----11556
NM_012334chr594511 4057 3588 3159 1489 1140 625 405 198 22895 1427 ----
NM_012343chr51851 31135 381 206 2738 722 --
NM_012347chr642977 805 630 614 --12995 --
NM_012382chr573781 3665 3614 3384 922 840 394 33997 2904 857 --24203 997
NM_012383chr9------1280
NM_012394chr1246 27 ------
NM_012399chr2231693 1344 792 1613 11901 --
NM_012408chr201295 2831 791 ----
NM_012416chr931117 877 853 --21081 442 --
NM_012420chr1062329 1992 1648 1505 294 27 21954 257 1552 --
NM_012425chr1052685 2663 2300 1999 882 --42724 719 217 133 2692 195
NM_012428chr152287 21 1350 ----
NM_012431chr763508 3202 2858 937 811 739 23134 2628 42820 2779 638 474 32656 1307 1036
NM_012433chr21252 ------
NM_012434chr641443 1147 615 441 11644 1412 --
NM_012443chr101572 2153 71 --1135
NM_012448chr1782295 2145 1882 1868 1684 1677 1654 491 12557 2998 915 --
NM_012463chr1221401 1301 1340 ----
NM_012464chr4--1599 22470 704 --
NM_012465chr10103443 3165 2854 2801 2540 2306 2174 1086 480 358 11283 --12874
NM_012475chr1--136 ----
NM_012479chr772695 2254 2149 669 600 413 50 12024 32666 555 274 12578
NM_012482chr13718 80 34 1639 ----
NM_013229chr123527 186 60 1486 --32657 1817 475
NM_013230chrY11621 3530 46 29 --11351
NM_013231chr1444329 3998 3382 184 1794 44292 3866 3625 3262 13820
NM_013233chr22430 377 1995 31281 957 211 --
NM_013246chr114933 864 705 227 ------
NM_013248chr203260 239 231 ------
NM_013249chr113209 166 28 151 ----
NM_013254chr123645 291 95 --1682 --
NM_013255chr7168676 8315 7984 7478 6617 6442 6338 6329 5449 2284 1894 1488 1005 928 698 497 45894 3475 1925 805 48125 7024 5702 528 27389 3272
NM_013257chr842186 1862 709 305 21906 957 ----
NM_013261chr433583 2729 116 23520 2742 42520 2439 1066 1030 --
NM_013262chr61511 11492 ----
NM_013269chr12104362 4355 4182 4041 3505 3186 1335 604 449 30 --33957 1357 641 14022
NM_013275chr162616 198 ------
NM_013279chr1142258 2252 586 579 --1907 --
NM_013281chr2021521 604 ----11010
NM_013282chr19----21124 367 21295 1012
NM_013283chr53868 615 97 1844 ----
NM_013286chr383701 3281 3055 1322 984 825 224 72 23270 1066 ----
NM_013302chr1664715 4634 4613 1659 1073 1017 --24621 3008 --
NM_013309chr1582637 2590 2196 2035 1821 909 672 161 11004 ----
NM_013313chr2273240 1366 859 680 472 150 102 43317 2692 2160 1106 1226 1835
NM_013316chr72853 179 --1903 1238
NM_013326chr18------170
NM_013341chr232243 2028 1792 --12713 11957
NM_013354chr831368 963 65 1454 ----
NM_013357chr83708 685 121 1289 ----
NM_013358chr151699 1467 686 487 27 21536 255 ----
NM_013372chr1562941 1349 981 395 251 211 13005 12825 12982
NM_013374chr352597 2462 2411 1118 306 --12673 --
NM_013377chr121110 ------
NM_013381chr1242443 1554 833 200 11898 12313 1219
NM_013386chr181804 1566 1348 1283 411 338 258 50 --11828 1425
NM_013390chr941674 659 489 355 11287 11502 11704
NM_013396chr2151279 1194 971 955 556 11144 ----
NM_013400chr751029 1003 950 934 855 ------
NM_013411chr132791 2375 341 22771 2306 22225 281 --
NM_013436chr21578 ------
NM_013437chr8--1924 11220 --
NM_013438chr9--161 31811 710 538 --
NM_013441chr12454 434 ------
NM_013444chrX2347 87 --1845 164
NM_013446chr731406 1374 1139 ------
NM_013447chr1942573 2387 963 622 1259 31110 703 459 --
NM_013448chr142730 642 ------
NM_013450chr22927 331 2499 35 ----
NM_013951chr251724 961 576 412 85 11535 ----
NM_013981chr5----146 --
NM_013982chr5----146 --
NM_013983chr5----146 --
NM_013986chr221230 ------
NM_013989chr1494052 3776 3732 3707 3653 3278 1127 1094 658 33990 3463 1971 34096 1962 141 11146
NM_013995chrX62582 2298 2257 874 106 23 22620 2192 1585 12249
NM_013996chr71484 ----1424
NM_013996chr71484 ----1424
NM_013997chr71484 ----1424
NM_013997chr71484 ----1424
NM_013998chr71484 ----1424
NM_013998chr71484 ----1424
NM_014000chr1021284 267 11666 ----
NM_014007chr941184 1150 838 145 ------
NM_014010chr92465 206 --1498 --
NM_014011chr262639 2294 1935 1756 698 400 22062 1623 22001 389 1609
NM_014016chr351092 612 590 183 62 ----31689 1284 583
NM_014021chr193436 3305 2900 2232 1253 1230 1120 699 527 --2648 91 13449
NM_014023chr1062277 2050 734 693 607 517 --12757 --
NM_014028chr633341 3080 2187 33273 3016 801 32710 509 177 11055
NM_014034chr61982 21340 1031 1199 --
NM_014039chr1131095 918 475 --21216 373 --
NM_014043chr311261 1307 --21050 636
NM_014044chr21188 ------
NM_014048chr16104862 4517 4474 4240 1811 878 797 373 363 191 34637 3337 56 14122 11287
NM_014071chr201214 ------
NM_014089chr1332131 619 373 --31935 859 65 11750
NM_014106chr1521201 32 22997 1882 22078 1033 12791
NM_014109chr82907 27 11059 199 --
NM_014110chr11291 --1848 --
NM_014112chr895421 4222 3950 3515 3466 1665 1552 1490 1341 13573 43667 3631 850 670 --
NM_014117chr1652248 1828 901 508 484 32049 2021 667 22531 552 --
NM_014141chr773479 1186 998 950 586 346 194 34748 992 318 --25237 1480
NM_014155chr11147511 6693 5996 5761 5637 5095 4869 2994 2952 2228 2183 2000 1222 869 46320 5312 4654 1835 45788 5746 1877 806 17430
NM_014157chr1631350 219 63 --11568 1650
NM_014171chr21726 1154 1578 130
NM_014181chr242948 2524 2197 1175 1675 ----
NM_014182chr121508 2633 104 ----
NM_014183chr20----1312 --
NM_014191chr121105 1390 2955 216 --
NM_014211chr571556 1426 708 673 456 407 165 11475 21596 1405 1376
NM_014212chr121893 --175 --
NM_014217chr13742 58 49 --21323 507 11691
NM_014231chr1241939 1846 751 742 --1581 --
NM_014233chr1741657 1429 667 623 11534 22047 1353 1129
NM_014240chr3103787 3608 2921 2877 1436 806 659 557 207 151 --1991 --
NM_014243chr452074 1434 379 153 93 11831 11958 1274
NM_014253chrX62372 2123 1927 338 332 78 22306 2045 1180 --
NM_014258chr203520 246 44 --1290 --
NM_014264chr41106 ------
NM_014268chr1821300 924 1458 21365 1147 --
NM_014271chrX--1715 1624 1113
NM_014278chr42446 385 ------
NM_014279chr91266 ----1736
NM_014280chr11667 ------
NM_014282chr92923 86 ------
NM_014283chr131570 1059 129 ----11079
NM_014288chr1----1225 --
NM_014289chrX3483 260 88 ----11155
NM_014294chr881383 1344 1149 1135 1085 444 373 48 21100 934 31018 465 275 --
NM_014300chr15--2446 332 ----
NM_014309chr2295384 5305 4568 3842 3600 1472 1235 822 197 1184 25181 4863 --
NM_014313chr131565 1163 1078 1356 --193
NM_014319chr1211982 11783 122 1121
NM_014323chr221173 --3703 395 285 --
NM_014325chr1221904 756 2895 306 ----
NM_014326chr1521244 1184 ------
NM_014331chr4136159 5169 5067 2628 2396 2048 1857 1458 1176 1044 611 541 300 36293 6006 2967 44849 2074 242 161 12429
NM_014333chr1132636 1885 581 --1776 --
