TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-130a-5p
miRNA Sequence: UUCACAUUGUGCUACUGUCUGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000092chr244162 3756 1754 1356 14386 13562 14440
NM_000216chrX73848 2968 1229 751 524 121 37 --22680 2577 --
NM_000332chr652813 1817 1559 1350 389 24707 2564 21312 1069 11332
NM_000633chr1864303 4159 4133 3430 3411 1071 --25272 3877 24418 3668
NM_000899chr1254091 3462 1208 864 854 22734 1301 14287 --
NM_001001664chr242916 2793 1527 1481 13802 23370 3136 23163 1282
NM_001001709chr921788 988 1693 --32632 2611 865
NM_001003712chr1253851 3445 925 764 245 22613 1631 12838 13609
NM_001005473chr565105 4488 1981 1932 1234 807 22354 2179 16534 16577
NM_001007094chr1034391 2847 655 1505 24060 403 2739 488
NM_001007466chr695104 4450 4378 4224 4046 3699 1880 1149 809 --43459 3231 1007 797 --
NM_001008401chr192341 93 --1510 2167 85
NM_001010891chr596154 5008 4643 2360 2092 672 541 419 340 167 24736 721 16816
NM_001013746chr752362 2067 1910 815 69 12058 6740 487 407 323 239 155 5885 732 563 231 62
NM_001014797chr1076805 6448 6185 2059 1126 491 189 46715 6530 5183 902 15244 16374
NM_001024948chr142833 1068 125 30 53389 3301 2910 254 207 23126 3037 11108
NM_001025076chr10106048 5967 5285 3901 2284 1696 1125 1023 931 210 --36131 5605 1044 1247
NM_001025077chr1097406 7325 6643 5259 2483 2381 2289 1568 381 11278 37489 6963 2402 11605
NM_001025580chrX74239 3594 3512 3369 3183 2739 421 1966 --12860
NM_001037339chr131734 1374 58 ----31615 1587 1567
NM_001037340chr131734 1374 58 ----31615 1587 1567
NM_001037341chr131734 1374 58 ----31615 1587 1567
NM_001037341chr131734 1374 58 ----31615 1587 1567
NM_001039618chr11105550 5421 4538 4512 4200 3826 552 504 372 189 --35143 742 157 24090 1065
NM_001040284chr1664406 4376 2224 2002 1797 1544 14576 11853 25625 5480
NM_001040429chr1383103 2709 2415 1300 1219 1069 999 976 12367 1338 13036
NM_001042355chr1684712 4462 3432 3325 1964 1153 1086 361 13804 33893 1689 1274 --
NM_001042412chr1684712 4462 3432 3325 1964 1153 1086 361 13804 33893 1689 1274 --
NM_001042599chr237422 6687 428 --26452 5129 37206 6863 1515
NM_001042603chr1264949 4585 4069 1071 337 245 45292 3841 3650 1514 --14629
NM_001042604chr321801 1613 11093 14466 21736 455
NM_001106chr3159379 9196 8946 8189 8054 7010 6351 6253 5976 3393 3204 2923 2159 1384 559 39718 9694 6561 39086 2287 2123 --
NM_001167chrX75907 5483 5473 2574 1383 272 53 46610 5884 426 62 1763 34654 1024 382
NM_002033chr1124068 2799 1873 33829 3352 2894 22852 788
NM_002214chr765030 856 575 409 198 161 --11656 15085
NM_002264chr363903 3815 3621 1745 1507 639 --44970 1828 692 304 14709
NM_002270chr535655 5431 4761 35671 2057 268 11218 21700 1170
NM_002397chr52770 43 ----31952 1556 598
NM_002600chr131734 1374 58 ----31615 1587 1567
NM_002709chr283039 2822 2284 1414 821 303 168 65 11129 32494 813 349 --
NM_003034chr12107932 7853 7838 6000 5673 2988 2517 1579 1250 57 12423 37134 6164 1653 21470 663
NM_003298chr386039 4639 4093 2044 1243 1019 667 440 21547 1505 36196 5407 1033 --
NM_003421chr1034391 2847 655 1505 24060 403 2739 488
