TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-130b-3p
miRNA Sequence: CAGUGCAAUGAUGAAAGGGCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr52219 199 ------
NM_000037chr82964 820 ------
NM_000038chr521961 235 ------
NM_000051chr1163484 3327 2570 2523 935 707 --22300 488 --
NM_000052chrX22116 41 ------
NM_000068chr1911561 ------
NM_000070chr151501 ------
NM_000081chr121450 1252 1226 ----
NM_000084chrX35427 1089 1042 --15160 1150
NM_000088chr171215 --1152 --
NM_000089chr72759 312 ------
NM_000090chr21696 --1736 --
NM_000091chr222131 871 32852 2484 1917 12441 --
NM_000093chr922393 908 --12162 --
NM_000096chr35863 678 286 217 137 ------
NM_000108chr7--1204 ----
NM_000109chrX52596 2374 572 521 282 --12128 --
NM_000111chr72382 90 ------
NM_000125chr653815 3674 889 326 44 14054 44223 3956 3772 999 --
NM_000129chr621448 545 ------
NM_000135chr1611009 ----180
NM_000138chr1552539 2081 1954 941 455 12120 11768 --
NM_000141chr1011067 11322 ----
NM_000142chr421429 376 ------
NM_000161chr14177 ------
NM_000163chr52839 601 1766 ----
NM_000165chr651650 1585 1556 662 626 --1502 11385
NM_000168chr743234 2660 1314 561 ------
NM_000176chr533876 2592 596 ------
NM_000183chr2--170 1144 --
NM_000188chr103738 293 228 --2590 82 --
NM_000189chr21864 11943 ----
NM_000194chrX2164 109 --1141 1186
NM_000208chr1931849 1511 1010 --23898 3143 --
NM_000210chr21365 1547 32023 1720 491 12041
NM_000214chr2011219 ------
NM_000216chrX74086 3701 3631 3169 3118 827 30 12790 11016 --
NM_000217chr1264844 3649 3269 1495 998 783 --33686 983 153 --
NM_000219chr2172510 2486 2425 2046 860 763 271 ------
NM_000222chr421327 87 --11655 --
NM_000237chr821785 1753 11610 ----
NM_000240chrX32293 1477 102 --11502 --
NM_000245chr721652 1566 --11842 1107
NM_000248chr372848 2334 2096 1049 927 216 22 --11086 --
NM_000259chr1585885 5645 5029 4833 2546 2237 1668 1283 25301 413 --25873 609
NM_000264chr973244 2097 1289 1258 645 458 298 ------
NM_000267chr1743471 3355 359 101 11224 11190 1981
NM_000276chrX31846 569 561 --2454 418 12122
NM_000280chr111144 ------
NM_000282chr132196 49 --1210 --
NM_000284chrX41859 711 160 149 1172 ----
NM_000291chrX3239 187 148 ------
NM_000297chr421973 136 --21845 1679 --
NM_000298chr13262 237 38 ------
NM_000301chr61216 ------
NM_000304chr171820 11116 11077 --
NM_000314chr1053156 2544 1227 1153 656 12967 22259 418 --
NM_000319chr1221230 946 ------
NM_000332chr6126811 6465 6444 6043 6008 5146 4942 4645 1535 682 381 62 --36929 4634 901 16936
NM_000337chr554726 2591 1802 1422 1184 12622 12262 --
NM_000345chr41784 ------
NM_000346chr172596 457 --12024 --
NM_000358chr52403 175 ------
NM_000361chr2031757 1689 432 12085 ----
NM_000362chr2243601 3149 1015 780 ------
NM_000368chr9131 --44885 3954 594 429 14460
NM_000378chr1131244 787 366 ------
NM_000389chr621455 1308 --11152 --
NM_000390chrX42748 2447 2144 297 --12287 11033
NM_000396chr12234 66 --1530 --
NM_000399chr101462 ------
NM_000408chr273145 2894 2752 2381 1138 256 176 ------
NM_000430chr1763780 2797 2699 2476 1073 46 1907 23465 2874 --
NM_000435chr193978 802 661 ------
NM_000439chr51653 1303 ----
NM_000441chr772300 2009 1887 807 466 411 60 ------
NM_000444chrX3112 59 38 ------
NM_000448chr1152959 2629 2545 579 543 12022 23055 57 12764
NM_000449chr12574 468 --170 --
NM_000451chrX31825 823 73 ------
NM_000459chr91832 --1899 --
NM_000461chr344079 3995 3039 2884 13869 23774 186 --
NM_000462chr15--11232 --11337
NM_000474chr72632 265 ------
NM_000480chr1141177 1058 576 21 --1144 --
NM_000484chr212799 247 ------
NM_000486chr1253081 2488 2322 1025 532 ------
NM_000489chrX32743 1087 1012 --1449 --
NM_000492chr711009 11500 ----
NM_000503chr841903 1239 655 370 21403 1396 11775 11297
NM_000508chr41894 --1132 --
NM_000509chr41176 ------
NM_000516chr20166 ------
NM_000522chr72487 436 11077 ----
NM_000527chr1942346 1848 839 544 --42167 1976 877 819 --
NM_000538chr1321292 136 --1159 --
NM_000555chrX36913 6727 1785 27470 2326 36664 5649 2517 11206
NM_000560chr1--1691 ----
NM_000572chr12856 110 ------
NM_000578chr231752 1418 1263 ------
NM_000596chr7------1202
NM_000597chr21308 ------
NM_000599chr234640 1435 666 --34493 3870 3825 11044
NM_000609chr1083155 3127 2987 2609 2193 2130 881 128 --1251 --
NM_000610chr1132784 1034 681 1470 ----
NM_000615chr1122886 223 --23004 1954 --
NM_000618chr1276051 5916 4080 1617 624 603 184 12123 1425 1340
NM_000618chr1276051 5916 4080 1617 624 603 184 12123 1425 1340
NM_000627chr2284 39 ------
NM_000641chr1921581 389 ------
NM_000681chr1031305 1266 867 ------
NM_000684chr103985 943 149 ------
NM_000686chrX2394 192 --1527 --
NM_000693chr1531581 618 410 ------
NM_000701chr1173 ------
NM_000702chr132231 1995 887 --11860 --
NM_000719chr12116507 5833 5356 5263 5066 1946 1884 1810 1080 1064 379 --36667 1544 1377 --
NM_000722chr7----1284 --
NM_000724chr104551 454 421 233 1539 ----
NM_000739chr72667 182 --196 --
NM_000756chr8132 ------
NM_000767chr1911488 21178 368 ----
NM_000800chr5--21237 95 11519 --
NM_000806chr521397 38 1592 ----
NM_000810chr151117 ------
NM_000813chr585442 5238 5081 4202 3647 3472 1343 54 14761 11903 --
NM_000814chr1523851 1014 ------
NM_000816chr51184 ------
NM_000817chr23933 821 197 ------
NM_000824chr41954 --1107 --
NM_000826chr452412 2010 1885 1855 418 12536 21948 1760 --
NM_000827chr532600 328 244 ------
NM_000828chrX62163 2118 2062 1942 1442 579 11596 ----
NM_000829chr1132219 1511 934 --22064 784 --
NM_000833chr1641056 482 307 148 11369 ----
NM_000838chr642433 2182 2071 338 --1671 --
NM_000844chr31349 --1403 --
NM_000855chr111351 ------
NM_000859chr551680 1541 1508 1072 87 ------
NM_000861chr352390 1979 1738 791 689 22328 848 ----
NM_000868chrX32053 1960 1903 --1142 --
NM_000872chr1051459 567 437 264 113 ------
NM_000875chr1556744 6567 4859 4278 1189 --15662 26497 1377
NM_000876chr621011 305 --11076 --
NM_000877chr243079 1082 1023 474 --13111 12961
NM_000883chr71657 ----1100
NM_000883chr71657 ----1100
NM_000885chr2----1849 --
NM_000891chr1783660 3246 2821 1077 1046 848 740 491 --13640 --
NM_000899chr1274422 4316 4200 3011 1648 336 229 11759 ----
NM_000901chr432404 2006 405 ----11758
NM_000902chr331174 628 101 ------
NM_000905chr71170 ------
NM_000912chr843518 2701 2594 503 --13495 --
NM_000917chr101201 --135 --
NM_000919chr5--1103 ----
NM_000924chr1231223 945 192 ------
NM_000933chr20--2404 377 1171 --
NM_000944chr472052 1913 1476 846 627 411 327 --11937 --
NM_000945chr241816 1624 1581 1564 --1807 --
NM_000950chrX42923 1360 1319 457 --13241 --
NM_000956chr143927 345 251 --11080 --
NM_000958chr531313 1050 448 ------
NM_000962chr932104 571 550 --1369 --
NM_000965chr351218 1198 396 333 277 ------
NM_001001132chr212310 187 --11386 --
NM_001001323chr1242825 2181 413 319 1879 12916 --
NM_001001331chr382535 2505 2376 1766 910 565 488 335 --12603 --
NM_001001344chrX32168 1803 449 --2971 726 --
NM_001001349chr1721712 454 11215 ----
NM_001001389chr1132784 1034 681 1470 ----
NM_001001390chr1132784 1034 681 1470 ----
NM_001001391chr1132784 1034 681 1470 ----
NM_001001392chr1132830 1080 727 1516 ----
NM_001001395chr1212005 --1381 --
NM_001001396chr154482 4315 4131 3769 1149 --24278 3235 --
NM_001001419chr575212 5045 3608 1540 1189 537 416 1835 24819 852 --
NM_001001420chr575212 5045 3608 1540 1189 537 416 1835 24819 852 --
NM_001001433chr2043180 2487 2316 134 --1716 --
NM_001001481chr883268 2623 2556 852 594 526 151 135 --12434 --
NM_001001484chr1032399 1724 1631 1317 ----
NM_001001549chr722822 2580 --21785 402 --
NM_001001550chr722822 2580 --21785 402 --
NM_001001555chr722822 2580 --21785 402 --
NM_001001557chr851986 1938 1830 1630 675 ------
NM_001001664chr242905 2705 1412 843 11245 34107 3890 142 1304
NM_001001668chr1913872 13169 13351 --
NM_001001706chr61238 ------
NM_001001740chr1----126 --
NM_001001740chr1----126 --
NM_001001852chr222942 756 ------
NM_001001872chr142585 481 --1155 1579
NM_001001890chr2154257 4127 3490 1650 825 --1531 --
NM_001001974chr1042271 2007 564 126 ------
NM_001001995chrX11566 11910 ----
NM_001002026chr332453 1535 959 ------
NM_001002033chr171120 --2805 301 --
NM_001002243chr22757 733 --1378 --
NM_001002255chr6160 ------
NM_001002257chr273061 2213 1432 1395 744 83 76 13419 1138 --
NM_001002258chr231872 1836 203 --1164 --
NM_001002259chr12----1249 --
NM_001002295chr102324 280 --163 --
NM_001002838chrX21869 1852 --11480 --
NM_001002843chr151426 ------
NM_001002860chr14104620 4502 4314 3454 3384 1814 1070 430 421 196 13464 2391 299 --
NM_001003652chr1898339 8036 3097 2256 1902 1771 1510 392 370 27680 5519 1807 22557 1130
NM_001003674chr1885950 5286 4903 2590 2029 939 790 162 14633 11448 1586
NM_001003675chr1885950 5286 4903 2590 2029 939 790 162 14633 11448 1586
NM_001003681chr2221950 1751 --12122 --
NM_001003688chr4144 ----11100
NM_001003712chr1232699 2500 299 22525 1032 13650 --
NM_001003760chr643669 2866 2697 2250 12849 22393 801 --
NM_001003792chr32102 82 1862 ----
NM_001003793chr32102 82 1862 ----
NM_001003800chr941473 993 390 145 13506 2826 484 --
NM_001003845chr21405 ------
NM_001003891chr221331 1873 ----
NM_001003937chr221582 1443 1211 ----
NM_001004023chr1--1208 ----
NM_001004065chr943084 2497 2420 1502 --13320 1473
NM_001004106chr52260 70 ------
NM_001004308chrX--165 11478 --
NM_001004317chr644013 3787 3543 3277 ------
NM_001004329chr1221460 77 --31138 1002 361 11253
NM_001004346chr431209 398 162 ------
NM_001004360chr221497 353 ----1256
NM_001004439chr1521087 831 --1117 --
NM_001004720chr221052 269 --1946 --
NM_001004722chr231221 438 58 --11115 --
NM_001005242chr1221583 1409 11250 --1330
NM_001005271chr1721148 1024 ------
NM_001005273chr1721148 1024 ------
NM_001005335chr192291 243 ------
NM_001005354chr12----175 1445
NM_001005360chr191810 --1230 --
NM_001005361chr191810 --1230 --
NM_001005362chr191810 --1230 --
NM_001005366chr124926 840 309 41 --2688 654 --
NM_001005375chrY21856 577 --2526 377 --
NM_001005386chr222104 483 12037 ----
NM_001005404chr1784474 4443 3432 3366 3041 1262 537 449 --13246 --
NM_001005417chr13680 673 580 ------
NM_001005463chr1032370 826 413 --1793 12097
NM_001005474chr331116 552 198 ------
NM_001005476chr21624 ------
NM_001005526chr2--1120 ----
NM_001005609chrX32850 1530 365 11248 --1320
NM_001005732chr21--1607 ----
NM_001005733chr21--1564 ----
NM_001005739chr22590 355 ------
NM_001005751chr102152 135 ------
NM_001005781chr22406 388 --1243 --
NM_001005782chr22855 837 --2692 270 --
NM_001005849chr173479 401 157 --1195 --
NM_001005861chr32860 616 ------
NM_001005914chr3--1405 ----
NM_001005920chr161770 ------
NM_001006117chrY3274 77 30 ------
NM_001006600chr532285 818 125 --41779 1746 1534 693 --
NM_001006610chr161160 ------
NM_001006617chr941238 1185 592 410 11161 ----
NM_001006618chr9--1219 ----
NM_001006619chr941238 1185 592 410 11161 ----
NM_001006620chr941238 1185 592 410 11161 ----
NM_001006621chr941238 1185 592 410 11161 ----
NM_001006626chr72667 182 --196 --
NM_001006627chr72667 182 --196 --
NM_001006628chr72667 182 --196 --
NM_001006629chr72667 182 --196 --
NM_001006630chr72667 182 --196 --
NM_001006631chr72667 182 --196 --
NM_001006632chr72667 182 --196 --
NM_001006635chr21246 ------
NM_001006636chr21899 --2704 371 --
NM_001006639chrX1219 --172 --
NM_001006640chrX1219 --172 --
NM_001006641chr921451 1190 --11627 --
NM_001006642chr921451 1190 --11627 --
NM_001006643chr921451 1190 --11627 --
NM_001006657chr242981 2906 2066 136 --12333 1942
NM_001006684chrX2433 206 ------
NM_001007024chr1754375 4289 4157 3293 506 11493 14346 --
NM_001007025chr1754375 4289 4157 3293 506 11493 14346 --
NM_001007075chr431101 265 95 ----1717
NM_001007097chr945076 4276 4029 1503 1157 1318 1958
NM_001007099chr12788 206 1220 ----
NM_001007100chr12788 206 1220 ----
NM_001007102chr661632 1567 1328 1284 1222 624 --21646 1506 --
NM_001007189chr5123 ------
NM_001007214chr11408 2507 497 1249 --
NM_001007226chr172972 127 --11096 --
NM_001007227chr172972 127 --11096 --
NM_001007228chr172972 127 --11096 --
NM_001007229chr172972 127 --11096 --
NM_001007230chr172972 127 --11096 --
NM_001007237chr142539 479 345 200 --12622 12854
NM_001007246chr2121307 125 1180 ----
NM_001007257chr131516 422 49 ------
NM_001007466chr654894 4547 4013 3994 1959 34727 1088 464 35092 4710 1690 --
NM_001007553chr12358 269 --1427 --
NM_001007559chr1822042 1301 --11790 --
NM_001007565chr3--1353 ----
NM_001007595chr151285 --1226 --
NM_001008222chrX2871 139 ------
NM_001008225chr73686 64 44 1551 2597 589 --
NM_001008239chr1873561 3309 2952 2860 1263 489 28 --12385 --
NM_001008388chr421032 420 1114 ----
NM_001008392chr343341 2945 215 33 22924 2242 ----
NM_001008405chr73364 198 90 --11456 --
NM_001008408chr756340 5050 4590 535 490 --1409 --
NM_001008495chr82242 131 --12275 --
NM_001008529chr1721291 1041 ------
NM_001008540chr2190 ------
NM_001008541chr1022176 676 ----12131
NM_001008541chr1022176 676 ----12131
NM_001008564chr1371956 1908 1897 1763 1503 751 87 --22144 2091 --
NM_001008566chr222137 52 ------
NM_001008660chr1121395 1155 1432 11273 --
NM_001008701chr1923012 511 12296 ----
NM_001008723chr101412 ------
NM_001008738chr541793 1108 870 70 --12104 --
NM_001008860chr151342 1275 1755 --
NM_001008892chr151342 1275 1755 --
NM_001008894chr151342 1275 1755 --
NM_001008895chr131388 ------
NM_001008938chr111158 ----1477
NM_001009552chr82588 573 ------
NM_001009554chr464769 3688 3467 1893 1670 359 --14535 --
NM_001009554chr464769 3688 3467 1893 1670 359 --14535 --
NM_001009555chr41308 ----179
NM_001009567chr103652 639 500 --1108 --
NM_001009571chr731686 1291 1228 --1491 --
NM_001009899chr376403 5229 5076 817 770 305 213 --46554 6546 913 764 --
NM_001009960chr741920 1911 716 87 --12833 --
NM_001009993chr264392 3753 3270 1441 413 78 13417 ----
NM_001010000chr18----13527 --
NM_001010844chr6----125 --
NM_001010854chr141521 ------
NM_001010861chr142560 2278 2163 29 --1978 --
NM_001010888chrX84526 3962 3005 1817 1748 1214 972 874 14674 33637 293 96 --
NM_001010891chr586728 6350 5793 5012 1521 797 344 186 ------
NM_001010895chr952083 1380 726 386 162 --11968 --
NM_001010908chr10----1509 --
NM_001010917chr101611 171 ----
NM_001010924chr1031206 365 131 11173 ----
NM_001010927chr6----1538 --
NM_001010942chr124505 313 293 161 11081 --11270
NM_001010989chr16--1416 ----
NM_001010990chr16--1416 ----
NM_001011515chr421002 878 --11055 --
NM_001011516chr421002 878 --11055 --
NM_001011537chr342303 2223 1469 820 11975 ----
NM_001011553chr75933 805 289 194 89 --1956 --
NM_001011658chrX22118 1577 ------
NM_001011666chr746557 6449 4831 693 22499 1058 14681 14482
NM_001011708chr262534 2528 2394 2077 1863 1807 ------
NM_001011713chr1431089 67 51 --1155 --
NM_001011885chr151366 --11731 --
NM_001012337chr3194 --148 --
NM_001012398chr16129 1183 1296 --
NM_001012410chr3147 ------
NM_001012420chr1532012 772 315 2720 492 22061 794 --
NM_001012423chr1532012 772 315 2720 492 22061 794 --
NM_001012506chr31153 ------
NM_001012507chr6137 ------
NM_001012514chr21975 --193 --
NM_001012516chr21975 --193 --
NM_001012642chr1532053 1935 1607 1664 12091 --
NM_001012751chr1061519 1404 1245 625 318 230 ----1656
NM_001012755chrX74827 4265 1730 1626 821 565 124 --25054 4171 --
NM_001012761chr522395 147 ------
NM_001012968chrX1175 12755 42731 2388 861 556 --
NM_001012977chrX1933 --1944 --
NM_001012980chrX1233 ------
NM_001012989chrX----169 --
NM_001013031chr1063507 3417 3388 1173 980 541 13488 --12711
NM_001013406chr73448 436 322 --11118 --
NM_001013415chr41522 ------
NM_001013437chr181119 ------
NM_001013438chr31212 ------
NM_001013439chr3158 ------
NM_001013690chr1252441 2210 1785 391 205 ------
NM_001013699chr121511 --2103 97 --
NM_001013703chr152350 69 ------
NM_001013843chr153762 745 658 ------
NM_001014797chr10138211 8200 7938 7224 6334 5905 5442 3181 2416 1441 1301 1209 695 --37836 5084 2137 --
NM_001014809chr42866 345 ----1603
NM_001014812chr151444 ------
NM_001015045chr431824 801 490 11005 ----
NM_001015508chr8----1491 --
NM_001015877chrX53095 2825 2211 1168 904 12979 ----
NM_001015887chr311227 --11838 11355
NM_001015892chr5----151 --
NM_001017369chr4----11090 --
NM_001017371chr231352 1052 192 ------
NM_001017395chr333512 3192 2582 1332 ----
NM_001017405chr41901 --1178 --
NM_001017415chr1--1210 ----
NM_001017416chr1--1210 ----
NM_001017440chr767508 6341 5493 4982 2768 2572 --35254 1432 166 16682
NM_001017523chr1241847 1720 1485 751 ------
NM_001017922chr121724 137 11561 ----
NM_001017923chr1421568 1469 1464 ----
NM_001017926chr811146 21497 528 ----
NM_001017930chrX31301 1189 198 1959 ----
NM_001017962chr101201 --135 --
NM_001017969chr92489 456 1519 ----
NM_001017977chr11359 ------
NM_001017999chr13808 454 114 --1745 --
NM_001017999chr13808 454 114 --1745 --
NM_001018000chr13808 454 114 --1745 --
NM_001018000chr13808 454 114 --1745 --
NM_001018001chr13808 454 114 --1745 --
NM_001018005chr152151 70 ------
NM_001018053chr141897 1645 694 368 11514 ----
NM_001018056chr92508 145 ------
NM_001018057chr1121268 151 1514 11327 1974
NM_001018064chr951941 1559 1485 1349 162 1334 ----
NM_001018065chr954061 2351 1553 1496 1382 14315 46013 5901 5752 714 --
NM_001018066chr954061 2351 1553 1496 1382 14315 46013 5901 5752 714 --
NM_001018067chr184619 4211 1698 682 447 300 259 60 24698 2032 --15173
NM_001018068chr184619 4211 1698 682 447 300 259 60 24698 2032 --15173
NM_001018069chr184619 4211 1698 682 447 300 259 60 24698 2032 --15173
NM_001018072chr1241847 1720 1485 751 ------
NM_001018074chr533876 2592 596 ------
NM_001018075chr533876 2592 596 ------
NM_001018076chr533876 2592 596 ------
NM_001018077chr533876 2592 596 ------
NM_001018090chr151470 ------
NM_001018091chr151580 ------
NM_001018102chr151470 ------
NM_001018115chr31637 ------
NM_001020658chr131420 1058 259 1203 11444 --
NM_001020658chr131420 1058 259 1203 11444 --
NM_001020825chr521351 67 ------
NM_001023567chr1562383 1581 775 722 494 315 --1797 --
NM_001024094chr533876 2592 596 ------
NM_001024218chr142728 692 ------