NM_014335chr1531118 1104 1005 ------
NM_014342chr1131266 485 74 21173 1151 11494 --
NM_014350chr521174 1085 --1346 188
NM_014351chr2241407 1069 913 442 --11474 --
NM_014352chr113947 578 510 1425 --21397 968
NM_014363chr1341056 1050 486 319 1931 ----
NM_014365chr123351 244 235 --153 --
NM_014372chr151896 1840 1505 1495 699 ------
NM_014374chr751029 1003 950 934 855 ------
NM_014382chr341657 1531 1323 149 ------
NM_014394chr102301 25 2754 308 11200 --
NM_014397chr92317 223 11153 ----
NM_014409chr131157 1093 1075 ------
NM_014415chr331409 1221 466 11398 ----
NM_014423chr5154961 4918 4691 4672 4599 2215 1973 1553 1105 1028 781 513 470 177 26 24224 1438 55342 4452 2109 1984 959 --
NM_014432chr641467 1060 599 140 11137 1613 --
NM_014445chr342309 1721 1570 175 21963 566 --11925
NM_014447chr451650 522 197 153 130 --1425 147
NM_014452chr631093 1015 455 2923 344 ----
NM_014455chr1------1149
NM_014456chr1051545 698 662 586 242 ------
NM_014458chr131398 950 385 ------
NM_014469chr111333 ------
NM_014491chr73838 764 276 ------
NM_014494chr1661508 909 867 861 494 110 --11860 --
NM_014496chrX2296 254 1270 ----
NM_014506chr921663 638 ------
NM_014515chr12----1218 1327
NM_014520chr171446 1469 1103 --
NM_014521chr21220 21877 1754 --11442
NM_014547chr151191 ------
NM_014547chr151191 ------
NM_014548chr1551628 1601 1329 1203 389 1608 --11531
NM_014552chr261400 1328 411 342 291 47 --11433 --
NM_014553chr2113348 3010 2984 2691 2606 2115 1198 1145 665 611 253 31228 307 277 33046 958 623 --
NM_014554chr1261972 1753 1732 1697 1687 1504 --1902 --
NM_014562chr21802 ------
NM_014569chr751517 1384 1281 562 469 ------
NM_014570chr221236 11037 --145
NM_014574chr1421353 992 1505 1275 --
NM_014577chr222318 152 --1106 --
NM_014584chr1431505 294 212 ------
NM_014585chr241263 1211 1177 973 ------
NM_014587chr1621417 1362 11312 ----
NM_014588chr203583 219 146 1605 --1774
NM_014592chr54794 661 151 137 --1183 --
NM_014603chr171227 11718 31694 1384 389 --
NM_014606chr481525 1473 1148 1005 988 509 326 85 ------
NM_014607chr262141 1550 839 643 188 120 --1604 11768
NM_014608chr153426 159 94 ------
NM_014612chr921557 966 11011 2443 345 --
NM_014613chr522679 1228 13059 --1614
NM_014614chr231105 1039 78 ------
NM_014615chr1663542 3282 3052 2940 1314 836 ----13254
NM_014616chr3113430 3191 2900 2598 2321 2271 1068 878 840 815 628 33421 3020 88 12738 12401
NM_014630chr1583987 3452 3148 2801 2476 1473 1200 604 1204 21001 545 33665 1099 1045
NM_014633chr113401 123 30 ------
NM_014634chr2253059 2782 1384 812 453 ----1891
NM_014635chr241749 1628 280 211 1373 --31382 1236 519
NM_014636chr9114348 4084 3902 3301 2841 1612 1390 1337 593 326 262 13499 24181 3973 --
NM_014637chr821076 98 --21375 229 --
NM_014647chr1642076 1682 685 657 11753 --1852
NM_014653chr1242073 1706 1653 716 31549 1325 517 ----
NM_014655chr162089 2008 1669 1556 876 556 11826 11802 22334 2263
NM_014660chr72992 133 ----1767
NM_014667chr382385 2343 2289 1779 964 847 539 277 1806 --2752 690
NM_014670chr251578 626 332 269 147 ----1180
NM_014674chr363845 3047 2638 1511 1088 718 ----23989 374
NM_014676chr121676 1167 2634 370 --21660 1252
NM_014677chr851196 1184 916 893 119 31356 1331 1151 1847 --
NM_014682chr811856 ------
NM_014683chr1731607 1476 786 --11463 1476
NM_014685chr163466 226 210 1516 ----
NM_014686chr1942266 2096 2053 291 22374 172 12286 --
NM_014689chr2129 1153 --1522
NM_014690chr752311 1949 995 664 451 32416 964 182 1740 --
NM_014699chr16------1343
NM_014700chr1641567 1469 1323 360 ------
NM_014701chr15103438 3056 2584 2345 1204 1184 1126 382 329 22 22363 2270 33019 1215 189 33391 2939 414
NM_014702chr683357 3296 3184 2439 2180 1291 944 759 23434 1260 33205 1000 912 22969 586
NM_014705chr721429 88 11848 1570 --
NM_014707chr741437 148 134 62 3616 282 246 --21596 1459
NM_014711chr1651591 826 785 372 214 2447 350 ----
NM_014713chr21496 ----1549
NM_014715chr115828 770 673 322 210 1604 ----
NM_014717chr19----1775 --
NM_014720chr1031796 696 267 ----1513
NM_014721chr6125540 5298 4766 4562 2312 2145 2085 1870 1564 1451 1325 273 --45799 2345 2069 1533 26080 2051
NM_014727chr191250 ----1236
NM_014729chr842220 1962 279 174 ------
NM_014730chr12135062 4199 4183 4100 3658 3592 3438 1639 1456 1330 975 878 700 43683 1935 1405 320 21764 938 13472
NM_014730chr12135062 4199 4183 4100 3658 3592 3438 1639 1456 1330 975 878 700 43683 1935 1405 320 21764 938 13472
NM_014731chr2031765 1515 394 --31558 1281 122 --
NM_014732chr1685709 3688 2204 1854 1365 1023 919 869 25184 4069 14820 11502
NM_014733chr552097 1709 839 322 131 --22042 747 42057 1935 1598 419
NM_014736chr152844 283 1395 --1719
NM_014739chr674093 4001 2941 2666 821 725 694 13781 --22889 1559
NM_014746chr232704 289 239 21357 1306 12817 33780 3626 1289
NM_014747chr1105658 4334 3796 3785 3511 2033 1944 1476 701 442 25341 2187 45434 5356 4955 4398 14035
NM_014751chr821513 1485 22113 1623 12039 --
NM_014752chr1141828 1379 752 189 ----1661
NM_014754chr82939 225 2976 909 ----
NM_014755chr284152 3461 3369 2760 2661 1513 823 357 --23902 3252 1594
NM_014757chr542356 1710 954 271 1259 11579 1854
NM_014761chr161185 1932 11145 --
NM_014764chr1241232 404 276 268 --1394 --
NM_014766chr731174 1024 524 ----13813
NM_014767chr10103621 2378 2372 1475 1364 1269 955 455 433 49 1920 ----
NM_014772chr1842999 2638 2430 1393 22675 827 12715 12444
NM_014774chr152845 1176 1078 1007 87 11283 12472 1420
NM_014776chr1273111 2718 2484 2428 1127 84 32 22834 1156 41003 952 469 157 --
NM_014779chr331023 982 786 --3794 287 163 --
NM_014781chr821080 433 1246 21016 422 --
NM_014783chr1541192 1104 673 219 11643 21589 1348 2658 543
NM_014790chr5--127 ----
NM_014795chr21276 1334 ----
NM_014797chr673193 2962 2682 912 563 372 53 --12427 --
NM_014802chr1241044 406 348 49 --1162 --
NM_014810chr183675 3440 2652 2381 2319 780 660 303 1464 22947 2592 1436
NM_014812chr1----11379 11555
NM_014819chr542212 1728 1537 220 2431 58 22520 752 1148
NM_014820chr351836 787 684 606 546 21843 518 11300 11826
NM_014822chr43639 596 69 --1229 1426
NM_014824chr1131981 1745 200 ------
NM_014826chr183884 3792 3319 1477 1003 896 848 769 12726 11589 21617 1069
NM_014827chr141576 1517 364 94 5666 618 530 132 24 ----
NM_014828chr1422394 534 21869 800 12233 1675
NM_014829chr552096 2074 614 305 226 12266 --22383 1777
NM_014830chr121627 12846 21275 315 13659
NM_014832chr1341763 1677 1512 378 21353 674 ----
NM_014835chr202369 152 1484 22276 101 --
NM_014836chr1031980 1309 727 ------