NM_003423chr1932430 1670 1041 11032 2124 40 2207 116
NM_003430chr1921501 556 11195 4638 473 305 221 3630 465 297
NM_003441chr42843 356 1435 71175 1092 1009 929 527 366 29 3921 189 104
NM_003574chr1875481 5472 5232 3832 1407 880 862 22136 1168 35308 4667 4025 15542
NM_003615chr343170 2790 104 49 43336 3191 2806 268 --12812
NM_003663chr353401 1347 222 125 103 --12403 23215 39
NM_003966chr5107834 7676 6221 3061 1632 1522 1378 1054 706 303 26100 229 35842 2521 461 --
NM_003994chr1254091 3462 1208 864 854 22734 1301 14287 --
NM_004170chr91479 ----21648 736
NM_004171chr1148255 3450 2559 354 27602 7476 19209 39679 9551 318
NM_004232chr1853898 3553 1088 457 242 1224 11187 32510 1219 262
NM_004293chr943652 3212 2955 602 22641 1317 --33539 3482 331
NM_004694chr173805 770 129 1137 --1691
NM_004726chrX65796 5535 3925 1432 1072 480 25752 4623 24559 4117 24225 3788
NM_004745chr8106560 5919 4983 4575 4555 2776 2487 1624 888 365 --26415 1040 12178
NM_004796chr1462305 2027 1986 1809 803 567 ----21515 1504
NM_005056chr1275193 4829 4313 1315 581 489 21 45536 4085 3894 1758 157 14873
NM_005160chr2265419 1593 992 862 779 442 16383 36257 5729 1513 14316
NM_005197chr1496018 5180 5061 4821 4367 4037 3979 1797 1728 35231 3761 1960 --15667
NM_005204chr102893 138 1171 3958 721 116 1668
NM_005235chr237422 6687 428 --26452 5129 37206 6863 1515
NM_005359chr18116233 5716 5206 4343 4332 1669 1623 1049 472 464 127 25069 2438 --16252
NM_005433chr1822420 249 12239 --22525 2058
NM_005504chr1235782 4672 129 36505 4359 2591 16122 16402
NM_005578chr344948 4092 3362 337 --11196 23691 1984
NM_005759chr263984 3376 3190 1614 1034 708 3799 785 759 --1652
NM_005840chrX127020 6181 2876 2867 2693 2466 1966 1956 1532 1424 823 811 46155 5638 4874 425 --16113
NM_005955chr184946 4728 3762 3517 2121 1118 1095 402 45331 3704 3361 278 15052 25418 5295
NM_006148chr1732799 1171 1094 12808 21109 1103 22509 2093
NM_006524chr71733 --61063 902 818 398 146 62 8971 810 726 390 306 231 138 54
NM_006561chr10106048 5967 5285 3901 2284 1696 1125 1023 931 210 --36131 5605 1044 1247
NM_006750chr16108048 7800 7296 5047 3006 2991 2782 2667 2226 855 17716 22544 1544 12453
NM_006827chr1472919 2456 2128 702 550 404 316 11204 12986 12805
NM_006924chr1763471 3065 1297 876 802 777 1283 23360 729 24475 1476
NM_007038chr2176062 5387 1931 1590 1332 803 167 24701 1616 34943 2095 1172 --
NM_007106chr133625 411 24 --2766 589 22817 1924
NM_007172chr221449 1934 42133 2107 767 141 23336 2385
NM_012081chr5103354 2933 2526 1299 1282 1043 786 748 668 390 22772 27 ----
NM_012382chr574176 3842 3286 3247 3035 552 376 1515 11075 14022
NM_013255chr778767 8420 6699 6190 2766 1215 1184 17052 38479 7639 1233 11910
NM_013261chr473747 3535 3392 1312 1036 374 292 12575 13510 23557 3200
NM_014423chr565494 4636 3681 1999 701 662 --11256 1192
NM_014721chr686863 6530 6522 2696 1170 1005 128 93 1532 1833 15837
NM_014810chr133078 1039 936 12509 32285 152 38 23322 1440
NM_014988chr472675 2427 2178 1055 1044 949 302 --12599 11915
NM_015247chr1684712 4462 3432 3325 1964 1153 1086 361 13804 33893 1689 1274 --