NM_001024226chr11407 ------
NM_001024227chr11407 ------
NM_001024228chr11407 ------
NM_001024455chrX42152 709 241 45 ----12645
NM_001024457chr21295 --21311 560 --
NM_001024647chr1286366 6238 6104 4991 3075 2970 1278 809 24972 216 35379 5104 4670 --
NM_001024649chr51926 12858 11864 --
NM_001024660chr311408 1685 11240 --
NM_001024680chr221801 1275 --21335 163 --
NM_001024688chr81203 --12160 --
NM_001024808chr1232834 2784 2296 --11819 --
NM_001024847chr362447 2366 2064 1591 916 524 --2572 272 --
NM_001024947chr51172 --1815 1973
NM_001024948chr132728 2551 1403 --13350 --
NM_001024956chr1155196 5018 4189 1165 338 23763 856 --15189
NM_001025068chr32245 182 --1539 --
NM_001025069chr32245 182 --1539 --
NM_001025076chr1066020 5778 4622 2381 262 206 --12468 --
NM_001025077chr1087378 7136 5980 4811 4805 4721 1620 1564 --14797 11316
NM_001025079chr333745 2727 1084 ----33529 3063 1550
NM_001025105chr531395 1374 441 --1253 --
NM_001025201chr21245 183 ----
NM_001025252chr821160 75 11025 13221 --
NM_001025253chr821160 75 11025 13221 --
NM_001025266chr353160 3078 514 469 49 13119 ----
NM_001025356chr1282985 2943 2808 2786 2733 2157 1885 1177 ------
NM_001025366chr611374 ------
NM_001025366chr611374 ------
NM_001025367chr611374 ------
NM_001025367chr611374 ------
NM_001025368chr611374 ------
NM_001025368chr611374 ------
NM_001025369chr611390 ------
NM_001025369chr611390 ------
NM_001025370chr611374 ------
NM_001025370chr611374 ------
NM_001025389chr1141177 1058 576 21 --1144 --
NM_001025390chr1141177 1058 576 21 --1144 --
NM_001025579chr1731018 992 426 --1326 --
NM_001025580chrX43804 3533 2808 2607 11265 12867 --
NM_001025595chr41118 --31573 1045 298 --
NM_001025603chr12574 468 --170 --
NM_001025616chr421521 1483 11815 1356 --
NM_001025777chr25535 407 338 201 154 ------
NM_001025780chr93501 315 50 ------
NM_001029858chr653342 3053 453 243 70 --42964 2554 2255 355 --
NM_001029860chr82293 258 ------
NM_001029875chr542346 2239 997 533 ------
NM_001029882chr1----1479 --
NM_001029882chr1----1479 --
NM_001029884chr652613 2577 2307 2152 954 --1181 --
NM_001029989chr153943 392 190 --2301 249 --
NM_001030002chr171322 ------
NM_001030006chr1731875 421 399 ------
NM_001030007chr1673991 3546 3373 3161 2696 2525 593 23972 1472 53653 3010 2702 1195 227 --
NM_001030055chr1444299 4014 3874 1154 --11506 11132
NM_001030272chr111107 2467 46 ----
NM_001030273chr111107 2467 46 ----
NM_001030287chr1----11118 --
NM_001031623chr6----21278 357 --
NM_001031679chr1263316 3162 1097 919 433 32 ------
NM_001031680chr172524 2415 754 552 478 179 102 12545 --22481 2284
NM_001031684chr221278 1248 --11458 --
NM_001031695chr2275426 4839 3929 3858 1331 283 233 14142 23724 1189 --
NM_001031700chr452359 2348 913 790 43 11644 11969 --
NM_001031710chr71834 ------
NM_001031711chr531695 1522 1363 ------
NM_001031716chr2----163 --
NM_001031804chr1664299 2705 2694 1213 1162 356 21602 890 13249 --
NM_001031812chr551999 1603 751 682 504 --32246 1562 1542 --
NM_001032221chr941429 331 190 137 11803 11471 --
NM_001032279chr111388 ------
NM_001032280chr61428 --21656 1283 --
NM_001032288chr20--11401 ----
NM_001032293chr173637 549 446 ------
NM_001032296chr1372795 2749 2674 1090 1022 934 685 12384 ----
NM_001032363chr132248 239 143 ------
NM_001032363chr132248 239 143 ------
NM_001032380chr1041546 815 220 144 ------
NM_001032393chrX------2750 208
NM_001032394chr612594 --12550 --
NM_001032395chr612461 --12417 --
NM_001032999chr2075307 4966 4343 4215 1819 890 170 15223 ----
NM_001033045chr253671 3302 1460 680 594 33411 1308 925 --13881
NM_001033047chr422170 408 ----12542
NM_001033049chr2121971 744 ------
NM_001033057chr331378 1338 140 --31828 1406 659 --
NM_001033059chr63628 595 192 1164 ----
NM_001033081chr131787 130 82 --1163 --
NM_001033082chr131787 130 82 --1163 --
NM_001033087chr2062872 2611 2457 1316 854 146 ------
NM_001033112chr52135 110 ------
NM_001033117chr364547 3146 3046 1202 1181 840 ------
NM_001033503chr52447 361 ------
NM_001033506chr11----1411 --
NM_001033507chr131540 528 188 --1716 --
NM_001033518chr751864 1753 1140 293 65 ------
NM_001033519chr751864 1753 1140 293 65 ------
NM_001033520chr751864 1753 1140 293 65 ------
NM_001033551chr1754088 3575 1387 1060 478 --23860 843 --
NM_001033557chr2------174
NM_001033561chr172200 127 --1213 --
NM_001033566chr171990 ------
NM_001033568chr171990 ------
NM_001033602chr1342694 875 491 339 ------
NM_001033723chr852565 1859 1707 1102 435 ------
NM_001033756chr611308 ------
NM_001033756chr611308 ------
NM_001034841chr1652059 1891 1745 1563 731 --15488 --
NM_001034852chr1431896 749 377 --2548 131 1843
NM_001034954chr1062440 2344 2159 958 827 599 --12829 --
NM_001034955chr1062440 2344 2159 958 827 599 --12829 --
NM_001034956chr1062440 2344 2159 958 827 599 --12829 --
NM_001034957chr1062440 2344 2159 958 827 599 --12829 --
NM_001035chr121141 847 ------
NM_001035003chr42409 181 ------
NM_001035004chr42409 181 ------
NM_001035260chr1031574 1308 1290 ------
NM_001037131chr231241 1147 1136 ------
NM_001037132chr741488 871 739 542 --11617 --
NM_001037133chr741488 871 739 542 --11617 --
NM_001037164chr731905 1401 378 11556 ----
NM_001037172chr3----21389 305 --
NM_001037174chr222184 807 12042 --1625
NM_001037317chr142560 2278 2163 29 --1978 --
NM_001037332chr522411 1650 ------
NM_001037333chr522411 1650 ------
NM_001037334chr1842383 648 637 391 ----1255
NM_001037339chr121852 1766 1303 ----
NM_001037340chr121852 1766 1303 ----
NM_001037341chr121852 1766 1303 ----
NM_001037341chr121852 1766 1303 ----
NM_001037535chrX11385 ------
NM_001037536chrX11385 ------
NM_001037540chrX11385 ------
NM_001037553chr2154453 4188 4055 1865 1368 14104 13474 --
NM_001037582chr421317 75 ------
NM_001037631chr22387 135 1196 ----
NM_001037954chr1143262 2910 2431 706 --1428 --
NM_001038493chr221345 588 --1965 --
NM_001038640chr153863 842 383 1790 ----
NM_001039199chr2064979 4938 4464 1863 1697 1502 --23710 3339 --
NM_001039360chr181267 --1744 --
NM_001039465chr141426 ------
NM_001039538chr243045 2522 662 261 --21477 289 --
NM_001039547chr3107836 7620 7534 6922 6816 6691 5724 3218 2297 1955 --11460 --
NM_001039573chr171421 ------
NM_001039574chr13815 192 117 ------
NM_001039577chr1104143 3903 3884 1594 1493 1318 1115 638 625 399 24326 1507 13462 --
NM_001039580chr424443 599 11034 44415 3856 494 488 --
NM_001039590chrX43961 2495 819 354 ------
NM_001039591chrX43961 2495 819 354 ------
NM_001039618chr1143785 1699 1595 662 25095 2250 ----
NM_001039649chr131313 ------
NM_001039675chr15--1232 ----
NM_001039690chr1612372 ------
NM_001039709chr2075307 4966 4343 4215 1819 890 170 15223 ----
NM_001039711chr11953 1341 1965 --
NM_001039712chr11953 1341 1965 --
NM_001039802chr131391 1155 136 11344 ----
NM_001039840chrX84176 4003 1654 942 823 575 503 162 --35887 4795 200 --
NM_001039888chr11101 --1319 --
NM_001039916chr12--1966 ----
NM_001039917chr12--1966 ----
NM_001039918chr12--1966 ----
NM_001039919chr12--1966 ----
NM_001039920chr12--1966 ----
NM_001039937chr13103985 3474 3432 3305 2577 1470 1095 688 459 97 --33974 3685 79 --
NM_001040001chr6--11886 ----
NM_001040020chr711256 ------
NM_001040033chr1--1691 ----
NM_001040092chr81318 ------
NM_001040097chr7----1154 --
NM_001040098chr7----1154 --
NM_001040099chr7----1154 --
NM_001040100chr351200 1122 183 123 32 --1794 --
NM_001040101chr43485 329 189 ------
NM_001040110chr72428 209 --1160 --
NM_001040113chr163939 250 163 ------
NM_001040114chr163798 109 22 ------
NM_001040135chr71788 --1124 --
NM_001040142chr221751 1591 ------
NM_001040143chr221751 1591 ------
NM_001040144chr1612372 ------
NM_001040146chr1612372 ------
NM_001040152chr733366 1871 750 13698 25115 4576 --
NM_001040153chr133865 397 127 --2758 168 1917
NM_001040157chr41430 12670 2574 142 --
NM_001040158chr51380 ------
NM_001040159chr411484 --1442 --
NM_001040214chr652204 1631 503 423 69 --32385 2323 945 --
NM_001040260chr431063 905 341 --1476 --
NM_001040261chr431063 905 341 --1476 --
NM_001040272chr952377 2242 1816 1565 816 ------
NM_001040284chr16115810 5286 4628 4489 4410 2319 2186 1051 818 477 61 1812 15889 --
NM_001040402chr442468 2291 1159 712 --2799 103 23099 2248
NM_001040409chr2----1329 --
NM_001040429chr1322360 1424 ------
NM_001040441chr155253 4698 1867 198 135 --21876 1022 --
NM_001040450chr1542341 1854 939 250 12153 ----
NM_001040453chr1542341 1854 939 250 12153 ----
NM_001040455chr11----31357 1330 358 --
NM_001040619chr1189 --11568 --
NM_001040633chr71254 ----1192
NM_001040653chr31826 --12358 --
NM_001040665chr754603 4130 1918 830 243 21168 434 11625 --
NM_001040708chr81780 --21140 285 --
NM_001040709chr122523 274 11582 ----
NM_001040712chr963028 2946 2907 2694 2445 714 12322 23004 1401 13022
NM_001040876chr431449 737 369 --1688 1502
NM_001042355chr16105193 3957 3576 3296 1452 1157 525 481 275 53 14699 1196 --
NM_001042357chr1031201 479 48 --174 --
NM_001042358chr1031201 479 48 --174 --
NM_001042360chr1031201 479 48 --174 --
NM_001042361chr1031232 510 79 --1105 --
NM_001042363chr1031201 479 48 --174 --
NM_001042364chr1031232 510 79 --1105 --
NM_001042365chr1031232 510 79 --1105 --
NM_001042371chr163705 427 205 --11766 --
NM_001042383chr373178 2434 2277 2206 904 675 174 1309 12582 13272
NM_001042387chr1031232 510 79 --1105 --
NM_001042388chr181344 ------
NM_001042389chr1031201 479 48 --174 --
NM_001042390chr1031201 479 48 --174 --
NM_001042392chr1031201 479 48 --174 --
NM_001042393chr1031232 510 79 --1105 --
NM_001042395chr1031201 479 48 --174 --
NM_001042396chr1031232 510 79 --1105 --
NM_001042397chr1031232 510 79 --1105 --
NM_001042404chr121982 699 ----1633
NM_001042412chr16105193 3957 3576 3296 1452 1157 525 481 275 53 14699 1196 --
NM_001042413chr973985 3768 3520 3424 2874 1119 732 --1620 12831
NM_001042424chr422154 190 ----1542
NM_001042425chr61428 --21656 1283 --
NM_001042430chr142554 148 ------
NM_001042453chrX41666 1474 1266 1078 ------
NM_001042459chr31232 ------
NM_001042473chr1012050 ----1163
NM_001042475chr6----195 --
NM_001042481chr1452450 2237 2061 742 256 12626 22030 165 --
NM_001042486chr20--11048 ----
NM_001042492chr1743471 3355 359 101 11224 11190 1981
NM_001042494chr1523851 3738 ------
NM_001042495chr1523851 3738 ------
NM_001042496chr1523851 3738 ------
NM_001042497chr1523851 3738 ------
NM_001042506chrX1933 --1944 --
NM_001042510chr831840 1338 572 ------
NM_001042511chr831840 1338 572 ------
NM_001042517chr133653 197 169 ----1989
NM_001042537chrX42216 1598 907 39 --1201 165
NM_001042543chr431596 506 397 ------
NM_001042548chr21343 --1697 --
NM_001042555chr1244291 614 210 27 14000 34058 1258 970 23786 3682
NM_001042599chr267734 7437 7142 2272 2107 1430 --47247 7015 2147 1086 --
NM_001042601chr333104 600 350 12630 1629 --
NM_001042603chr1275234 4073 3522 3464 3406 1847 152 1258 --14327
NM_001042604chr364168 4048 3273 1081 619 187 21910 91 14724 1265
NM_001042616chr43481 431 110 --1166 --
NM_001042646chr341731 1462 249 86 ------
NM_001042669chr421521 1483 11815 1356 --
NM_001042749chrX2246 145 11658 21925 1839 1371
NM_001042750chrX2246 145 11658 21925 1839 1371
NM_001042751chrX2246 145 11658 21925 1839 1371
NM_001043318chr1453847 3297 3038 1639 1465 13010 22580 672 --
NM_001043351chr122098 1954 ------
NM_001044305chr661570 1224 1143 313 239 151 1245 ----
NM_001044385chr273542 3302 3169 3158 2541 901 648 1625 ----
NM_001044722chr551999 1603 751 682 504 --32246 1562 1542 --
NM_001044723chr551999 1603 751 682 504 --32246 1562 1542 --
NM_001046chr523006 2831 32483 2350 967 ----
NM_001048183chr172486 2477 1414 1102 948 354 105 --33756 3703 538 --
NM_001066chr121819 857 --12154 --
NM_001068chr3177 1243 ----
NM_001078chr11260 ------
NM_001079874chr131694 606 103 --11899 --
NM_001083620chr452410 2008 1883 1853 417 12534 21946 1758 --
NM_001096chr172795 609 ------
NM_001099678chr3115832 5818 5301 4457 3897 3888 2582 2256 1050 863 262 --26103 4980 11007
NM_001100108chr1108100 7866 7705 7003 6766 6593 6291 5656 1256 246 ----15111
NM_001106chr399669 8887 7757 7642 7326 6974 3678 3212 1596 ----19274
NM_001113490chrX63284 2802 2714 2524 816 703 23184 145 22764 877 --
NM_001116chr1653083 2913 2832 910 661 --33021 874 514 --
NM_001117chr181826 --22144 1906 --
NM_001119chr411452 ------
NM_001121chr1031793 680 45 ------
NM_001124chr111513 ------
NM_001127chr221197 1695 ----
NM_001128chr1673991 3546 3373 3161 2696 2525 593 23972 1472 53653 3010 2702 1195 227 --
NM_001144chr161106 ------
NM_001146chr82885 487 11555 ----
NM_001147chr82385 62 ------
NM_001148chr421440 1432 ------
NM_001149chr1011183 ------
NM_001151chr41240 ------
NM_001153chr22917 193 --2880 199 --
NM_001156chr104647 465 424 148 ------
NM_001160chr1222256 290 --42095 468 263 116 1903
NM_001167chrX65421 5397 4998 4464 1309 616 --46538 4263 2246 1756 --
NM_001173chr1444299 4014 3874 1154 --11506 11132
NM_001177chr1242443 2375 1844 71 ----12315
NM_001178chr111107 2467 46 ----
NM_001186chr2152857 2566 2387 2068 514 --11108 --
NM_001187chr212500 115 ------
NM_001198chr64889 648 301 77 ------
NM_001200chr202391 251 ------
NM_001201chr423653 101 --2857 90 --
NM_001204chr296421 6352 6300 5070 5022 2520 2140 648 39 --1210 --
NM_001206chr943130 3041 794 158 --1774 --
NM_001219chr712041 ----21818 77
NM_001222chr1041899 749 655 519 ------
NM_001235chr111667 ------
NM_001241chr231867 934 514 ------
NM_001241chr231867 934 514 ------
NM_001256chr1762923 2673 2418 2215 928 615 --12864 --
NM_001257chr161163 --11390 --
NM_001259chr754178 2275 1824 1077 720 21985 1856 24586 1868 --
NM_001260chr133279 96 27 ------
NM_001261chr9159 ------
NM_001270chr51197 1203 ----
NM_001271chr1593247 2870 2826 2507 2189 1116 1101 698 201 ----11079
NM_001280chr191679 ------
NM_001281chr19--1142 ----
NM_001282chr1731875 421 399 ------
NM_001284chr51433 ------
NM_001286chr142701 2616 2214 327 11066 12761 --
NM_001290chr43984 832 732 ------
NM_001298chr231316 1305 967 1853 ----
NM_001304chr1793704 2996 2636 2562 2334 976 892 570 318 23500 74 11302 --
NM_001310chr1232903 307 76 ------
NM_001313chr42866 345 ----1603
NM_001315chr642063 1802 903 892 1535 ----
NM_001329chr101345 --21257 663 --
NM_001331chr1132197 254 37 ------
NM_001332chr521090 489 --21146 441 --
NM_001343chr521694 1673 ------
NM_001346chr31454 --32549 2027 1006 --
NM_001356chrX62272 1749 1581 1539 308 267 1509 ----
NM_001364chr1154211 3412 3016 2998 1020 11296 2850 96 --
NM_001378chr2170 ------
NM_001379chr192197 53 1228 ----
NM_001385chr8------1288
NM_001386chr811925 --21871 1654 --
NM_001389chr211433 --1580 --
NM_001390chr1863369 3255 3139 2798 1108 419 --11239 13073
NM_001396chr2132484 759 374 ------
NM_001399chrX32850 1530 365 11248 --1320
NM_001400chr131338 417 196 --1265 --
NM_001402chr621939 567 ------
NM_001407chr31227 ------
NM_001408chr121612 220 ------
NM_001412chrX53456 3310 3102 2892 276 ------
NM_001417chr1251856 1396 704 636 157 ------
NM_001418chr112574 59 ------
NM_001418chr112574 59 ------
NM_001419chr1974604 4133 3205 787 262 87 23 --11176 --
NM_001420chr1922597 1271 --23166 2085 --
NM_001423chr122364 341 ----11952
NM_001427chr731979 1800 392 ------
NM_001429chr223688 314 264 --162 --
NM_001431chr62402 198 ------
NM_001432chr463922 3725 3519 1329 1277 124 11554 33936 3652 3639 --
NM_001438chr131058 774 117 --13201 13403
NM_001448chrX3656 268 191 ------
NM_001449chrX1845 ------
NM_001451chr1631369 1329 1242 ------
NM_001452chr6----1669 --
NM_001454chr172870 236 ------
NM_001458chr73685 619 551 ------
NM_001463chr2189 --155 183
NM_001490chr953557 3336 2947 2742 533 --12564 1487
NM_001494chr101755 ------
NM_001498chr651285 323 312 255 105 127 1335 --
NM_001527chr644775 4740 1346 781 --21448 337 --
NM_001530chr1441083 962 902 465 --1239 --
NM_001533chr192291 243 ------
NM_001542chr142539 479 345 200 --12622 12854
NM_001546chr631026 258 193 ------
NM_001564chr4----1141 --
NM_001584chr111382 --11042 --
NM_001587chrX31846 569 561 --2454 418 12122
NM_001604chr111144 ------
NM_001609chr1034073 3474 3039 34373 1064 982 23732 1128 --
NM_001610chr111612 ------
NM_001614chr171599 --1549 --
NM_001614chr171599 --1549 --
NM_001616chr233490 877 170 --22972 438 23390 2860
NM_001634chr63628 595 192 1164 ----
NM_001650chr1814116 --12897 14125
NM_001656chr5151 ----12038
NM_001658chr11407 ------
NM_001660chr31673 ------
NM_001662chr71308 ------
NM_001663chr1422596 665 --22086 447 --
NM_001668chr142100 1716 743 652 ------
NM_001674chr1----11118 --
NM_001676chr13----1167 --
NM_001677chr12920 140 ------
NM_001681chr121640 ------
NM_001682chr1242539 1895 127 33 1593 12630 --
NM_001683chr382535 2505 2376 1766 910 565 488 335 --12603 --
NM_001684chr154199 4032 3848 3486 866 --23995 2952 --
NM_001686chr12121 ------
NM_001689chr231872 1836 203 --1164 --
NM_001690chr322485 353 ------
NM_001693chr821152 267 --168 --
NM_001694chr161117 ------
NM_001695chr833474 3254 1541 2305 224 24273 3846 --
NM_001699chr1921449 702 11711 ----
NM_001701chr9----21585 1462 --
NM_001704chr6----144 --
NM_001706chr31387 11022 ----
NM_001707chr71229 --148 --
NM_001709chr113916 300 198 22857 220 ----
NM_001714chr12----1427 --
NM_001718chr621230 1027 --11090 --
NM_001730chr1311042 ------
NM_001730chr1311042 ------
NM_001731chr122884 851 --1753 1371
NM_001742chr741832 1738 583 64 ------
NM_001743chr23397 213 34 --1461 1411
NM_001744chr52506 47 189 ----
NM_001746chr51926 12858 11864 --
NM_001748chr12950 195 ------
NM_001753chr71244 --11564 --
NM_001754chr2154257 4127 3490 1650 825 --1531 --
NM_001755chr1672200 1901 1778 1733 1563 849 231 --21542 449 2575 212
NM_001759chr1255058 4163 3994 3851 1483 --11695 --
NM_001762chr7----1186 --
NM_001769chr122323 130 ------
NM_001777chr333745 2727 1084 ----33529 3063 1550
NM_001788chr75933 805 289 194 89 --1956 --
NM_001791chr131391 1155 136 11344 ----
NM_001792chr183975 800 252 --1395 --
NM_001797chr161660 --1759 --
NM_001806chr1932755 2090 1185 11934 12776 --
NM_001813chr41163 ------
NM_001822chr21245 183 ----
