TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1304-3p
miRNA Sequence: UCUCACUGUAGCCUCGAACCCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr573782 3691 3427 861 800 545 205 ----23244 2833
NM_000208chr1994285 4157 4004 3565 3496 3268 1792 1596 1085 12931 23961 3118 13641
NM_000461chr364618 3724 3412 1358 974 733 --1697 11517
NM_000793chr1474349 3864 3487 3344 1294 1285 768 24996 1822 21051 1009 13406
NM_001001481chr863305 3243 2768 2110 808 469 1453 ----
NM_001002860chr1464509 3779 3296 1132 837 821 --23513 1058 11100
NM_001003652chr1897813 7330 7312 7241 7116 6689 6683 2436 2004 38235 7799 1411 1628 --
NM_001003940chr15113400 3216 3019 2877 2522 2488 2352 1399 1137 1088 329 21065 256 23253 940 13683
NM_001003942chr15113400 3216 3019 2877 2522 2488 2352 1399 1137 1088 329 21065 256 23253 940 13683
NM_001003943chr15113404 3220 3023 2881 2526 2492 2356 1403 1141 1092 333 21069 260 23257 944 13687
NM_001005473chr576636 6245 5256 4241 597 156 124 ----16154
NM_001007023chr1474349 3864 3487 3344 1294 1285 768 24996 1822 21051 1009 13406
NM_001010867chr1116190 4375 4314 4262 2081 2036 1861 1830 1816 1616 860 --24589 1752 26586 754
NM_001014797chr10118168 6983 6747 6690 6490 6015 5915 2199 1858 1565 1346 26670 5464 16575 --
NM_001018074chr573782 3691 3427 861 800 545 205 ----23244 2833
NM_001018075chr573782 3691 3427 861 800 545 205 ----23244 2833
NM_001018076chr573782 3691 3427 861 800 545 205 ----23244 2833
NM_001018077chr573782 3691 3427 861 800 545 205 ----23244 2833
NM_001020825chr531257 1166 902 ----1308
NM_001024094chr573782 3691 3427 861 800 545 205 ----23244 2833
NM_001024948chr182526 2396 2332 1087 776 377 364 355 11389 ----
NM_001030007chr1694023 3934 3427 3347 3280 3226 2905 1528 1024 23843 1366 23477 2660 --
NM_001037165chr7198457 7538 7451 7034 6886 6573 6550 6300 5728 5426 3416 3033 1932 1713 1707 1497 1265 1109 816 48731 6242 2004 27 28013 6436 11177
NM_001039547chr3117259 6613 6454 2668 2494 2426 2152 2108 2067 424 314 57861 7643 6119 5739 5439 57599 5703 2276 1761 1147 16536
NM_001040152chr744672 4260 1215 655 --24199 541 24858 995
NM_001040429chr1342791 2745 1310 127 13287 --13002
NM_001040441chr185456 5332 5108 4677 4105 2191 2072 1643 --35232 1167 1001 --
NM_001040665chr794170 3964 3932 1986 1834 1377 1233 1085 138 --13863 14415
NM_001042555chr1234257 1910 1373 11717 --23892 1392
NM_001100108chr198072 7782 6641 6062 5510 3023 2135 1034 210 28120 6314 36270 5635 2573 15677
NM_001106chr3159573 8156 8114 6569 6545 6203 6018 3756 3709 3527 3127 1268 919 538 34 11818 48397 8065 6677 3743 16622
NM_001128chr1694023 3934 3427 3347 3280 3226 2905 1528 1024 23843 1366 23477 2660 --
NM_001455chr684970 4211 3575 1021 268 254 104 26 11169 23840 1644 11040
NM_001918chr148224 6952 6783 2015 58876 8700 8622 2060 1583 48656 2579 1846 519 --
NM_002025chrX88415 7720 6751 6424 2416 2318 2075 950 32763 863 497 --12726
NM_002092chr484579 4205 3865 3832 3744 3396 3341 439 23648 3569 13606 --
NM_002310chr595989 5900 4972 1230 1013 893 841 550 187 ------
NM_002387chr564716 4227 3808 1749 1079 761 14405 11559 23922 330