NM_014838chr2222524 410 42837 821 704 510 22081 2001 --
NM_014839chr172066 2039 1696 1679 871 604 346 11909 12016 --
NM_014841chr631377 895 430 --11070 --
NM_014846chr8--1303 ----
NM_014847chr11380 ------
NM_014848chr1552464 2279 2162 1879 539 --22092 311 22453 2291
NM_014850chr3104805 4309 4291 4054 3928 3888 3717 3513 3299 334 ----13661
NM_014857chr1182 ------
NM_014859chr1731293 1184 95 ----11415
NM_014862chr1554140 3638 1332 1273 1069 44232 4009 3200 1308 12933 --
NM_014864chr174002 3341 2883 983 937 837 372 23289 2716 24362 3942 23630 803
NM_014870chr163374 3226 1737 1702 830 811 --14608 11646
NM_014872chr922211 2096 1488 12018 --
NM_014873chr1134578 4471 4155 3805 3394 1898 1794 1539 1533 1283 826 615 562 1546 13240 1404
NM_014874chr141783 1647 1173 286 --11856 --
NM_014877chr17147614 7513 6918 6319 5488 4942 2608 2479 2369 2208 1921 1867 1762 937 77200 6402 2968 2594 1157 556 503 57624 7584 6383 2909 2020 37125 2384 2224
NM_014887chr133721 701 278 ------
NM_014890chr33313 279 250 ------
NM_014893chrY21989 245 11904 ----
NM_014897chr1752279 2045 1178 881 553 ----22072 614
NM_014899chr573076 2779 2666 2565 2447 2149 1100 32178 1000 219 --1839
NM_014900chr231051 938 315 2851 235 ----
NM_014903chr1272397 2377 1845 942 840 598 379 11683 1204 1331
NM_014904chr1043559 2523 1490 1187 62800 2787 2627 1358 925 572 23219 1478 --
NM_014905chr261933 1914 1460 1268 662 77 11484 --11378
NM_014906chr17103953 3939 3887 3513 3069 2943 2514 1331 907 834 --21339 143 31533 1006 81
NM_014912chr1033080 3020 564 11056 33240 2623 2233 13363
NM_014917chr13975 870 350 1956 ----
NM_014918chr1541574 1153 655 133 ------
NM_014920chr682621 1487 1362 1239 753 695 657 360 2594 223 12336 12545
NM_014921chr1962888 2848 2804 2253 1950 159 ----1605
NM_014923chr1321745 467 12035 21626 285 21759 1508
NM_014924chr14102745 2192 1217 1003 929 650 388 231 158 62 --2519 459 13191
NM_014927chrX1104 145 ----
NM_014932chr321893 1486 1182 11578 11823
NM_014934chr1393543 3254 2961 2908 2759 1253 780 540 288 32554 1310 375 23642 149 11379
NM_014936chr652423 1850 721 482 418 11764 21775 378 1340
NM_014939chr1831336 1266 1226 ----2393 200
NM_014942chr642631 1836 927 465 1328 --11802
NM_014944chr131478 579 225 ----11233
NM_014945chr541487 361 334 57 11781 1185 --
NM_014946chr2113001 2936 2889 2796 2447 2433 2023 1075 633 433 279 43022 2254 2114 1039 2936 778 --
NM_014947chr152995 2959 2599 2246 2048 22307 726 1401 2770 704
NM_014949chr11674 ------
NM_014950chr1431365 1253 222 21470 416 158 1336
NM_014959chr1983445 2336 1426 1357 1223 1069 792 504 12317 ----
NM_014961chr461923 1766 1644 1394 810 89 21753 464 --42189 1691 657 292
NM_014962chr2072671 2614 2475 2078 978 937 132 32273 1873 312 12629 --
NM_014964chr17101829 1804 1750 1719 1713 978 870 798 248 145 1552 ----
NM_014969chr131013 997 979 11044 ----
NM_014978chr1021803 1227 ----11652
NM_014982chr14114717 4565 4507 4266 4100 3311 2083 1441 1416 1013 542 21767 310 41792 1112 950 355 31932 757 333
NM_014988chr462770 2589 2256 2240 444 39 12760 22529 505 12234
NM_014989chr661998 1719 1636 1333 608 241 1267 ----
NM_014990chr141938 11128 2847 468 --
NM_014991chr472706 2688 2680 2504 2437 2018 703 22778 2098 23214 2320 22199 452
NM_014992chr142809 704 148 --1879
NM_014996chr32813 423 --1366 --
NM_014997chr742583 1859 1141 1060 12047 22175 1054 --
NM_014999chr122652 200 --1581 --
NM_015000chr1262991 2865 2397 980 571 340 12686 32547 267 149 32915 2694 2486
NM_015002chr1272118 1621 1486 1458 714 696 427 --1587 12092
NM_015005chr1451764 1334 1099 325 46 1333 ----
NM_015008chr393400 2856 2728 2481 2409 1250 523 268 89 42820 2783 679 81 22297 823 --
NM_015009chr32648 251 ------
NM_015015chr1962050 1947 744 442 427 354 --1495 --
NM_015017chr1124 ----11322
NM_015020chr1663353 2867 2593 791 717 693 23686 1327 12825 32715 1418 421
NM_015025chr242605 2547 2033 1977 42712 1020 920 156 22754 2485 --
NM_015026chr12134577 4329 4257 4144 4001 3451 3256 2947 2936 1753 1647 940 211 1126 34604 4136 3962 44295 3727 1018 855
NM_015032chr1372858 2757 1034 787 608 427 26 1326 ----
NM_015035chr20156450 6145 5379 5023 4742 4707 4690 4422 4292 1406 1094 724 582 448 78 34719 1754 1368 16592 24521 426
NM_015039chr1103122 2768 1644 1527 1515 912 594 549 199 73 33407 373 295 33552 1508 1300 --
NM_015040chr293324 2810 2347 1183 1024 995 777 672 639 --12679 --
NM_015042chr1584289 4085 3971 3121 2782 1746 1336 566 24207 4076 ----
NM_015045chr10----1875 1863
NM_015051chr912184 52815 2757 2505 965 243 13123 13062
NM_015052chr72356 174 --1446 --
NM_015055chr1182990 2324 2214 2175 1846 896 822 203 --32907 1033 448 12268
NM_015059chr15103781 3214 2749 2555 1510 1379 1042 882 363 148 14013 ----
NM_015064chr1283373 3276 2817 1213 799 716 563 518 --11151 21448 613
NM_015068chr763950 3911 3764 1431 418 28 32706 2609 1320 --1127
NM_015069chr162262 117 ------
NM_015070chr131417 11398 1569 1149
NM_015071chr5156248 5899 5689 5059 4889 4506 4235 2154 1935 1890 1875 1118 1095 677 460 106464 6280 6118 5782 4843 1615 1509 1355 1253 733 21744 825 1577
NM_015074chr1134190 3954 3210 1927 1517 1185 916 894 476 458 391 308 142 44635 3060 3043 1457 --14382
NM_015076chr663663 3635 3485 3085 1372 168 13645 1242 24229 961
NM_015086chr1251133 984 603 356 105 --1624 --
NM_015091chr14------2829 65
NM_015092chr1654440 2984 1875 1624 120 13514 22947 2857 14327
NM_015093chr651888 1588 1347 701 662 --11220 127
NM_015094chr2264299 4137 4130 3519 553 154 11874 ----
NM_015097chr341958 1548 1511 669 1368 ----
NM_015100chr151850 1468 705 651 104 1684 --11403
NM_015101chr142799 2617 2137 1029 11965 --154
NM_015107chrX92374 2223 2212 2087 1559 522 410 306 264 ------
NM_015110chr982337 2298 1758 1566 873 362 345 233 2552 392 12388 2938 815
NM_015111chr584101 3936 3822 2817 2780 966 631 400 13094 13461 --
NM_015115chr463027 2579 2546 845 624 356 42849 2733 2155 2012 32461 2403 760 22319 2038
NM_015116chr1351504 1322 1076 513 419 ------
NM_015122chr19----1234 --
NM_015125chr19----1489 --
NM_015129chrX11816 ------
NM_015132chr731979 1492 684 21801 1579 1801 --
NM_015138chr1532028 1836 257 22489 121 ----
NM_015141chr352216 1854 908 390 244 22244 2072 ----
NM_015143chr41486 21304 923 ----
NM_015144chr1652794 555 529 478 226 --43517 2807 2670 765 11253
NM_015149chr1--12088 ----
NM_015151chr213732 336 309 ------
NM_015153chr61545 1722 --2796 100
NM_015155chr1033036 1158 1152 1322 12931 2416 352