NM_001826chr11398 ------
NM_001827chr9----1276 --
NM_001829chr45702 635 312 277 268 ------
NM_001830chrX73391 3310 1437 1143 845 799 94 --1485 --
NM_001833chr9--1254 ----
NM_001839chr16725 652 554 536 303 271 --1114 --
NM_001842chr9188 --1112 --
NM_001854chr121051 433 1354 ----
NM_001858chr664213 4197 3866 3652 468 305 --13505 --
NM_001859chr933872 2653 2644 --33808 973 756 --
NM_001862chr2----170 --
NM_001873chr42585 511 --1679 --
NM_001884chr51382 1399 ----
NM_001885chr11----122 --
NM_001892chr531395 1374 441 --1253 --
NM_001893chr171321 ------
NM_001901chr621049 418 ------
NM_001902chr11404 ------
NM_001904chr3----1339 --
NM_001907chr16163 ------
NM_001918chr198791 8677 8668 8122 3318 3146 2684 2600 1867 18266 21321 540 --
NM_001924chr11558 --137 --
NM_001935chr23864 297 71 ------
NM_001938chr121627 349 --21728 355 --
NM_001939chrX----13870 --
NM_001944chr1832298 2154 657 12344 ----
NM_001946chr1231072 413 362 1126 ----
NM_001949chr632833 2706 2042 ----12384
NM_001950chr161760 ------
NM_001954chr61751 1827 ----
NM_001955chr62938 64 ------
NM_001957chr442171 2124 1609 308 ------
NM_001964chr541162 464 403 274 --11109 --
NM_001967chr33579 452 65 ------
NM_001968chr43712 654 98 --1165 --
NM_001969chr1452998 2744 2463 852 712 --32988 2691 784 --
NM_001977chr421382 226 ------
NM_001981chr132312 547 492 1349 31787 1556 911 --
NM_001982chr121193 --11082 --
NM_001991chr1732211 733 87 ------
NM_001993chr13901 735 254 --141 --
NM_001995chr431522 1393 1259 1423 --11329
NM_001999chr531210 1162 979 ------
NM_002009chr1562622 2592 2274 733 256 153 1179 ----
NM_002010chr131175 --1404 --
NM_002015chr1373218 3139 2530 1016 952 710 661 12160 12604 1473
NM_002017chr112980 254 ------
NM_002024chrX52094 1589 1438 313 185 12015 1761 --
NM_002025chrX79288 7938 5834 3446 3375 1701 234 37624 7148 1515 39109 7035 1814 --
NM_002031chr63649 557 161 --1543 --
NM_002039chr42683 284 ------
NM_002040chr2133040 2792 2496 ------
NM_002045chr3----1294 --
NM_002051chr102324 280 --163 --
NM_002054chr21115 1346 ----
NM_002056chr22674 644 --1284 --
NM_002061chr111469 --11944 --
NM_002063chrX--1830 11100 --
NM_002069chr74664 554 543 27 --1389 --
NM_002074chr141739 1695 625 225 ------
NM_002076chr1263261 3171 2931 2322 1010 650 ------
NM_002077chr941986 1882 703 111 1789 ----
NM_002080chr161758 ------
NM_002082chr52223 33 ------
NM_002084chr52737 157 ------
NM_002087chr171298 ------
NM_002092chr484009 3625 2034 1719 1591 1322 999 53 --13287 --
NM_002106chr41323 ------
NM_002114chr61172 ------
NM_002126chr1754094 1583 1454 841 741 13373 1710 --
NM_002129chr4----1336 --
NM_002130chr541443 322 226 158 --1391 --
NM_002137chr71483 11614 ----
NM_002139chrX------1242
NM_002140chr91153 ------
NM_002141chr71619 --1546 --
NM_002146chr17----31236 1159 951 --
NM_002154chr51193 ------
NM_002158chr243828 3448 3401 895 ------
NM_002163chr162488 294 --1122 --
NM_002166chr23561 541 36 ------
NM_002167chr12488 413 ------
NM_002181chr2137 ------
NM_002182chr312190 --12201 --
NM_002193chr231890 1477 398 --11464 --
NM_002199chr41278 ------
NM_002202chr51981 --1873 --
NM_002203chr563984 3825 3587 1522 1447 1123 11079 1290 --
NM_002205chr122907 192 --1284 --
NM_002214chr765193 2238 2094 1596 399 122 --13845 --
NM_002222chr351338 1201 1138 529 421 --1270 --
NM_002235chr1231351 1189 500 ------
NM_002239chr2----1253 --
NM_002241chr111966 --12225 --
NM_002245chr12449 440 ------
NM_002246chr241235 1226 376 158 ------
NM_002247chr1032112 777 127 ------
NM_002253chr41552 ----11366
NM_002264chr365000 4853 4183 3301 1999 138 23388 942 24961 120 1536
NM_002267chr1362311 2272 2225 2106 1601 363 --12346 --
NM_002268chr341643 1571 1478 1293 1140 ----
NM_002270chr5125093 4848 4511 4092 3673 1989 1017 975 935 879 516 341 15472 45622 2032 1937 773 --
NM_002283chr123796 659 57 ------
NM_002290chr62972 317 ------
NM_002293chr112272 --21019 756 --
NM_002298chr1321429 33 ------
NM_002314chr721080 272 ------
NM_002334chr111374 --21876 246 --
NM_002335chr111165 ------
NM_002336chr1253629 1980 1969 902 158 13851 --21051 244
NM_002349chr21241 --31412 1217 1035 130
NM_002351chrX51673 1556 1393 168 99 11471 123 --
NM_002354chr22361 142 1285 ----
NM_002355chr1241421 1364 1001 140 --1259 --
NM_002356chr642751 2658 321 312 12545 ----
NM_002360chr722638 274 ------
NM_002374chr243045 2522 662 261 --21477 289 --
NM_002375chr332238 2205 1447 --11421 --
NM_002380chr82810 339 --1390 --
NM_002381chr24421 69 60 45 --2963 937 --
NM_002382chr1421270 871 ------
NM_002387chr554831 4413 3762 934 78 15001 44962 4935 4626 2004 --
NM_002397chr542078 1984 231 215 188 --12241
NM_002398chr221428 339 ------
NM_002399chr151169 ------
NM_002401chr1732499 2045 827 --1858 --
NM_002402chr72783 310 ------
NM_002406chr51106 ------
NM_002408chr142707 311 1541 1282 --
NM_002428chr1631445 1432 1311 ------
NM_002429chr1221025 206 ----1531
NM_002430chr2222385 864 ------
NM_002438chr103652 639 500 --1108 --
NM_002444chrX31951 1792 1402 ------
NM_002448chr4--1709 ----
NM_002449chr511223 ------
NM_002451chr953810 3457 2481 1576 662 13777 ----
NM_002455chr1145 ------
NM_002474chr163798 109 22 ------
NM_002478chr111555 ------
NM_002480chr1251455 1207 1081 358 33 ------
NM_002485chr81203 --12160 --
NM_002487chr152591 262 ------
NM_002499chr1562208 1935 1526 581 299 76 --2864 631 --
NM_002500chr241234 1166 819 454 --2936 905 --
NM_002501chr1954089 3953 2877 1670 1112 ------
NM_002514chr831155 879 413 1342 1320 --
NM_002515chr143720 522 65 ------
NM_002518chr231243 1076 989 1367 ----
NM_002519chr1121022 102 11514 21320 113 --
NM_002523chr721232 440 ------
NM_002524chr131071 803 50 ------
NM_002527chr12----1262 --
NM_002536chrX21527 232 ----11299
NM_002539chr21271 ------
NM_002540chr91655 ------
NM_002541chr7----21036 1031 --
NM_002547chrX43880 3098 1680 706 --21653 127 --
NM_002556chr112726 649 12005 ----
NM_002572chr11----196 --
NM_002577chr313345 --1290 --
NM_002578chrX----2426 376 --
NM_002581chr975699 4965 4283 4203 3964 2072 234 ------
NM_002585chr11390 ------
NM_002589chr41125 ------
NM_002594chr2022287 2058 ------
NM_002595chr122436 195 1298 11612 --
NM_002599chr1121204 69 ------
NM_002600chr121852 1766 1303 ----
NM_002608chr2231505 1351 997 ------
NM_002610chr263107 2250 1122 652 540 181 --12723 12955
NM_002613chr1654236 3916 3742 1346 1210 --13713 --
NM_002623chr202795 204 ------
NM_002628chr351196 1149 767 326 211 ----1912
NM_002629chr10--1873 ----
NM_002634chr172879 780 ------
NM_002641chrX2776 625 11271 31861 1378 196 11415
NM_002643chr21162 ------
NM_002645chr1132150 841 154 33133 2020 741 22718 327 12434
NM_002655chr855030 4939 4810 4624 3829 11274 24971 4245 --
NM_002656chr62922 196 ------
NM_002657chr2043603 3304 2734 862 ------
NM_002660chr201222 ------
NM_002667chr61324 ------
NM_002670chr31396 ------
NM_002674chr12--1170 ----
NM_002687chr1431146 169 103 --1161 --
NM_002699chr121457 1277 ------
NM_002706chr22152 68 ------
NM_002709chr242592 899 722 69 --12573 13173
NM_002710chr122877 78 ------
NM_002711chr71840 --1322 --
NM_002713chr12995 983 --1201 --
NM_002714chr631110 825 412 ------
NM_002715chr541164 900 517 207 ------
NM_002716chr1143138 1328 902 609 1526 11304 --
NM_002718chr322165 76 1125 12316 --
NM_002719chr1432424 2363 981 ------
NM_002729chr102205 145 ----1609
NM_002731chr1--23108 1115 144 --
NM_002734chr1731831 1728 149 ------
NM_002736chr721775 704 --1233 --
NM_002737chr1746636 6593 1854 1252 --26119 5433 --
NM_002738chr162325 92 ------
NM_002740chr322647 1797 22485 304 --1324
NM_002742chr14--1267 --1688
NM_002745chr2263611 3492 1623 1270 741 247 --23587 479 --
NM_002748chr1531053 350 199 1257 ----
NM_002753chr42662 534 ------
NM_002755chr15198 --1317 --
NM_002776chr1931316 203 118 --11325 --
NM_002779chr101546 --1219 --
NM_002787chr7189 ----1505
NM_002822chr1221831 1692 --21384 108 11458
NM_002823chr21504 1515 ----
NM_002825chr7----162 --
NM_002827chr201492 2440 143 ----
NM_002828chr181358 133 1686 --
NM_002829chr911104 1504 11135 --
NM_002830chr2----1145 --
NM_002837chr1264332 2847 1442 1318 449 174 --21160 830 --
NM_002838chr141166 958 791 184 ------
NM_002839chr963028 2946 2907 2694 2445 714 12322 23004 1401 13022
NM_002840chr121619 1573 --1272 --
NM_002841chr31179 ----1227
NM_002843chr1143374 2788 467 213 13480 23152 577 --
NM_002844chr651240 1003 335 277 69 ------
NM_002845chr182448 111 --2434 162 --
NM_002849chr122282 186 ------
NM_002852chr3----1143 --
NM_002858chr151291 1224 1125 902 495 1225 11211 --
NM_002865chr8----1210 --
NM_002868chr121905 --1968 --
NM_002869chr111303 --12081 --
NM_002873chr51438 ------
NM_002874chr922486 800 2310 41 12319 --
NM_002886chr354135 3986 3629 1888 684 23783 879 1105 --
NM_002890chr5------1207
NM_002892chr1441650 1401 1345 392 ------
NM_002894chr181156 --1189 --
NM_002902chr151568 ------
NM_002906chr1132349 1998 1869 12065 ----
NM_002912chr63903 801 157 ------
NM_002923chr1----1528 --
NM_002924chr11102 ------
NM_002940chr431449 737 369 --1688 1502
NM_002941chr311608 --2348 322 --
NM_002942chr331243 520 297 1103 1437 1364
NM_002945chr172789 742 ------
NM_002956chr122383 253 --1451 2513 363
NM_002957chr923502 2395 --11437 --
NM_002958chr32860 616 ------
NM_002959chr164259 3819 3789 1778 1039 409 11753 14403 13740
NM_002968chr1621004 148 1404 ----
NM_002970chrX1137 ------
NM_002971chr31128 1167 ----
NM_002977chr221060 566 22110 489 22472 181 11361
NM_002979chr12788 206 1220 ----
NM_002982chr172372 307 ------
NM_002996chr1631748 1647 531 ------
NM_002998chr82874 62 11707 ----
NM_003010chr1722235 443 1399 ----
NM_003016chr1731789 1767 271 21597 418 2553 457 --
NM_003017chr621279 104 1475 ----
NM_003026chr9----1378 --
NM_003031chr161160 ------
NM_003034chr1276892 6688 5990 2681 2346 1453 97 21260 764 26527 782 --
NM_003035chr13643 634 308 ------
NM_003036chr121170 975 ------
NM_003042chr342185 1922 456 330 ------
NM_003043chr332910 737 214 --23805 989 194
NM_003045chr1364445 3830 3602 3055 1602 522 --1564 --
NM_003048chr232784 2623 1052 --22712 2703 11130
NM_003051chr141444 1254 751 637 ------
NM_003060chr52902 447 ------
NM_003068chr83790 306 36 ------
NM_003069chrX1273 1745 ----
NM_003070chr92778 757 ------
NM_003074chr322186 1814 ------
NM_003075chr121333 ------
NM_003076chr1211153 --11596 --
NM_003077chr172529 316 --1193 --
NM_003081chr201206 ------
NM_003099chr1576422 4677 4668 1953 1920 1593 1053 --22317 1892 16516
NM_003100chr51292 ----1281
NM_003105chr11183 ------
NM_003106chr31271 1744 ----
NM_003107chr632331 2181 851 --12103 --
NM_003108chr2106965 6903 6577 4540 1501 1288 1185 1138 979 305 11294 26608 5719 --
NM_003110chr171309 ------
NM_003111chr231352 1052 192 ------
NM_003112chr742152 881 194 36 ------
NM_003115chr12365 342 ------
NM_003128chr252435 2233 1779 904 705 --12073 --
NM_003131chr621404 558 ------
NM_003135chr5196 ------
NM_003136chr141116 --1335 --
NM_003139chr11--1378 1651 --
NM_003144chr61164 ------
NM_003149chr311168 1614 ----
NM_003150chr1752303 2285 841 825 53 --1452 --
NM_003152chr1711219 --21213 1043 --
NM_003155chr862519 818 759 622 138 76 --12547 12579
NM_003156chr11----11326 --
NM_003161chr1733483 2330 885 --1890 --
NM_003173chrX31385 885 346 --1216 1499
NM_003174chr102741 252 --1621 --
NM_003178chr352252 2144 1739 1633 892 --22181 1723 --
NM_003182chr71388 174 ----
NM_003182chr71388 174 ----
NM_003185chr2041255 997 878 337 1327 ----
NM_003187chr5----151 --
NM_003188chr62197 136 ------
NM_003189chr163307 3260 3187 2616 1270 920 --23229 1027 --
NM_003199chr1875254 5184 4961 4884 3486 435 326 --35326 4618 1463 --
NM_003200chr1921767 617 --1703 --
NM_003203chr231788 577 215 ------
NM_003204chr17----21181 611 --
NM_003206chr61318 ------
NM_003211chr1231439 1387 1136 ------
NM_003217chr1221939 64 --1120 --
NM_003220chr61428 --21656 1283 --
NM_003221chr683688 3091 2805 1613 1499 1324 1130 659 --13420 --
NM_003222chr201916 ------
NM_003223chr16----1859 --
NM_003242chr362447 2366 2064 1591 916 524 --2572 272 --
NM_003244chr181101 ----172
NM_003246chr1551997 1869 1626 125 52 ------
NM_003247chr631974 1668 1426 --11605 --
NM_003253chr2141813 1664 621 107 ------
NM_003255chr173902 485 374 --11965 --
NM_003257chr1541186 949 917 333 ------
NM_003262chr3104976 4818 4166 3697 3395 2086 1992 970 612 270 ------
NM_003269chr631263 1174 226 --11303 --
NM_003272chr11243 ------
NM_003274chr2151100 1034 860 738 45 ------
NM_003275chr921507 344 1129 ----
NM_003288chr2041055 1000 185 160 ------
NM_003291chr131802 ------
NM_003295chr131201 ------
NM_003298chr366172 3973 3927 1452 1300 646 15839 36122 4868 4618 15592
NM_003299chr12------1200
NM_003304chr321478 61 --11372 --
NM_003305chr41174 ----1286
NM_003314chr51173 ------
NM_003319chr22804 244 ------
NM_003320chr1154362 3937 3103 3078 1430 ------
NM_003336chrX31100 1074 201 --1293 --
NM_003337chr53302 181 170 1696 21580 1060 --
NM_003338chr102211 97 --1694 --
NM_003339chr551593 1173 530 187 154 --21380 993 11343
NM_003340chr411203 131 ----
NM_003341chr31666 ------
NM_003342chr1751028 705 325 107 76 --13114 --
NM_003344chr721220 247 ------
NM_003345chr161366 ----1573
NM_003347chr2221943 54 ------
NM_003348chr1211718 --2431 69 --
NM_003349chr20--11401 ----
NM_003350chr81861 --1999 --
NM_003352chr22855 837 --2692 270 --
NM_003358chr92149 138 ------
NM_003367chr191151 ------
NM_003368chr1--1210 ----
NM_003369chr113872 447 64 ------
NM_003372chrX----1938 --
NM_003373chr1021980 652 ------
NM_003376chr611374 ------
NM_003376chr611374 ------
NM_003383chr92508 145 ------
NM_003387chr252677 2573 2349 2193 285 12855 ----
NM_003390chr111711 --21091 290 --
NM_003392chr354264 2928 1421 1353 546 13207 34348 1367 1320 --
NM_003400chr21211 ------
NM_003403chr141801 ------
NM_003404chr2031703 1505 411 11983 ----
NM_003406chr821604 1535 ------
NM_003409chr1821109 1099 --1112 --
NM_003410chrX32985 2737 784 ------
NM_003411chrY1578 --2696 681 --
NM_003412chr372807 2370 2107 1962 1920 595 391 --43112 2605 542 463 --
NM_003418chr32712 167 ------
NM_003430chr1921190 130 11091 ----
NM_003432chr51458 ------
NM_003442chr111843 ------
NM_003452chr91900 --1873 --
NM_003453chr131612 ------
NM_003457chr173637 549 446 ------
NM_003458chr363588 3269 3063 2489 2481 1182 13747 ----
NM_003463chr632618 1274 661 --21339 723 --
NM_003466chr211977 --12438 --
NM_003467chr2190 ------
NM_003468chr233255 2650 1345 24360 3178 1283 --
NM_003470chr1641537 1325 628 517 ------
NM_003471chr341999 1850 1588 696 --1237 --
NM_003472chr651339 1310 313 253 213 --1182 --
NM_003473chr10--1351 ----
NM_003474chr1042199 1630 233 75 11927 --21873 45
NM_003478chr114398 364 280 194 --21103 234 12919
NM_003483chr1232505 1911 378 --12845 --
NM_003488chr171700 --136 --
NM_003489chr2133478 3012 331 ----1955
NM_003496chr71845 ------
NM_003498chr1652812 2106 972 143 77 1427 12521 --
NM_003505chr731890 1357 546 11550 ----
NM_003506chr821244 62 1316 2112 100 --
NM_003507chr221588 1554 ------
NM_003559chr1733661 1455 544 ----1636
NM_003563chr172972 127 --11096 --
NM_003566chr1252871 2774 1035 423 59 --1532 --
NM_003574chr1864564 3838 3544 1369 1219 238 25433 2275 1700 --
NM_003576chr1372795 2749 2674 1090 1022 934 685 12384 ----
NM_003580chr8148 ------
NM_003581chr221052 269 --1946 --
NM_003582chr1--1208 ----
NM_003583chr1273706 3565 3204 2852 2698 2518 739 --21268 836 --
NM_003589chr131388 ------
NM_003590chr2104048 3835 3475 3404 3072 3035 1575 735 397 38 22674 993 33085 758 561 --
NM_003595chr222137 52 ------
NM_003597chr222151 846 ------
NM_003601chr4173 ------
NM_003603chr451545 1522 1405 785 524 --2677 437 --
NM_003607chr164283 4105 4095 3890 3821 243 --13379 --
NM_003613chr152639 267 --1654 --
NM_003615chr333632 2646 2483 ------
NM_003617chr173937 3261 1890 1838 1612 1080 60 34950 2001 1152 ----
NM_003618chr231308 300 225 ------
NM_003620chr17----1154 --
NM_003622chr12----2971 264 --
NM_003626chr1131254 385 330 1471 ----
NM_003628chr21624 ------
NM_003629chr133003 207 101 ------
NM_003630chr61707 ------
NM_003644chr1775996 4662 4456 4372 2513 2383 1091 16596 1520 --
NM_003654chr11------1173
NM_003658chr111584 ------
NM_003659chr211203 ------
NM_003670chr3--11135 195 --
NM_003671chr943516 3329 2962 613 --13024 --
NM_003672chr12723 195 ------
NM_003679chr142971 2452 407 176 ------
NM_003692chr91217 ------
NM_003701chr131940 ------
NM_003705chr24309 299 290 266 --1276 --
NM_003713chr11459 ------
NM_003714chr532595 2038 214 --1638 13085
NM_003716chr31329 1319 1901 --
NM_003718chr74511 480 208 136 ------
NM_003722chr332565 2215 1768 --22012 428 --
NM_003728chr42219 104 ------
NM_003743chr211955 --12063 --
NM_003749chr1332387 2142 526 11514 ----
NM_003750chr10------1227
NM_003758chr15------1617
NM_003758chr15------1617
NM_003762chr131327 994 979 --1946 2355 347
NM_003763chr2043180 2487 2316 134 --1716 --
NM_003768chr131149 654 363 --1507 --
NM_003774chr1232286 2201 1254 1802 1780 --
NM_003778chr31715 ------
NM_003780chr13680 673 580 ------
NM_003783chr131208 908 803 ------
NM_003787chr1831448 1307 1197 ------
NM_003796chr19----1559 --
NM_003797chr11----1164 --
NM_003799chr18104510 4500 4446 3994 3107 3013 1556 912 794 179 --1560 --
NM_003800chr632017 1663 173 --1628 1536
NM_003825chr152990 452 ------
NM_003829chr9164 --1202 --
NM_003850chr133183 160 151 ------
NM_003858chr143585 501 268 ------
NM_003861chr1442658 759 552 345 --1405 --
NM_003862chr51111 ------
NM_003872chr222395 1158 --12723 --
NM_003873chr1022345 1889 --32140 766 465 1616
NM_003884chr321584 319 --11838 --
NM_003885chr1742700 1870 187 40 --22677 2027 --
NM_003887chr262048 1670 1662 699 343 208 --21435 545 1321
NM_003895chr2131489 498 104 ------
NM_003901chr1022568 2095 32585 2202 1988 ----
NM_003902chr12700 294 ----1653
NM_003906chr21186 ------
NM_003913chr664265 3674 3203 1166 966 756 --24304 3738 --
NM_003916chrX11434 ------
NM_003921chr131848 345 202 --11492 --
NM_003922chr152337 282 ------
NM_003932chr2251825 1535 1451 1411 456 --11761 --
NM_003934chr921139 1043 --21101 506 --