NM_002581chr954246 4035 3835 1751 1035 43850 3702 3506 1013 14829 14338
NM_002709chr252561 2416 1229 675 629 ----11075
NM_003034chr1256787 6745 6298 1885 493 15174 12325 28077 6978
NM_004171chr11119155 8807 8398 8104 7689 7283 7223 6218 1991 1780 159 25933 1575 --13267
NM_004863chr1475202 5110 4669 3773 3299 882 867 34228 4000 796 14184 11741
NM_004866chr574785 4464 1374 1029 491 275 262 --14324 --
NM_004992chrX158008 7442 7347 6745 6679 6421 6144 5944 3339 2602 2387 2307 1134 729 530 1852 26519 3034 15222
NM_004992chrX158008 7442 7347 6745 6679 6421 6144 5944 3339 2602 2387 2307 1134 729 530 1852 26519 3034 15222
NM_005121chr1773663 2572 1314 1282 1053 951 87 ----12715
NM_005188chr11147813 7386 6927 6818 5286 2002 1982 1956 1451 1245 1217 1148 137 102 28053 756 139 16284
NM_005359chr18106308 5798 5763 4596 2134 2004 1381 1197 577 477 ------
NM_005746chr772789 2678 2130 966 960 714 411 11833 ----
NM_005840chrX97162 6787 6737 2872 1988 1773 1669 1490 1371 ----17253
NM_005901chr1897813 7330 7312 7241 7116 6689 6683 2436 2004 38235 7799 1411 1628 --
NM_005909chr574208 3397 1689 1633 1243 1057 726 43019 448 355 345 ----
NM_006203chr574698 4239 3797 3521 2047 1366 786 25283 1056 25062 536 --
NM_006544chr1495929 5464 5287 4983 4946 4667 4265 1949 843 15236 ----
NM_006599chr1697795 7711 7306 6178 5855 3237 2257 2012 223 --33313 2143 1168 --
NM_006620chr664151 3811 3750 3571 1237 37 23633 1664 11792 13504
NM_006654chr1234257 1910 1373 11717 --23892 1392
NM_007011chr1586282 5684 5134 4589 1605 1316 369 90 15650 26213 5605 15954
NM_007050chr20117992 7348 6492 5435 5205 4899 3169 3104 2994 1279 1076 37043 6361 363 16610 1718
NM_007249chr13128862 8160 7822 7576 7046 2801 2351 2274 2105 1307 948 221 23500 1671 12152 --
NM_012095chr1073341 2733 2602 2271 1183 308 193 182 13221 --
NM_012164chr9117186 5912 5155 2990 2789 1882 1760 1585 1504 1227 837 11835 1741 16793
NM_012218chr19112368 2217 1948 1215 1029 1023 961 928 864 454 367 ----1445
NM_012296chr1183871 2513 1176 1154 1114 1088 570 170 13061 31325 1103 1075 --
NM_012479chr772711 2638 2613 2440 2401 2193 1676 --11953 --
NM_013989chr1474349 3864 3487 3344 1294 1285 768 24996 1822 21051 1009 13406
NM_014423chr595384 5162 4602 3426 3410 2142 1832 1785 732 14147 --12206
NM_014683chr1772064 1820 1784 1662 721 337 133 ------
NM_014701chr1572992 2526 2438 1295 676 606 245 ----12480
NM_014747chr1145484 4778 4292 4206 3923 3762 2328 2250 2118 1894 1743 1561 732 147 --1848 25316 4522
NM_014877chr17117719 7251 6255 5958 5850 5657 4710 3084 2914 2058 914 15757 ----
NM_015068chr753524 3112 1422 1250 67 --13051 13710
NM_015074chr1144976 4226 3656 3380 3319 1981 1855 1508 1382 1084 949 743 621 84 --34065 1295 730 --
NM_015310chr898365 8193 7860 6337 5835 5611 5592 3272 1609 ------
NM_015375chr194480 3699 3212 1958 1753 1746 1198 355 165 64075 3391 3218 1240 1166 959 2915 547 --
NM_016206chr398277 7441 6845 5990 2449 2048 1634 969 168 11032 12714 --
NM_016248chr1343909 1613 368 87 13433 --13406
NM_018299chr863305 3243 2768 2110 808 469 1453 ----
NM_018364chr1103316 3044 2598 2589 2547 1582 631 544 438 216 ------