NM_015336chr1232162 571 509 11003 --22192 242
NM_015365chrX74239 3594 3512 3369 3183 2739 421 1966 --12860
NM_015553chr6115205 4906 4839 4297 3724 1853 1615 577 546 285 266 11002 14926 34970 3220 830
NM_015569chr174251 4240 4139 3378 3057 1790 632 --13225 14834
NM_015693chr4------2291 219
NM_015852chr773574 3161 2555 2342 2270 1320 739 12546 163580 1241 1160 1076 992 908 824 656 647 572 488 404 236 152 143 68 131233 1152 1068 900 816 732 564 480 396 321 312 228 60
NM_015879chr1896558 5633 5524 3269 2113 1812 1598 1044 603 17773 28395 3338 18570
NM_016083chr662445 1565 1088 1071 549 449 12982 --21078 358
NM_016206chr358322 8064 7305 3320 2119 25874 5667 16987 26882 6387
NM_016220chr752362 2067 1910 815 69 12058 6740 487 407 323 239 155 5885 732 563 231 62
NM_016260chr297419 7377 7248 6755 6491 1799 1548 1074 446 --37319 1388 894 26411 4647
NM_016530chr1544019 2687 2617 388 ----23986 3781
NM_016531chr463792 2911 2676 1124 664 457 23610 2858 23784 1567 23057 217
NM_016577chr384255 4204 3243 3206 1229 953 936 339 23931 3785 23940 3755 14501
NM_017637chr9149170 8074 7847 7316 6081 3548 3297 3037 2961 2714 1189 846 329 72 11195 27730 3756 15970
NM_017761chr111346 11068 --21534 450
NM_018155chr343362 3276 1238 1173 13293 --2618 185
NM_018184chr362060 1827 1770 1420 1369 489 31952 1915 536 11727 11709
NM_018257chr2072304 2212 2006 1953 1647 601 455 --12292 32615 414 50
NM_018293chr332214 365 169 12816 1948 2855 44
NM_018362chr1153223 2729 1587 1564 1224 11058 23077 2939 13688
NM_018440chr8108179 7716 7669 7267 5896 3182 1716 993 955 199 26025 2970 12486 17450
NM_018566chr165059 1866 1300 632 186 170 13743 --41473 1458 461 354
NM_018638chr1264094 3993 3800 1885 217 202 1286 --35192 1814 1173
NM_019001chr321801 1613 11093 14466 21736 455
NM_019050chr421857 1699 12254 --21484 886
NM_020133chr656246 4881 4380 2131 234 --12386 26381 263
NM_020245chr695010 4356 4284 4130 3952 3605 1786 1055 715 --43365 3137 913 703 --
NM_020718chr1676444 2027 1829 1230 1092 639 133 11573 25599 4637 15639
NM_020772chr1797816 6879 6444 6332 3190 3151 1942 947 337 --27043 5714 37086 1222 301
NM_020783chr1852362 886 765 686 165 --2347 310 22177 2031
NM_020841chr1253851 3445 925 764 245 22613 1631 12838 13609
NM_020853chr1232679 2456 774 --12433 32783 2711 260
NM_020858chr1552370 2099 791 253 26 --22149 1567 31842 1539 381
NM_020917chr1943606 3112 1495 67 12923 43520 3177 1320 1183 1832
NM_020921chr1433087 3055 976 --13612 32850 2676 251
NM_021914chr1452438 1697 983 709 290 21759 901 --1303
NM_022459chr1375507 4869 4821 1630 1545 1323 1077 33845 1647 1151 --11340
NM_022781chr992501 2473 2024 526 468 446 273 203 137 --12900 12864
NM_024646chr142626 1028 705 134 21509 152 1843 2493 477
NM_024676chr141267 1254 921 913 --21314 906 --
NM_031431chr1351624 741 585 311 93 1618 --21864 261
NM_031954chr1282828 2712 2134 1133 975 559 359 309 12177 --22753 299
NM_032012chr985316 4596 4456 4157 4103 3630 3404 468 --11393 15268
NM_032505chr382730 2626 2353 2159 1699 865 524 363 ----11047
NM_032810chr1051549 1352 1010 357 330 11150 --11139
