TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-130b-5p
miRNA Sequence: ACUCUUUCCCUGUUGCACUAC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX186634 6227 6058 5523 5237 5133 4522 2699 2313 2277 1012 484 478 465 421 235 223 33 45738 4963 975 651 ----
NM_000192chr1211044 11416 21461 51 875 71 65 61 50 48 46 42
NM_000208chr19134447 4094 3691 3355 3274 3195 1667 1503 1244 942 531 419 312 --34455 3868 1504 13647
NM_000217chr1284879 4826 4260 4143 3495 1833 1214 840 54751 4150 3573 1343 240 21316 243 13414
NM_000259chr15126132 5572 5244 5164 4792 2562 2002 1888 1350 431 278 266 44349 1959 1304 95 --11306
NM_000332chr6136968 6797 6559 6114 5774 5333 5191 2341 1598 1452 1287 704 257 54713 4455 1470 1459 1322 31939 1789 844 --
NM_000337chr5125958 5936 4620 4394 4173 4005 2358 1961 1745 1565 1388 1190 45720 5150 2397 1433 26142 5329 --
NM_000351chrX103558 3507 2748 1707 1357 678 510 468 343 212 12951 12952 11700
NM_000368chr9214798 4617 4600 4466 3983 3751 3549 3536 3392 3335 3098 3043 2949 1580 1453 1438 1319 1257 1086 1005 987 11510 54439 4176 4141 1386 819 11859
NM_000376chr1253039 2751 1110 609 600 13075 22409 1111 32880 2487 2477
NM_000451chrX22120 358 22175 1757 12182 62181 2179 2089 2087 2085 629
NM_000522chr721083 197 ----3147 115 109
NM_000533chrX61593 1559 802 395 371 340 31878 1641 138 21722 1463 2724 598
NM_000555chrX127792 7382 2997 2913 2880 2255 2239 1561 1349 675 479 212 46759 6538 6294 5991 ----
NM_000599chr2123752 3726 3692 3230 2980 1827 819 719 523 374 353 302 23703 321 24466 1646 64010 3346 1715 325 293 273
NM_000610chr11102125 1865 1173 1167 1007 859 851 650 535 25 22590 781 32748 2061 763 11156
NM_000618chr12116235 4670 4339 4244 1995 1323 1194 1124 1037 757 25 75722 5007 4129 1684 1672 1653 1651 21702 933 14364
NM_000618chr12116235 4670 4339 4244 1995 1323 1194 1124 1037 757 25 75722 5007 4129 1684 1672 1653 1651 21702 933 14364
NM_000719chr12226577 6400 6389 6212 5878 5845 5825 5813 5733 5456 5133 4895 4805 4500 4383 4370 4128 2295 1965 1298 1048 808 36612 5697 2571 65437 5313 2434 2121 1158 1141 11788
NM_000721chr15383 238 136 113 105 --31880 593 93 12401
NM_000793chr14184819 4580 4215 4185 4147 3795 3409 1817 1345 916 895 764 723 390 294 254 127 105 24951 4105 65077 4876 904 828 711 673 --
NM_000806chr561529 1310 745 413 269 261 --1220 2255 241
NM_000809chr4178946 8432 7575 6720 6700 3614 3071 3060 2984 2630 2352 1934 1834 1346 1332 1228 865 27874 2274 ----
NM_000814chr15104234 3919 3857 3388 3151 2999 1623 1324 448 235 32780 2755 1491 13121 1335
NM_000831chr1175467 4774 4718 4675 4201 3951 3920 2414 1484 1358 1250 1079 1032 623 510 349 66 65190 2315 1510 1134 649 57 34993 1668 788 --
NM_000861chr342213 2144 1036 811 52544 2247 395 288 192 22100 945 3765 294 292
NM_000875chr15136510 6158 6036 5268 5236 5041 4985 4485 4389 4382 1051 684 541 26302 2230 22529 70 26591 69
NM_000891chr1763119 2269 1247 1166 948 150 12388 32352 2325 959 11403
NM_000944chr472280 1930 1786 1756 1705 355 166 ----1175
NM_001001344chrX122617 2527 2083 2012 1614 1605 989 320 291 263 243 218 1916 1249 1299
NM_001001389chr11102125 1865 1173 1167 1007 859 851 650 535 25 22590 781 32748 2061 763 11156
NM_001001390chr11102125 1865 1173 1167 1007 859 851 650 535 25 22590 781 32748 2061 763 11156
NM_001001391chr11102125 1865 1173 1167 1007 859 851 650 535 25 22590 781 32748 2061 763 11156
NM_001001392chr11102171 1911 1219 1213 1053 905 897 696 581 71 22636 827 32794 2107 809 11202
NM_001001396chr1114406 3929 3560 3472 3331 2939 2746 1427 1010 912 433 24421 3483 1121 33939 3485 2958
NM_001001481chr8103074 2957 2565 2508 2324 1322 1153 667 643 585 23434 2874 ----
NM_001001484chr1041925 1690 1548 557 31971 1805 819 11569 11658
NM_001001557chr8101888 1576 1370 848 626 459 384 252 153 79 1441 31734 1467 637 11427
NM_001001668chr1994222 3801 3661 3017 1596 963 437 414 408 11511 --14131
NM_001001709chr962473 2435 2363 1796 632 323 2529 300 2851 343 12200
NM_001003407chr10134635 3917 3906 3209 3142 1401 1375 1346 1050 808 709 442 31 44157 3436 691 127 23310 446 24250 3848
NM_001003408chr10134635 3917 3906 3209 3142 1401 1375 1346 1050 808 709 442 31 44157 3436 691 127 23310 446 24250 3848
NM_001003652chr18128679 8138 7854 7000 6730 6720 6658 5843 3480 1960 581 215 37036 2038 107 27602 3129 21884 222
NM_001003674chr18186989 5799 5688 5226 4267 2829 2742 2250 2209 1900 1502 1297 852 838 546 425 396 33 45771 4295 2070 338 36325 2655 2073 --
NM_001003675chr18186989 5799 5688 5226 4267 2829 2742 2250 2209 1900 1502 1297 852 838 546 425 396 33 45771 4295 2070 338 36325 2655 2073 --
NM_001003698chr671842 1795 740 644 504 466 425 ----18136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 104 102
NM_001003699chr671842 1795 740 644 504 466 425 ----18136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 104 102
NM_001003712chr1294088 4012 3577 2870 1517 1079 988 546 35 11374 --23381 588
NM_001003800chr9103746 3272 3030 2867 1283 1089 590 556 505 365 --32779 1259 1083 13659
NM_001004065chr9103188 2836 2624 1132 1068 1056 1021 535 377 351 41439 1099 1089 210 23193 679 31109 1091 686
NM_001005404chr1743513 2757 1269 878 33794 3090 511 54012 1402 386 378 74 24110 3072
NM_001005473chr5206477 5950 5941 5910 5567 5524 4548 2185 1445 1194 1159 1080 1020 1004 988 980 967 886 872 135 46071 5818 1914 1886 11203 56479 1073 1053 1033 729
NM_001005609chrX93255 3249 2783 2585 2538 2503 1227 533 482 --43416 3072 2551 1144 22905 2514
NM_001007023chr14184819 4580 4215 4185 4147 3795 3409 1817 1345 916 895 764 723 390 294 254 127 105 24951 4105 65077 4876 904 828 711 673 --
NM_001007094chr10144259 4149 3381 3031 2736 1747 1732 1722 1580 1489 902 118 41 34 44297 4043 1116 108 --21582 959
NM_001007097chr9104766 4523 4404 3752 3435 1980 1780 1122 1043 554 22018 1314 23794 29 23793 2016
NM_001007257chr131324 491 334 1234 21368 492 31367 1365 1363
NM_001007466chr6114694 3837 3694 3170 1971 1373 964 950 628 340 129 199 34301 4106 141 1120
NM_001008407chr781520 1377 1151 570 459 328 314 299 1372 11789 21753 1547
NM_001008408chr7166330 6157 4387 4299 4218 4206 2539 2469 2453 2434 2288 1696 1486 1387 433 347 34847 1913 1401 45817 5234 4852 1185 --
NM_001009554chr4114762 4525 4355 3786 3771 3538 3384 1196 1082 1070 304 31599 1102 138 ----