NM_015156chr1484000 3878 3507 1623 1503 1369 394 98 23230 3198 11282 13381
NM_015157chr112242 56 ----1283
NM_015161chr1611192 --11347 --
NM_015162chr15125 ------
NM_015163chr1471914 1885 1715 1695 1519 224 143 --1692 --
NM_015170chr852135 1582 1542 783 227 12129 12061 --
NM_015172chr121323 1051 ----11658
NM_015176chr131620 1275 1195 11183 ----
NM_015180chr141257 1566 1757 --
NM_015184chr32249 40 --1193 --
NM_015185chrX52799 2750 1065 375 342 --12765 --
NM_015186chr92384 365 ------
NM_015191chr1121965 1064 22734 2639 11948 --
NM_015192chr2032636 618 446 --12574 --
NM_015197chr1453405 3330 3039 2952 570 ------
NM_015198chr711174 1230 --11075
NM_015199chr372910 2314 2153 1999 1889 945 298 22865 1930 22957 2043 --
NM_015200chr43389 179 124 1782 ----
NM_015202chr1621696 1678 11685 ----
NM_015206chr15113718 3000 2778 2444 1318 1222 841 506 384 209 121 11005 12715 11497
NM_015208chr1843914 2556 846 317 33656 2570 1346 33285 416 198 11213
NM_015209chr192189 2024 1835 897 761 646 605 249 152 11749 ----
NM_015215chr182936 2504 2436 2097 898 802 593 524 ------
NM_015225chr953040 2409 1003 557 327 52603 969 877 459 122 73135 2869 2857 2588 729 585 129 --
NM_015230chr431804 1786 55 11598 11653 21512 1278
NM_015231chr112980 939 ------
NM_015233chr1341046 519 495 141 --3802 599 454 --
NM_015234chr641145 1023 395 273 --11158 --
NM_015236chr42999 102 1116 1330 --
NM_015239chr91408 ------
NM_015245chr692549 2323 2087 1957 1909 722 562 349 330 194 --1964
NM_015247chr16155321 5186 4982 4782 4221 4131 3924 1892 1614 1607 1296 608 506 370 263 1201 45277 4311 1207 1163 24014 1874
NM_015250chr921834 189 ------
NM_015252chr23886 739 623 ------
NM_015256chr51161 --2571 147 1529
NM_015260chr1921586 1225 --11366 --
NM_015263chr152238 106 --177 11133
NM_015265chr242347 2092 426 269 11654 --164
NM_015267chr1222144 1368 1638 ----
NM_015268chr32667 125 ------
NM_015269chr12471 186 ------
NM_015271chr484305 4038 3936 3577 3385 1575 561 449 11225 24091 721 13719
NM_015272chr1661800 1774 1488 1461 588 180 ----1522
NM_015275chr1272151 2081 1583 1327 795 246 107 2669 146 11597 11607
NM_015277chr1841808 1401 1250 518 --1309 11792
NM_015278chr682964 2583 689 574 540 310 83 24 11223 1720 11087
NM_015282chr282616 2404 2008 999 964 889 830 324 22806 2727 1489 --
NM_015285chr1842322 1888 1824 587 1391 22181 1931 141
NM_015286chr154832 599 537 281 32270 615 460 11860 --
NM_015288chr553266 3165 1453 838 83 11187 13369 --
NM_015291chr153239 2701 2165 982 158 1461 --23218 877
NM_015296chr1351142 998 945 862 280 11106 ----
NM_015299chr1483962 3731 3698 2818 2528 1597 1080 91 --33935 3350 712 33985 2723 1558
NM_015305chr1431646 501 176 11844 ----
NM_015310chr8177773 7469 7403 7137 7087 6758 6469 6299 5891 5163 3190 2851 2464 1987 1839 864 129 66395 6073 6008 5149 2742 2408 37343 1765 1535 37600 2396 1092
NM_015313chr1193796 1781 1373 1264 1148 807 712 581 437 11586 23685 605 23725 3192
NM_015314chr742431 2092 1615 186 1906 11673 --
NM_015315chr553291 2772 1036 998 241 --1739 --
NM_015317chr232408 1003 667 --12073 12872
NM_015321chr1964389 3952 3033 1599 1348 930 ------
NM_015323chr621449 1325 21414 668 ----
NM_015326chr172306 2096 731 607 524 517 107 12571 1877 12876
NM_015328chr783072 2431 2189 2170 2124 2028 1191 508 23037 2945 21966 716 12784
NM_015335chr1231931 969 24 21986 1680 ----
NM_015336chr1242561 655 620 591 22341 2158 ----
NM_015339chr2031002 920 48 --2195 151 --
NM_015344chr852091 2016 1917 828 710 --22085 1997 --
NM_015345chr642258 2247 978 690 22230 1986 22462 1018 --
NM_015346chr1451737 1612 1403 241 101 31435 1318 381 11203 1194
NM_015347chr1272976 2771 1998 1960 1156 1123 1046 31924 936 467 21820 232 --
NM_015349chr632516 2293 1086 12763 1147 --
NM_015350chr11167 --2529 387 --
NM_015352chr20103821 3564 1395 1055 1026 938 392 352 299 27 11142 13052 12767
NM_015355chr1771867 1844 1605 1558 352 225 63 --21378 1326 --
NM_015358chr212999 118 --1375 --
NM_015361chr21677 --2721 231 1289
NM_015365chrX53850 1090 958 455 35 34304 3130 1603 43905 3542 2784 2618 12907
NM_015375chr174840 4228 3283 1045 803 398 330 --130 --
NM_015378chr132909 2675 2515 12893 22555 2149 12168
NM_015379chr7----147 --
NM_015382chr141131 137 2561 319 --
NM_015393chr473607 3317 2573 1159 695 495 40 ----22997 197
NM_015396chr32448 245 ------
NM_015397chr941742 1516 1405 300 --1276 --
NM_015401chr1251117 813 783 88 55 ------
NM_015415chr12218 173 ------
NM_015429chr33982 779 416 ------
NM_015435chr81470 1197 ----
NM_015436chr472966 2240 920 816 563 346 318 1486 52558 2387 2278 1033 463 --
NM_015446chr141676 1185 345 185 11622 1458 1638
NM_015447chr92591 155 ------
NM_015455chr563959 3717 3457 1479 683 607 13093 1856 --
NM_015457chr1111047 11055 --1146
NM_015458chr8105309 4325 4284 3848 3566 1906 963 612 419 315 34384 4356 3450 34588 1591 371 43891 1315 1289 525
NM_015460chr331970 322 204 --11709 --
NM_015464chr721021 712 ------
NM_015465chr52492 277 ------
NM_015475chr23854 258 220 ------
NM_015484chr14964 783 268 252 ----1872
NM_015485chr11130 ----1106
NM_015496chr81239 ------
NM_015497chr152991 254 1351 ----
NM_015507chrX2313 302 1171 ----
NM_015508chr32574 524 --1193 --
NM_015509chr1241224 638 544 310 --1347 11237
NM_015514chr143508 201 187 ------
NM_015520chr362531 1716 1064 975 742 431 --11799 12451
NM_015526chr1911493 --11240 --
NM_015532chr1552715 2550 2526 2440 2154 11738 2287 58 22265 1094
NM_015534chr12424 89 2789 171 1766 --
NM_015535chr2104227 4176 4083 3234 3051 2850 2842 340 159 146 --14217 13341
NM_015541chr33965 271 37 --11443 --
NM_015542chr1011111 1392 --2892 419
NM_015550chr763225 1117 1004 293 165 96 22381 1357 32451 2293 136 --
NM_015553chr6114685 3586 3394 3302 1973 1353 1338 1279 901 460 275 15024 11810 --
NM_015554chr1552883 2399 2293 1155 913 52275 2097 958 415 153 22382 2036 1506
NM_015555chr671747 1699 1383 1163 1119 588 233 --21826 344 175
NM_015557chr132515 2374 416 --13204 --
NM_015564chr593289 3115 2956 2899 2773 2600 626 615 320 13364 1646 --
NM_015565chr2191919 1522 1514 1444 728 677 592 245 121 21593 559 11806 1741
NM_015567chr1341209 1196 477 256 1172 --2896 826
NM_015569chr194670 4161 3109 3095 1486 927 847 786 315 34072 1604 609 54682 3905 3608 3599 3429 31944 1213 755
NM_015570chr711764 --11536 --
NM_015571chr651889 767 488 336 25 41736 1033 430 282 --32571 2556 2506
NM_015575chr263717 3289 2423 1430 896 92 13637 21098 166 1656
NM_015576chr372404 2389 2334 2110 1825 1146 476 --52281 2244 863 767 631 --