NM_033181chr662445 1565 1088 1071 549 449 12982 --21078 358
NM_033656chr2122373 893 --23719 134 25151 4642
NM_052851chr1341561 75 68 56 1543 12111 --
NM_138638chr1452438 1697 983 709 290 21759 901 --1303
NM_138970chr1462305 2027 1986 1809 803 567 ----21515 1504
NM_144571chr456759 6004 5795 4331 1015 24390 1500 42532 2233 1464 794 26803 4261
NM_144578chr1485049 4831 4452 4377 2206 989 763 218 2551 328 24687 1315 21930 1087
NM_144973chr1274031 3844 3431 1991 1576 695 217 35078 4991 804 14765 13901
NM_145259chr247146 5496 4483 2009 32225 2198 65 15258 16737
NM_152261chr1232442 412 348 ----21621 302
NM_152605chr191222 --51015 881 474 139 55 1199
NM_152624chr596528 5253 2221 2200 2135 1573 1300 578 261 16803 36746 2839 1615 --
NM_153188chr535655 5431 4761 35671 2057 268 11218 21700 1170
NM_153456chr1366122 5847 4595 2024 1475 1275 36311 5610 2463 2811 533 23954 3944
NM_153616chr1552370 2099 791 253 26 --22149 1567 31842 1539 381
NM_153617chr1552370 2099 791 253 26 --22149 1567 31842 1539 381
NM_153618chr1552370 2099 791 253 26 --22149 1567 31842 1539 381
NM_153619chr1563608 3337 2505 2449 1264 1250 --23387 2805 23080 2777
NM_153645chr221449 1934 42133 2107 767 141 23336 2385
NM_153689chr21151 12053 2179 141 12330
NM_153810chr1021236 630 --11082 44780 4037 1992 1888
NM_170710chr422874 782 --11290 22576 1266
NM_173511chr293271 1373 1358 783 689 521 382 121 97 --12896 12633
NM_173642chr189212 7233 5931 5852 1966 1755 432 425 12164 48310 5909 396 82 15796
NM_173829chr596206 6143 5908 5490 5234 4274 4159 792 168 --46045 5715 4520 945 25082 1508
NM_175624chr1267645 6358 6232 5371 2609 378 21997 1314 46725 2040 2016 1664 11600
NM_175625chr1267645 6358 6232 5371 2609 378 21997 1314 46725 2040 2016 1664 11600
NM_175910chr1912355 1211 12968 886 807 723 639 555 546 471 303 219 135 51 6960 799 715 631 463 127
NM_178006chr1341561 75 68 56 1543 12111 --
NM_178007chr1341561 75 68 56 1543 12111 --
NM_181265chr422874 782 --11290 22576 1266
NM_181358chr1103797 3608 3165 3072 2797 1585 1376 1369 1336 1020 11461 1733 --
NM_181869chr1221945 38 ----22258 330
NM_182493chr1665315 5223 5048 1975 1780 423 34015 470 220 15237 35116 4667 904
NM_182515chr1976191 5987 5803 5390 5087 4938 185 32275 1659 594 1602 1259
NM_183376chr1542426 2190 1871 233 --1145 22264 705
NM_194282chr431956 1939 654 ----23114 2923
NM_194328chr992501 2473 2024 526 468 446 273 203 137 --12900 12864
NM_194329chr992501 2473 2024 526 468 446 273 203 137 --12900 12864
NM_194330chr992501 2473 2024 526 468 446 273 203 137 --12900 12864
NM_194332chr992501 2473 2024 526 468 446 273 203 137 --12900 12864
NM_194434chr1875481 5472 5232 3832 1407 880 862 22136 1168 35308 4667 4025 15542
NM_198268chr1103797 3608 3165 3072 2797 1585 1376 1369 1336 1020 11461 1733 --
NM_198269chr1103797 3608 3165 3072 2797 1585 1376 1369 1336 1020 11461 1733 --
NM_198715chr196239 5987 5784 5448 5305 4600 4552 260 248 14196 --11700
NM_199072chr733024 2306 354 1181 11087 22739 2624
NM_203282chr19--11324 --3238 166 157
NM_206876chr283039 2822 2284 1414 821 303 168 65 11129 32494 813 349 --