NM_001009554chr4114762 4525 4355 3786 3771 3538 3384 1196 1082 1070 304 31599 1102 138 ----
NM_001009899chr365308 5042 5036 2528 2364 1805 185 24742 4365 25961 4116
NM_001009993chr264240 3404 1361 1149 894 721 53956 3454 1107 826 255 23959 613 1907
NM_001010000chr1863009 2424 728 373 250 225 13549 2550 159 1383
NM_001010888chrX114064 3902 2912 1871 1742 1684 1476 1423 1366 773 181 23536 3051 --11145
NM_001010891chr596617 6224 6165 6093 5424 2196 2084 237 104 2507 202 45570 4886 4695 693 15533
NM_001010986chrX72005 1859 1844 1753 1740 1610 852 --2966 958 22110 902
NM_001011513chr431583 864 121 51443 1124 181 39 24 12724 31451 1449 1447
NM_001011666chr7136381 6101 6040 5947 5909 5607 5451 5155 4579 1296 883 95 32 96541 4923 4380 2487 2211 1945 1221 1219 183 12492 16372
NM_001012393chr11134628 4375 3944 3724 3513 1913 1830 1740 1452 1417 1322 1233 706 54749 4362 4273 3695 746 --14556
NM_001012423chr15102883 2778 2764 2493 2471 1082 965 839 817 640 1167 22656 1846 --
NM_001012753chr1914948 932 864 811 782 494 373 344 308 240 158 142 74 21 ------
NM_001014797chr10218193 8018 7400 6967 6941 6686 6323 6274 5980 5911 5542 5532 5484 5416 5177 5068 5048 4971 2867 2491 400 48110 7342 3297 810 36845 6117 6011 16934
NM_001017395chr392511 2243 1450 1440 1123 506 324 103 55 11143 23259 1130 13601
NM_001017440chr7278229 7634 7478 7458 7037 6459 6330 6221 6141 6123 6087 5797 5456 5447 5300 3185 2689 2608 2594 2476 2439 1898 1137 1129 726 479 200 67153 6986 6906 2405 1107 360 47300 5448 361 351 37312 2596 1290
NM_001017535chr1253039 2751 1110 609 600 13075 22409 1111 32880 2487 2477
NM_001018065chr9155501 5149 4681 4630 4406 4177 4008 3770 3746 1805 1248 1124 1004 80 50 31975 1746 1020 15594 --
NM_001018066chr9155501 5149 4681 4630 4406 4177 4008 3770 3746 1805 1248 1124 1004 80 50 31975 1746 1020 15594 --
NM_001024647chr12187579 7220 7146 7113 5884 5547 4716 2915 2143 1977 1817 1696 853 743 733 563 393 89 21662 901 ----
NM_001024948chr1103340 2777 2228 1391 1295 929 550 418 257 97 31383 899 595 21329 41 --
NM_001025076chr1066104 5269 4456 4430 2314 761 11629 14102 25444 4584
NM_001025077chr10107462 6627 5814 5788 4940 2119 1254 940 768 675 32987 318 119 15460 26802 5942
NM_001025233chr1262763 2549 2319 1751 1720 970 22193 224 --42054 349 216 214
NM_001025252chr863181 2708 2126 2112 2021 486 23042 2782 12647 12459
NM_001025253chr863181 2708 2126 2112 2021 486 23042 2782 12647 12459
NM_001025580chrX44265 2654 1476 414 2731 688 --3849 692 690
NM_001030007chr1683526 3269 3196 1519 1389 719 693 382 22772 116 63701 2614 1020 960 560 58 13366
NM_001031695chr2284312 3536 1987 1107 999 344 143 99 45460 4823 4445 1667 65403 3545 1910 1437 1397 332 33665 455 352
NM_001031804chr1663829 3740 3708 3394 3150 606 32719 1377 957 11558 --
NM_001034841chr16135359 4885 4760 3853 3353 2099 1595 1315 1105 966 634 290 225 11073 --21783 741
NM_001034852chr1451863 1834 1825 1751 773 1664 12057 32054 327 216
NM_001037165chr7178754 8198 8183 8123 7629 7520 7457 7357 6713 5501 2835 2611 2097 2006 812 724 523 22680 637 56281 3234 2738 2510 1339 36280 6278 1336
NM_001037290chr115989 825 299 103 93 --1109 --
NM_001039395chr952467 2346 895 420 38 3850 530 27 --1260
NM_001039538chr293605 3038 2859 2775 2506 1386 506 434 204 23018 2534 21115 456 --
NM_001039615chr85839 649 615 267 109 --21879 384 2321 191
NM_001039840chrX75988 5747 4696 4521 1203 1121 993 11609 --21094 1090
NM_001040001chr671592 1565 692 495 292 84 76 51697 1413 1367 1315 318 ----
NM_001040152chr784437 4072 3901 3391 1772 1690 1013 781 54493 4226 4114 3969 3256 --13945
NM_001040284chr16125820 5483 5000 4537 4452 3930 3724 2252 1841 435 396 213 35088 4474 4460 --12376
NM_001040429chr1342962 1331 285 100 53328 2594 272 258 243 12231 --
NM_001042355chr16155378 4740 4626 4606 4433 4419 4211 3821 3568 1523 1289 1220 886 799 427 12127 25174 3747 12131
NM_001042412chr16155378 4740 4626 4606 4433 4419 4211 3821 3568 1523 1289 1220 886 799 427 12127 25174 3747 12131
NM_001042481chr1482576 2419 2117 2038 1944 440 362 248 1464 1434 --
NM_001042599chr2177727 7513 6866 6352 4827 2735 1697 1659 1639 1349 1197 1030 936 263 178 122 29 12558 16965 2823 188
NM_001042601chr393181 3090 2402 2396 2297 2035 1276 1224 946 42566 2154 1185 1011 --12578
NM_001044385chr2103799 3471 2981 2782 2597 1083 909 854 694 510 61525 1406 1198 729 539 216 ----
NM_001044387chr1943814 3457 521 415 23945 974 13958 53957 3955 3953 3951 3949
NM_001044388chr1943814 3457 521 415 23945 974 13958 53957 3955 3953 3951 3949
NM_001083621chr194451 4093 3885 3689 3543 3030 1862 1151 45 23261 3251 22938 313 24055 3550
NM_001100108chr1127745 7598 7158 7146 6902 6561 6453 2708 2027 1988 1637 93 22825 1580 27729 1328 28310 2168
NM_001106chr3189541 8906 8742 8404 8325 7863 7766 6815 6297 3921 3749 3441 3358 1939 1827 755 469 294 --37494 6240 3515 12016
NM_001128chr1683526 3269 3196 1519 1389 719 693 382 22772 116 63701 2614 1020 960 560 58 13366
NM_001204chr297631 7360 5265 4759 2816 2481 2268 1247 735 26117 851 1722 17720
NM_001206chr9113105 2799 2704 2678 2243 2219 2210 1241 726 220 92 145 21093 970 21247 965
NM_001219chr762013 1987 590 472 435 297 11472 31485 694 429 1474
NM_001256chr1752585 879 322 297 166 --1302 21161 862
NM_001259chr7126140 5890 5081 4949 4857 4372 4052 4022 3852 2433 1944 453 45097 2056 683 264 26273 4201 --
NM_001304chr1762739 2612 2356 1294 708 105 33734 84 82 --3965 743 741
NM_001364chr11184287 3378 3063 2976 1606 1539 1401 1277 1003 796 681 526 491 472 211 180 162 34 31383 1322 1073 --33747 1317 1313
NM_001399chrX93255 3249 2783 2585 2538 2503 1227 533 482 --43416 3072 2551 1144 22905 2514
NM_001419chr1954526 1932 1851 683 634 34589 4020 1498 149 23537 1412
NM_001420chr1962696 2280 1983 587 571 46 32022 612 92 --13923 76 74 72 70 68 66 62 56 54 52 50 48
NM_001426chr23191 118 96 1185 --2137 127
NM_001438chr142894 1007 989 549 73590 3260 932 666 568 566 45 11426 1670
NM_001546chr651059 372 164 102 54 1153 2158 67 2157 155
NM_001609chr10114011 3965 3460 3212 3147 1670 1606 1532 1428 1421 1238 33642 3182 2812 23336 2889 --
NM_001650chr18153793 3641 3504 3149 2904 2880 2731 2648 2633 1659 1484 1183 518 175 165 53078 2782 2625 787 459 32787 2707 1636 --
NM_001684chr1104123 3646 3277 3189 3048 2656 1144 727 629 150 24138 3200 --33656 3202 2675
NM_001759chr12114059 3602 3444 3303 1449 1278 1235 863 473 459 153 14336 1492 228 24