NM_015577chr531403 697 534 11518 21304 455 11170
NM_015578chr19136 21874 1745 12041 11927
NM_015602chr131542 1313 1204 11789 158 --
NM_015627chr141851 1778 1364 369 1617 2388 188 --
NM_015630chr2--1814 1299 1457
NM_015634chr10--1406 ----
NM_015635chr972200 1815 1428 742 709 561 138 --31442 275 56 --
NM_015640chr155022 4535 1509 1349 614 34726 1542 1034 15235 11181
NM_015641chr72292 56 --11197 --
NM_015646chr124324 168 128 25 ------
NM_015660chr72293 278 ------
NM_015675chr191622 ----1651
NM_015676chr143289 255 146 ------
NM_015677chr23467 148 47 ----3639 541 179
NM_015687chr64547 433 232 82 1522 ----
NM_015691chrX42455 631 420 388 --12909 31825 217 82
NM_015695chr662172 2033 1969 1857 1809 652 11638 32156 1892 605 11873
NM_015702chr21275 --199 --
NM_015713chr863589 3120 2774 1221 933 839 3859 138 94 --21318 345
NM_015723chr72576 527 ------
NM_015726chr141714 1368 1175 595 11630 1329 11198
NM_015833chr2172253 2197 1954 1841 1702 790 236 31595 937 732 ----
NM_015840chr152335 2100 1799 947 257 11846 12157 --
NM_015841chr152335 2100 1799 947 257 11846 12157 --
NM_015844chr181952 --1959 --
NM_015846chr181952 --1959 --
NM_015847chr181952 --1959 --
NM_015850chr822134 1642 22063 853 ----
NM_015852chr763462 2626 920 772 184 80 53530 3305 3061 2405 1419 13035 11356
NM_015866chr121285 1023 1978 ----
NM_015872chr11341 --1307 --
NM_015878chr842139 1780 663 21 --11544 --
NM_015879chr18187492 7061 6985 6507 6385 5731 5562 5454 5264 5223 2887 2538 2447 2374 1633 1354 696 482 37431 2155 416 48057 6140 6111 6104 26949 2194
NM_015885chr111768 ------
NM_015886chr8105644 5096 4871 4795 4142 2181 752 512 211 196 --45195 3717 1989 1377 15266
NM_015888chr183259 3252 2992 2731 2369 2236 2161 655 22284 168 1198 12102
NM_015891chr651862 1590 1420 581 220 --1564 22022 1984
NM_015902chr81746 ------
NM_015904chr22523 253 1617 ----
NM_015905chr72409 114 ------
NM_015906chr164837 4167 609 497 463 264 11719 34655 1101 281 24614 4183
NM_015912chr8102491 2342 2271 2236 2228 1973 1009 677 432 251 ----21690 543
NM_015913chr12784 554 1796 ----
NM_015927chr161355 ------
NM_015932chr132727 299 --1568 1239
NM_015933chr32185 61 ------
NM_015939chr202240 126 4645 251 64 22 ----
NM_015949chr721008 645 1683 ----
NM_015955chr21141 ------
NM_015960chr10391 79 65 ------
NM_015975chrX3724 551 150 1490 ----
NM_015984chr11416 --1136 --
NM_015986chr1731386 1211 384 177 2534 100 --
NM_015990chr411044 1379 ----
NM_015995chr1545243 4506 869 520 44914 4586 4301 891 12097 --
NM_015999chr12475 98 1655 ----
NM_016002chr12644 53 --1732 --
NM_016009chr1144842 4396 4248 4162 4105 3857 3758 3468 3167 1383 1072 962 900 291 44944 3940 1566 62 34225 1955 664 --
NM_016018chr832022 1833 452 ----32754 2356 2234
NM_016022chr131029 705 94 --1165 --
NM_016023chr862083 845 651 564 168 57 32050 1664 79 --1670
NM_016025chr1641722 1601 1478 224 1112 11694 11834
NM_016027chr84461 428 394 207 1126 1194 --
NM_016032chrX2215 124 --11341 --
NM_016038chr72419 110 126 1595 --
NM_016039chr14----1160 --
NM_016040chr162653 2484 1956 985 490 464 --32249 2017 760 22316 2259
NM_016057chr127956 918 884 874 830 441 258 11142 11004 --
NM_016072chr1262448 1897 973 635 432 109 12363 ----
NM_016076chr173039 2835 2648 2262 1166 607 35 12510 1700 12912
NM_016083chr6123638 3491 3260 3049 2956 2797 2532 867 860 790 623 564 --1851 23430 1204
NM_016090chr113835 799 119 --1941 --
NM_016094chr32735 271 ------
NM_016096chr872061 724 635 580 433 351 195 11489 31960 845 84 --
NM_016098chr61166 --1368 1155
NM_016100chr20--2387 34 ----
NM_016103chr51512 --1203 --
NM_016107chr531016 513 132 ------
NM_016120chrX------1342
NM_016121chr121001 398 ----11108
NM_016122chr12------1493
NM_016125chr172573 226 1492 1521 --
NM_016127chr82722 63 1511 --1282
NM_016129chr41341 ----1239
NM_016131chr252327 1628 1516 1475 909 189 22021 1486 12163
NM_016132chr1552733 2480 2340 511 458 --22318 2203 --
NM_016133chr231424 1133 464 11657 31623 542 494 --
NM_016141chr32811 621 1307 ----
NM_016152chr331249 945 361 ------
NM_016156chr1152194 2048 1744 1549 279 --22253 136 --
NM_016194chr1511267 2375 277 --1703
NM_016200chr73812 581 143 --1772 --
NM_016206chr3208563 8228 8073 7809 6773 6677 6542 6270 5717 5635 5583 3602 3528 2973 2864 2389 1969 1648 878 580 48619 3509 3440 3301 56876 6840 3492 1655 547 27704 3140
NM_016217chr663435 3057 2496 2341 551 266 43168 2972 1224 1105 198 1372
NM_016221chr532333 808 564 11468 31574 849 629 --
NM_016227chr131570 1059 129 ----11079
NM_016230chr61355 ------
NM_016231chr17------2443 331
NM_016235chr1651414 1391 1371 1294 1268 11422 ----
NM_016245chr42218 161 --193 --
NM_016248chr1383468 3020 2951 2915 2699 737 599 467 33501 3267 817 23283 1140 --
NM_016252chr23885 647 641 2768 706 1994 1787
NM_016255chr632948 2422 1048 2340 135 11156 11112
NM_016257chr152579 2545 2302 110 68 23007 805 11329 33278 3127 2209
NM_016260chr2146974 6441 6087 5804 5711 5670 5583 5390 4977 2984 1924 760 269 221 36550 2030 1753 36921 5172 2952 2925 682
NM_016261chr174777 575 122 70 ------
NM_016269chr41734 11000 ----
NM_016271chr1811481 2207 154 148 21943 590
NM_016272chr2262770 2638 1911 718 687 283 22394 1114 32555 2308 297 --
NM_016275chr352472 2035 1991 942 893 22701 1080 1491 --
NM_016281chr122972 350 11106 1861 --
NM_016284chr161670 ------
NM_016287chr13688 630 268 1137 152 --
NM_016289chr221736 619 1709 ----
NM_016302chr3276 48 --3539 530 147 --
NM_016303chrX3403 180 87 ------
NM_016307chr9----1292 --
NM_016308chr141615 1417 328 85 ------
NM_016312chr12----1110 --
NM_016315chr251862 1526 547 230 73 31636 653 519 11239 --
NM_016316chr21520 2744 465 129 --
NM_016320chr1121019 92 1251 ----
NM_016322chr913180 --1638 11302
NM_016338chr521122 955 11069 ----
NM_016351chr71117 2550 513 ----
NM_016356chr682810 2751 2627 2578 2478 2189 963 785 2346 164 1360 12092
NM_016357chr1221186 1047 3970 904 186 --1511
NM_016374chr121114 476 11601 11383 1573
NM_016374chr121114 476 11601 11383 1573
NM_016376chr1794138 3917 3893 2673 1657 1361 1194 882 443 11346 --11306
NM_016377chr651616 572 512 103 28 ------
NM_016395chr1521949 1438 --1534 --
NM_016396chr1592537 2308 1954 1935 1160 651 380 367 218 --11198 --
NM_016410chr91415 ------
NM_016418chr2263847 3798 2517 1368 995 60 --22451 279 --
NM_016422chr1153031 2804 2275 1058 533 31953 752 309 --1834
NM_016424chr1771997 1385 801 768 729 540 511 1430 32031 1969 1783 --
NM_016427chr181102 ------
NM_016433chr1221599 303 2392 194 ----