NM_018440chr8127588 7122 6147 5970 2533 2276 1971 1582 1505 1360 302 285 38094 6660 5379 ----
NM_022048chr15145779 5497 5112 4858 4831 2413 1873 1796 1292 1242 902 393 288 175 15198 14071 13908
NM_022340chr362673 2533 1235 872 122 52 21042 101 22888 997 11036
NM_022459chr1356022 1410 1226 1035 149 23928 2067 24498 2511 --
NM_024607chr883605 3086 2853 1173 1048 791 212 67 13645 11804 14139
NM_024761chr9115156 5075 4402 3529 1870 1572 1358 1157 952 797 131 --13692 --
NM_024770chr296644 6318 5419 5016 2349 1830 1470 1147 133 1911 35722 2138 867 --
NM_024947chr3109548 9377 7355 6195 5839 3745 2524 672 662 458 1571 27273 6425 --
NM_024989chr2106546 6320 5279 2232 1364 1331 1086 885 700 50 ------
NM_030648chr4124955 4580 4374 3736 3552 2195 2048 1750 1546 1534 1504 352 14177 12172 --
NM_032457chr443752 3546 1456 155 11040 1633 13476
NM_033224chr797597 7243 6640 6381 2579 2406 991 726 168 --35298 2432 83 --
NM_033503chr15113400 3216 3019 2877 2522 2488 2352 1399 1137 1088 329 21065 256 23253 940 13683
NM_052885chr1294862 4190 3993 3501 3466 1033 703 297 288 ------
NM_080491chr1183871 2513 1176 1154 1114 1088 570 170 13061 31325 1103 1075 --
NM_130847chr11115523 4596 4492 3994 3971 3875 3638 1791 1712 1107 817 32296 1835 1342 --24202 505
NM_133170chr20117992 7348 6492 5435 5205 4899 3169 3104 2994 1279 1076 37043 6361 363 16610 1718
NM_133334chr485998 5497 5008 4671 4309 1813 237 59 ----34813 1761 458
NM_138468chr265574 4948 4825 4571 2038 26 24646 3986 45146 3943 2409 1581 --
NM_138713chr1697795 7711 7306 6178 5855 3237 2257 2012 223 --33313 2143 1168 --
NM_138714chr1697795 7711 7306 6178 5855 3237 2257 2012 223 --33313 2143 1168 --
NM_138809chr532745 2613 270 2490 321 32519 840 443 22168 2067
NM_144571chr445941 1888 1835 1276 11745 1356 12798
NM_144599chr1595406 5233 4708 4557 3980 3460 2004 1006 426 11368 --14281
NM_145259chr246891 4556 1748 546 27069 2057 22083 1218 14817
NM_152756chr573565 3250 2920 1618 1099 1015 328 ----23540 3085
NM_152924chr1586282 5684 5134 4589 1605 1316 369 90 15650 26213 5605 15954
NM_152999chr794170 3964 3932 1986 1834 1377 1233 1085 138 --13863 14415
NM_173214chr1697795 7711 7306 6178 5855 3237 2257 2012 223 --33313 2143 1168 --
NM_173642chr198107 6994 6798 6708 6395 3014 2804 962 566 68857 8536 7950 6553 2615 587 22908 862 --
NM_173825chr342468 587 37 27 22515 1999 11955 1796
NM_175736chr1266092 5164 2913 2494 505 58 27380 2813 25813 1566 16928
NM_177538chr2108352 7814 7349 7170 7085 5844 2351 2311 1427 1212 37294 3181 2509 97974 6915 6733 5572 2912 2461 2073 1739 1023 --
NM_182515chr1985082 4497 4223 2628 2451 1769 1143 1100 36285 5517 493 34768 1017 66 --
NM_194283chr592825 2644 1160 924 856 713 527 182 90 14065 11285 --
NM_198900chr1266092 5164 2913 2494 505 58 27380 2813 25813 1566 16928
NM_199462chr194480 3699 3212 1958 1753 1746 1198 355 165 64075 3391 3218 1240 1166 959 2915 547 --
NM_201559chr684970 4211 3575 1021 268 254 104 26 11169 23840 1644 11040
NM_206876chr252561 2416 1229 675 629 ----11075
NM_206909chr898365 8193 7860 6337 5835 5611 5592 3272 1609 ------
NM_207012chr1073341 2733 2602 2271 1183 308 193 182 13221 --