NM_001955chr62165 157 --2915 305 4313 304 302 300
NM_002025chrX188776 8574 8235 7992 7756 7109 6448 6123 6116 3382 3036 2918 2728 2296 1994 1969 1629 873 16870 21337 685 16622
NM_002092chr483713 3468 3454 3179 1995 1942 1785 185 23729 1255 --21948 1253
NM_002193chr261583 1351 760 644 442 344 --1451 5634 450 448 446 444
NM_002223chr1283249 3196 3006 2967 2740 2484 1167 244 2692 502 23407 794 1297
NM_002241chr1152952 2895 2768 2721 2694 2676 2567 2541 2501 2470 892 866 837 523 328 --1249 23006 2921
NM_002270chr585080 4814 4319 3832 2271 2104 1806 1795 25569 5231 24220 384 --
NM_002313chr10134635 3917 3906 3209 3142 1401 1375 1346 1050 808 709 442 31 44157 3436 691 127 23310 446 24250 3848
NM_002334chr11132030 1900 1864 1779 1694 1541 1464 1449 1437 489 482 468 413 --21857 1821 11696
NM_002374chr293605 3038 2859 2775 2506 1386 506 434 204 23018 2534 21115 456 --
NM_002397chr541929 1580 1559 570 21749 1594 1390 1387
NM_002451chr9173759 3629 3620 3594 3542 3282 2995 2736 2681 1039 932 784 351 303 138 122 89 ------
NM_002505chr661496 1473 1379 1332 1111 342 21068 268 2990 964 4989 987 985 981
NM_002522chr1793978 3968 3283 3104 3007 2664 1391 1383 1022 13620 1928 43743 3603 3110 1456
NM_002545chr11134628 4375 3944 3724 3513 1913 1830 1740 1452 1417 1322 1233 706 54749 4362 4273 3695 746 --14556
NM_002547chrX123656 3151 3058 2992 2794 2615 1462 382 315 254 162 104 33760 1716 818 53008 2599 1637 1547 56 --
NM_002577chr3103755 3699 3669 2451 1392 610 602 519 211 118 31152 1079 707 --11170
NM_002581chr9115264 4453 3430 1633 1607 1367 1357 1307 1053 468 151 54529 4184 3563 1884 404 1628 23436 406
NM_002607chr71930 2257 173 --6277 275 271 265 263 261
NM_002612chr761542 1418 1304 1292 647 500 --22004 537 41325 797 795 309
NM_002698chr19112942 2917 2481 2404 2188 2160 2099 1949 773 464 422 42839 1848 781 483 42484 2075 908 358 22483 903
NM_002737chr17186409 6215 5729 5381 5239 4654 4608 4554 4371 2571 2563 2501 2234 2134 1209 541 448 202 24332 1319 12484 36475 2467 2286
NM_002886chr3145131 4648 4400 4314 4084 3347 3232 1916 1361 795 528 487 378 371 13797 21161 512 --
NM_002955chr671842 1795 740 644 504 466 425 ----18136 134 132 130 128 126 124 122 120 118 116 114 112 110 108 106 104 102
NM_003030chr371243 630 565 489 430 423 410 --21761 749 1287
NM_003034chr1297785 6956 6194 5420 5176 2528 2409 918 121 57451 7446 6137 5840 5786 15863 15054
NM_003099chr15116461 5903 5320 5186 4971 4943 4872 4779 4201 1067 687 36139 4839 1993 24161 622 14845
NM_003107chr682631 1956 1761 621 501 167 116 88 52063 1708 357 105 98 2440 259 --
NM_003108chr2137002 6447 5234 5158 4751 4634 2711 2382 2090 1782 1701 479 142 76938 6318 5916 5854 2240 991 595 35044 2302 2231 --
NM_003199chr1885692 5481 5215 4891 4846 1004 755 200 14329 --14771
NM_003204chr174712 432 382 318 11252 3731 371 155 41796 1794 1792 1790
NM_003236chr2113555 3548 3468 3212 3190 2757 2687 2658 2175 449 55 32799 1162 254 73219 3067 1314 1098 949 943 460 33218 3216 3214
NM_003298chr3145046 4469 4391 4327 4311 4219 2424 1994 1550 1081 340 330 270 25 14156 ----
NM_003326chr152703 2462 427 417 277 2743 602 2435 91 --
NM_003410chrX62829 2555 1088 1060 986 580 22708 1035 11006 --
NM_003421chr10144259 4149 3381 3031 2736 1747 1732 1722 1580 1489 902 118 41 34 44297 4043 1116 108 --21582 959
NM_003439chr7103327 3268 3081 2607 2538 1108 1035 446 347 208 ----23117 606
NM_003574chr1844977 2084 948 760 --15490 35489 5487 4222
NM_003607chr1164167 3906 3524 3344 2745 1545 1467 1209 1154 1031 1021 719 709 684 676 581 1623 1712 31551 1519 711
NM_003617chr174853 4821 4335 4238 3669 3442 400 34684 3314 925 34777 3711 3698 13690
NM_003759chr473944 3678 3244 2995 2955 1349 495 22962 1155 --24075 1140
NM_003768chr161693 1677 1403 716 663 354 31707 1586 451 1717 31669 1667 1590
NM_003774chr1232918 2300 54 12540 1568 32631 2333 810
NM_003822chr172725 2082 1183 1177 1146 77 65 21039 41 --11189
NM_003872chr262574 1941 719 377 368 57 --12867 21089 1069
NM_003939chr1093840 3584 2883 2629 1435 1130 1032 610 425 53571 2604 2602 1264 726 21436 780 13495
NM_004028chr18153793 3641 3504 3149 2904 2880 2731 2648 2633 1659 1484 1183 518 175 165 53078 2782 2625 787 459 32787 2707 1636 --
NM_004098chr1041065 269 253 68 31164 279 48 1290 16341 339 337 335 333 331 329 327 325 321 315 311 305 303 285 120
NM_004170chr961544 1195 744 592 580 36 21866 80 --2586 315
NM_004171chr11138583 8402 7778 6923 5935 5816 3621 3567 3335 2568 1190 1016 778 22276 600 16730 --
NM_004232chr1883652 3263 2513 2474 2439 1339 1029 126 32569 1125 199 --32575 2573 1534
NM_004293chr9123485 3395 3104 2937 2822 2644 2500 2413 1163 1027 335 161 53331 2841 2667 834 517 ----
NM_004338chr18186989 5799 5688 5226 4267 2829 2742 2250 2209 1900 1502 1297 852 838 546 425 396 33 45771 4295 2070 338 36325 2655 2073 --
NM_004397chr1193787 3164 2694 1211 1178 433 284 176 123 53092 1287 321 298 157 43093 1288 806 272 --
NM_004430chr862444 2390 1957 1007 434 248 11782 32156 1943 850 22008 2004
NM_004441chr361320 927 833 360 337 90 11051 1348 3900 343 26
NM_004502chr172180 156 1192 --350 40 27
NM_004586chrX134566 4089 3904 3504 3476 3297 1897 1768 1351 979 744 208 81 55004 4664 3531 1966 968 11971 12160
NM_004612chr974272 4173 3364 3083 1817 341 101 33829 3287 1032 --11743
NM_004637chr311058 11338 --3367 365 363
NM_004745chr8136891 6232 6072 5915 5469 5321 5135 2815 2164 1495 1181 747 473 --24878 4703 26234 4775
NM_004748chr15124164 3832 3222 2791 2729 1342 845 768 490 375 110 90 13185 --1905
NM_004796chr1431709 966 648 22079 1550 11997 1678
NM_004823chr1971592 1575 1562 1512 1448 1356 484 11456 11212 101548 1546 1544 1542 1538 1532 1500 1478 1474 1454
NM_004845chrX73764 3308 2679 1614 786 266 183 34194 286 118 13699 33621 2654 1234
NM_004904chr7136381 6101 6040 5947 5909 5607 5451 5155 4579 1296 883 95 32 96541 4923 4380 2487 2211 1945 1221 1219 183 12492 16372
NM_004999chr673614 3124 3010 1793 1307 1183 1159 23786 324 22993 590 23347 3328
NM_005065chr14145081 4557 3871 3834 3619 1910 1719 1689 1673 1272 667 654 105 39 34457 3980 584 ----
NM_005076chr1154063 3914 3890 3763 3304 1615 1302 1235 1165 824 672 464 297 280 100 11339 33243 1409 702 --
NM_005079chr863181 2708 2126 2112 2021 486 23042 2782 12647 12459