NM_003936chr22796 372 ------
NM_003938chr19191 ------
NM_003941chr752264 2238 1806 1018 498 1995 32526 2346 926 --
NM_003947chr331314 1242 300 --11271 --
NM_003953chr151940 1078 635 204 121 12730 1260 --
NM_003958chr653066 3051 3003 2673 1525 12568 13943 12609
NM_003966chr597598 7420 7358 6676 5349 4799 3007 2474 115 --17792 15407
NM_003968chr3------1680
NM_003972chr101323 --1179 --
NM_003980chr62542 277 --11099 --
NM_003993chr11309 ------
NM_003994chr1274422 4316 4200 3011 1648 336 229 11759 ----
NM_003998chr41593 ------
NM_004006chrX52596 2374 572 521 282 --12128 --
NM_004007chrX52596 2374 572 521 282 --12128 --
NM_004009chrX52596 2374 572 521 282 --12128 --
NM_004010chrX52596 2374 572 521 282 --12128 --
NM_004011chrX52596 2374 572 521 282 --12128 --
NM_004012chrX52596 2374 572 521 282 --12128 --
NM_004013chrX52596 2374 572 521 282 --12128 --
NM_004014chrX52596 2374 572 521 282 --12128 --
NM_004015chrX52596 2374 572 521 282 --12128 --
NM_004016chrX52510 2288 486 435 196 --12042 --
NM_004017chrX52596 2374 572 521 282 --12128 --
NM_004018chrX52510 2288 486 435 196 --12042 --
NM_004020chrX52596 2374 572 521 282 --12128 --
NM_004021chrX52510 2288 486 435 196 --12042 --
NM_004022chrX52510 2288 486 435 196 --12042 --
NM_004023chrX52510 2288 486 435 196 --12042 --
NM_004028chr1814116 --12897 14125
NM_004034chr104647 465 424 148 ------
NM_004035chr1755029 4718 3727 3497 1609 --1572 --
NM_004040chr26936 906 894 863 211 146 ------
NM_004050chr141776 1770 --11925
NM_004061chr51237 ------
NM_004063chr8--188 ----
NM_004067chr721469 485 ------
NM_004071chr2179 ------
NM_004074chr11172 ------
NM_004075chr12----1431 --
NM_004081chrY21856 577 --2526 377 --
NM_004085chrX1801 ------
NM_004087chr311439 11430 ----
NM_004093chr1332731 2388 411 --12991 --
NM_004094chr1431967 804 638 --13000 --
NM_004097chr21300 ------
NM_004098chr101357 --2888 504 --
NM_004100chr652353 1918 1051 915 442 12148 ----
NM_004103chr83817 165 130 ------
NM_004109chr112851 135 --1732 --
NM_004114chrX41125 1103 1069 495 ------
NM_004117chr622206 1436 --1497 --
NM_004124chr1433532 2878 90 --43574 1388 970 249 --
NM_004136chr1532829 963 353 1371 --12757
NM_004145chr194600 299 279 47 ------
NM_004156chr82588 573 ------
NM_004161chr221233 557 197 2603 81 --
NM_004162chr341260 975 907 888 1835 --11169
NM_004170chr921394 610 --31437 757 163 --
NM_004171chr1198062 6841 6619 6606 3743 2013 1930 1376 501 --18304 --
NM_004177chr11125 --1323 --
NM_004185chr1167 ----1288
NM_004210chr1022135 1693 ------
NM_004226chr23301 238 107 ------
NM_004229chrX31934 1887 148 --11870 --
NM_004232chr1823843 2846 1332 23757 27 --
NM_004235chr93849 689 661 ------
NM_004236chr152458 166 ------
NM_004242chr61350 ------
NM_004247chr17155 ------
NM_004261chr12816 219 ------
NM_004267chr31168 ------
NM_004272chr551463 1447 1343 1258 85 --1487 --
NM_004274chr1452115 2101 1054 962 208 ------
NM_004279chr7----1321 --
NM_004280chr6157 ------
NM_004281chr10162 ------
NM_004286chr221253 ------
NM_004293chr922971 780 --2591 575 1171
NM_004301chr31110 ------
NM_004302chr1222813 2101 ----12292
NM_004311chr1022995 2376 --2421 304 --
NM_004323chr952413 2274 2004 1978 436 --1216 --
NM_004326chr12413 317 1419 ----
NM_004331chr832610 2459 2017 ------
NM_004337chr831568 487 71 ------
NM_004338chr1885950 5286 4903 2590 2029 939 790 162 14633 11448 1586
NM_004342chr73536 414 206 --11940 --
NM_004349chr811160 ------
NM_004350chr172524 2415 754 552 478 179 102 12545 --22481 2284
NM_004354chr41732 ------
NM_004360chr1622007 571 --11511 --
NM_004370chr642019 734 221 71 ------
NM_004379chr211198 1641 11757 1162
NM_004380chr16----21678 51 --
NM_004384chr551999 1603 751 682 504 --32246 1562 1542 --
NM_004385chr52674 569 ------
NM_004386chr1942287 1762 591 144 --1354 --
NM_004389chr22578 137 1208 ----
NM_004392chr1332520 1960 636 11073 12396 --
NM_004393chr342368 1822 1687 392 ------
NM_004395chr52211 83 ------
NM_004396chr17------1199
NM_004397chr1132933 1233 389 13411 53695 1708 1676 1485 207 1235
NM_004414chr2131563 1488 1013 --1292 11389
NM_004415chr62641 545 ------
NM_004417chr5--1464 ----
NM_004419chr102277 237 ------
NM_004430chr832691 2368 1733 --12701 --
NM_004432chr942314 2068 1878 1781 --22412 243 --
NM_004438chr272813 2487 1289 1183 1084 74 55 --23307 1072 --
NM_004439chr4142 ------
NM_004440chr611609 11654 11428 --
NM_004441chr331213 116 83 ------
NM_004454chr342287 1697 877 403 --22095 1793 --
NM_004456chr71194 ------
NM_004457chr241536 1097 530 234 ------
NM_004458chrX41879 893 561 182 11858 42659 2568 2199 1039 --
NM_004459chr1762039 1825 1666 1368 1327 648 11904 --11444
NM_004460chr21224 ------
NM_004464chr443694 1515 582 447 --23433 1494 1192
NM_004474chr11942 ------
NM_004475chr171853 --11174 --
NM_004480chr142570 230 ------
NM_004481chr121759 558 --12593 --
NM_004482chr22298 122 ------
NM_004491chr1953776 2899 1408 1129 331 --24305 1520 --
NM_004496chr1421181 1097 ------
NM_004499chr51422 ------
NM_004501chr173769 3104 1531 734 465 318 165 ----2675 453
NM_004504chr231042 902 129 22388 1024 168 --
NM_004505chr1721912 1852 ------
NM_004516chr1921166 266 ------
NM_004519chr81209 ------
NM_004525chr231357 1073 44 1198 1216 --
NM_004529chr911309 ------
NM_004537chr122195 36 ------
NM_004540chr212589 122 ------
NM_004550chr1--1151 ----
NM_004566chr1011587 --1812 1952
NM_004571chr2172615 2493 2473 1291 1012 102 39 12464 23094 872 --
NM_004575chr441313 1141 614 526 ------
NM_004576chr5189 ------
NM_004578chr11273 --1862 --
NM_004586chrX65210 5028 3602 3347 1790 492 --35039 1728 873 --
NM_004591chr22159 82 ----1418
NM_004593chr33277 228 171 ------
NM_004594chr161944 ------
NM_004598chr573321 2597 690 478 172 63 32 ----1826
NM_004600chr1--21192 427 1623 --
NM_004606chrX184 ------
NM_004612chr954038 4016 3507 1404 464 1200 33358 1774 929 1637
NM_004615chrX2934 310 --1806 --
NM_004622chr242447 1543 313 108 ------
NM_004627chr211629 1226 ----
NM_004636chr3--1405 ----
NM_004637chr321258 923 ------
NM_004642chr122683 496 --1191 --
NM_004654chrY11052 139 ----
NM_004655chr17--11324 11271 21071 532
NM_004657chr221139 71 ----11293
NM_004660chrY51682 1523 1485 1422 265 1512 ----
NM_004663chr1511133 ------
NM_004667chr15--3655 592 241 ----
NM_004671chr181208 ------
NM_004684chr43351 324 273 ------
NM_004685chr1342690 1067 829 389 --32947 256 180 --
NM_004686chr81510 ------
NM_004687chr1741523 1318 845 773 --21834 1593 1526
NM_004690chr61600 --1659 --
NM_004703chr1732533 2368 30 ------
NM_004709chrX21678 1139 11217 ----
NM_004714chr192236 129 ------
NM_004719chr1262746 2487 2133 373 344 168 12346 11015 --
NM_004721chr3----1309 --
NM_004725chr10--2953 210 1343 --
NM_004726chrX33929 2206 1346 --1150 --
NM_004730chr541619 1416 685 444 --22117 643 12024
NM_004733chr31563 ------
NM_004734chr1343063 2625 2344 816 ------
NM_004736chr11766 --12153 12107
NM_004741chr1021515 181 1547 ----
NM_004742chr321743 1182 --31600 1341 246 --
NM_004745chr832672 2458 1506 --11571 --
NM_004748chr1533813 3459 525 11584 ----
NM_004751chr151420 ------
NM_004755chr1451217 990 797 399 33 --1815 11004
NM_004757chr4------1103
NM_004759chr111824 --11697 --
NM_004760chr7186 --21856 1603 1365
NM_004762chr173506 490 74 ------
NM_004768chr13905 402 394 ------
NM_004770chr81191 ------
NM_004772chr541546 1499 1341 465 11395 ----
NM_004774chr1742389 2318 2071 437 ------
NM_004776chr2033306 2757 2038 --23227 2169 --
NM_004779chr52120 64 --11219 --
NM_004780chrX1219 --172 --
NM_004781chr131734 200 164 11702 --1551
NM_004781chr131734 200 164 11702 --1551
NM_004787chr41154 ------
NM_004788chr1122564 2513 --11686 --
NM_004792chr2----1186 --
NM_004796chr1432295 1909 1845 --12412 --
NM_004798chr2033683 2665 2281 --23388 2483 --
NM_004799chr11432 --2424 69 --
NM_004800chr131262 ------
NM_004801chr2----1529 --
NM_004805chr231219 1077 81 ------
NM_004808chr1073150 2938 1201 957 564 387 159 --1630 12702
NM_004822chr1764028 3725 3638 2941 2764 1511 --12552 --
NM_004824chr631363 1255 1141 ------
NM_004831chr1951115 870 163 98 26 --1433 --
NM_004834chr23984 912 800 23294 1369 ----
NM_004836chr2----1608 --
NM_004839chr153598 534 85 ------
NM_004842chr621772 719 --11548 --
NM_004849chr631609 1107 179 11156 ----
NM_004850chr241753 1169 645 582 ------
NM_004856chr151461 ------
NM_004857chr1444790 4100 879 870 --21832 538 --
NM_004859chr1752330 2286 1957 1072 407 11058 22321 312 --
NM_004866chr584345 1814 1161 987 644 594 507 373 11196 13276 --
NM_004867chrX2474 102 ------
NM_004871chr1754375 4289 4157 3293 506 11493 14346 --
NM_004874chr81413 ------
NM_004887chr511114 --11068 --
NM_004888chr92707 167 1962 ----
NM_004891chr21194 ------
NM_004893chr51380 ------
NM_004896chr1031489 1223 1205 ------
NM_004902chr202711 621 ------
NM_004904chr746557 6449 4831 693 22499 1058 14681 14482
NM_004906chr62669 555 ------
NM_004912chr73448 436 322 --11118 --
NM_004921chr111863 12293 22237 214 --
NM_004927chr1121464 146 ------
NM_004929chr8--160 ----
NM_004936chr943015 2049 1202 717 11863 1935 12523
NM_004938chr911001 11160 11269 --
NM_004939chr21125 --170 --
NM_004945chr191810 --1230 --
NM_004946chr5----1421 --
NM_004947chr342474 2264 525 322 --2461 111 1414
NM_004948chr1831436 477 461 11145 1571 --
NM_004949chr1832008 802 669 ------
NM_004956chr744446 1044 530 174 1933 31516 561 34 1146
NM_004958chr1----148 --
NM_004963chr123157 116 48 ------
NM_004965chr212762 48 ------
NM_004966chr102875 101 ------
NM_004969chr10138 ------
NM_004973chr621595 1119 --21440 176 21738 98
NM_004976chr1145110 3615 1973 1851 ------
NM_004978chr121478 231 ------
NM_004982chr121484 ------
NM_004984chr12131 1131 1173 --
NM_004985chr1274310 3895 3646 3587 1365 1085 55 14509 24375 4197 --
NM_004992chrX68446 8201 8017 5500 3305 1120 --47832 6195 5764 246 1983
NM_004992chrX68446 8201 8017 5500 3305 1120 --47832 6195 5764 246 1983
NM_004995chr142314 189 ------
NM_004998chr152827 705 2808 246 ----
NM_004999chr654486 4338 4166 1233 469 --14074 --
NM_005010chr741488 871 739 542 --11617 --
NM_005011chr72428 209 --1160 --
NM_005020chr7144 --1459 --
NM_005027chr1921199 881 ------
NM_005028chr1031471 681 267 11539 ----
NM_005030chr161234 ------
NM_005032chrX2996 715 ------
NM_005037chr3------149
NM_005045chr71899 --1965 --
NM_005054chr241684 521 512 159 11563 21338 144 --
NM_005056chr1275478 4317 3766 3708 3650 2091 396 1502 --14571
NM_005063chr1023007 2967 ----13849
NM_005065chr1445107 4369 1381 951 --64668 4001 1505 1100 940 65 1739
NM_005066chr1----2760 74 --
NM_005079chr821160 75 11025 13221 --
NM_005080chr22----1626 --
NM_005087chr3158 ------
NM_005088chrX2325 288 --1888 --
NM_005093chr2075307 4966 4343 4215 1819 890 170 15223 ----
NM_005095chr121973 1565 ------
NM_005096chrX1209 --11030 --
NM_005097chr101290 ------
NM_005102chr21343 --1697 --
NM_005109chr332223 992 487 ------
NM_005120chrX2207 27 ------
NM_005121chr1783760 3231 3201 3165 2832 2506 1537 1404 ----23114 909
NM_005124chr63908 686 344 --269 21 --
NM_005126chr312030 11646 12173 --
NM_005133chr111388 ------
NM_005134chr181344 ------
NM_005135chr1523851 3738 ------
NM_005140chrX1379 2772 92 ----
NM_005141chr4150 ------
NM_005151chr1842383 648 637 391 ----1255
NM_005153chr161773 --2659 547 --
NM_005154chr152429 421 1595 ----
NM_005156chr965407 4649 3881 3732 1334 992 24154 1869 24725 367 --
NM_005157chr951902 767 591 468 177 --11555 --
NM_005168chr2----21679 325 --
NM_005171chr1211115 --31270 1171 359 --
NM_005178chr192425 127 ------
NM_005180chr1031621 505 466 ------
NM_005181chr81741 --1853 --
NM_005184chr192463 260 ------
NM_005188chr1167455 7404 7223 6504 1296 213 --12084 --
NM_005197chr1476223 6084 5712 3773 2435 1689 1675 --26091 5209 --
NM_005203chr102143 39 ------
NM_005204chr102699 290 ------
NM_005214chr22350 98 1159 ----
NM_005215chr182587 236 ------
NM_005219chr511690 ------
NM_005220chr172558 167 ------
NM_005221chr71133 ------
NM_005222chr72934 301 ------
NM_005230chr12----1117 --
NM_005233chr342536 2314 2302 2062 1504 ----
NM_005235chr267734 7437 7142 2272 2107 1430 --47247 7015 2147 1086 --
NM_005238chr1131203 953 478 ------
NM_005239chr2131706 799 141 ------
NM_005241chr341329 1103 396 202 11360 ----
NM_005242chr53536 155 30 ------
NM_005243chr222125 26 ------
NM_005249chr141778 --2740 48 --
NM_005252chr142579 528 161 ----
NM_005254chr1521331 469 ------
NM_005256chr111752 ------
NM_005257chr1841365 1302 518 95 --1327 --
NM_005259chr221420 947 ----11473
NM_005277chr491960 1951 1867 1559 1469 1432 1391 448 37 --1633 1350
NM_005281chr12973 759 ------
NM_005284chr61492 ------
NM_005296chrX1884 ------
NM_005302chr7----1416 --
NM_005310chr171322 ------
NM_005311chr722822 2580 --21785 402 --
NM_005313chr1531380 286 169 ------
NM_005316chr1121003 385 --2858 153 --
NM_005324chr173687 643 512 --31974 106 100 --
NM_005328chr82548 241 --1503 --
NM_005329chr1642357 2144 502 251 --12049 --
NM_005333chrX31005 175 151 --181 --
NM_005338chr743688 2874 2766 462 ------
NM_005339chr454254 1171 1070 448 390 13020 33577 1027 457 --
NM_005342chrX62816 1908 762 509 280 220 ------
NM_005358chr1331721 1526 731 --2707 410 --
NM_005359chr1826223 2551 --45173 1851 1361 1037 --
NM_005370chr1921291 961 ------
NM_005375chr651149 1034 983 845 144 1758 1897 --
NM_005378chr22567 38 1573 ----
NM_005382chr81369 ------
NM_005385chr352666 2100 1763 662 447 12590 ----
NM_005386chr202566 211 1802 1782 --
NM_005388chr921501 396 ------
NM_005392chr921907 1472 ------
NM_005399chr131287 985 477 13441 2152 51 --
NM_005400chr273044 2959 2826 2338 1916 1203 1025 --1140 --
NM_005402chr731678 576 494 ------
NM_005406chr1821156 1098 ------
NM_005414chr31302 --1208 --
NM_005417chr2032007 1595 256 ------
NM_005430chr12----2692 266 --
NM_005433chr183963 534 140 12301 2757 464 --
NM_005436chr1053791 3727 3653 1491 1275 --21238 107 --
NM_005437chr101495 --11461 --
NM_005438chr11------1226
NM_005439chr12129 ------
NM_005440chr1743275 2982 1191 1182 1447 ----
NM_005443chr41134 ------
NM_005450chr171177 ------
NM_005455chr111557 21782 1694 ----
NM_005460chr51397 ------
NM_005461chr2061698 1464 1373 1354 687 366 21290 634 11624 --
NM_005465chr11201 --11845 --
NM_005475chr1233234 1207 638 ------
NM_005476chr911367 --11236 1381
NM_005477chr1522448 721 ------
NM_005477chr1522448 721 ------
NM_005487chr2221950 1751 --12122 --
NM_005493chr62773 101 ------
NM_005494chr73658 239 112 ------
NM_005497chr17106017 5765 5712 5703 5621 5371 4621 4457 1581 354 --24630 4466 --
NM_005499chr193663 536 455 ------
NM_005502chr982965 2892 2744 2709 2562 1170 125 58 --33117 2096 1036 --
NM_005504chr1285954 5094 4652 2643 2178 1752 1184 599 22453 581 56214 6069 5881 295 70 --
NM_005509chr52360 145 11313 ----
NM_005513chr31285 --11470 --
NM_005517chr151430 1185 1088 1049 29 ------
NM_005521chr101792 ------
NM_005522chr71949 1448 ----
NM_005537chr13----1702 --
NM_005542chr7----21933 1863 --
NM_005544chr23921 356 235 ------
NM_005563chr14890 271 242 58 --1610 --
NM_005569chr2231463 1394 1256 ------
NM_005573chr52676 235 --1461 --
NM_005578chr354858 4131 3255 272 240 14889 ----
NM_005595chr12656 82 ------
NM_005596chr9125588 5351 5050 4603 4539 3982 2016 1575 1460 1322 1143 440 11188 35085 4927 1624 --
NM_005598chr131663 1287 1154 ------
NM_005602chr311293 --11210 --
NM_005603chr183694 451 442 --192 --
NM_005604chr6----21830 527 --
NM_005605chr81111 ------
NM_005613chr152141 1793 1658 1511 629 ------
NM_005618chr6------1227
NM_005626chr1144 ------
NM_005627chr63906 139 109 --1797 --
NM_005634chrX2164 115 ------
NM_005637chr1822042 1301 --11790 --
NM_005638chrX21547 1193 --11245 --
NM_005639chr1261562 1205 452 148 103 25 ------
NM_005644chr11372 ------
NM_005647chrX63370 3101 2729 2349 490 112 --23248 801 --
NM_005648chr81148 ------
NM_005655chr821292 810 --11312 --
NM_005662chr82395 309 ------
NM_005665chr154481 4113 1729 1717 1044 --13936 11571
NM_005668chr564110 3265 1742 980 278 29 --21754 1542 11301
NM_005688chr321263 418 1432 21129 229 --
NM_005708chr13131 ------
NM_005715chr632542 984 586 1102 12524 --
NM_005721chr21344 --11079 --
NM_005722chr222104 483 12037 ----
NM_005725chr131752 132 124 ------
NM_005734chr112528 167 ------
NM_005737chr252456 1013 1006 903 462 --1531 --
NM_005738chr731905 1401 378 11556 ----
NM_005746chr7102731 2477 973 740 708 550 373 324 177 53 ------
NM_005748chr121954 23050 2351 11158 --
NM_005749chr171637 ------
NM_005751chr71343 ------
NM_005754chr52341 282 ------
NM_005759chr251761 728 606 556 201 44783 4096 3597 2927 14603 --
NM_005765chrX2334 282 ------
NM_005766chr131400 ------
NM_005776chr142682 568 1308 1270 --
NM_005778chr31436 ------
NM_005782chr171198 ------
NM_005786chr1841227 1133 968 847 21188 57 1413 137
NM_005789chr1711707 --21453 329 --
NM_005795chr242609 2522 2343 330 ------
NM_005808chr343341 2945 215 33 22924 2242 ----
NM_005822chr62925 836 ------
NM_005826chr1----1486 --
NM_005828chr1784862 4818 3982 3487 3200 1860 569 116 --21878 1510 --
NM_005833chr9--1157 ----
NM_005839chr1142 ------
NM_005840chrX76229 5808 2939 2640 2509 2108 1584 14686 12367 --
NM_005841chr411101 ------
NM_005842chr132556 237 ------
NM_005843chr231910 1340 1247 ------
NM_005845chr1331564 1309 1278 --21134 74 --
NM_005852chr1721148 1024 ------
NM_005857chr1--11349 ----
NM_005859chr531062 977 365 ------
NM_005862chr341025 809 783 397 11043 ----
NM_005870chr1321376 238 ----11183
NM_005871chr102943 315 1864 1156 --
NM_005880chr1641519 1129 477 361 ------
NM_005882chr41901 --1178 --
NM_005885chr531068 600 263 ------
NM_005897chr121104 253 ------
NM_005898chr1153002 2694 740 468 234 12151 11255 --
NM_005900chr4144 ----11100
NM_005901chr1898339 8036 3097 2256 1902 1771 1510 392 370 27680 5519 1807 22557 1130
NM_005902chr1534553 3668 1534 --1955 --
NM_005903chr575212 5045 3608 1540 1189 537 416 1835 24819 852 --
NM_005904chr1811370 ------
NM_005906chr641641 493 430 175 ------
NM_005909chr533911 980 519 1273 ----
NM_005911chr21564 --1334 --
