TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1307-5p
miRNA Sequence: UCGACCGGACCUCGACCGGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001013622chr411126 --7451 390 328 266 204 143 81 --
NM_001396chr2142729 782 741 587 11836 ----
NM_004432chr931894 794 700 ------
NM_015575chr263354 2488 2432 1193 979 527 ------
NM_020673chr2056179 5898 5249 1449 1236 ------
NM_020796chr542738 1850 972 908 ------
NM_024554chr161166 1132 520 168 156 23 ------
NM_130436chr2142729 782 741 587 11836 ----
NM_130438chr2143306 1359 1318 1164 12413 ----