NM_005188chr11148304 7999 7972 7394 7307 7012 6680 6323 5603 2208 1993 1241 1021 471 21516 245 1246 --
NM_005197chr1465131 4298 3974 2472 1988 963 55969 2346 2212 1284 207 44956 4106 3766 1964 55954 873 871 869 865
NM_005207chr2293498 3490 3024 2955 2897 2761 2299 267 200 23264 455 1284 23109 453
NM_005219chr541549 1412 592 189 31707 1466 1290 31718 1467 194 41717 1715 1713 1711
NM_005222chr74801 89 80 47 2681 311 1320 3335 315 313
NM_005235chr2177727 7513 6866 6352 4827 2735 1697 1659 1639 1349 1197 1030 936 263 178 122 29 12558 16965 2823 188
NM_005238chr1172765 1342 1300 787 700 440 176 11238 22692 1018 21381 287
NM_005284chr62162 117 3415 134 125 ----
NM_005339chr483481 2982 2883 1474 865 692 268 202 12863 --13912
NM_005399chr1124311 3676 3612 3197 1508 1484 1244 1202 967 786 345 326 34201 3690 1074 11548 --
NM_005400chr292739 2200 1897 1165 1147 860 777 648 353 2741 467 12450 12131
NM_005458chr972321 1725 1569 885 400 268 225 31999 1808 335 2392 338 12005
NM_005497chr17116145 5411 2440 2388 2333 2258 1380 1151 545 390 168 32311 1186 537 32366 1360 592 22059 174
NM_005504chr12136340 6300 5903 5853 5357 5304 5280 5264 4734 1720 1433 1329 587 12343 21330 1017 14682
NM_005578chr3104302 4219 3886 3613 3577 3492 1092 657 474 445 11371 --34321 4317 3583
NM_005596chr9156105 5621 5510 5225 5131 3940 3933 2022 1201 904 782 304 228 210 176 --25891 4897 14533
NM_005604chr621689 967 42094 1987 1701 313 3650 471 269 3305 303 299
NM_005665chr164802 4099 3599 3275 1579 1312 23216 1766 --34323 3299 1678
NM_005668chr5104516 4443 3918 3505 3117 2891 1793 1071 352 112 --23804 3745 --
NM_005779chr5103374 2842 2465 2380 1296 1169 830 542 503 285 12939 --21435 333
NM_005840chrX187644 7398 6931 6748 6380 6358 6158 6123 6073 6028 5648 5305 4776 4732 2966 1731 1686 1161 16534 27477 2020 96390 6388 6386 6384 6382 6368 6364 6342 5757
NM_005853chr163496 460 92 1542 --494 84 82 80
NM_005901chr18128679 8138 7854 7000 6730 6720 6658 5843 3480 1960 581 215 37036 2038 107 27602 3129 21884 222
NM_005902chr15124083 3751 3546 3384 3333 2871 1603 1418 1259 1209 732 100 34313 1119 794 54114 3097 1826 1790 419 11781
NM_005909chr584048 3708 3105 595 488 437 400 321 2468 460 51260 471 350 340 328 9422 386 384 382 380 349 327 325 323
NM_005910chr1753901 2811 2539 331 40 33418 2639 779 21499 49 22904 342
NM_005935chr4115141 5122 5010 4866 4500 3459 1070 894 541 449 414 23426 1690 14032 1837
NM_005941chr873068 2959 2722 2549 1492 473 302 1465 13073 13376
NM_006007chr9104078 3556 3217 1730 1543 898 601 502 487 67 24281 3832 13833 --
NM_006017chr42417 49 1713 --4733 721 719 717
NM_006037chr274406 4315 3744 3429 660 494 304 --14188 23830 1325
NM_006054chr1171621 1230 1092 322 296 225 78 21500 312 1290 --
NM_006139chr272537 2246 1158 770 741 481 388 32866 293 191 22215 1771 --
NM_006203chr5135603 5159 4691 4373 4243 3614 3512 3387 2126 1724 680 376 291 33947 2183 833 45286 5197 5053 4832 --
NM_006226chr231234 489 399 1281 21425 242 8303 301 299 297 295 291 285 283
NM_006252chr1107423 7027 6194 5973 5577 2482 2375 2023 1756 577 27547 5999 11711 16122
NM_006283chr8124067 3801 3714 3693 3458 3428 3199 1931 1243 591 205 175 21256 435 --14038
NM_006315chr454068 3729 3231 2794 532 --24387 1289 22890 140
NM_006371chr3165092 4719 4706 4223 2119 2010 1842 1811 1764 1718 1629 1619 1008 892 799 789 15082 54828 3696 1768 1623 1411 44182 1457 1164 122
NM_006380chr1773984 3048 1189 572 500 349 306 12930 13728 11730
NM_006457chr431583 864 121 51443 1124 181 39 24 12724 31451 1449 1447
NM_006534chr2092884 2236 2158 1321 648 432 379 100 70 32791 1239 390 --11119
NM_006546chr17176698 6331 6269 5202 4509 2589 2357 2241 2165 1904 1262 686 650 631 357 317 145 25741 1772 26368 1967 25401 4067
NM_006548chr331136 664 609 21579 549 --31583 1581 415
NM_006557chr971503 1328 1295 1090 545 528 135 11308 --2586 571
NM_006561chr1066104 5269 4456 4430 2314 761 11629 14102 25444 4584
NM_006599chr16117707 7222 5677 5360 3304 3211 1305 988 658 500 147 ----11866
NM_006620chr6114804 4226 4038 3723 3685 3559 3516 1955 1758 1405 1015 34071 3465 3311 14390 1118
NM_006720chr10134635 3917 3906 3209 3142 1401 1375 1346 1050 808 709 442 31 44157 3436 691 127 23310 446 24250 3848
NM_006729chrX95018 3647 1667 1019 732 445 395 298 91 35465 1476 377 1478 --
NM_006732chr1921558 421 1593 384 75 54 393 83 44
NM_006750chr16187638 7317 6963 6410 5806 5512 3205 3019 2554 2270 1790 1688 1538 1489 1028 553 157 22 25674 1610 11689 16497
NM_006884chr371243 630 565 489 430 423 410 --21761 749 1287
NM_006885chr1643932 3899 1193 771 23597 1590 23700 1595 23699 1661
NM_006902chr153361 3217 2525 2468 1036 23237 2615 11006 11013
NM_006924chr1793584 3558 3467 3059 1771 1738 1690 734 448 23321 379 33119 2723 1778 12719
NM_007011chr15136387 6136 5742 5716 5367 4811 2767 2135 1635 1297 1077 426 373 --34636 4349 680 12237
NM_007030chr564570 1827 1700 1519 790 308 13961 43870 3835 3765 3625 24864 4820
NM_007050chr20167627 6932 6912 6674 6281 6169 6121 5425 5287 4970 3199 2837 2555 2267 1479 555 97845 6989 6100 5703 2287 2097 1066 772 121 46522 6298 5859 1387 26994 854
NM_007137chrX85127 4146 2095 1868 1402 1365 1081 401 31514 1444 841 --51826 1512 326 194 190
NM_007153chr19154426 3847 3789 3712 3623 3432 3373 2955 2780 2771 1350 822 752 512 408 34241 4103 494 24420 3307 33304 3191 754
NM_007172chr22103135 2930 2811 2670 2204 1338 731 404 240 132 12781 2654 369 1970
NM_007203chr9103188 2836 2624 1132 1068 1056 1021 535 377 351 41439 1099 1089 210 23193 679 31109 1091 686
NM_007249chr13116825 6384 6228 3580 3510 2854 2434 2410 2290 1238 97 89152 8337 7587 7117 6238 2833 1082 238 32881 783 542 27433 1314
NM_007350chr12124274 4229 3811 3546 3375 3168 1631 1306 901 814 442 240 1827 24244 3006 --
NM_012104chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_012104chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_012164chr9107299 7225 6742 6653 6596 5130 2602 1842 1120 734 37415 4994 1011 11615 --
NM_012199chr1104182 3420 3398 3186 927 869 574 450 268 86 33446 3411 1242 24095 4029 24220 4173
NM_012214chr2136287 6096 6011 4754 4496 4488 4281 4211 4160 4111 4067 4017 2197 15122 25523 4189 --
NM_012215chr1041630 1568 430 178 21529 1392 41445 743 439 283 1212
NM_012252chr7105385 4953 4174 1852 1631 1527 1344 545 260 160 44936 4659 4635 879 ----
NM_012259chr651022 539 481 454 376 --2387 379 31039 488 378