NM_016436chr2072485 2261 986 756 459 381 184 --12559 --
NM_016441chr232104 912 574 31842 419 57 --1638
NM_016442chr52777 666 1755 --12119
NM_016447chr71234 --1212 --
NM_016470chr20--129 1451 --
NM_016480chr52612 567 1342 ----
NM_016485chr631952 1829 1594 52267 1477 768 487 431 1210 --
NM_016486chr11360 ------
NM_016494chr22137 72 ------
NM_016499chr111519 1181 ----
NM_016507chr1742220 970 920 828 2988 460 170 22471 63
NM_016513chr682621 1487 1362 1239 753 695 657 360 2594 223 12336 12545
NM_016516chr22604 246 ----1650
NM_016519chr42394 211 --1366 --
NM_016530chr1583156 2971 2938 2886 1429 1162 805 580 23610 656 13915 23316 57
NM_016531chr4103872 3636 3630 3463 3302 3224 1672 1196 828 54 24158 2890 1175 1127
NM_016542chrX21725 314 1433 ----
NM_016547chr1--1735 ----
NM_016570chr12--1464 ----
NM_016577chr384107 4001 3399 758 655 583 129 123 24398 570 21715 521 11337
NM_016587chr71978 ----1286
NM_016596chr1251117 813 783 88 55 ------
NM_016603chr552265 1914 1440 864 484 ------
NM_016605chr521948 952 11809 11786 1592
NM_016607chrX31310 488 155 ----11486
NM_016613chr482295 2064 2008 1807 713 579 457 133 1761 22492 229 1826
NM_016618chr25573 451 400 230 114 --1107 2508 187
NM_016620chr111021 ----11473
NM_016621chr1174105 3759 3622 3179 1381 894 284 34237 4221 67 21012 984 21482 466
NM_016626chr1851688 1140 433 371 32 --11411 11533
NM_016628chr102669 630 ------
NM_016631chr212204 181 ------
NM_016644chr53497 73 37 ----1434
NM_016651chr142175 98 ------
NM_016654chr1551347 1286 901 477 144 ----1497
NM_016818chr212206 199 ------
NM_016824chr1041629 1212 465 123 1456 11197 --
NM_016836chr21593 ------
NM_016839chr21593 ------
NM_016931chr11--129 152 1353
NM_016948chr161119 ------
NM_016950chr441211 1126 435 364 1101 21351 38 --
NM_016952chr1132950 2846 1618 33580 3150 1011 23953 287 --
NM_016954chrX151 1639 1208 --
NM_017409chr122542 525 ------
NM_017412chr84926 904 413 228 ----11193
NM_017415chr5114572 4557 4437 3979 3692 576 552 392 339 272 131 23598 58 23590 350 --
NM_017420chr14103667 3194 2832 2631 1339 1058 948 934 294 100 41461 1312 1098 619 21515 571 43835 3314 1523 1382
NM_017423chr442081 2011 1779 435 --11706 --
NM_017426chr4--1232 --1657
NM_017437chr143566 258 66 --139 1278
NM_017440chr123415 102 51 ------
NM_017447chr2144215 3034 456 169 44175 3215 1698 1280 31631 710 633 11059
NM_017451chr1711057 ------
NM_017455chr152287 21 1350 ----
NM_017489chr821203 395 --21235 186 --
NM_017491chr43999 149 76 ------
NM_017495chr201219 --1184 11481
NM_017519chr621324 506 1352 ----
NM_017520chr131598 ------
NM_017522chr131246 207 87 11071 ----
NM_017545chr201535 ----1389
NM_017551chr1042495 2145 1785 365 --12541 --
NM_017563chr3125941 5806 5210 5138 4589 2181 1557 1530 1087 1076 598 50 22440 214 11867 35415 1095 196
NM_017569chr131105 ------
NM_017575chr1721528 1131 ------
NM_017580chr1042316 1753 1486 926 12101 1671 --
NM_017582chr121594 479 1156 ----
NM_017588chr941975 1904 446 213 ----1135
NM_017590chr2232581 1825 303 22542 473 1608 1855
NM_017593chr4--1506 ----
NM_017596chr194673 4495 4362 3267 2918 1799 1465 1021 324 11001 --33322 3300 2840
NM_017599chr1221918 823 --21691 271 1625
NM_017610chr1562023 1870 1526 781 406 203 1452 ----
NM_017617chr9--11541 ----
NM_017628chr465001 4909 4623 3607 1205 937 63545 3351 1370 1305 714 314 24424 3741 34970 4756 507
NM_017629chr151551 582 515 345 303 21408 77 11892 1280
NM_017632chr41361 ------
NM_017633chr653961 3736 3588 2800 2779 --23620 2568 23544 3011
NM_017634chr831422 1301 1243 ----1508
NM_017635chr1131444 1365 416 139 1358 --
NM_017637chr998817 8440 8212 6805 6017 5738 2609 2045 480 67520 5753 3160 1348 1333 274 25931 3612 --
NM_017640chr65854 771 279 124 97 ----1258
NM_017641chr123781 154 56 ------
NM_017643chr1782704 2282 2199 1974 1254 1237 840 296 --42525 1906 1247 1104 1802
NM_017644chr3114950 4916 3416 1971 1905 1856 1719 1168 1150 1120 782 11757 44497 4203 1407 1260 --
NM_017650chr764985 4149 2277 1491 999 116 45190 3918 1388 732 1264 15901
NM_017657chr23880 78 24 ------
NM_017658chr1484209 4161 3966 3652 2954 1583 1331 380 14514 13506 --
NM_017660chr1953075 2880 2473 2358 944 23428 3307 --11245
NM_017661chr151370 ------
NM_017664chr1341032 822 679 202 11058 ----
NM_017666chrX62006 901 816 732 563 258 --22247 805 --
NM_017667chr74577 492 372 364 ------
NM_017672chr1521121 528 ----11356
NM_017680chr941003 915 806 691 ------
NM_017686chr13856 283 122 --1349 --
NM_017693chr1361661 1264 1167 1025 653 452 --11331 --
NM_017694chr241909 1400 597 286 21633 121 ----
NM_017709chr163776 2926 2772 2732 1636 114 33867 2939 1539 14076 21701 823
NM_017714chr202331 314 --1686 --
NM_017719chr341633 1599 416 403 22202 619 ----
NM_017730chr32709 517 ------
NM_017737chr162198 1551 1466 699 494 259 --12118 11968
NM_017738chr931052 873 819 --1962 1138
NM_017742chr1831936 1629 112 ----1324
NM_017744chr152055 1600 911 566 333 --1788 12213
NM_017745chrX2217 118 ------
NM_017747chr52435 22 --198 --
NM_017752chrX12153 21734 678 --11538
NM_017753chr92921 197 1355 --11051
NM_017758chr17--1400 ----
NM_017768chr1154 1266 --1731
NM_017769chr14123140 2723 2567 2546 2363 2161 1208 1179 1123 952 853 507 12947 1377 32588 840 34
NM_017770chr662536 2488 2168 1164 649 421 2596 404 12195 12464
NM_017774chr61368 --4375 308 301 44 --
NM_017778chr841520 1165 457 172 21294 160 ----
NM_017779chr142755 2476 2213 1726 12601 42228 1809 915 412 1109
NM_017786chr82477 90 ------
NM_017787chr1052893 2019 963 955 388 12212 --2729 272
NM_017791chr1431651 1131 430 21166 1145 ----
NM_017798chr2061241 1135 818 778 172 28 11192 ----
NM_017799chr1421542 693 11378 --11980
NM_017811chr992996 2802 2745 2615 2339 676 296 226 177 1468 ----
NM_017812chr72728 291 ------
NM_017813chr895799 5457 4569 4345 1901 1175 529 452 208 --23564 789 15840
NM_017824chr1082497 2473 2359 2256 1984 1903 798 773 --1563 --
NM_017831chr18104349 4079 3633 3296 3080 983 652 636 453 162 24419 4221 23105 460 --
NM_017845chr42832 681 2569 321 ----
NM_017848chrX74299 3912 3792 3016 543 472 351 13295 12929 11248
NM_017851chr1531218 1126 1066 --1376 1802
NM_017856chrX41835 611 396 56 1370 41729 1650 390 341 --
NM_017866chr81720 1270 1335 --
NM_017869chr161592 --1631 --
NM_017870chr111226 ------
NM_017880chr22431 293 165 1325 --
NM_017890chr841379 444 410 223 1281 11509 31663 668 580
NM_017902chr10135574 5497 4607 4592 3989 3901 3892 1884 1605 1577 583 553 232 24430 736 55629 5205 4404 1794 826 --