NM_005917chr21184 ------
NM_005920chr141046 624 303 296 ------
NM_005922chr61389 ------
NM_005923chr62625 102 1605 ----
NM_005924chr71749 --4778 439 375 286 --
NM_005926chr151457 1362 ----
NM_005933chr1142693 2588 2564 1916 --12492 --
NM_005935chr464973 4467 4325 3552 1485 44 11305 13680 --
NM_005937chr1744129 3638 1488 914 --11422 1701
NM_005941chr853287 2923 1470 1440 1360 23218 1460 ----
NM_005955chr194897 4690 4569 3839 2170 1611 1065 926 248 --35468 1581 366 --
NM_005962chr1022176 676 ----12131
NM_005962chr1022176 676 ----12131
NM_005963chr17----172 --
NM_005964chr1741517 1408 477 238 ------
NM_005966chr242396 2020 1678 1539 ------
NM_005968chr19----1171 --
NM_005969chr1131202 268 248 ------
NM_005986chr1341874 652 257 96 ------
NM_005994chr171749 ------
NM_005996chr123994 629 53 --1238 1489
NM_006007chr954158 4085 1425 1102 1076 43349 1087 743 707 21039 680 --
NM_006010chr32196 21 ------
NM_006011chr1564204 4151 3837 1153 1146 956 ------
NM_006015chr14881 874 486 366 ------
NM_006016chr642223 1632 1624 1542 ------
NM_006022chr132710 677 --21068 360 --
NM_006033chr1841861 1777 336 180 --21611 509 --
NM_006037chr264308 3718 3672 1719 1666 1222 --23882 1426 --
NM_006038chr2041903 742 723 104 ------
NM_006047chr2033165 2630 110 --12993 --
NM_006054chr1131363 1158 108 ----171
NM_006060chr7114275 3755 3219 3025 2965 2794 2693 1752 1650 575 212 12770 14280 --
NM_006063chr2185 1442 ----
NM_006064chrX1265 1384 ----
NM_006067chr162909 799 ------
NM_006070chr3--1353 ----
NM_006073chr641799 1406 438 273 ----1556
NM_006076chr71990 ------
NM_006079chr62799 145 ------
NM_006080chr752408 2213 1036 963 478 22833 2058 12921 --
NM_006094chr841923 1739 690 448 11868 22412 951 --
NM_006095chr474388 3710 3572 3145 2837 703 180 --13136 --
NM_006100chr3184 --2221 51 --
NM_006106chr1132602 1039 700 ------
NM_006108chr1132349 1483 29 ----1249
NM_006113chr131694 606 103 --11899 --
NM_006133chr1112340 --12377 --
NM_006134chr2151153 570 561 176 96 --21369 1301 --
NM_006135chr131369 524 381 ------
NM_006141chr161533 1641 22497 995 --
NM_006143chr121125 ------
NM_006147chr15463 453 417 376 44 ------
NM_006148chr1722666 2060 ------
NM_006153chr31624 ------
NM_006154chr1562900 2721 2588 2263 923 429 --1192 --
NM_006157chr11--1351 ----
NM_006158chr821528 1299 --11354 --
NM_006159chr121578 ------
NM_006161chr51612 1477 2661 245 --
NM_006162chr1831541 1448 629 ------
NM_006164chr21360 ----144
NM_006166chr1252277 975 472 272 236 --12567 --
NM_006167chr83675 553 313 --1808 --
NM_006180chr951941 1559 1485 1349 162 1334 ----
NM_006183chr12--1143 ----
NM_006186chr211001 ------
NM_006194chr1421237 939 ------
NM_006195chr941204 966 407 47 --11045 --
NM_006202chr1921580 632 ------
NM_006203chr575144 4141 3505 751 543 481 384 --23729 892 --
NM_006206chr452382 2295 2244 902 444 --22761 2271 --
NM_006209chr81318 ------
NM_006216chr24677 648 206 98 --1663 --
NM_006218chr3394 83 48 ------
NM_006226chr221412 1142 ----1335
NM_006237chr1321861 114 ----11499
NM_006246chr1421142 511 ------
NM_006251chr542781 2074 988 129 --12484 --
NM_006252chr1127512 7171 6950 6291 6041 5642 5461 5372 2629 2604 2557 547 --26007 824 24691 32
NM_006255chr1421134 776 --2750 694 --
NM_006256chr152726 2248 1087 1039 782 --1187 --
NM_006265chr81346 ------
NM_006267chr251909 446 231 217 173 ------
NM_006268chr112987 265 ------
NM_006275chr202967 21 ------
NM_006277chr23680 491 67 ------
NM_006281chr82755 186 --31093 998 315 --
NM_006281chr82755 186 --31093 998 315 --
NM_006282chr2054007 1567 1136 592 562 --14445 --
NM_006283chr8104743 4094 3280 1676 1513 1204 1198 1089 193 34 21465 1268 34116 3666 1920 --
NM_006284chr11121 ------
NM_006290chr631878 1615 1575 ------
NM_006292chr112233 172 ------
NM_006298chr662261 2117 1243 1200 1060 539 22317 78 ----
NM_006301chr12122 ------
NM_006313chr1231669 1498 1088 1425 ----
NM_006315chr453501 3283 2834 1168 1131 --13876 --
NM_006317chr53874 355 332 ------
NM_006320chr41943 ------
NM_006321chr331956 473 328 ------
NM_006322chr133944 224 190 --145 --
NM_006323chr41619 ------
NM_006330chr811050 ------
NM_006333chr21657 --1541 --
NM_006334chr93219 96 88 --1289 --
NM_006335chr13784 732 433 --1212 --
NM_006343chr22309 67 ------
NM_006350chr5198 ------
NM_006352chr131482 425 313 --31507 839 132 12045
NM_006353chr6127 1947 ----
NM_006359chrX42216 1598 907 39 --1201 165
NM_006364chr141487 --11166 1847
NM_006367chr131073 929 282 ------
NM_006373chr17----21052 80 --
NM_006379chr732164 303 156 ------
NM_006380chr1754374 3750 3397 2856 1722 --31685 356 98 --
NM_006386chr222577 300 --12171 12353
NM_006389chr11----11355 --
NM_006390chr1281168 1140 605 479 404 370 307 39 21843 1733 ----
NM_006393chr1064380 4232 4187 811 770 615 ------
NM_006400chr121137 --1375 --
NM_006413chr1021025 217 1448 ----
NM_006416chr6----1701 147
NM_006420chr20113310 3209 2975 2788 2698 2208 2117 962 937 280 196 ------
NM_006431chr12--1224 ----
NM_006434chr1062440 2344 2159 958 827 599 --12829 --
NM_006451chr51751 ------
NM_006459chr104761 563 435 280 --1752 --
NM_006460chr1741658 1180 447 276 ------
NM_006463chr2150 ------
NM_006464chr271524 1496 741 441 369 233 226 --23254 434 --
NM_006465chr151169 ------
NM_006469chr161166 1135 316 207 131 124 1347 ----
NM_006471chr18168 --194 --
NM_006482chr1273706 3565 3204 2852 2698 2518 739 --21268 836 --
NM_006483chr192236 129 ------
NM_006484chr192236 129 ------
NM_006489chr143720 522 65 ------
NM_006496chr121530 294 ------
NM_006497chr173783 684 531 ------
NM_006504chr1032483 2414 400 ------
NM_006520chrX21302 303 --1471 --
NM_006526chr203393 319 195 --41948 1653 1388 124 --
NM_006527chr42190 83 ------
NM_006530chr121337 --1349 1153
NM_006534chr202924 718 154 12587 --
NM_006537chr15194 --1622 --
NM_006538chr283578 3351 2732 1170 1034 849 692 638 --14099 --
NM_006540chr82993 241 ------
NM_006544chr1485864 4779 4213 3889 2364 2251 1731 1221 14674 1347 34697 3991 1627
NM_006546chr1731462 1302 529 --14054 --
NM_006547chr731912 550 271 --12053 --
NM_006549chr1242857 2394 423 260 ------
NM_006554chr21246 ------
NM_006557chr931654 304 297 ------
NM_006559chr141126 1097 927 166 ------
NM_006561chr1066020 5778 4622 2381 262 206 --12468 --
NM_006565chr1631178 1161 1030 --11168 --
NM_006570chr92373 52 ------
NM_006574chr3172 --1294 --
NM_006575chr1421208 131 185 ----
NM_006577chr23859 260 25 11209 ----
NM_006593chr24767 539 180 96 ------
NM_006595chr1121312 630 ------
NM_006599chr1678171 7753 7428 5817 5488 2856 398 17044 12005 --
NM_006601chr1211060 --1718 --
NM_006603chrX2246 145 11658 21925 1839 1371
NM_006605chr22----1131 --
NM_006606chr202350 26 ------
NM_006614chr3103473 3082 3003 2700 1379 983 897 875 333 252 ------
NM_006622chr51481 ------
NM_006624chr1052079 1852 728 140 104 --1249 --
NM_006625chr1----1204 11026
NM_006625chr1----1204 11026
NM_006625chr1----1204 11026
NM_006628chr1544533 1144 739 185 1689 13606 --
NM_006633chr52624 226 1599 ----
NM_006636chr2----1329 --
NM_006644chr131257 ------
NM_006654chr1244291 614 210 27 14000 34058 1258 970 23786 3682
NM_006662chr16----1263 --
NM_006670chr62626 441 ------
NM_006675chr1263334 2402 2232 2116 274 81 --13347 --
NM_006682chr72572 167 11084 ----
NM_006690chr2021738 142 ------
NM_006700chr12----1804 --
NM_006706chr5145 181 ----
NM_006710chr22920 750 1708 ----
NM_006713chr5130 1152 ----
NM_006717chr983310 3141 2952 2795 2689 2643 2405 1286 --22414 2112 --
NM_006718chr62922 196 ------
NM_006722chr372848 2334 2096 1049 927 216 22 --11086 --
NM_006724chr61389 ------
NM_006726chr411038 ----1936
NM_006729chrX75155 5123 1319 145 104 76 53 14660 14118 --
NM_006732chr1952138 2075 2049 1379 508 ------
NM_006734chr651076 630 509 297 231 1639 --1414
NM_006735chr71327 ------
NM_006738chr1522948 620 --23483 1235 --
NM_006745chr4----11090 --
NM_006746chrX11385 ------
NM_006750chr1638031 6557 2571 --15980 --
NM_006754chr731144 1079 395 ------
NM_006756chr831321 1243 578 --11286 --
NM_006761chr17------1797
NM_006765chr8181 ------
NM_006766chr831889 1658 965 --12527 --
NM_006772chr6----11487 --
NM_006775chr63903 443 236 1762 13014 --
NM_006777chrX62863 2699 2245 1871 1859 760 ------
NM_006788chr1831801 1690 1343 --22031 1308 --
NM_006791chr152585 69 ------
NM_006805chr521159 631 ------
NM_006806chr211171 ------
NM_006807chr1741257 381 240 183 ------
NM_006811chr201402 ----1782
NM_006813chr62904 337 ------
NM_006815chr1221296 377 ------
NM_006823chr841169 503 114 67 --11215 --
NM_006826chr231203 1152 1046 ------
NM_006827chr1442300 1038 948 32 --1751 --
NM_006832chr1431072 751 709 1151 1948 1676
NM_006852chr1722182 304 ------
NM_006857chr21758 --182 --
NM_006874chr41393 --11068 --
NM_006885chr1673723 3357 3097 1445 1350 1308 391 --1871 --
NM_006887chr21751 --1656 --
NM_006888chr1453403 2884 2830 2781 632 --32926 1100 554 1240
NM_006892chr2011154 ------
NM_006892chr2011154 ------
NM_006895chr232090 1944 442 21551 372 11426 --
NM_006897chr121425 ------
NM_006908chr731493 339 47 11032 1541 --
NM_006910chr161114 ------
NM_006912chr132533 833 346 --1961 1256
NM_006914chr931434 532 117 ------
NM_006915chrX1527 ----22479 505
NM_006918chr1155196 5018 4189 1165 338 23763 856 --15189
NM_006920chr22579 563 11743 1361 --
NM_006922chr231864 383 324 22411 1762 12012 --
NM_006924chr1712828 --1123 --
NM_006925chr141426 ------
NM_006930chr541452 1241 163 95 --1751 --
NM_006931chr1211481 --11941 --
NM_006937chr173479 401 157 --1195 --
NM_006938chr183691 680 49 ------
NM_006939chr14----2305 262 --
NM_006940chr121692 --1730 --
NM_006941chr221242 11148 ----
NM_006948chr2132231 593 307 22394 1713 1774 --
NM_006951chr102784 264 --1778 --
NM_006955chr1073421 2535 2320 2279 2178 767 651 12541 12783 --
NM_006965chr1831024 481 343 ------
NM_006981chr922978 2716 ----12258
NM_006982chr121255 ------
NM_006996chr131596 1188 103 --21859 1818 1684
NM_006997chr102398 302 1111 ----
NM_006999chr541880 1372 606 295 11792 ----
NM_007005chr931517 1501 350 ------
NM_007006chr1642542 2159 811 231 --12554 --
NM_007008chr25922 899 749 381 144 ------
NM_007011chr1556091 5946 5626 4851 1476 --1215 --
NM_007013chr8162 --2789 34 --
NM_007019chr201171 ------
NM_007023chr22821 143 --1892 --
NM_007034chr12869 128 --21024 721 --
NM_007035chr122682 644 1185 ----
NM_007038chr2175946 5631 4637 1611 1304 1035 171 14427 25613 4619 25448 1269
NM_007040chr1921030 735 ------
NM_007042chr322411 367 --1319 --
NM_007045chr6----1115 --
NM_007050chr2077800 7742 6075 6026 5042 2387 2293 ------
NM_007052chrX130 --1146 --
NM_007054chr563880 2786 1412 722 386 191 --3525 423 238 1220
NM_007064chr311408 1685 11240 --
NM_007078chr1063023 1951 1220 1206 1172 169 --22770 243 --
NM_007084chr131461 --1293 1575
NM_007096chr9--1254 ----
NM_007106chr1342252 1118 688 563 ----1364
NM_007107chr311876 12197 ----
NM_007111chr132841 607 ------
NM_007114chr342856 2028 1175 1138 --12090 --
NM_007118chr53902 812 175 --1124 --
NM_007124chr631275 756 432 --11630 --
NM_007125chrY31325 561 191 1435 ----
NM_007145chr192450 51 --21234 152 --
NM_007146chr1752393 1119 520 504 486 ------
NM_007150chrX1155 12111 ----
NM_007158chr12358 269 --1427 --
NM_007159chr3------11734
NM_007166chr1121395 1155 1432 11273 --
NM_007170chr11269 ------
NM_007173chr1162413 1494 1476 706 553 237 ------
NM_007174chr1222143 278 --1242 --
NM_007178chr121441 ------
NM_007185chr1----21000 332 --
NM_007187chr134746 359 338 21 2771 350 1198 --
NM_007189chr751205 1196 607 158 101 ------
NM_007190chr1031157 756 23 --11048 --
NM_007191chr12----1618 --
NM_007197chr121178 ------
NM_007198chr811520 134 ----
NM_007200chr1522948 620 --23483 1235 --
NM_007202chr171753 1663 ----
NM_007203chr943084 2497 2420 1502 --13320 1473
NM_007212chr122288 67 --1867 11736
NM_007214chr621033 32 ------
NM_007217chr3126 ------
NM_007218chr81223 ------
NM_007220chrX134742 4660 4446 4431 4147 3674 3157 3023 1597 1199 1094 115 91 --24649 770 --
NM_007222chr811146 21497 528 ----
NM_007231chrX42080 961 572 285 ------
NM_007236chr153820 685 121 --11646 --
NM_007246chr42905 102 ------
NM_007249chr13139342 9267 8989 8375 8200 7723 7017 5949 3760 3693 1788 1446 295 --12552 12186
NM_007256chr1121672 382 ------
NM_007270chr731518 258 99 --11479 --
NM_007276chr71163 ------
NM_007285chr162323 108 ------
NM_007286chr532120 1937 1325 ------
NM_007287chr331174 628 101 ------
NM_007288chr331174 628 101 ------
NM_007289chr331174 628 101 ------
NM_007292chr1755029 4718 3727 3497 1609 --1572 --
NM_007313chr951902 767 591 468 177 --11555 --
NM_007315chr221120 1048 ----11395
NM_007324chr11432 --2424 69 --
NM_007325chrX62163 2118 2062 1942 1442 579 11596 ----
NM_007331chr442606 2445 2240 478 1169 ----
NM_007345chr1821768 502 ------
NM_007347chr1543235 3072 1061 197 1376 12199 --
NM_007349chr72449 76 --1376 --
NM_007358chr131562 581 31 ------
NM_007361chr141513 --1555 --
NM_007363chrX31000 980 223 1124 ----
NM_007368chr1331453 1310 1100 ------
NM_007372chr171879 ------
NM_007373chr1031265 1148 579 11315 --1118
NM_007375chr142785 2116 1724 333 191 42451 2158 1077 979 12466
NM_012072chr2054240 3966 1358 1033 807 23092 713 1520 --
NM_012081chr573451 3294 3204 3096 2443 487 166 --12962 --
NM_012082chr8----1316 --
NM_012089chr1----11505 --
NM_012093chr121170 238 ----11042
NM_012095chr1043242 3233 1041 600 --11280 --
NM_012096chr343767 2494 851 613 21491 204 2314 172 22816 1089
NM_012097chr222184 807 12042 --1625
NM_012104chr1123454 3005 ------
NM_012104chr1123454 3005 ------
NM_012115chr6137 ------
NM_012117chr12134 ------
NM_012118chr4----1461 --
NM_012120chr61883 --12556 1704
NM_012137chr132891 2786 2706 --22963 2216 --
NM_012141chr13103985 3474 3432 3305 2577 1470 1095 688 459 97 --33974 3685 79 --
NM_012156chr2032649 921 507 --1206 --
NM_012161chr421103 59 --11087 --
NM_012175chr112689 664 ------
NM_012183chr11601 ------
NM_012193chr1185380 4706 4561 3600 939 639 564 533 --51527 1112 997 898 778 14931
NM_012197chr91547 11383 ----
NM_012199chr174502 4294 3735 2905 1497 1487 819 --44512 4381 1002 920 --
NM_012207chr101184 ------
NM_012214chr296171 5954 5615 5295 1503 957 818 604 283 26108 928 --1250
NM_012215chr1031461 1347 620 11508 21604 599 --
NM_012218chr1942976 1908 1201 35 ------
NM_012219chr332835 2281 72 ------
NM_012229chr102568 181 1427 11237 --
NM_012234chr352337 2315 1319 766 76 1455 12283 --
NM_012238chr1051746 1642 1547 1290 177 --1693 --
NM_012242chr103764 308 273 ------
NM_012243chr13297 174 65 --1762 --
NM_012247chr1031004 954 877 ------
NM_012248chr161169 ------
NM_012249chr232807 1397 650 1695 ----
NM_012250chr1121313 1066 ------
NM_012252chr735370 5310 4393 24817 321 21212 1149 --
NM_012255chr203428 339 185 ------
NM_012257chr741042 417 343 36 --2858 835 --
NM_012259chr621285 445 --11084 11401
NM_012262chr175087 3794 3197 1025 969 878 457 --45037 4692 3442 936 --
NM_012264chr2221973 218 ------
NM_012264chr2221973 218 ------
NM_012281chr73755 720 578 22412 951 1796 --
NM_012282chrX1352 1244 ----
NM_012286chrX--1574 ----
NM_012289chr19159 ------
NM_012290chr241529 1479 1289 606 ------
NM_012297chr451886 1803 1713 939 462 1477 155 11880
NM_012300chr522375 2054 --32402 1719 374 --
NM_012301chr721942 1468 ------
NM_012302chr12929 374 ------
NM_012304chr551848 1612 992 531 253 ------
NM_012307chr1821095 24 ------
NM_012308chr1132217 480 330 --1694 --
NM_012309chr1161701 620 534 503 365 329 --13364 13435
NM_012316chr1104856 4018 3865 2142 1737 1659 650 576 538 327 13915 23579 3434 --
NM_012317chrX2722 662 ------
NM_012319chr18--182 ----
NM_012323chr2221464 1058 --1436 --
NM_012325chr202632 139 11138 ----
NM_012328chr731217 944 401 ------
NM_012329chr1731051 104 78 ------
NM_012330chr101483 ------
NM_012333chr131529 640 447 --1605 --
NM_012338chr721188 871 ------
NM_012343chr52780 419 ------
NM_012345chr13----11290 1719
NM_012347chr642876 1870 1167 33 --12658 1456
NM_012382chr554337 1776 1672 755 409 13291 1799 --
NM_012395chr753342 3237 3225 2986 199 --13050 --
NM_012399chr2221665 1608 ------
NM_012402chr1141383 1374 866 496 ------
NM_012416chr911266 11019 ----
NM_012419chr6----1442 --
NM_012420chr1011949 2914 159 12291 --
NM_012421chr11417 ------
NM_012425chr1032710 2074 1976 --12408 --
NM_012426chr162364 318 1119 ----
NM_012428chr153962 761 357 --1736 --
NM_012431chr733632 468 209 ----188
NM_012434chr6----1108 --
NM_012446chr51614 ------
NM_012454chr6----1538 --
NM_012479chr732167 974 641 ------
NM_012482chr11634 ------
NM_013229chr1222256 290 --42095 468 263 116 1903
NM_013231chr1444082 273 119 111 23147 149 ----
NM_013233chr241469 1375 1287 436 1568 ----
NM_013237chr5----168 --
NM_013253chr1121268 151 1514 11327 1974
NM_013261chr453527 2941 2352 1244 1157 13502 1631 13333
NM_013262chr621316 1303 147 ----
NM_013275chr163799 733 129 ------
NM_013281chr2031288 370 119 --1252 --
NM_013283chr51776 ----1141
NM_013296chr11420 ------
NM_013300chr12----2245 211 --
NM_013305chr181137 ----1803
NM_013313chr2243116 1404 1379 767 12257 22795 2200 --
NM_013316chr71314 1384 ----
NM_013326chr18------155
NM_013330chr11213 --1174 --
NM_013341chr262534 2528 2394 2077 1863 1807 ------
NM_013354chr821360 977 --1430 --
NM_013371chr1----1319 --
NM_013372chr1542242 2229 459 424 13204 ----
NM_013374chr332185 431 101 171 22291 841 1237
NM_013377chr123545 509 277 ------
NM_013381chr121721 181 ----
NM_013382chr1432041 1977 869 --11684 --
NM_013386chr12286 104 --11514 --
NM_013423chrX----11014 --
NM_013427chrX----11014 --
NM_013436chr22673 191 ----1163
NM_013437chr8------1871
NM_013438chr961729 726 508 421 225 130 --21589 374 11526
NM_013444chrX51024 863 356 330 141 11162 1439 11081
NM_013446chr731270 555 521 --1299 --
NM_013448chr141249 1120 ----
NM_013449chr1221931 427 ------
NM_013943chr132879 876 99 1533 21214 824 13022
NM_013951chr211977 --12438 --
NM_013986chr222125 26 ------
NM_013993chr61751 1827 ----
NM_013994chr61751 1827 ----
NM_013995chrX42412 1866 994 971 12025 1403 --
NM_013996chr71388 174 ----
NM_013996chr71388 174 ----
NM_013997chr71388 174 ----