NM_012395chr793380 2486 2076 1176 1050 861 494 77 55 33321 2566 1149 ----
NM_012431chr762327 836 703 685 551 310 33143 2316 99 --32762 2362 2344
NM_013231chr1474307 4019 2916 1517 871 638 485 43640 3112 1565 884 33931 3014 386 --
NM_013255chr7188858 8293 7920 7533 7403 6832 6816 6224 6175 5738 5678 5628 5416 3207 1850 1638 1188 886 37237 6641 1038 27299 949 --
NM_013286chr383764 3517 3172 3137 3067 2871 2593 1331 23729 751 13594 23143 1304
NM_013372chr1593393 3020 2998 2345 2058 1294 725 298 219 63092 2272 2068 1275 1247 962 33289 1165 385 1659
NM_013374chr3103172 2942 2530 2231 1942 1921 1198 1050 722 44 --12932 12967
NM_013989chr14184819 4580 4215 4185 4147 3795 3409 1817 1345 916 895 764 723 390 294 254 127 105 24951 4105 65077 4876 904 828 711 673 --
NM_014112chr8134993 4917 4597 4336 4290 3825 3497 3388 1808 1770 499 211 203 --1357 34604 3423 331
NM_014141chr775266 4383 3644 3292 1423 624 54 31809 1759 535 2678 526 2629 60
NM_014155chr11136476 6286 5619 2600 2584 2413 2136 1676 591 453 396 202 176 45751 2619 513 33 25943 2572 17478
NM_014309chr2284302 3526 1977 1097 989 334 133 89 45450 4813 4435 1657 65393 3535 1900 1427 1387 322 33655 445 342
NM_014331chr4147341 7194 7013 6223 6009 5532 2322 2298 1892 901 605 465 459 113 37428 7178 1251 ----
NM_014368chr952031 1653 772 720 666 2741 693 --31381 750 566
NM_014423chr5105150 4335 4151 4046 3791 2251 1749 764 195 60 24358 4114 11743 --
NM_014613chr572918 2837 2100 721 601 164 94 --12861 3461 452 96
NM_014614chr251251 939 507 501 494 ------
NM_014630chr1563409 3193 2755 1564 1282 1270 21522 1264 21526 444 --
NM_014646chr1872213 2000 1227 1046 626 331 311 22764 1211 1848 33063 2330 199
NM_014647chr1632092 1739 1627 31418 756 506 1838 22198 1941
NM_014653chr1232172 1902 523 61921 1913 1893 1395 1369 837 21894 838 91925 1923 1876 1874 1872 1870 1868 1866 175
NM_014721chr6137212 6925 6364 6206 2859 2843 2820 2468 407 384 348 198 122 35480 2591 444 14663 1413
NM_014730chr12214746 4523 4467 4417 4141 4094 4074 3920 3889 3854 3616 3576 3453 1554 1372 540 466 312 160 143 44 2134 108 22089 1533 23972 856
NM_014730chr12214746 4523 4467 4417 4141 4094 4074 3920 3889 3854 3616 3576 3453 1554 1372 540 466 312 160 143 44 2134 108 22089 1533 23972 856
NM_014755chr2104109 3790 3556 3417 3330 3184 2886 2738 2706 240 --23383 830 14008
NM_014762chr1102545 2382 2094 1821 1610 1017 1011 538 180 21 22482 98 22156 799 22409 302
NM_014766chr7153367 3312 2815 2798 2462 2451 2373 1144 1130 1105 947 938 931 560 337 11018 --1569
NM_014803chr10102854 2622 2568 2183 2129 883 579 516 464 204 12284 2433 145 12288
NM_014826chr1164167 3906 3524 3344 2745 1545 1467 1209 1154 1031 1021 719 709 684 676 581 1623 1712 31551 1519 711
NM_014827chr161372 1338 1177 1109 621 533 21144 268 21171 293 11683
NM_014840chr1263216 2789 2680 1232 891 741 33086 761 166 31367 550 320 31329 763 589
NM_014864chr1123928 3914 3904 3883 3550 3513 3504 3064 2755 1731 1136 557 1634 11528 31056 640 638
NM_014870chr194451 4093 3885 3689 3543 3030 1862 1151 45 23261 3251 22938 313 24055 3550
NM_014873chr1134745 4482 4359 4283 4045 3795 3492 3280 1856 1515 1120 305 268 --23879 3508 11926
NM_014877chr17137524 7236 6662 6512 5769 5539 5105 3051 1930 1636 1472 1264 488 26343 4821 36344 5637 5112 --
NM_014893chrY92318 2073 1639 852 762 693 487 442 132 3661 70 58 1561 --
NM_014899chr553034 2657 1263 1132 682 32513 867 177 1877 2896 872
NM_014904chr1063895 3869 3471 3086 2469 129 33227 1141 39 11124 284 43
NM_014909chr14113388 3134 2845 1589 1374 1366 1217 1203 1080 689 534 23771 3321 53600 3322 1550 1502 123 21273 506
NM_014912chr1083244 3175 2488 2414 2217 1375 416 46 32781 2693 56 22665 1065 --
NM_014935chr172906 2521 1387 1324 727 623 426 22550 1086 73051 2616 2384 1397 841 827 785 15767 765 763 761 759 757 755 753 751 749 747 743 733 731 729
NM_014982chr14115179 4810 4432 4416 4223 2114 1709 1467 984 934 248 21643 63 15138 1492
NM_015008chr392511 2243 1450 1440 1123 506 324 103 55 11143 23259 1130 13601
NM_015020chr1663018 2958 2914 1536 970 559 23380 1150 13173 2972 652
NM_015026chr1233311 76 30 34422 483 348 --24057 3197
NM_015035chr20126390 6253 5617 4570 2578 2497 2255 1573 1423 1011 881 24 36009 2630 576 21574 61 15455
NM_015049chr2102960 2411 2135 1321 1026 402 385 233 88 46 1369 1125 1395
NM_015051chr9103351 3190 2950 2769 2456 2444 2322 2102 279 116 43387 2715 814 425 --12899
NM_015064chr12103202 3188 2751 2462 2356 829 786 678 598 250 31231 863 418 21177 356 1881
NM_015068chr793289 2924 2753 1202 1048 993 923 624 542 43345 3078 2966 2821 11137 12797
NM_015071chr5186066 5933 5518 5389 5366 5219 5197 4873 4603 4595 2349 1858 1398 1380 1318 1024 530 248 65339 4481 4354 1824 1362 1260 31982 1804 334 45345 2593 2131 1864
NM_015076chr6124024 3865 3827 3762 3338 3252 1376 1066 918 879 797 298 23090 848 11782 13576
NM_015077chr1774264 3443 3434 1231 947 364 59 34474 4186 3248 44518 4284 3446 923 33445 3102 3002
NM_015090chr1136121 5487 5230 4949 4762 4523 4499 4455 3964 3922 845 446 429 44778 4771 4017 929 24035 4018 11613
NM_015199chr372335 2259 2165 1107 641 455 103 --1152 22020 1203
NM_015247chr16155378 4740 4626 4606 4433 4419 4211 3821 3568 1523 1289 1220 886 799 427 12127 25174 3747 12131
NM_015310chr8218416 8369 8034 7659 7144 7115 7030 6961 6886 6847 6776 6710 6398 6380 5948 5675 5484 5304 5206 1049 723 26273 6077 66686 6078 3182 2535 2056 685 11376
NM_015352chr20173939 3138 3043 3014 2980 2856 2770 2723 2706 2598 2450 2442 1482 1212 707 154 133 43751 3101 346 330 53216 3087 2784 1529 1419 13082
NM_015365chrX44265 2654 1476 414 2731 688 --3849 692 690
NM_015375chr1174559 4487 4109 4001 3841 3707 3548 3465 3254 3235 1611 1553 1296 688 669 290 169 24924 3610 14093 11479
NM_015393chr483765 3326 2443 1216 1052 580 423 306 32852 2513 806 32915 864 463 32517 844 812
NM_015458chr8104504 3736 3575 3382 1981 1897 1665 656 581 398 24375 355 45210 4167 1850 227 --
NM_015713chr883263 3189 2591 1334 1322 1307 881 575 ----23161 1136
NM_015852chr7183608 2409 1316 1216 1135 1051 967 883 799 715 631 547 463 379 295 211 127 43 --12634 --
NM_015866chr131324 491 334 1234 21368 492 31367 1365 1363
NM_015879chr18238311 7434 7414 7332 7316 6889 6363 6318 6308 6000 5608 5582 3279 2631 2458 2173 1986 1938 1793 1681 1327 998 122 1220 28041 7357 --