NM_017905chr132574 115 --1630 1502
NM_017919chr9165325 5263 5031 3944 3615 2302 1852 1681 1467 1315 1125 1046 865 841 707 295 24591 3669 11825 24958 630
NM_017922chr14--1552 ----
NM_017925chr931538 781 536 ------
NM_017933chr221596 281 1145 21619 407 11222
NM_017938chrX21839 559 12075 1219 --
NM_017943chr14--3872 152 99 --2145 38
NM_017944chr1132239 2065 936 33107 2727 1935 22529 2116 --
NM_017946chr731303 474 467 --21083 156 160
NM_017958chr252000 1855 1153 859 721 1730 22971 1907 11980
NM_017964chr2--31006 205 98 1758 1237
NM_017969chr2234 28 ------
NM_017987chr1062189 1885 1647 1382 856 424 1367 --1559
NM_017988chr124789 167 133 67 ------
NM_017998chr9----31391 415 50 1525
NM_018000chr242203 1637 1546 701 --3479 316 148 --
NM_018003chr1531646 680 486 --12326 11949
NM_018004chr32109 25 ------
NM_018008chr31334 ----174
NM_018011chr134575 541 215 129 ------
NM_018014chr23971 906 354 --1440 --
NM_018015chrX11098 41025 319 116 49 ----
NM_018018chr1251619 1362 464 224 27 ------
NM_018024chr8--1587 ----
NM_018025chr192247 176 ------
NM_018028chr193199 124 114 ------
NM_018030chr182952 82 ------
NM_018032chr163900 872 48 ------
NM_018036chr1454155 3670 3324 752 325 34091 3129 2988 34062 3420 1362 21354 1265
NM_018043chr1121274 1049 1362 --11168
NM_018063chr102439 401 ------
NM_018078chr4--1201 31002 907 185 --
NM_018084chr223042 810 53136 2441 2421 1310 1065 22878 131 --
NM_018085chr1147916 7906 7252 6968 6812 6211 2927 2276 1705 1553 1283 900 880 522 45588 2788 836 387 13234 1235
NM_018086chr251663 1638 1404 424 139 ------
NM_018087chr11240 ------
NM_018092chr1661554 1436 1042 603 392 223 11387 --1420
NM_018094chrX1298 ------
NM_018098chr321130 1054 ------
NM_018105chr831259 238 55 --2858 27 --
NM_018110chr1641388 1040 996 471 1916 ----
NM_018112chr93987 964 73 --21002 870 --
NM_018117chr105715 709 698 264 130 ------
NM_018121chr1032609 1985 1233 12037 22839 2495 --
NM_018126chr411579 2580 322 ----
NM_018128chr1731496 432 89 ------
NM_018131chr101720 --1881 --
NM_018133chr351863 1761 1721 700 655 1671 12225 --
NM_018142chr81180 ------
NM_018150chr11678 ------
NM_018155chr363063 2697 2149 868 260 120 21234 312 1735 12407
NM_018156chr132909 2675 2515 12893 22555 2149 12168
NM_018157chr12103180 3044 2928 2765 2240 2155 2073 1295 959 51 42969 2547 1242 578 13253 178
NM_018159chrX41689 1292 633 541 ------
NM_018169chr12----1372 --
NM_018178chr131521 521 394 --41837 1804 1353 566 11768
NM_018181chr1821739 775 1726 21522 1220 21932 315
NM_018184chr31439 2258 66 ----
NM_018195chr1172062 2036 1367 1346 683 461 426 12076 21570 1383 1855
NM_018199chr141970 21229 981 1385 11108
NM_018200chr1532633 1603 932 12057 1747 --
NM_018201chr962103 1896 728 643 635 629 ------
NM_018211chr152181 1390 603 48 37 196 21746 1478 --
NM_018214chr621089 888 11015 ----
NM_018221chr22327 93 ------
NM_018222chr1141672 1361 1181 389 21460 673 ----
NM_018227chr492559 1981 1236 1042 855 771 449 417 284 1802 --12827
NM_018234chr222249 809 2832 462 1257 --
NM_018240chr14869 341 327 28 ------
NM_018241chr4----11040 1821
NM_018243chr4123651 3534 3373 3280 2685 1399 1314 916 804 787 77 61 ----13842
NM_018247chr642078 1059 321 242 21107 169 12027 1121
NM_018252chr13550 511 148 ------
NM_018254chr162124 952 677 331 218 95 1603 2811 439 1849
NM_018286chr174872 788 229 48 1949 1177 --
NM_018287chr1041301 1114 855 284 1253 1869 --
NM_018290chr461284 1167 1024 441 329 157 --1908 --
NM_018293chr332297 2066 148 11821 12049 --
NM_018299chr873497 2547 2236 1298 1093 1067 81 23228 489 --2733 569
NM_018307chr173605 309 63 --1320 --
NM_018312chr1152213 2105 512 491 148 1240 --11646
NM_018313chr332577 2425 1804 11925 ----
NM_018314chr111769 1715 --1498
NM_018315chr421258 302 11541 1444 1276
NM_018321chr5------1159
NM_018323chr431508 414 178 1297 21556 1246 1118
NM_018325chr931199 612 382 1454 ----
NM_018327chr201518 --11206 --
NM_018328chr23523 455 208 ------
NM_018330chr102428 74 --11632 11136
NM_018334chr7------1534
NM_018335chr142481 209 --1135 --
NM_018339chr951662 1500 596 515 37 1366 ----
NM_018351chr12104644 4358 4115 4096 3938 3871 3752 1386 1070 265 21641 251 --34407 3483 1610
NM_018361chr854025 3790 1437 702 456 1724 21128 614 --
NM_018362chr1143126 1304 950 440 22981 2517 23759 1571 --
NM_018364chr193576 2987 2842 1635 551 506 432 412 291 23621 2956 23422 1032 33744 2517 1446
NM_018370chr1252165 2114 1673 612 544 --31500 1474 225 2162 50
NM_018373chr14146492 6214 5498 5116 4555 4126 3946 1941 1836 1193 1012 831 163 89 22487 1125 1432 --
NM_018374chr7104981 4883 3736 3200 2057 1696 1677 1174 1150 119 34498 4400 1509 23467 1770 --
NM_018375chr1481919 1624 1536 1301 1294 1181 584 109 1713 --1660
NM_018383chr261947 1601 654 610 333 32 1677 ----
NM_018385chr341273 1175 270 183 1825 ----
NM_018387chr92508 454 ----1169
NM_018388chrX51494 1400 1276 1167 58 --1301 --
NM_018403chr393372 3072 2997 2861 2621 1447 1408 1235 1122 13851 --13576
NM_018413chr121286 ------
NM_018416chr123995 558 129 --21781 775 22040 909
NM_018424chr921925 1911 21218 505 1104 --
NM_018425chr1082240 1812 974 704 697 421 121 105 22480 376 ----
NM_018426chr6--1613 ----
NM_018427chr1631457 456 429 21397 1101 21207 325 11042
NM_018429chr552378 902 456 326 108 12882 1944 --
NM_018433chr22518 146 ------
NM_018440chr8208206 7950 7698 7584 7156 7102 6869 6856 6728 6550 6250 5941 3455 2220 1834 1636 883 750 431 414 16919 27661 1231 22367 2128
NM_018442chr12343 70 --1375 --
NM_018444chr871869 1783 639 440 237 126 102 --12176 11734
NM_018445chr153583 516 178 ------
NM_018448chr121831 ------
NM_018449chr9--1695 ----
NM_018452chr6_random62437 2340 1385 1155 1088 1011 43837 2610 2372 1483 13352 21207 724
NM_018464chr10--1103 ----
NM_018466chrX--124 1212 1579
NM_018469chr1711377 11214 1940 --
NM_018475chr42666 199 ------
NM_018482chr842571 2110 592 257 --22159 926 --
NM_018490chr1121898 391 ----11186
NM_018509chr1751723 534 489 327 287 ------
NM_018527chr131179 --1328 1434
NM_018557chr261694 1434 1357 1177 360 108 ----21520 1308
NM_018559chr13----173 156
NM_018561chr62627 219 ------
NM_018566chr165045 3544 1800 1386 424 317 65115 3504 1538 1345 802 532 34544 3282 742 23815 549
NM_018569chr43535 474 265 11362 --11039
NM_018571chr2170 --1253 --
NM_018584chr12984 976 --3899 874 828 --
NM_018590chr1041668 1488 1380 186 ------
NM_018602chr1541189 245 218 81 11708 1407 --
NM_018638chr12105706 4471 3847 1996 1684 1479 655 570 395 331 43613 1942 1542 134 1813 24495 4189