NM_013997chr71388 174 ----
NM_013998chr71388 174 ----
NM_013998chr71388 174 ----
NM_014000chr1021980 652 ------
NM_014010chr9--1604 ----
NM_014011chr222614 2526 ------
NM_014016chr311699 ------
NM_014021chr172856 2471 2310 1350 1325 1138 494 1628 12379 --
NM_014023chr1032705 590 151 ------
NM_014028chr662422 2319 2310 750 480 412 --12777 13147
NM_014031chr51301 1109 ----
NM_014034chr611255 ------
NM_014043chr31259 ------
NM_014048chr1675240 5177 5170 5123 4010 812 447 --25297 91 --
NM_014071chr201481 ------
NM_014089chr1371956 1908 1897 1763 1503 751 87 --22144 2091 --
NM_014110chr12995 983 --1201 --
NM_014112chr843946 3715 1423 270 21704 1591 32203 2012 1993 11353
NM_014117chr1632404 795 463 ------
NM_014153chr162663 575 ------
NM_014154chr33492 213 203 --21442 1432 --
NM_014155chr1166120 5979 2990 1541 1101 329 --27317 5890 12356
NM_014178chr142589 574 --1170 --
NM_014181chr232090 488 362 1371 --12930
NM_014189chr411452 ------
NM_014191chr121974 --2728 423 11052
NM_014212chr122927 639 ------
NM_014223chr12731 549 2706 134 1578 --
NM_014231chr121255 --22154 157 --
NM_014233chr1731982 447 289 ------
NM_014240chr394068 3572 3215 1607 1588 1440 1360 886 277 --33918 1460 795 1537
NM_014243chr41183 11343 32131 1782 1502 --
NM_014245chr31361 ------
NM_014249chr151517 ------
NM_014250chr2221950 1751 --12122 --
NM_014253chrX42449 2368 2178 1589 ------
NM_014263chr1031193 1142 1059 ------
NM_014264chr41500 ------
NM_014265chr82782 197 --1683 --
NM_014268chr1831255 151 134 ------
NM_014271chrX1139 1102 ----
NM_014278chr42380 157 ----1351
NM_014279chr9------1964
NM_014280chr13705 646 165 --2717 294 --
NM_014282chr9135 --2464 132 --
NM_014283chr121133 349 ------
NM_014290chr9----1195 --
NM_014294chr82135 122 1926 ----
NM_014296chr331349 1121 1051 --1239 1525
NM_014299chr1942152 1414 678 333 ------
NM_014300chr151469 ----1132
NM_014305chr13192 ------
NM_014309chr2275416 4829 3919 3848 1321 273 223 14132 23714 1179 --
NM_014315chr14134 ------
NM_014319chr1271807 1420 1344 768 761 559 244 1634 ----
NM_014331chr4147799 7353 7113 6678 6348 6043 5636 4877 2821 2809 1589 1580 1037 867 17098 57717 6575 4754 2815 495 12492
NM_014332chrX1139 ------
NM_014333chr1142523 2490 1781 573 ------
NM_014342chr1111440 --1947 --
NM_014344chr111775 1676 ----
NM_014351chr2221468 69 ------
NM_014363chr1341209 1112 266 63 --1517 --
NM_014372chr121357 493 1688 --11548
NM_014376chr522411 1650 ------
NM_014380chrX1208 --2167 61 --
NM_014382chr32550 293 --11710 21772 369
NM_014392chr43485 329 189 ------
NM_014393chr832253 1516 880 --31726 1544 441 --
NM_014394chr103854 358 77 165 ----
NM_014410chr18----1363 --
NM_014415chr34625 305 232 40 11445 31457 366 336 --
NM_014417chr194931 877 678 181 ------
NM_014421chr4--2801 57 ----
NM_014423chr555601 5357 5188 3462 1886 44033 756 681 653 1746 11171
NM_014426chr202536 214 --160 1490
NM_014431chr1031683 1437 1256 ------
NM_014432chr62339 297 ------
NM_014445chr332418 1574 649 --22043 1816 --
NM_014447chr41118 --31572 1044 298 --
NM_014452chr62856 339 11204 ----
NM_014454chr61857 1790 ----
NM_014456chr10----1298 --
NM_014458chr131333 1250 68 --11115 --
NM_014488chr11------1234
NM_014489chr111854 ------
NM_014491chr72759 733 ------
NM_014494chr163696 589 489 11985 22379 398 --
NM_014515chr12--1880 1384 --
NM_014521chr221717 1158 --1454 11248
NM_014522chrX1653 ------
NM_014554chr1252166 2030 1418 714 142 ------
NM_014563chrX22118 1577 ------
NM_014572chr1331605 1194 578 1224 ----
NM_014574chr1431452 560 234 ----11196
NM_014577chr223715 682 633 --2919 687 --
NM_014585chr221136 417 1348 163 --
NM_014586chr2114445 --34545 4029 3257 --
NM_014587chr1651553 1245 556 415 303 --11355 --
NM_014591chr10----11311 --
NM_014593chr18133 ------
NM_014600chr221646 1459 ------
NM_014612chr911294 11081 11002 1417
NM_014613chr543054 2626 2538 2059 --13007 --
NM_014614chr241063 978 584 152 ------
NM_014615chr1643549 2991 1093 488 11122 2977 784 --
NM_014616chr383461 3434 2390 2125 919 833 635 543 --22862 1306 --
NM_014618chr9139 ------
NM_014629chr811284 ------
NM_014630chr1543677 3519 1495 114 11085 1795 --
NM_014634chr2233411 1221 182 --12814 --
NM_014635chr241662 483 123 107 --11306 --
NM_014636chr9104055 4026 3773 3749 2778 1301 1223 1028 538 454 --14119 --
NM_014637chr811236 --21304 1169 --
NM_014647chr1621975 1706 --12166 --
NM_014653chr1222159 1561 ------
NM_014655chr141643 902 528 497 --12318 --
NM_014660chr71307 --21091 281 --
NM_014666chr5--11139 ----
NM_014667chr342339 2190 2019 1710 --32445 960 164 1485
NM_014670chr21544 --1585 1233
NM_014674chr333762 3746 159 --42883 1571 842 597 --
NM_014676chr131420 1058 259 1203 11444 --
NM_014677chr821303 159 ------
NM_014678chr221121 ------
NM_014679chr1131039 266 255 ------
NM_014682chr882231 2147 2068 1871 528 352 106 76 21686 503 22124 258 1128
NM_014683chr1721334 764 11502 --1598
NM_014685chr16--1416 ----
NM_014686chr1972461 2399 2292 1997 1893 1684 518 1888 1899 --
NM_014700chr1611267 ------
NM_014701chr1562924 1053 981 876 824 750 --183 --
NM_014702chr621190 167 1802 13367 --
NM_014705chr751711 1588 263 150 29 --1761 --
NM_014706chr122803 74 ------
NM_014707chr7------11815
NM_014709chr22611 179 ------
NM_014711chr1631806 769 206 1733 --1650
NM_014712chr161637 ------
NM_014713chr21489 --1339 --
NM_014717chr191643 ------
NM_014721chr6106898 6847 6649 5854 5624 5591 5251 5097 1063 723 25935 1772 45310 2265 1416 79 --
NM_014723chr2023231 3119 ----11029
NM_014725chrX21259 1113 ------
NM_014726chr1731316 1033 479 ------
NM_014727chr192256 223 ------
NM_014729chr861877 1810 1648 925 275 68 --1708 12115
NM_014730chr1245105 4668 4543 4291 ------
NM_014730chr1245105 4668 4543 4291 ------
NM_014732chr1685854 5305 5218 5135 2035 1927 1586 252 12013 25716 5179 --
NM_014733chr542229 2136 1572 306 1788 11877 --
NM_014735chrX1796 11679 1327 --
NM_014736chr152968 215 --2326 274 --
NM_014739chr633724 267 39 23203 3018 1187 11612
NM_014740chr17147 ------
NM_014741chr1122183 1836 ------
NM_014743chr41295 12942 12253 --
NM_014746chr273751 2754 1514 1339 680 621 567 --24279 711 --
NM_014750chr142213 185 ------
NM_014751chr841993 1755 1527 417 --22075 872 --
NM_014752chr1151734 1643 1545 1338 290 ----1227
NM_014755chr242772 1379 561 333 --41059 688 682 510 1940
NM_014756chr111158 ----1477
NM_014757chr541867 1652 1526 1503 ------
NM_014758chr1111836 --12492 --
NM_014764chr1231246 869 820 --11324 --
NM_014765chr142469 2249 878 855 --12347 --
NM_014774chr143238 2238 2086 387 ----12612
NM_014779chr31257 11112 ----
NM_014781chr83805 487 295 --1416 --
NM_014787chr111037 12701 12097 --
NM_014790chr51192 ------
NM_014795chr23877 477 208 1192 2945 306 --
NM_014803chr1032373 802 188 ------
NM_014807chr11----1646 --
NM_014810chr173571 3466 3082 2669 1121 756 230 1644 1109 1989
NM_014812chr121982 699 ----1633
NM_014813chr12612 119 --152 --
NM_014819chr52894 363 --11917 --
NM_014820chr332025 1860 1764 ------
NM_014822chr43622 220 189 --2255 30 --
NM_014824chr112352 83 ----1582
NM_014826chr164283 4105 4095 3890 3821 243 --13379 --
NM_014827chr11383 ------
NM_014828chr1442418 1568 893 359 ------
NM_014829chr51360 --1608 --
NM_014835chr2021938 1485 1646 ----
NM_014836chr1041546 815 220 144 ------
NM_014839chr122113 809 ------
NM_014841chr61238 1178 ----
NM_014846chr81104 --1242 --
NM_014847chr1----1496 --
NM_014848chr1512158 12273 1475 --
NM_014850chr364547 3146 3046 1202 1181 840 ------
NM_014864chr164303 3534 3356 3015 762 744 --34319 3470 490 --
NM_014868chr121590 2879 331 ----
NM_014872chr952134 704 567 407 165 ------
NM_014873chr174779 4492 4196 3085 1576 950 728 21937 64 --13865
NM_014876chr2231990 1558 213 ------
NM_014877chr1787555 6891 5708 5612 4980 1179 551 266 --47225 7083 5327 186 --
NM_014883chr431824 801 490 11005 ----
NM_014887chr13----137 1800
NM_014888chr711256 ------
NM_014890chr31232 ------
NM_014892chr61150 ------
NM_014893chrY41743 1473 951 895 11692 ----
NM_014897chr1753257 3248 2261 2206 1010 23191 952 22850 237 1373
NM_014900chr2126 ------
NM_014901chr542002 767 176 118 --12200 --
NM_014902chr20--11048 ----
NM_014903chr1242416 2245 483 290 ------
NM_014904chr1063732 3543 3375 2948 2719 1279 11168 11469 --
NM_014905chr24461 359 337 225 ------
NM_014906chr1733238 2953 2880 23027 949 13125 --
NM_014912chr1042494 1334 395 100 --33143 2967 227 --
NM_014913chr1831438 1375 504 1510 ----
NM_014914chr231241 1147 1136 ------
NM_014916chr74792 674 520 269 --2608 485 --
NM_014918chr15----11581 --
NM_014920chr633450 2933 2315 12585 ----
NM_014921chr1923012 511 12296 ----
NM_014923chr13--151 ----
NM_014925chr122884 226 ------
NM_014926chr31946 ------
NM_014932chr311685 11478 ----
NM_014933chr41102 ------
NM_014935chr133880 1508 120 ------
NM_014937chr10----179 --
NM_014939chr1811177 ------
NM_014942chr612436 12589 ----
NM_014945chr531733 128 28 ------
NM_014946chr223094 2946 --23056 2850 --
NM_014947chr163012 2963 2928 2302 2144 261 1713 ----
NM_014949chr12970 59 ------
NM_014950chr1421663 460 11615 ----
NM_014951chr1032578 1924 1877 ------
NM_014952chr1511956 ------
NM_014961chr432158 1574 377 ------
NM_014962chr2032381 2084 244 --22845 2686 --
NM_014964chr1742456 2310 2272 604 21593 1519 ----
NM_014969chr141117 1027 318 271 --2944 912 --
NM_014974chr1031617 1567 1206 --11299 1678
NM_014978chr1041858 1540 724 679 ----11710
NM_014982chr14115387 5273 4948 4248 3640 1982 1756 1405 726 296 242 2580 559 ----
NM_014988chr452116 2058 1931 618 469 --1206 --
NM_014989chr641931 1528 1343 823 --21261 787 --
NM_014991chr473043 2948 2585 968 941 769 315 --12794 --
NM_014992chr142612 262 ------
NM_014994chr1531927 485 462 --22381 1831 --
NM_014996chr31988 1957 1741 --
NM_015000chr1242665 2093 751 274 --1695 --
NM_015002chr1272272 2114 1795 487 400 356 21 11860 ----
NM_015004chr31104 ------
NM_015008chr333512 3192 2582 1332 ----
NM_015009chr32701 643 --1245 --
NM_015017chr121148 946 --1821 --
NM_015020chr1653697 1468 1292 918 534 13065 --13116
NM_015024chr821269 1036 --11240 --
NM_015025chr232672 2193 201 --21716 648 12578
NM_015026chr1261875 1744 538 390 328 169 --14704 11583
NM_015027chr16128 ------
NM_015032chr1362610 2525 2127 2050 1084 777 ------
NM_015040chr21749 --43400 1316 740 177 12428
NM_015042chr1553534 3518 2852 1298 502 --11386 13988
NM_015045chr1052215 2017 1984 1814 159 ------
NM_015049chr263121 2623 1042 860 103 58 11006 ----
NM_015055chr1122862 2245 --1338 --
NM_015056chr2152421 955 913 363 38 21712 49 1804 12627
NM_015061chr91556 1887 ----
NM_015062chr10----1210 --
NM_015068chr71723 12550 23967 3428 --
NM_015071chr566158 5108 4195 4002 772 517 ------
NM_015072chr141437 1251 1385 --
NM_015074chr153710 3651 595 346 176 24203 3283 24086 1316 14885
NM_015075chrX31796 1742 1520 ------
NM_015076chr674068 3983 1549 1011 941 814 63 23529 863 34516 1325 1225 11652
NM_015080chr111714 ------
NM_015087chr1321958 185 --12411 1444
NM_015090chr185607 4400 2430 2274 1852 1571 799 563 ----16058
NM_015091chr14189 ----1282
NM_015092chr1683351 1846 1759 1316 963 898 459 176 1147 24002 1393 14648
NM_015093chr621432 592 --11623 --
NM_015097chr322346 1848 --1283 --
NM_015100chr111255 --1782 --
NM_015102chr12362 130 ------
NM_015107chrX1110 ------
NM_015115chr442468 2291 1159 712 --2799 103 23099 2248
NM_015116chr1331690 1629 1114 --21656 1139 --
NM_015125chr191420 --1483 --
NM_015130chr411124 ------
NM_015134chr172662 508 ------
NM_015137chr822376 1969 --11899 --
NM_015138chr1522658 705 ------
NM_015141chr362174 2047 1690 751 595 176 12729 12199 12465
NM_015143chr441204 1016 377 49 ------
NM_015144chr1664008 3971 3828 3727 3294 3219 ----1499
NM_015149chr131583 823 359 ------
NM_015151chr212865 316 --1329 --
NM_015153chr62653 553 ------
NM_015155chr1042079 1061 779 646 22447 1083 ----
NM_015156chr1473259 2721 2504 1452 1408 1365 1148 33286 3244 2729 ----
NM_015158chr92675 260 ------
NM_015161chr1611297 2564 67 11287 --
NM_015169chr8--1370 ----
NM_015170chr831432 623 341 --1150 --
NM_015172chr141578 1520 1109 201 ------
NM_015176chr131086 678 661 --31248 1208 711 1215
NM_015178chr812726 --1450 --
NM_015180chr141589 --1920 --
NM_015184chr3----177 --
NM_015192chr2052799 2366 2063 692 30 --32791 2005 761 12770
NM_015198chr711230 --1920 --
NM_015200chr442591 2471 1968 1673 ------
NM_015206chr1532892 2841 2785 13509 1623 --
NM_015208chr1864050 3765 3527 2535 774 471 --11123 1241
NM_015209chr13808 454 114 --1745 --
NM_015210chr184996 871 259 225 139 1969 --
NM_015215chr153005 2896 2690 2362 1165 --32107 203 197 --
NM_015216chr551504 1176 368 314 70 --11036 --
NM_015225chr953049 2744 2463 712 185 1856 32645 2598 1184 2394 105
NM_015231chr112129 76 ------
NM_015233chr1342694 875 491 339 ------
NM_015234chr631400 1192 1125 21425 1030 1973 --
NM_015236chr4190 11247 ----
NM_015238chr51476 ------
NM_015247chr16105193 3957 3576 3296 1452 1157 525 481 275 53 14699 1196 --
NM_015250chr91347 11808 ----
NM_015251chr1622268 1475 --1146 --
NM_015252chr21253 ----1117
NM_015254chr853161 2312 1050 835 128 ------
NM_015260chr1921597 1349 ------
NM_015262chr102152 135 ------
NM_015265chr252657 1968 883 454 176 --1326 --
NM_015267chr1211746 --12056 --
NM_015271chr444026 2614 1483 361 11664 24085 799 140
NM_015272chr161565 --22010 290 --
NM_015275chr122527 338 --11535 --
NM_015277chr1851337 1319 1279 687 430 --259 51 --
NM_015278chr653099 2471 2160 455 316 --23211 2739 --
NM_015282chr222083 261 ------
NM_015285chr1822299 2203 --1345 --
NM_015286chr154678 397 314 291 --1826 --
NM_015288chr523671 1484 --13865 --
NM_015291chr122872 2773 12146 13387 12422
NM_015294chr174943 844 799 265 --11147 --
NM_015296chr1331101 961 477 1894 ----
NM_015299chr1442935 1099 982 785 1879 ----
NM_015308chr111764 1881 ----
NM_015310chr846866 6320 3080 2382 36491 1672 116 18325 --
NM_015313chr1134856 4677 3679 21478 188 21158 308 --
NM_015314chr741679 1646 672 286 ------
NM_015315chr552788 2206 2139 1129 1047 ------
NM_015317chr232350 1123 1017 1759 ----
NM_015320chr21157 ----11007
NM_015321chr1964910 4902 4209 1739 833 271 ------
NM_015326chr122413 2232 ------
NM_015328chr732862 1916 274 ----12871
NM_015331chr1----1578 --
NM_015335chr1232127 334 124 12172 ----
NM_015336chr1251788 741 687 418 334 --22526 2010 --
NM_015338chr20----1339 --
NM_015344chr852133 2031 1959 1912 549 --1347 --
NM_015347chr1282344 2332 2288 2094 1901 1152 850 688 --22247 341 21910 257
NM_015349chr611004 --22604 925 --
NM_015355chr1742010 1745 727 221 --1332 1494
NM_015358chr212134 49 11057 ----
NM_015359chr822416 135 ------
NM_015361chr24783 358 320 172 --2870 746 --
NM_015365chrX43804 3533 2808 2607 11265 12867 --
NM_015375chr184915 4361 4337 3882 3782 3076 1979 1672 13715 1936 --
NM_015378chr142218 2194 1833 253 ----1420
NM_015381chr221751 ------
NM_015385chr1062440 2344 2159 958 827 599 --12829 --
NM_015387chr242114 1931 49 24 ------
NM_015393chr453826 3582 2328 877 242 --1764 --
NM_015409chr1231921 772 349 1206 22715 664 --
NM_015424chr11------163
NM_015429chr331066 1031 382 ------
NM_015435chr831491 1167 1061 1206 11426 --
NM_015443chr172617 279 ------
NM_015446chr151658 1567 1460 1175 433 ------
NM_015455chr533487 3087 225 13542 24039 622 33176 651 497
NM_015458chr845286 4646 4149 879 14909 34940 3374 906 --
NM_015460chr331782 1464 135 ------
NM_015461chr184204 170 116 69 ------
NM_015464chr7----1224 --
NM_015475chr211030 1890 ----
NM_015477chr154790 386 293 62 ------
NM_015483chr72444 146 1980 ----
NM_015493chr1942017 1869 1556 432 ------
NM_015508chr331321 267 217 ------
NM_015520chr332076 2036 838 --22526 2104 --
NM_015523chr112234 104 ------
NM_015525chr6124 ------
NM_015530chr22840 93 --2398 264 --
NM_015531chr111157 ------
NM_015532chr151470 ------
NM_015534chr11988 ------
NM_015535chr263531 1441 1364 548 496 409 --32693 1627 1228 --
NM_015542chr10----11124 --
NM_015548chr64987 956 769 243 ------
NM_015550chr733305 2529 677 1388 1542 13311
NM_015554chr1572708 2540 2180 1825 1135 450 22 198 32263 544 164 --
NM_015555chr6----21278 357 --
NM_015560chr312797 ----1220
NM_015564chr5--23178 828 1213 1816
NM_015565chr2132233 1973 330 --12301 --
NM_015567chr1331155 929 820 --21135 32 --
NM_015570chr721290 464 ------
NM_015571chr651829 1782 1000 685 665 --12630 11758
NM_015576chr322380 824 1497 11911 --
NM_015578chr1921575 1411 ------
NM_015595chr32186 37 ----1349
NM_015602chr111344 ------
NM_015605chr1031232 510 79 --1105 --
NM_015607chr11145 ------
NM_015609chr12951 170 --2124 70 --
NM_015610chr751864 1753 1140 293 65 ------
NM_015622chr7189 ------
NM_015626chr17--11198 1128 --
NM_015630chr2--11115 1258 1863
NM_015635chr931982 1870 205 1804 1432 --
NM_015640chr184619 4211 1698 682 447 300 259 60 24698 2032 --15173
NM_015641chr751219 1091 1026 328 52 11240 11056 --
NM_015646chr124505 313 293 161 11081 --11270
NM_015649chr191154 ------
NM_015652chr10------161
NM_015675chr19----1563 --
NM_015678chr1351374 570 532 432 108 --21162 678 11431
NM_015680chr2--123 ----
NM_015686chrX12465 --12485 22327 813
NM_015691chrX31088 539 522 --12925 --
NM_015702chr2--128 ----
NM_015711chr19----1770 --
NM_015714chr11243 --1366 1300
NM_015719chr192819 51 ------
NM_015726chr131826 1737 599 --1618 --
NM_015833chr2121971 744 ------
NM_015850chr811516 12457 21680 1525 --
NM_015855chr11--1687 ----
NM_015866chr131516 422 49 ------
NM_015869chr3------149
NM_015872chr111484 ----11381
NM_015878chr841793 1484 697 501 ------
NM_015879chr1898557 8218 7135 6673 5504 1767 1519 445 185 36866 1948 924 78003 6436 2757 596 590 230 142 --
NM_015881chr1121268 151 1514 11327 1974
NM_015885chr111355 --1164 --
NM_015886chr865345 1723 1578 1120 1021 81 ------
NM_015888chr141200 662 626 68 ------
NM_015889chr221331 1873 ----
NM_015892chr1052402 1987 800 467 295 --12354 --
NM_015898chr1922076 2030 ------
NM_015902chr83736 640 602 ----1762
NM_015906chr144549 3858 3444 1257 --2757 517 --
NM_015908chr7278 42 ------
NM_015913chr12771 597 --1738 --
NM_015914chr16141 ------
NM_015920chr152630 594 ------