NM_015886chr8145767 5030 4508 3690 3637 3565 2187 1744 1679 1536 1312 981 857 311 11215 --22012 72
NM_015898chr1942457 2384 1762 1617 32195 700 48 --452 50 40 36
NM_015995chr15105069 5015 4627 4442 4259 4098 3940 3760 3455 1373 22163 78 24487 2130 22129 82
NM_016009chr194665 4055 3642 3195 1888 1810 1747 1311 435 1804 23294 1298 13293
NM_016083chr673572 3001 2985 1461 759 501 64 33915 3219 1404 12852 1815
NM_016206chr3148501 7982 7831 6327 5862 2909 2437 2243 1576 1261 1061 848 331 99 37165 6797 5912 13293 22849 111
NM_016257chr183334 2766 2232 1123 809 708 427 296 33306 2869 188 11222 43345 3308 2904 933
NM_016260chr296050 6027 5996 5146 3032 2646 438 364 184 46375 1292 197 195 12576 13012
NM_016507chr1742681 2526 943 26 21197 464 --23025 329
NM_016588chr62854 68 1878 1598 2884 882
NM_016834chr1753901 2811 2539 331 40 33418 2639 779 21499 49 22904 342
NM_016835chr1753901 2811 2539 331 40 33418 2639 779 21499 49 22904 342
NM_016841chr1753901 2811 2539 331 40 33418 2639 779 21499 49 22904 342
NM_016929chr683844 3574 1539 1205 929 911 471 36 33819 3536 2989 43537 2800 1753 472 1441
NM_017563chr3135566 4698 4221 4120 2549 1944 1888 1769 1616 1565 1432 320 217 36116 2447 1991 24500 1408 34605 1983 1714
NM_017628chr494894 4349 4158 3986 3435 3428 1859 1613 238 14448 --24477 93
NM_017633chr6123837 3652 3581 3277 3250 3020 2553 2460 484 192 80 53 6787 785 763 399 253 251 42908 2625 1260 1230 12907
NM_017637chr9167641 7617 7605 7329 6928 6418 5872 5866 3376 2654 2551 2326 1292 744 492 229 127891 7676 7234 6430 3715 3384 3207 1919 1873 1593 422 378 47852 7679 7609 1637 36154 3713 1645
NM_017643chr1761226 635 354 338 235 34 --12106 32105 1017 823
NM_017650chr775434 4642 2131 751 628 498 425 35676 4442 1103 --35844 3849 1297
NM_017694chr231546 1361 460 11285 11355 21354 424
NM_017784chr321036 793 ----4874 131 129 127
NM_017848chrX104654 4584 4309 3842 3480 1757 1667 1559 1418 1412 22985 969 64573 1542 1448 1381 785 34 21539 821
NM_017902chr1095420 5340 5322 5030 4113 3759 3656 2039 1957 24434 2283 55483 3741 1909 1588 643 55270 5050 597 448 446
NM_017919chr9115572 5103 4756 4155 4096 3795 1721 1309 543 335 250 21578 941 12173 --
NM_017994chr7112463 2290 2237 1097 1040 976 952 922 841 290 37 22481 2153 22438 2014 129
NM_018027chr1091329 1263 880 748 642 549 489 449 327 42518 2349 2137 972 1460 --
NM_018157chr1272633 2407 2287 1139 1039 631 264 12273 22457 415 12323
NM_018200chr1572120 1874 1012 595 347 145 126 1705 2877 101 32459 872 531
NM_018247chr6102849 2777 2377 2204 2100 2054 1905 769 453 443 ----1389
NM_018293chr382842 2819 2527 2209 824 790 783 733 12720 --1338
NM_018299chr8103074 2957 2565 2508 2324 1322 1153 667 643 585 23434 2874 ----
NM_018440chr8208330 7956 7402 7161 7138 6947 6102 6071 5496 5374 2889 2673 2651 1729 1689 1408 1213 871 585 172 48112 7083 6616 2103 13132 166
NM_018660chr882794 2481 1120 972 883 462 403 340 22173 1073 42178 1242 681 227 22161 94
NM_018999chr1084809 3970 3751 3626 1170 295 287 45 24216 1252 44633 4217 3666 94 --
NM_019064chr173822 670 644 --2320 169 4736 319 317 28
NM_020122chr275290 5069 4992 4416 2136 436 282 35537 4584 4523 13952 25676 139
NM_020205chr1103163 3106 3071 3055 3000 2904 541 531 379 27 31215 765 705 1769 1620
NM_020228chr1131909 1688 251 32125 489 414 --7859 857 855 853 851 811 724
NM_020245chr6104600 3743 3600 1877 1279 870 856 534 246 35 --34207 4012 47 126
NM_020297chr1272560 2480 2389 1126 617 607 417 1674 11000 --
NM_020337chr442659 2648 2168 2125 21251 867 --22222 2026
NM_020440chr183262 3111 2139 1276 899 832 443 58 23195 2099 32663 2144 1231 12557
NM_020443chr1166910 6248 5482 5294 5183 4611 2365 1819 1749 1736 1419 1201 1097 754 648 187 56829 5023 2603 2556 1455 56832 5756 2269 625 139 32370 624 392
NM_020466chr6114572 4439 1686 1595 1377 1367 944 880 832 121 21 54983 3878 1479 1320 639 --43503 1547 1331 1325
NM_020673chr20127296 6915 6809 6685 5583 5352 3046 2693 2164 2033 1490 781 32798 334 221 --17004
NM_020699chr1135438 5376 5084 4458 4349 4189 4138 3661 1922 1473 1111 772 620 13576 31781 777 714 --
NM_020718chr16136393 5969 5213 4848 4631 4385 4060 2579 1400 1043 928 624 544 11276 2390 383 --
NM_020724chr482604 2570 2421 2373 1830 1765 292 46 21849 25 156 12423
NM_020734chr1282508 2221 2141 769 398 202 110 103 --1136 12696
NM_020739chr15124164 3832 3222 2791 2729 1342 845 768 490 375 110 90 13185 --1905
NM_020742chrX72487 2127 1715 823 575 64 57 32549 505 72 2709 461 488 86 82 70
NM_020748chr172762 435 3681 450 443 1551 1285
NM_020772chr17158660 8294 8004 7514 7400 6328 6012 5874 3289 3105 1660 1492 1254 1036 391 12192 27334 6000 --
NM_020774chr1895851 5740 5083 4768 4522 4374 2405 2254 432 21806 729 25045 1196 --
NM_020782chr12164472 4465 4326 4122 3769 3750 3591 3439 3274 2982 1920 1043 838 764 309 89 33142 3023 182 ----
NM_020802chr1173205 3113 2748 2654 2648 2607 213 13069 12749 23073 2080
NM_020841chr1294088 4012 3577 2870 1517 1079 988 546 35 11374 --23381 588
NM_020844chr8116823 5337 2939 2885 2664 2188 1124 986 725 550 199 46023 6009 1214 291 25975 2638 --
NM_020935chr2124281 3436 1738 1724 1561 1527 1010 966 913 592 417 339 34400 3392 772 --179
NM_020960chr984931 4162 3557 1780 1384 912 755 268 33579 1278 1216 44890 3724 1693 386 1259
NM_021038chr363227 2675 2530 765 38 32 32848 2472 983 ----
NM_021061chr8124385 3646 3476 3433 3319 3206 3077 3045 2866 1109 982 140 23935 3114 23940 3239 14387
NM_021116chr7128230 7870 7768 7722 6936 6540 3523 3261 2854 2738 1368 992 59103 8364 6023 3103 1507 46157 6024 2989 2170 --
NM_021120chrX63160 2851 2162 823 347 330 63028 2895 2839 2064 886 324 33084 3077 1110 12005
NM_021165chr14757 736 291 31 ----3759 309 161
NM_021638chr484756 4598 4509 3667 1308 710 263 252 --34180 3609 394 21485 954
NM_021647chr4114762 4525 4355 3786 3771 3538 3384 1196 1082 1070 304 31599 1102 138 ----
NM_021705chr661496 1473 1379 1332 1111 342 21068 268 2990 964 4989 987 985 981
NM_021813chr6115663 5272 5183 5016 3955 3809 2011 1741 1365 1124 223 --64995 4210 4065 1742 1479 1169 11897
NM_021905chr672270 1425 408 358 344 222 199 --2830 212 1795
NM_021912chr15104234 3919 3857 3388 3151 2999 1623 1324 448 235 32780 2755 1491 13121 1335
NM_021949chrX112912 2822 2378 2307 1909 1900 615 586 558 538 513 --1544 1594
NM_021960chr182564 2449 2102 1864 735 297 206 191 12541 21933 170 12547