NM_018640chr122784 462 3883 739 660 12406 --
NM_018650chr121765 1691 21836 477 ----
NM_018652chr152947 87 --1205 --
NM_018657chr32526 52 1771 1556 --
NM_018667chr1682780 2696 1871 998 579 353 320 252 ------
NM_018682chr72663 200 1166 1514 --
NM_018683chr2021260 589 --21660 1314 --
NM_018685chr751048 784 754 167 95 1956 --11032
NM_018689chr1552669 2242 1665 1030 470 12551 12530 --
NM_018691chr53988 935 472 31180 403 259 1815 --
NM_018695chr532305 1814 569 12044 11981 --
NM_018698chrX71496 741 500 387 172 141 120 1182 21214 111 11404
NM_018703chr16--1331 ----
NM_018710chr82467 361 11376 11078 21175 73
NM_018712chr1141195 599 264 62 1469 1325 --
NM_018713chr111084 --1981 2348 252
NM_018718chr792224 2182 1870 1756 1661 1519 547 349 226 ------
NM_018719chr72935 909 ------
NM_018840chr20----1499 --
NM_018841chr183628 3407 2940 1465 1020 863 404 145 53596 3127 2849 889 138 --12974
NM_018846chr73805 727 690 2343 37 1864 1926
NM_018847chr941962 1708 1412 722 1350 --1549
NM_018890chr721252 1112 1199 --1925
NM_018898chr541848 1512 601 315 ----2942 567
NM_018899chr541848 1512 601 315 ----2942 567
NM_018900chr541848 1512 601 315 ----2942 567
NM_018901chr541848 1512 601 315 ----2942 567
NM_018902chr541848 1512 601 315 ----2942 567
NM_018903chr541848 1512 601 315 ----2942 567
NM_018904chr541848 1512 601 315 ----2942 567
NM_018905chr541848 1512 601 315 ----2942 567
NM_018906chr541848 1512 601 315 ----2942 567
NM_018907chr541848 1512 601 315 ----2942 567
NM_018908chr541848 1512 601 315 ----2942 567
NM_018909chr541848 1512 601 315 ----2942 567
NM_018910chr541848 1512 601 315 ----2942 567
NM_018911chr541848 1512 601 315 ----2942 567
NM_018912chr511746 ------
NM_018913chr511746 ------
NM_018914chr511746 ------
NM_018915chr511746 ------
NM_018916chr511746 ------
NM_018917chr511746 ------
NM_018918chr511746 ------
NM_018919chr511746 ------
NM_018920chr511746 ------
NM_018921chr511746 ------
NM_018922chr511746 ------
NM_018923chr511746 ------
NM_018924chr511746 ------
NM_018925chr511746 ------
NM_018926chr511746 ------
NM_018927chr511746 ------
NM_018928chr511746 ------
NM_018929chr511746 ------
NM_018931chr52666 320 --1821 --
NM_018934chr51148 ----1140
NM_018945chr633105 2886 1446 23583 973 --13728
NM_018947chr784243 4004 3822 3433 3296 1022 675 71 11520 --1718
NM_018948chr13569 508 119 ------
NM_018951chr711203 ------
NM_018958chr1554080 3431 2977 559 179 23867 2862 21426 250 13168
NM_018959chr191256 --1187 --
NM_018963chr2131423 1282 988 183 --1122
NM_018970chr751037 794 245 46 21 32808 532 425 12683 21028 626
NM_018976chr1252079 2000 1905 1782 778 ------
NM_018977chrX2922 720 2415 229 ----
NM_018979chr1252107 1613 791 573 505 12088 --11793
NM_018992chr1671596 1483 1414 1243 671 146 113 ------
NM_018993chr20--1551 ----
NM_018994chr11384 --1116 --
NM_018999chr10104607 4583 3945 3613 3259 3200 3165 3118 1763 687 34906 3993 3072 44791 4335 3824 1636 --
NM_019000chr531163 338 103 11059 1667 21601 1332
NM_019001chr3184776 4688 4401 4306 3661 3619 3297 3135 1565 1266 1190 933 792 739 553 544 315 191 31729 685 611 --13627
NM_019002chr22332 82 ------
NM_019004chr73938 521 288 2387 23 ----
NM_019005chr7144 1289 1260 --
NM_019010chr171259 --1402 --
NM_019022chr18113119 2497 2398 2201 2056 826 801 754 457 274 86 32508 2254 924 --23222 442
NM_019026chr14522 110 35 23 --1128 --
NM_019027chr451885 1059 1048 843 361 ----12620
NM_019028chr11------1343
NM_019030chr51171 2155 29 ----
NM_019035chr42513 506 1831 ----
NM_019036chr621240 86 --11164 --
NM_019042chr751243 1204 1195 1130 959 ----11159
NM_019045chrX4672 647 594 41 ------
NM_019049chr13754 735 531 ------
NM_019050chr442269 1842 895 609 11460 2868 537 1620
NM_019053chr1031090 974 331 ------
NM_019054chr101498 --1157 --
NM_019058chr10----1828 --
NM_019063chr221684 1475 1844 21960 632 21639 556
NM_019071chr71644 2580 63 ----
NM_019072chr573939 3469 2883 1525 883 361 334 23373 3272 33918 3748 552 1923
NM_019074chr151977 ------
NM_019080chr13175 --21531 182 1956
NM_019083chr11201 2109 86 11458 --
NM_019084chr101358 ----12380
NM_019087chr54381 272 223 139 1591 11575 11240
NM_019091chr24724 305 171 28 11104 ----
NM_019096chr651042 965 446 409 355 ------
NM_019098chr83717 242 136 1391 11787 --
NM_019106chr2273172 2357 1363 1310 1269 1256 724 11148 22541 802 --
NM_019113chr19135 ------
NM_019114chr992550 2236 2152 2054 1784 1030 427 199 80 1883 1480 31838 1800 727
NM_019116chr1653174 2762 2560 1343 1242 11288 13552 --
NM_019117chrX43199 2694 2352 1228 --23030 2763 --
NM_019555chr321550 1127 21307 690 1697 --
NM_019556chrX31243 1013 71 31505 1251 272 21033 303 1475
NM_019557chr12843 703 ------
NM_019590chr1031516 1379 480 1991 ----
NM_019592chr91702 ----1653
NM_019593chr2082732 2632 2625 2149 2094 1034 368 203 13018 13162 --
NM_019595chr23635 607 546 --1704 --
NM_019600chr152726 585 --1327 --
NM_019610chr142209 1665 744 334 1838 1457 --
NM_019842chr6136 180 ----
NM_019852chr14190 ------
NM_019857chrX31781 1675 1177 149 ----
NM_019859chr1041398 1292 1103 577 ------
NM_019860chr1041446 1340 1151 625 ------
NM_019862chr1621464 455 --21792 1515 --
NM_019891chr161318 1204 1067 514 485 349 1329 --11184
NM_019895chr331011 932 191 11057 ----
NM_019898chr1621464 455 --21792 1515 --
NM_019899chr1621464 455 --21792 1515 --
NM_019900chr1621464 455 --21792 1515 --
NM_019903chr1041629 1212 465 123 1456 11197 --
NM_020066chr15975 961 842 370 135 1753 ----
NM_020116chr421664 365 21137 263 ----
NM_020122chr254809 2315 1886 1640 224 11593 54246 1902 1391 678 300 25286 3877
NM_020123chr102413 100 ------
NM_020130chr851447 1201 1138 903 72 --11048 11035
NM_020135chr6------1339
NM_020141chr121907 1630 --21942 1924 1811
NM_020144chr761630 1609 1468 1403 811 127 1793 11996 11369
NM_020147chr1571085 926 862 202 135 48 23 1382 1739 --
NM_020148chr1852366 2205 702 431 295 --12851 --
NM_020150chr1081860 1586 1528 1522 818 418 132 38 --2569 77 --
NM_020156chr71103 2619 159 ----
NM_020157chr203937 864 817 1635 1334 --
NM_020159chr421144 332 --11686 11161
NM_020168chr1521218 220 --1259 --
NM_020177chr5103148 2745 2685 2378 801 574 530 437 410 323 11186 1753 33003 2283 237
NM_020178chr172987 457 ------
NM_020180chr183966 483 89 1311 ----
NM_020184chr22179 169 ----1264
NM_020186chr7153 1497 ----
NM_020193chr112343 266 21004 27 ----
NM_020194chr22620 80 --1552 --
NM_020198chr1721428 1094 31472 423 46 ----
NM_020204chr15810 282 192 101 58 1665 ----
NM_020225chr41