NM_015939chr202223 173 1672 --1614
NM_015955chr22488 377 --1423 --
NM_015975chrX21182 26 --31832 1172 740 --
NM_015976chr12281 108 ------
NM_015980chr52620 89 ------
NM_015990chr431101 265 95 ----1717
NM_015995chr1565411 5094 4866 4846 4336 198 --22113 323 --
NM_016003chr751864 1753 1140 293 65 ------
NM_016009chr164743 3600 3591 1630 787 153 --14158 --
NM_016021chr682968 2939 2891 2066 1997 1952 490 56 --12037 --
NM_016025chr1631788 1581 1381 ------
NM_016032chrX2871 139 ------
NM_016040chr132492 2006 256 --31874 618 187 --
NM_016045chr2031249 1182 419 --1667 --
NM_016061chr251658 1514 1340 1147 1141 --11025 --
NM_016073chr1531096 270 228 ------
NM_016075chr1332581 398 345 ------
NM_016076chr153120 2690 836 778 310 --12052 --
NM_016078chr1721032 884 --1340 --
NM_016083chr682925 2826 2809 2414 1186 1179 747 555 23540 1521 13334 --
NM_016090chr111888 --11072 --
NM_016096chr831840 1338 572 ------
NM_016103chr52447 361 ------
NM_016107chr52947 310 ------
NM_016120chrX--1749 ----
NM_016126chr1122 ------
NM_016129chr4180 ------
NM_016131chr272156 2118 2098 1509 370 257 238 ------
NM_016132chr1512580 ------
NM_016133chr2125 1250 ----
NM_016141chr32815 229 --1217 --
NM_016144chr5----155 --
NM_016152chr351218 1198 396 333 277 ------
NM_016169chr1033103 2589 412 13284 ----
NM_016185chr171120 --2805 301 --
NM_016192chr2----1106 --
NM_016195chr102753 57 194 ----
NM_016200chr7139 ------
NM_016201chr321843 1546 11962 21860 1466 --
NM_016203chr71254 ----1192
NM_016205chr42964 139 1505 11338 --
NM_016206chr387913 7673 6432 6056 5491 2735 2726 941 --28476 1818 --
NM_016211chr41102 ------
NM_016213chr15--146 ----
NM_016217chr621456 221 1459 33559 2263 807 --
NM_016221chr541798 1493 453 330 1112 11463 11486
NM_016227chr121133 349 ------
NM_016230chr62176 83 --1404 --
NM_016231chr1721693 226 --190 --
NM_016240chr821245 433 --11576 --
NM_016248chr1343439 2825 974 341 23889 3079 23812 3353 --
NM_016255chr632402 2177 858 22832 1324 ----
NM_016258chr13689 612 36 ------
NM_016260chr286878 6870 5367 5089 5033 5003 2525 63 --17507 --
NM_016270chr191490 --1339 --
NM_016271chr1842136 352 327 29 --1262 --
NM_016275chr32138 83 12295 --135
NM_016277chr621558 1521 2479 46 --11503
NM_016279chr5169 ------
NM_016281chr1211096 1466 --11022
NM_016284chr164610 359 187 23 ------
NM_016287chr122031 66 --1661 --
NM_016289chr23818 346 180 --22117 739 --
NM_016297chr233150 2655 2359 --2316 185 --
NM_016300chr31369 ------
NM_016308chr12576 455 ------
NM_016315chr221717 1483 --21631 1205 --
NM_016322chr952031 1193 1093 1044 761 --1944 22118 1033
NM_016339chr1751799 1585 1436 1361 62 ------
NM_016374chr161579 1464 1267 1230 432 151 --129 --
NM_016374chr161579 1464 1267 1230 432 151 --129 --
NM_016376chr1743876 813 796 780 23484 3057 13831 11456
NM_016377chr621772 719 --11548 --
NM_016395chr1561763 1576 1290 1265 336 179 --11747 --
NM_016396chr1562154 2120 1008 691 523 102 --195 --
NM_016422chr1163079 2898 2741 2080 1186 601 ------
NM_016423chr141324 ------
NM_016424chr17----1536 --
NM_016436chr2041662 1067 573 272 22468 2141 22606 2393 12386
NM_016441chr241952 1703 428 80 ------
NM_016447chr7--1185 ----
NM_016451chr11----175 --
NM_016467chr2175 ------
NM_016472chr1451247 1226 996 340 70 ------
NM_016480chr52135 110 ------
NM_016485chr652040 1573 1432 910 299 1902 ----
NM_016486chr1----1196 --
NM_016507chr1732672 313 107 ------
NM_016513chr633450 2933 2315 12585 ----
NM_016516chr22590 355 ------
NM_016520chr91311 --1320 --
NM_016525chr91882 --1243 --
NM_016530chr1564055 2602 691 382 347 295 --23724 1657 --
NM_016531chr423371 468 33556 3311 3036 13704 13050
NM_016538chr173474 398 171 --1158 --
NM_016542chrX41666 1474 1266 1078 ------
NM_016545chr11869 ------
NM_016546chr1231444 1225 144 1256 2420 415 --
NM_016559chr311113 --21130 49 1583
NM_016569chr123994 629 53 --1238 1489
NM_016578chr111494 ------
NM_016584chr121276 ------
NM_016587chr71163 ------
NM_016603chr532231 1821 67 11881 1121 1263
NM_016604chr511164 ------
NM_016605chr532284 859 437 ------
NM_016620chr141340 483 377 286 ------
NM_016621chr1163958 3518 3389 2962 1127 664 ------
NM_016623chr82453 244 --2520 249 --
NM_016626chr1821524 524 --11472 --
NM_016628chr102760 79 ------
NM_016631chr212769 701 ------
NM_016644chr51112 2350 179 ----
NM_016654chr1521331 469 ------
NM_016656chrX1265 1384 ----
NM_016733chr2231463 1394 1256 ------
NM_016823chr171972 ------
NM_016824chr1031793 680 45 ------
NM_016830chr12----1516 --
NM_016930chr43999 925 67 ------
NM_016936chr1641837 877 692 515 --1276 --
NM_016946chr162624 1426 1237 410 335 32 ----13641
NM_016950chr411484 --1442 --
NM_016952chr1143990 3531 1574 240 --13096 --
NM_016953chr265563 5366 4777 4746 4739 117 --25532 1720 --
NM_017409chr121774 --1571 --
NM_017410chr1221224 47 11125 1296 --
NM_017412chr831002 159 67 ------
NM_017420chr1483674 3553 3216 3174 3095 3007 2929 2715 1183 13043 11361
NM_017423chr412077 ------
NM_017426chr41271 1265 1426 --
NM_017447chr2163682 3296 2740 1674 1311 539 1837 ----
NM_017455chr153962 761 357 --1736 --
NM_017456chr173506 490 74 ------
NM_017481chr111210 193 ----
NM_017488chr251451 1370 1256 1236 563 ------
NM_017519chr61264 --1326 --
NM_017548chr342132 1908 1897 351 1816 11996 1138
NM_017551chr102912 135 ------
NM_017553chr1551258 1053 974 830 96 --1844 --
NM_017558chr16--1454 ----
NM_017563chr386373 6314 5591 5492 4956 2259 1418 77 26391 331 15937 14269
NM_017567chr21118 ------
NM_017569chr13------148
NM_017577chr31493 ------
NM_017578chr3296 47 ------
NM_017580chr1042290 1884 488 323 ------
NM_017582chr141779 1268 1235 1201 ------
NM_017590chr2242714 2504 1012 508 ------
NM_017593chr4174 1135 ----
NM_017594chr983321 2943 2916 2666 2611 1126 1101 1015 1673 1113 --
NM_017595chr1721712 454 11215 ----
NM_017596chr124639 4585 ------
NM_017602chrX4766 702 257 162 ------
NM_017610chr1551623 819 424 271 244 11896 2711 262 11477
NM_017617chr961405 1374 585 204 162 60 ------
NM_017629chr121278 227 --1132 1628
NM_017632chr4------1310
NM_017633chr632752 1562 1555 12814 11426 --
NM_017634chr82669 353 21806 1663 ----
NM_017635chr1131469 523 269 ------
NM_017637chr9199454 9366 9134 8454 8371 8169 8159 7477 3486 2812 2135 1805 1139 1002 819 391 119 84 76 29339 796 33632 2437 1939 --
NM_017640chr62642 613 --1247 --
NM_017641chr12177 1169 ----
NM_017643chr1762442 2401 2048 1241 579 273 ------
NM_017644chr345142 888 440 392 11928 11901 --
NM_017649chr1031056 1049 319 ------
NM_017650chr7125893 5836 5812 5628 5108 4996 4243 2219 1046 406 170 151 13911 35157 4299 2246 --
NM_017651chr631623 1591 263 ----11051
NM_017657chr22757 733 --1378 --
NM_017658chr1454016 1849 1255 254 92 31247 1218 280 44440 1482 1019 44 --
NM_017661chr151426 ------
NM_017679chr173622 278 263 ------
NM_017680chr91342 ------
NM_017694chr221600 1472 --21760 1579 --
NM_017700chr41542 --1129 --
NM_017709chr154161 3955 1351 1242 461 23283 651 ----
NM_017714chr202701 123 --1665 --
NM_017719chr352329 2242 2215 539 315 ------
NM_017730chr31168 ------
NM_017736chr162758 144 1111 1458 --
NM_017737chr131437 454 112 --12059 --
NM_017738chr92887 68 1276 ----
NM_017742chr1861914 1839 1300 1254 495 142 11215 11803 --
NM_017752chrX11764 12116 ----
NM_017753chr951033 807 301 252 131 ------
NM_017754chr635028 3610 1368 1283 ----
NM_017761chr141276 484 432 133 --2470 179 --
NM_017762chr1532179 729 604 ----22306 127
NM_017772chr61108 ------
NM_017778chr811247 11067 --11103
NM_017780chr81675 1193 ----
NM_017786chr8--1608 --1127
NM_017787chr1041958 1867 1857 145 ------
NM_017798chr202155 110 --1165 --
NM_017799chr141279 --1658 --
NM_017801chr321631 44 ------
NM_017811chr942593 2288 528 25 --1221 --
NM_017813chr875556 5501 5266 4475 4045 757 691 --1627 --
NM_017824chr102355 78 1210 22355 885 --
NM_017831chr1831489 147 40 --34635 1690 1285 --
NM_017848chrX54020 3253 1214 723 531 --21801 660 --
NM_017851chr152813 304 ------
NM_017857chr11----1682 --
NM_017866chr821101 772 --173 --
NM_017869chr161626 ------
NM_017890chr871710 677 507 376 197 174 75 ------
NM_017893chr102982 547 ------
NM_017902chr1062048 1696 1462 255 103 95 ------
NM_017910chr21368 ------
NM_017913chr9190 ------
NM_017921chr1731957 1684 616 ----12324
NM_017922chr142543 270 ----1241
NM_017925chr931920 1691 1366 --21826 1304 1157
NM_017933chr211609 --11032 11638
NM_017935chr42535 255 ----1225
NM_017938chrX32036 1485 647 ----2762 268
NM_017943chr142786 127 ------
NM_017944chr1132557 967 209 1195 22235 692 --
NM_017945chr321086 120 ------
NM_017952chr244386 3874 2908 886 22949 2866 12916 --
NM_017953chr121164 59 --2474 219 --
NM_017954chr731686 1291 1228 --1491 --
NM_017964chr2----174 --
NM_017969chr22176 170 ------
NM_017974chr21510 --11040 --
NM_017987chr1021378 362 ----1510
NM_017988chr121699 --1867 --
NM_017994chr722604 154 --1441 --
NM_018010chr321470 66 ------
NM_018011chr13----1425 --
NM_018019chr1731227 506 476 ------
NM_018025chr19181 ------
NM_018030chr184906 880 214 132 --1839 --
NM_018031chr31582 ------
NM_018032chr161240 --1391 --
NM_018043chr1121364 185 ------
NM_018046chr531958 1458 601 --11383 11720
NM_018048chr12----22030 1618 --
NM_018061chr12384 118 --2227 171 --
NM_018078chr41795 --1839 --
NM_018084chr251283 1180 1052 935 854 22076 488 33078 2992 263 --
NM_018085chr1107488 5381 5116 5043 2633 1745 1279 919 611 80 --47593 7167 5348 1416 11838
NM_018086chr23684 647 134 ------
NM_018092chr1631424 1087 607 ------
NM_018103chr1187 ------
NM_018105chr8----1911 --
NM_018113chr121147 1141 ----
NM_018116chr13524 507 118 ------
NM_018117chr10----1694 --
NM_018120chr81134 --1458 --
NM_018121chr1063051 2601 2571 2294 961 560 --52774 2657 2341 2129 983 --
NM_018126chr441253 1227 1086 200 ------
NM_018128chr1721018 540 ------
NM_018133chr311907 11634 1871 --
NM_018137chr111424 ------
NM_018150chr1291 81 ------
NM_018151chr22754 697 ----1615
NM_018155chr353409 3174 2225 761 21 12193 23380 2556 --
NM_018156chr142218 2194 1833 253 ----1420
NM_018157chr1252686 2244 2049 884 751 11098 12234 --
NM_018159chrX31340 1166 310 --2645 186 --
NM_018171chr121295 ----1245
NM_018176chr4----31549 1118 171 --
NM_018181chr1861903 1777 1421 1359 1300 562 --21264 304 --
NM_018182chr1731989 899 587 --11412 --
NM_018184chr371976 1622 1533 1524 1410 312 138 11900 22024 617 --
NM_018192chr32900 72 --11047 --
NM_018200chr1532364 2091 1682 --1543 --
NM_018201chr942110 1906 1738 198 ------
NM_018206chr162766 595 ------
NM_018208chr11151 11187 ----
NM_018211chr131831 1690 393 --21857 424 --
NM_018237chr10----1225 --
NM_018243chr463205 2817 2808 1447 544 496 11269 2911 409 --
NM_018247chr611022 22342 2211 12167 --
NM_018254chr142159 2139 771 658 12057 ----
NM_018257chr2021829 219 ------
NM_018263chr2--1652 22463 235 --
NM_018266chr3----1942 --
NM_018270chr20----1611 --
NM_018287chr102953 353 11045 2241 112 --
NM_018293chr332795 1902 1153 --22970 2888 --
NM_018299chr883268 2623 2556 852 594 526 151 135 --12434 --
NM_018307chr171990 ------
NM_018312chr1161603 1451 428 189 158 100 ------
NM_018313chr331874 1648 221 --1111 --
NM_018314chr113710 577 31 1755 ----
NM_018315chr41522 ------
NM_018317chr4196 ------
NM_018318chr122949 816 ------
NM_018325chr911600 --21577 1455 --
NM_018327chr2031770 1529 1395 ------
NM_018328chr22422 371 ------
NM_018330chr1041488 1440 1276 1266 11676 ----
NM_018335chr142488 149 ------
NM_018348chr1651218 1172 326 115 58 ------
NM_018351chr1264283 4215 3295 1518 1157 1128 1918 14659 --
NM_018361chr853280 1062 641 320 187 12978 11175 --
NM_018362chr1143065 1553 520 315 --21300 527 --
NM_018364chr143876 3178 2981 2674 13761 13390 --
NM_018365chr152241 37 --1192 --
NM_018367chr1122438 355 ----1959
NM_018368chr6153 ------
NM_018370chr1221799 304 ------
NM_018371chr841590 1519 633 208 --21534 1319 --
NM_018383chr2----1672 --
NM_018394chr33594 303 145 --11549 --
NM_018398chr31323 ------
NM_018403chr353909 3122 2993 1278 922 ------
NM_018409chr442850 2115 1019 87 1603 ----
NM_018412chr71162 ------
NM_018413chr121273 ------
NM_018416chr1212626 --22567 935 --
NM_018425chr1022259 440 ------
NM_018426chr6----1567 --
NM_018433chr2------1581
NM_018440chr878042 6491 6385 2571 2502 591 333 --12120 --
NM_018441chr2165 ------
NM_018442chr11359 ------
NM_018444chr832095 431 217 31718 1544 460 ----
NM_018445chr15----1224 --
NM_018448chr12147 ------
NM_018457chr12----175 1445
NM_018464chr101283 --1359 --
NM_018465chr9--1222 ----
NM_018469chr1761309 1261 1114 1023 554 73 11420 21499 1460 --
NM_018471chr21439 ------
NM_018477chr1421024 64 ----1137
NM_018482chr852273 1670 1008 863 803 ----11915
NM_018488chr172583 69 ------
NM_018489chr132346 2333 776 ------
NM_018490chr1111556 --21871 1536 --
NM_018557chr231445 610 364 2663 213 1338 11493
NM_018566chr145085 4693 4260 1057 ------
NM_018571chr21114 ------
NM_018584chr141196 1066 483 350 ------
NM_018638chr1254973 4953 4392 1142 455 34905 4676 4127 11397 --
NM_018640chr1212005 --1381 --
NM_018650chr132182 1539 66 ------
NM_018652chr153863 842 383 1790 ----
NM_018657chr32844 796 --1289 --
NM_018671chr15--1232 ----
NM_018682chr73599 544 90 ------
NM_018683chr2031646 1345 551 ------
NM_018685chr7--1823 184 --
NM_018686chr121241 ------
NM_018689chr1552690 2365 1880 811 658 ------
NM_018695chr532285 818 125 --41779 1746 1534 693 --
NM_018696chr181132 ------
NM_018697chr72629 229 12098 ----
NM_018700chr521609 1284 --1457 --
NM_018703chr161114 ------
NM_018704chr1----1676 --
NM_018708chr1931029 649 588 ------
NM_018710chr81439 1925 --1161
NM_018715chr142086 861 117 61 ------
NM_018717chr452823 2449 2212 503 474 --32736 2383 2353 --
NM_018718chr732196 2072 599 ------
NM_018719chr721035 340 ------
NM_018724chr13655 536 157 2142 104 ----
NM_018728chr1541522 1358 537 22 ------
NM_018834chr53909 824 275 --1106 --
NM_018841chr143915 3851 1577 612 --23719 2959 --
NM_018844chr73606 440 332 191 11698 --
NM_018846chr71834 ------
NM_018847chr921685 164 --1450 --
NM_018890chr731493 339 47 11032 1541 --
NM_018898chr532101 1554 802 ------
NM_018899chr532101 1554 802 ------
NM_018900chr532101 1554 802 ------
NM_018901chr532101 1554 802 ------
NM_018902chr532101 1554 802 ------
NM_018903chr532101 1554 802 ------
NM_018904chr532101 1554 802 ------
NM_018905chr532101 1554 802 ------
NM_018906chr532101 1554 802 ------
NM_018907chr532101 1554 802 ------
NM_018908chr532101 1554 802 ------
NM_018909chr532101 1554 802 ------
NM_018910chr532101 1554 802 ------
NM_018911chr532101 1554 802 ------
NM_018939chr51220 ------
NM_018945chr653018 1440 1127 910 730 1544 ----
NM_018951chr721159 810 ------
NM_018953chr121529 ------
NM_018955chr171139 151 ----
NM_018963chr2141369 1306 1238 162 11027 ----
NM_018970chr722879 2300 12857 ----
NM_018976chr1262810 2479 1933 931 668 443 ----12272
NM_018979chr1242541 861 149 103 --22586 2569 12552
NM_018993chr2041464 1374 1367 223 --21431 1326 --
NM_018999chr1064474 4352 4290 3352 1708 67 14513 23988 665 --
NM_019001chr364168 4048 3273 1081 619 187 21910 91 14724 1265
NM_019004chr762090 2018 1998 1560 934 764 --32304 1678 194 --
NM_019006chr153617 507 103 ------
NM_019027chr441973 1017 1002 348 1269 ----
NM_019035chr431940 1559 207 --21277 102 --
NM_019041chr632628 2134 1912 1168 ----
NM_019042chr741119 378 170 64 ------
NM_019044chr294728 4712 4297 3822 3542 3292 1324 1289 881 14463 1289 --
NM_019045chrX--1329 ----
NM_019046chr102773 210 ------
NM_019049chr11160 --1112 --
NM_019059chr7--1519 --1155
NM_019063chr222275 458 1411 1309 --
NM_019071chr72198 95 --1272 --
NM_019074chr15272 59 ------
NM_019084chr1032597 2433 904 ----1731
NM_019091chr21102 --11165 --
NM_019094chr1233046 2819 133 13411 11171 --
NM_019095chr201153 ------
NM_019096chr621098 359 ------
NM_019106chr2233438 2794 2369 ------
NM_019116chr1653008 2476 1084 428 160 --23709 3211 --
NM_019117chrX32655 1346 992 --11361 --
NM_019555chr331409 1373 579 --158 --
NM_019557chr1--1335 ----
NM_019558chr22360 328 ------
NM_019590chr1031174 1056 551 ------
NM_019593chr2053156 806 782 710 440 --22496 446 --
NM_019595chr23680 491 67 ------
NM_019596chr2131073 980 667 --32124 1848 714 --
NM_019597chrX------2750 208
NM_019600chr152784 515 --1203 --
NM_019605chr12506 89 ------
NM_019606chr72396 372 ------
NM_019610chr111950 ------
NM_019842chr62149 55 ------
NM_019843chr222493 458 ------
NM_019848chrX169 163 ----
NM_019854chr12--1698 ----
NM_019859chr1051490 598 468 295 144 ------
NM_019860chr1051538 646 516 343 192 ------
NM_019885chr242923 2898 1123 675 ------
NM_019891chr121265 345 ------
NM_019903chr1031793 680 45 ------
NM_020066chr11118 1290 ----
NM_020116chr41566 --21397 50 --
NM_020120chr25535 407 338 201 154 ------
NM_020122chr245943 4940 4931 2001 22350 1964 25974 3738 1933
NM_020123chr1031075 977 60 ------
NM_020132chr2154453 4188 4055 1865 1368 14104 13474 --
NM_020137chrX1351 ------
NM_020141chr1----11888 --
NM_020144chr752079 1639 727 546 506 11687 ----
NM_020148chr181581 32983 2057 1090 1212 1114
NM_020150chr1021818 1702 ------
NM_020156chr7264 45 1601 ----
NM_020157chr2011018 ------
NM_020159chr421524 51 11720 ----
NM_020163chr332260 2149 2014 ----12301
NM_020168chr152917 245 --11356 --
NM_020177chr543396 2297 1198 475 ------
NM_020178chr1761108 965 880 479 413 216 ------
NM_020180chr1821150 999 ------
NM_020182chr2033200 2383 365 13328 --1619
NM_020184chr242189 1773 1615 593 ------
NM_020190chr1123 ----1466
NM_020193chr1141340 912 192 22 ------
NM_020194chr25589 538 436 243 84 --1610 --
NM_020198chr1731146 1098 456 ------
NM_020199chr521215 173 --11160 --
NM_020205chr143445 3248 3130 2469 1206 1802 12276
NM_020210chr151976 ------
NM_020226chr42496 93 ------
NM_020228chr1132504 2293 1613 1439 ----
NM_020231chr31632 ------
NM_020232chr181185 ------
NM_020245chr654800 4453 3919 3900 1865 34633 994 370 34998 4616 1596 --
NM_020310chr1722819 2684 1186 ----
NM_020317chr13107 41 29 ------
NM_020319chr73932 617 70 1683 ----
NM_020336chr2043467 3365 1485 327 ------
NM_020337chr452144 2110 1219 1211 1138 --21172 440 --