NM_021961chr11167010 6633 6485 6215 6075 5725 5650 5601 5223 2018 1886 1571 1466 725 539 285 25064 228 ----
NM_021964chr385319 4640 4544 4371 4106 4074 2262 584 26073 5473 15249 11745
NM_022048chr15146143 5973 5300 4660 3911 2387 1853 1678 1594 1555 1507 1500 1284 732 41805 1542 933 874 31830 1810 908 21143 420
NM_022062chr1171598 433 426 416 332 262 143 2759 152 11248 1646
NM_022137chr1451863 1834 1825 1751 773 1664 12057 32054 327 216
NM_022456chr12187579 7220 7146 7113 5884 5547 4716 2915 2143 1977 1817 1696 853 743 733 563 393 89 21662 901 ----
NM_022459chr1385813 4947 4482 2071 2059 1984 1748 1044 14013 --1568
NM_022469chr182659 2558 2081 1278 835 415 295 254 11255 --22769 1247
NM_022648chr283316 3205 3167 2987 1467 1013 500 118 43153 1582 331 174 43080 2961 1583 91 14943 202 200 198 196 194 192 190 188 186 184 182 180 178
NM_022716chr153205 3061 2369 2312 880 23081 2459 1850 1857
NM_022817chr23278 195 66 12152 --2250 59
NM_022893chr282798 2704 2146 1223 1085 646 624 451 32826 2455 459 11228 4469 467 465 463
NM_022898chr1474306 3910 3892 3292 3154 1001 56 14123 24185 3147 44312 4184 3365 3146
NM_024034chr20--1212 21008 217 5236 234 232 230 216
NM_024341chr1943814 3457 521 415 23945 974 13958 53957 3955 3953 3951 3949
NM_024345chr9115877 5386 5180 4877 4636 3913 3886 2179 1983 973 776 24196 784 1956 --
NM_024408chr142787 1450 839 80 12540 13333 42802 2415 723 124
NM_024423chr1864141 2831 2634 1038 846 141 2908 211 2911 95 13510
NM_024512chr3103539 3452 3237 3066 1117 1036 828 682 353 80 33464 3051 670 1731 23057 3055
NM_024596chr875097 4954 4727 3305 1584 671 518 44889 1606 737 86 14600 34897 4895 4893
NM_024665chr384522 3494 3426 3328 2923 975 732 598 43968 1868 1594 280 54716 3978 3868 3410 2969 --
NM_024740chr11134174 3944 3804 3795 3599 3434 2858 2751 1391 1334 335 314 235 --14179 --
NM_024761chr9155106 4861 4165 3930 3794 3782 3633 3482 3386 2116 1879 801 227 142 24 1827 25110 1551 1707
NM_024770chr266571 5381 5369 5052 2556 1290 45530 5238 422 100 36108 5386 4229 --
NM_024817chr15155983 5783 5477 5035 4494 4196 3816 3635 2064 1928 1480 1461 1386 790 414 55175 4243 2365 2219 1920 33958 2200 727 12113
NM_024947chr3179540 9052 8438 7794 7688 6999 6223 5873 3690 3202 2936 2765 1624 1611 1575 575 235 29307 7638 46170 3235 2156 898 32785 2155 2153
NM_024949chr4123689 3383 3072 1800 1002 963 954 900 728 689 665 222 43967 1999 1192 1105 24286 901 13343
NM_024989chr2126794 6273 6083 5889 5201 2023 1752 1521 1216 1193 722 319 45426 1766 1698 590 --21813 1809
NM_025160chr1103656 3477 1719 1321 1053 902 837 653 449 429 33166 3121 1629 23877 412 43876 3874 3415 1693
NM_025179chr1123603 3046 1770 1738 1731 1567 1400 1190 545 534 193 72 54024 1824 1503 594 381 33127 599 29 --
NM_025222chr362876 2614 2119 1993 573 51 12089 22090 701 42650 2620 692 559
NM_030627chr584041 3838 3590 3424 3324 3293 1397 1080 1313 1568 2299 297
NM_030647chr7106323 6011 4474 4008 3951 3882 1926 804 401 205 64326 4213 4028 1725 910 230 45601 4479 247 210 --
NM_030648chr4125510 5430 4731 4659 3561 3479 2020 1837 1562 1538 1522 1397 44767 1998 1246 843 24296 814 44771 4769 4667 1914
NM_030664chr1041925 1690 1548 557 31971 1805 819 11569 11658
NM_030670chr12111985 1833 1515 1471 927 907 887 853 836 772 31 2861 810 1686 11625
NM_030671chr12111985 1833 1515 1471 927 907 887 853 836 772 31 2861 810 1686 11625
NM_030674chr12105496 5174 4914 4335 4317 4182 3958 1825 1260 1213 54786 1432 1417 1397 420 ----
NM_030761chr152429 1963 1909 618 331 1227 72208 2171 1013 902 891 690 373 2890 522
NM_030806chr1149355 9033 8034 7791 7587 7251 6851 6034 3756 3675 3147 2739 2513 1676 79085 7515 6020 5769 1667 1310 1237 36755 6070 2664 16922
NM_030817chr1231369 986 525 43591 3423 3271 761 43284 2981 1256 358 61255 1253 1251 1249 1247 1245
NM_030918chr1115135 4369 3941 3421 1507 1410 653 572 456 402 357 65336 4953 4938 3631 911 803 44939 4201 3953 1552 --
NM_031427chr14105344 5107 5096 4773 4636 4517 2013 1889 1826 1373 24574 1481 45279 4449 1367 474 --
NM_031468chr7278229 7634 7478 7458 7037 6459 6330 6221 6141 6123 6087 5797 5456 5447 5300 3185 2689 2608 2594 2476 2439 1898 1137 1129 726 479 200 67153 6986 6906 2405 1107 360 47300 5448 361 351 37312 2596 1290
NM_031469chr6103929 3165 2629 1588 927 745 468 441 290 145 22980 315 23499 1452 11159
NM_031845chr293605 3038 2859 2775 2506 1386 506 434 204 23018 2534 21115 456 --
NM_031847chr293605 3038 2859 2775 2506 1386 506 434 204 23018 2534 21115 456 --
NM_031938chr115989 825 299 103 93 --1109 --
NM_032047chr3102168 2144 2126 2077 911 896 472 457 425 102 22226 251 11977 --
NM_032105chr1207595 7543 7192 7175 6868 6263 5952 5890 5732 5144 2853 2756 1878 1308 1245 1214 1180 242 160 87 47427 7412 7037 1378 35845 2842 1629 25957 166
NM_032153chr391739 889 866 537 497 380 371 175 79 1505 --42043 2039 2025 824
NM_032228chr1172982 2894 1201 1047 973 867 391 11411 1258 1550
NM_032281chr1962696 2280 1983 587 571 46 32022 612 92 --13923 76 74 72 70 68 66 62 56 54 52 50 48
NM_032445chr1592501 2430 2256 2163 2155 2142 1801 140 56 21894 369 1384 --
NM_032859chr1363075 2742 2678 1186 118 98 33149 2550 809 --1333
NM_032864chr1111457 1275 1216 1181 1151 1106 580 508 425 274 66 11310 31557 1170 148 --
NM_032873chr11133800 3769 3731 3500 3476 3125 1565 1550 915 733 397 165 23 43989 1410 502 271 23096 364 --
NM_032932chr17145974 5725 5114 4860 4053 2111 2014 1995 1808 1746 1735 1649 1372 523 14211 55978 4750 1859 1791 795 21422 790
NM_033023chr71906 2233 149 --6253 251 247 241 239 237
NM_033083chr343241 3224 1150 233 12533 1420 43117 964 625 419
NM_033181chr673572 3001 2985 1461 759 501 64 33915 3219 1404 12852 1815
NM_033224chr7127888 7666 7628 6975 6352 6152 4910 2949 2775 2610 2247 225 1513 11948 --
NM_033285chr894144 3797 3304 2936 1762 1719 1023 627 538 34222 1628 907 23717 3254 --
NM_033429chr1582586 2465 2349 1130 919 845 393 87 22747 132 2707 249 12375
NM_033505chr2106762 6326 6253 4424 2488 2386 2150 1287 555 439 46528 5582 993 635 36314 5916 4973 --
NM_033637chr1093840 3584 2883 2629 1435 1130 1032 610 425 53571 2604 2602 1264 726 21436 780 13495
NM_033656chr2195681 5298 5046 4842 2301 1734 1672 924 365 24599 4456 15823 13880
NM_052828chr681384 1172 457 441 434 397 272 255 --1243 1366
NM_052832chr842087 628 156 49 ----22666 783