NM_020338chr1033485 3060 1329 23287 3269 ----
NM_020340chr632272 646 221 --32281 878 73 --
NM_020341chr2032044 1332 96 ------
NM_020342chr242283 1921 607 53 1535 22353 67 1107
NM_020346chr1141535 538 370 58 --2517 218 --
NM_020357chr31284 --1546 --
NM_020382chr121252 --1242 --
NM_020390chr384777 4596 4183 3272 3076 1840 1524 1414 1399 54944 4396 3782 3220 450 --
NM_020403chr1341671 1373 567 304 --1259 --
NM_020405chr1784485 4005 3633 3156 3026 1435 1204 925 ------
NM_020420chrY21856 577 --2526 377 --
NM_020423chr12553 236 ------
NM_020428chr1921167 1139 ------
NM_020429chr743082 2980 2288 1240 1735 11962 --
NM_020432chr751826 1638 718 686 220 --1401 --
NM_020443chr137034 5605 2745 11291 ----
NM_020444chr52323 42 --2997 506 --
NM_020445chr71788 --1124 --
NM_020449chrX1110 1181 ----
NM_020452chr111351 --12074 --
NM_020455chr612594 --12550 --
NM_020456chr1332273 1490 34 ------
NM_020463chr221450 1210 ------
NM_020466chr664804 3156 3107 543 448 177 23689 1217 43983 3453 3246 52 --
NM_020473chrX2776 625 11271 31861 1378 196 11415
NM_020474chr181346 --21871 1291 --
NM_020478chr82964 820 ------
NM_020482chr62234 131 ------
NM_020529chr142102 41 ------
NM_020532chr25922 899 749 381 144 ------
NM_020546chr533176 1173 657 --1193 12102
NM_020630chr101119 ----122
NM_020640chr351862 1524 694 490 61 1793 --12308
NM_020647chr862194 2156 1524 927 723 379 ------
NM_020648chr1852781 1928 877 753 425 ------
NM_020651chr2------21294 107
NM_020653chr172366 59 ------
NM_020655chr1621439 962 ------
NM_020689chr2051689 1519 1078 625 555 --11699 --
NM_020692chr142995 390 --135 --
NM_020693chr111166 179 ----
NM_020697chr831230 236 202 --11300 --
NM_020699chr175235 5180 4044 3541 1590 579 91 --14023 --
NM_020703chr1------1588
NM_020713chr2042948 2685 2097 737 ------
NM_020718chr16106497 6351 5374 4174 1874 1704 1112 603 514 289 25825 1617 66129 1862 1262 961 859 95 --
NM_020726chr51537 ----1209
NM_020728chr732855 1239 1074 --1812 1987
NM_020732chr61264 --1326 --
NM_020734chr1252464 2083 731 636 338 --22063 1066 13365
NM_020739chr1533813 3459 525 11584 ----
NM_020742chrX21016 958 ----11758
NM_020750chr61983 --21409 84 --
NM_020752chr101638 22002 1079 22253 856 --
NM_020755chr61170 ------
NM_020760chr221390 1256 11849 11988 --
NM_020765chr11101 176 ----
NM_020766chrX44603 3339 3025 2859 1456 ----
NM_020770chr13884 496 86 ------
NM_020772chr1788139 7807 7125 7119 6452 5720 1951 591 27827 7780 35638 5332 1296 17102
NM_020773chr452622 1894 1874 1025 666 ------
NM_020774chr1823887 841 --44934 4121 611 296 --
NM_020779chr242981 2906 2066 136 --12333 1942
NM_020783chr1862207 2146 1782 1505 916 896 ------
NM_020791chr1721018 509 ------
NM_020792chr362384 1868 1745 682 453 69 ------
NM_020794chr121384 226 11390 ----
NM_020795chr172772 392 ------
NM_020796chr522747 1169 ------
NM_020800chr331392 440 229 --11405 --
NM_020801chr521617 326 --1891 --
NM_020804chr622601 1035 ------
NM_020805chr1861916 1783 1748 468 350 84 21983 442 ----
NM_020806chr142728 692 ------
NM_020808chr131008 863 837 1959 ----
NM_020809chr11----22212 1511 11615
NM_020810chr1442891 2876 716 703 --1108 --
NM_020819chr611169 11098 11125 --
NM_020824chr10--1154 1130 --
NM_020825chr1663706 3365 3072 2552 1131 1009 2666 381 ----
NM_020834chr141454 1322 ----
NM_020839chr341477 998 592 529 ------
NM_020841chr1232699 2500 299 22525 1032 13650 --
NM_020843chr151133 ------
NM_020850chr16--13137 23288 3121 --
NM_020854chr1821578 540 --2144 63 1110
NM_020856chr1911007 1289 21170 1128 1414
NM_020858chr1552385 644 418 401 190 ------
NM_020860chr431187 936 736 ----1458
NM_020861chr61905 2427 171 ----
NM_020866chr131828 --11107 --
NM_020868chr221497 353 ----1256
NM_020870chr41467 --1226 --
NM_020871chrX12533 12409 1560 --
NM_020872chr311725 ------
NM_020909chr294155 4142 3406 3003 2891 1622 1085 809 607 14091 31581 1438 438 11091
NM_020917chr1923934 2677 11147 1581 12790
NM_020918chr1083516 3259 3049 2831 2811 2523 1002 984 --23431 1433 --
NM_020921chr1442875 2736 2342 33 12979 22709 643 --
NM_020922chrX21869 1852 --11480 --
NM_020925chr121281 431 ------
NM_020935chr233742 2874 31 --11617 13803
NM_020940chr1042553 1125 801 225 12256 22171 1145 12719
NM_020948chr11758 11144 32693 2449 1014 22913 2363
NM_020958chr141267 ------
NM_020960chr953901 3757 3563 3525 1621 --24763 162 --
NM_020962chr151579 12404 ----
NM_020967chr203985 191 96 ------
NM_020977chr421440 1432 ------
NM_020980chr1521139 694 1344 ----
NM_020987chr1011183 ------
NM_020993chr1232834 2784 2296 --11819 --
NM_021003chr142704 300 ------
NM_021005chr151322 1200 1429 --
NM_021007chr221751 1591 ------
NM_021012chr1743213 2933 2475 786 ------
NM_021033chr1331321 898 316 --13380 --
NM_021038chr361346 931 738 295 212 145 --23192 2451 --
NM_021061chr834285 3755 2855 --1415 --
NM_021069chr451545 1522 1405 785 524 --2677 437 --
NM_021090chr2244202 3768 1761 87 ------
NM_021097chr221003 245 22928 139 22762 2686 1925
NM_021110chr81738 ------
NM_021116chr778551 8483 8191 6599 6479 5698 775 15644 28285 6488 19067
NM_021136chr141726 --2718 163 --
NM_021137chr1712134 --1597 --
NM_021140chrX2806 205 ------
NM_021144chr91340 ------
NM_021148chr742120 358 347 107 --12246 --
NM_021149chr1621205 1174 ------
NM_021159chr431699 1228 345 ------
NM_021160chr61176 1205 ----
NM_021163chr753819 3663 3505 2730 1019 23133 2654 ----
NM_021168chr1651622 1548 479 380 328 ------
NM_021180chr11773 ------
NM_021183chrX32418 2274 58 --21879 1736 --
NM_021189chr13935 241 76 --1165 --
NM_021190chr141244 974 842 338 --11075 --
NM_021191chr1242387 1954 1794 290 --1181 --
NM_021192chr21428 ------
NM_021198chr22406 177 ------
NM_021202chr2022181 775 ------
NM_021205chr122400 991 1414 12876 --
NM_021215chr2061746 873 742 585 324 33 ------
NM_021218chr92991 659 ------
NM_021222chr11466 --11448 --
NM_021238chr1242011 1994 1858 1613 1772 12052 --
NM_021239chr1431184 358 163 --1341 --
NM_021240chr91491 --2474 170 --
NM_021242chrX4834 744 280 240 ------
NM_021244chr6------167
NM_021252chr1041785 1534 99 26 11842 ----
NM_021255chr1454071 1412 1000 748 183 11444 ----
NM_021260chr14----1238 --
NM_021572chr63420 369 24 --1327 1302
NM_021614chr51256 ------
NM_021622chr1042271 2007 564 126 ------
NM_021627chr331099 150 69 ------
NM_021629chr3105066 4897 4513 4267 3719 3426 1960 1425 1019 261 --24783 328 --
NM_021639chr11759 ------
NM_021643chr2--1740 ----
NM_021644chr101184 ------
NM_021647chr464769 3688 3467 1893 1670 359 --14535 --
NM_021648chr662640 1767 1720 441 305 211 ------
NM_021724chr17255 37 ------
NM_021728chr141768 ------
NM_021738chr102741 252 --1621 --
NM_021785chrX2229 50 --1367 --
NM_021807chr751177 1167 1063 807 483 ------
NM_021809chr2042293 1891 571 164 --1529 --
NM_021813chr655871 5196 4812 4704 4561 13715 1862 15588
NM_021814chr621443 384 1221 --1599
NM_021871chr4----146 --
NM_021907chr2--1252 ----
NM_021911chr585442 5238 5081 4202 3647 3472 1343 54 14761 11903 --
NM_021912chr1523851 1014 ------
NM_021913chr1921449 702 11711 ----
NM_021914chr142968 943 1502 11831 --
NM_021940chr661570 1224 1143 313 239 151 1245 ----
NM_021943chr6----187 --
NM_021945chr623539 475 --1653 --
NM_021946chrX11455 ------
NM_021947chr172955 483 --11144 --
NM_021949chrX32463 2098 744 --11021 --
NM_021950chr113673 441 126 --22228 1443 --
NM_021954chr1363377 3256 2259 1042 563 69 1509 ----
NM_021961chr1156591 6004 4988 4524 1007 --56943 6315 6207 4927 658 1789
NM_021964chr3116546 6513 6384 5924 4864 4138 4020 1164 742 321 155 21999 222 42311 1293 751 394 1561
NM_021973chr41577 --1114 --
NM_021976chr61675 ------
NM_021977chr683877 3860 3566 3255 1430 462 393 87 11280 11457 --
NM_021979chr141296 1364 ----
NM_021988chr20--11401 ----
NM_021994chr72829 176 1437 ----
NM_021998chrX41326 1206 981 469 --11531 --
NM_022006chr191371 ------
NM_022037chr231002 919 306 --2677 355 --
NM_022041chr162449 329 ------
NM_022048chr1546156 5414 5247 51 --45712 4088 1955 751 --
NM_022051chr11144 --1179 --
NM_022060chr142304 240 ----11354
NM_022062chr1131760 1433 358 ------
NM_022073chr1421456 120 --1332 --
NM_022080chr2052629 2567 1896 957 103 --32431 670 374 --
NM_022085chr641538 1518 1274 1057 ------
NM_022097chr161268 2253 156 ----
NM_022098chr2241407 1006 306 105 194 ----
NM_022114chr154657 4465 4055 4044 3697 --44628 3849 1689 556 --
NM_022118chr13168 --1186 --
NM_022130chr521078 148 --187 --
NM_022137chr1431896 749 377 --2548 131 1843
NM_022138chr62315 264 --2106 99 --
NM_022143chr7164 --1517 --
NM_022166chr1666134 5482 4850 4151 1067 220 16117 ----
NM_022170chr7--11560 --11083
NM_022171chr331497 612 207 --1621 --
NM_022173chr231002 919 306 --2677 355 --
NM_022346chr41124 --1345 --
NM_022374chr23353 198 140 ------
NM_022442chr20--11401 ----
NM_022444chr741949 1932 528 443 ----1769
NM_022456chr1286366 6238 6104 4991 3075 2970 1278 809 24972 216 35379 5104 4670 --
NM_022457chr1----126 --
NM_022458chr783188 2695 1262 1214 955 671 453 382 12736 11141 --
NM_022459chr13126150 6131 5730 5035 4912 4638 4265 1809 1520 1439 1177 47 14351 24690 1883 --
NM_022465chr1222505 2410 --13057 1592
NM_022470chr331246 481 380 --1396 --
NM_022474chr1452787 2486 2370 1023 453 12067 22768 935 --
NM_022476chr16129 1183 1296 --
NM_022488chr3--1131 ----
NM_022494chr10155 ------
NM_022496chr121454 ------
NM_022497chr353285 3111 2636 2454 1207 31200 827 678 13653 1124
NM_022566chr151598 ------
NM_022574chr742109 1557 672 545 ------
NM_022648chr234632 4581 791 --21593 1455 --
NM_022650chr5------1207
NM_022652chr1231072 413 362 1126 ----
NM_022658chr1221129 466 1458 11173 --
NM_022716chr132798 2057 276 ----13170
NM_022719chr2283789 3466 3215 3186 3127 1502 598 525 ------
NM_022726chr631723 1518 474 11567 ----
NM_022728chr71562 ------
NM_022730chr211040 ------
NM_022733chr12778 194 ------
NM_022739chr172851 452 ------
NM_022745chr142196 904 750 294 --1316 --
NM_022751chr18------190
NM_022753chr132578 1736 687 ------
NM_022757chr32985 120 ------
NM_022763chr352965 2832 2206 577 424 ------
NM_022771chr1231015 307 123 1873 ----
NM_022776chr341582 1405 312 102 --178 --
NM_022780chr231161 587 52 --2492 264 --
NM_022781chr933227 2455 625 1251 22418 131 12275
NM_022782chr12----184 142
NM_022802chr101345 --21257 663 --
NM_022818chr1621344 1168 --1268 --
NM_022823chr21438 2444 33 ----
NM_022824chr54723 388 142 57 ------
NM_022828chr521609 59 11421 11486 --
NM_022832chr42979 382 ----11834
NM_022838chrX1324 ------
NM_022841chr1562689 2495 2454 2269 2138 1918 1619 --32587 1990 673
NM_022842chr363305 2927 2551 2271 2172 1086 1892 ----
NM_022843chr1341335 1037 524 407 --1395 --
NM_022844chr163939 250 163 ------
NM_022845chr1672154 1855 1732 1687 1517 803 185 --21496 403 2529 166
NM_022893chr232554 2017 1940 13152 1291 --
NM_022894chr251683 1268 1134 640 550 --1259 --
NM_022897chr51317 1331 ----
NM_022898chr1444792 3849 3707 2991 --34487 4481 1400 --
NM_022900chr731071 240 226 --11109 --
NM_022902chr51394 ------
NM_022912chr222459 421 --12224 --
NM_022918chr1112191 1694 ----
NM_022965chr421429 376 ------
NM_022970chr1011067 11322 ----
NM_022977chrX41879 893 561 182 11858 42659 2568 2199 1039 --
NM_023000chr1441650 1401 1345 392 ------
NM_023001chr1441650 1401 1345 392 ------
NM_023009chr1----1672 --
NM_023012chr12192 1757 1104 --
NM_023016chr242773 2329 1920 103 --32015 491 485 --
NM_023037chr131294 --11043 --
NM_023074chr191936 183 ----
NM_023076chr1642165 774 481 161 ------
NM_023105chr811516 12457 21680 1525 --
NM_023106chr811516 12457 21680 1525 --
NM_023110chr811516 12457 21680 1525 --
NM_023111chr811516 12457 21680 1525 --
NM_023112chr14148 ------
NM_023923chr172486 2477 1414 1102 948 354 105 --33756 3703 538 --
NM_023925chr12----1249 --
NM_023927chr521053 128 ------
NM_023929chr862218 2106 2071 1081 175 33 1903 --1423
NM_023940chr43955 292 237 ------
NM_023948chr7----1154 --
NM_024007chr552951 2133 577 536 212 11990 --12979
NM_024015chr1721010 893 ------
NM_024019chr4----1162 --
NM_024034chr201996 1906 ----
NM_024054chr71333 ----1342
NM_024060chr111220 ------
NM_024069chr191683 ------
NM_024071chr14----1563 --
NM_024089chr131163 ------
NM_024102chr111195 ------
NM_024117chr941238 1185 592 410 11161 ----
NM_024295chr841701 1686 376 61 ------
NM_024297chr172547 102 ------
NM_024324chr221149 ------
NM_024325chr2011240 ----11072
NM_024336chr161328 ------
NM_024344chr151501 ------
NM_024348chr91251 ------
NM_024421chr1831228 269 253 1937 2447 363 --
NM_024424chr1131244 787 366 ------
NM_024425chr1131244 787 366 ------
NM_024426chr1131244 787 366 ------
NM_024429chr71254 ----1192
NM_024491chr31620 ------
NM_024494chr1167 ----1288
NM_024496chr141264 ------
NM_024501chr2----1494 --
NM_024511chr432783 828 792 ------
NM_024524chr323167 2941 --12661 --
NM_024529chr111084 ------
NM_024539chrX31197 1074 971 --21190 1085 --
NM_024541chr101487 11731 ----
NM_024546chr1321203 938 --21228 896 --
NM_024548chr341163 291 262 240 ------
NM_024551chr1232264 2014 602 ------
NM_024551chr1232264 2014 602 ------
NM_024554chr1----1185 --
NM_024556chr11----1386 --
NM_024561chr1351422 1199 1086 1070 72 ------
NM_024563chr511712 ------
NM_024569chr152017 1155 712 281 198 12807 1337 --
NM_024574chr42338 106 ----1113
NM_024582chr41217 --1392 --
NM_024583chr21242 1855 --1249
NM_024595chr121220 101 ------
NM_024607chr874446 4422 4396 3230 1614 1309 1195 11697 1583 --
NM_024612chr1721117 352 --1363 --
NM_024628chr321193 1117 ------
NM_024631chr111228 ------
NM_024635chr91228 ------
NM_024639chr62579 294 ------
NM_024643chr142526 120 ------
NM_024646chr153553 3229 2977 2475 299 13628 ----
NM_024652chr151820 11032 ----
NM_024659chr21899 --2704 371 --
NM_024663chr20----151 --
NM_024665chr3114472 4250 4211 3683 3632 3505 1519 1331 587 162 74 1962 24674 3343 11301
NM_024674chr163150 2675 1288 777 698 84 1668 ----
NM_024692chr221564 320 --21234 292 --
NM_024700chr131146 782 368 --1795 --
NM_024704chr201741 --1913 --
NM_024713chr1521542 262 1236 ----
NM_024721chr872382 1815 983 896 338 302 205 ----1212
NM_024725chr113825 816 88 ------
NM_024745chr165936 927 447 157 42 ------
NM_024749chr122023 51 ------
NM_024751chr41741 1656 1449 --
NM_024755chr153762 745 658 ------
NM_024759chr81132 1769 ----
NM_024761chr954220 2146 1976 1228 285 11236 ----
NM_024769chr112406 128 --11115 --
NM_024770chr2126006 5714 5680 5613 4935 4826 4629 4618 1774 888 879 147 --14464 --
NM_024772chr13490 426 202 ------
NM_024824chr1431585 277 52 --11408 1409
NM_024834chr1051331 594 516 446 292 ------
NM_024835chr17----1295 --
NM_024837chr153501 476 370 1171 ----
NM_024841chr1132142 937 638 11849 1952 --
NM_024881chr1931288 352 295 1987 22591 920 --
NM_024896chr932019 982 649 12255 1515 --
NM_024899chr182167 57 --1456 --
NM_024900chr441725 1700 145 85 11685 ----
NM_024900chr441725 1700 145 85 11685 ----
NM_024911chr11204 ------
NM_024915chr852017 1864 1143 633 576 --1972 12011
NM_024930chr552830 2219 996 641 79 ------
NM_024941chr521397 548 11301 ----
NM_024944chr211411 ------
NM_024946chr162590 447 ------
NM_024947chr3109471 7714 6791 3300 2507 2364 1313 1147 644 176 16502 39246 2852 2826 --
NM_024949chr443724 3419 434 321 --14302 2837 805
NM_024953chr1211842 12182 --12617
NM_024960chr20--2436 94 --1451
NM_024969chr23875 574 172 ------
NM_024989chr2107932 7480 6251 5847 5462 5087 2729 1450 906 825 --37370 5373 1379 --
NM_024991chr1062440 2344 2159 958 827 599 --12829 --
NM_025027chr192397 28 ------
NM_025040chr1921724 741 21542 1523 22470 2036 --
NM_025054chr863530 2984 1682 1669 1295 97 --13058 11133
NM_025069chr8--1192 ----
NM_025073chr123801 720 ------
NM_025076chr2136 --1197 --
NM_025106chr121876 1731 ------
NM_025126chr122525 269 ------
NM_025133chr22772 265 1948 ----
NM_025134chr162502 156 1201 11827 --
NM_025135chr181411 ------
NM_025137chr15173 --131 --
NM_025138chr132912 399 --1158 --
NM_025146chr311092 --22457 28 --
NM_025147chr23729 166 143 1226 ----
NM_025154chr721219 24 --3362 286 280 --
NM_025160chr154172 3071 2794 2701 541 1419 23669 623 11556
NM_025164chr1131904 1641 485 1867 ----
NM_025180chr362434 2277 2206 904 675 174 1309 23177 2582 13271
NM_025184chrX1834 ------
NM_025187chr1621259 541 ----1466
NM_025191chr153457 3004 1093 646 516 13375 ----
NM_025195chr831543 1537 1501 1636 ----
NM_025201chr1521530 1312 --11434 --
NM_025203chr22341 98 11330 ----
NM_025208chr1122102 705 --22210 214 --
NM_025221chr42409 181 ------
NM_025235chr1042099 1616 1555 294 1250 12226 1422
NM_025238chr152586 163 --11528 --
NM_025244chr2180 ------
NM_025248chr1732382 2285 802 ------
NM_025250chr722902 2709 --12860 1798
NM_030583chr82810 339 --1390 --
NM_030594chr1531323 1243 849 1162 31236 865 134 --
NM_030621chr1473716 1644 1383 1144 645 557 211 23954 750 43812 2904 1509 1453 13575
NM_030625chr101698 ------
NM_030627chr553190 3077 795 221 45 --11219 23871 1585
NM_030629chr1621472 522 ------
NM_030634chr152328 1001 613 546 508 ------
NM_030637chr141195 --1678 --
NM_030639chrX21776 1419 ------
NM_030647chr72718 146 24879 569 21703 874 --
NM_030648chr474281 3648 1727 1588 976 623 409 155 11962 45588 3538 2032 801
NM_030650chr244243 3947 1357 735 --44252 3866 3339 3282 13258
NM_030664chr1032399 1724 1631 1317 ----
NM_030665chr17----11419 --
NM_030670chr1221580 566 --11897 --
NM_030671chr1221580 566 --11897 --
NM_030674chr1295658 5424 5017 4084 1839 1482 1114 977 881 ------
NM_030751chr1021518 1346 1506 11294 --
NM_030751chr1021518 1346 1506 11294 --
NM_030755chr1422712 2289 12068 1995 1322
NM_030756chr10----196 --
NM_030759chr102661 176 ----1537
NM_030762chr1211366 --21571 682 --
NM_030780chr821732 330 ----11408
NM_030786chr13763 303 80 ------
NM_030790chr162293 255 ------
NM_030799chr52638 172 --32223 2116 815 --
NM_030803chr21510 --11040 --
NM_030806chr148698 2621 2183 130 16592 48443 3253 2488 847 18753
NM_030808chr173932 906 340 --1240 --
NM_030810chr641538 1518 1274 1057 ------
NM_030820chr631059 701 57 ------
NM_030881chr222577 300 --12171 12353
NM_030884chr33