NM_052845chr1292216 971 947 573 503 326 264 104 91 12712 42831 387 295 56 2668 386
NM_052885chr1294123 4093 3410 3297 3228 1606 1024 1018 150 14470 13507 --
NM_052917chr242937 1340 1265 711 1605 --2897 344
NM_052966chr173704 2420 1308 770 492 296 45 23779 2586 --21283 933
NM_053016chr9187381 6441 6275 6207 5844 5672 5351 5334 5186 4858 4835 2186 1881 1731 1621 1288 1179 170 46981 5923 1869 1389 17612 26374 1097
NM_053043chr7166330 6157 4387 4299 4218 4206 2539 2469 2453 2434 2288 1696 1486 1387 433 347 34847 1913 1401 45817 5234 4852 1185 --
NM_053056chr113798 480 373 32678 837 216 --3224 222 220
NM_080669chr17124651 4244 4142 3759 3320 3265 1697 1617 1476 1141 961 587 34007 1326 146 64068 1838 1702 520 479 323 --
NM_080717chr1211044 11416 21461 51 875 71 65 61 50 48 46 42
NM_080867chr1494850 4151 3530 3168 3155 1938 1476 1217 993 ----14333
NM_080872chr862473 1305 863 724 516 379 23292 2670 33756 178 65 12834
NM_133170chr20167627 6932 6912 6674 6281 6169 6121 5425 5287 4970 3199 2837 2555 2267 1479 555 97845 6989 6100 5703 2287 2097 1066 772 121 46522 6298 5859 1387 26994 854
NM_133264chr1793929 3473 2978 2913 1350 899 823 476 301 21520 721 43802 1054 668 524 12983
NM_133468chr792361 2326 1761 1659 932 756 502 483 70 --22037 59 12316
NM_133474chr451493 1144 665 549 482 21259 150 --21569 1453
NM_133646chr2125425 4766 3782 2047 1833 1483 1415 1122 855 801 696 88 22055 975 1980 11706
NM_138357chr10111538 1369 1296 1237 1166 339 271 200 148 135 33 1283 --11172
NM_138468chr2126231 6200 5409 5071 4600 4515 4320 2450 1887 1167 524 69 24617 4207 25909 525 15594
NM_138473chr12134691 4244 4174 4094 3876 3839 1656 1478 1265 1210 1094 483 148 33810 1776 1525 24272 91 33870 1405 88
NM_138576chr1474306 3910 3892 3292 3154 1001 56 14123 24185 3147 44312 4184 3365 3146
NM_138713chr16117707 7222 5677 5360 3304 3211 1305 988 658 500 147 ----11866
NM_138714chr16117707 7222 5677 5360 3304 3211 1305 988 658 500 147 ----11866
NM_138959chr1206304 6242 6233 5884 5490 5368 5146 4647 4503 4372 4243 2477 2281 2129 1726 1250 1189 543 192 164 55975 5157 1035 613 52 21142 843 --
NM_138970chr1431709 966 648 22079 1550 11997 1678
NM_138971chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_138971chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_138972chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_138972chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_138973chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_138973chr11133656 2978 2936 2930 2920 2886 2810 2765 1359 794 643 211 150 43142 2956 417 204 33589 2346 589 1599
NM_139279chr2123537 3228 2953 2348 2270 2162 857 480 403 367 302 295 23379 151 --1169
NM_139321chr20143299 3232 3200 3161 2943 1679 1667 1299 1175 1141 1105 936 286 107 13799 13322 11253
NM_144599chr15155304 5130 4924 4600 4067 3690 1917 1764 1624 1592 1482 1145 1037 394 80 21952 584 24860 3699 43803 590 588 586
NM_144973chr12115048 4747 4234 3530 1508 1233 994 982 798 735 354 24784 1599 25251 336 41077 1075 1071 671
NM_145013chr1182793 2456 2308 2245 2143 1964 875 213 22964 2286 32502 2044 495 12247
NM_145173chr1932165 1693 977 12104 42416 2293 2105 1055 51953 1951 1949 1947 1945
NM_145234chrX4923 858 341 204 1195 --1347
NM_145259chr2147142 7073 6640 5452 5229 4779 2397 2215 1710 1502 1094 1069 536 257 56767 6748 6077 5939 658 24591 1088 22616 2027
NM_147150chr9103188 2836 2624 1132 1068 1056 1021 535 377 351 41439 1099 1089 210 23193 679 31109 1091 686
NM_148955chr15116461 5903 5320 5186 4971 4943 4872 4779 4201 1067 687 36139 4839 1993 24161 622 14845
NM_152263chr1206034 5967 5035 5022 4819 4806 4552 4536 4509 4434 4423 4357 4005 3981 3919 3904 3839 3766 2079 1959 11226 2274 248 --
NM_152330chr1482576 2419 2117 2038 1944 440 362 248 1464 1434 --
NM_152375chr1102592 2398 2346 1840 1806 1613 983 676 502 215 1752 32154 537 158 21050 682
NM_152388chr2103799 3471 2981 2782 2597 1083 909 854 694 510 61525 1406 1198 729 539 216 ----
NM_152414chr871665 1373 1360 1066 612 573 458 11134 31110 582 489 7595 593 591 581 579 577 575
NM_152624chr5177114 6884 6164 5798 5023 4750 4712 4560 2478 2413 2341 1779 1243 1162 547 152 144 21970 1503 --12520
NM_152678chr392697 2136 2072 1963 446 421 271 226 137 22055 79 22524 734 --
NM_152754chr743021 2904 905 849 1670 63688 3660 2539 1321 1065 160 --
NM_152774chr752495 2388 2050 610 411 52221 2187 565 552 261 --2569 567
NM_152787chrX113520 3434 3091 3054 1189 1159 473 257 240 211 157 ----22939 221
NM_152793chr795202 4805 4337 3670 3660 728 563 527 454 34187 3889 1057 14123 126
NM_152826chr15116461 5903 5320 5186 4971 4943 4872 4779 4201 1067 687 36139 4839 1993 24161 622 14845
NM_152924chr15136387 6136 5742 5716 5367 4811 2767 2135 1635 1297 1077 426 373 --34636 4349 680 12237
NM_153035chr192906 2689 2374 2317 1055 1031 1007 561 36 --21013 279 12635
NM_153188chr585080 4814 4319 3832 2271 2104 1806 1795 25569 5231 24220 384 --
NM_153235chr632329 1561 236 31512 863 691 21548 1523 31531 1522 106
NM_153332chr8103303 3013 2875 2856 2744 2583 2158 615 568 47 --12586 12585
NM_153347chr11122367 2306 2160 1998 1992 1911 1823 1812 862 591 497 204 --32538 863 343 1620
NM_153442chr10196439 6410 6039 5702 5637 5369 5050 4995 4674 4375 4241 4051 1888 1701 1515 1506 1483 322 23 46390 6362 5766 1290 36447 6100 5597 36415 6318 434
NM_153456chr13196101 5886 5803 5613 5178 5116 4976 4952 4832 4664 4219 4057 2187 2128 1459 1366 1143 990 778 55192 3997 440 281 262 24788 2281 31375 450 444
NM_153605chr351150 232 81 46 23 --136 --
NM_153645chr22103135 2930 2811 2670 2204 1338 731 404 240 132 12781 2654 369 1970
NM_153712chr282871 2843 2675 1414 1082 1005 131 102 1166 --22613 692
NM_172071chr1117157 6624 5572 5400 5301 4721 4694 2857 2849 2093 1183 26902 5429 27410 5848 --
NM_173214chr16117707 7222 5677 5360 3304 3211 1305 988 658 500 147 ----11866
NM_173468chr475752 5713 2311 2000 1560 1271 367 75938 4890 4888 4193 2198 2024 879 --15621
NM_173511chr2103536 3454 3086 2754 2559 1389 907 258 234 140 52626 1011 660 560 376 ----
NM_173582chr1145451 4979 4126 969 24709 1748 25779 4392 41758 1756 1754 1752
NM_173642chr1198629 8556 8540 8370 8009 7318 6579 6225 6081 3608 3529 3088 3033 2468 2258 2231 2193 1618 1078 69057 8495 8219 7139 3503 3459 47722 6422 6351 3570 13496
NM_173694chrX72071 1925 1910 1819 1806 1676 918 --21032 1024 22176 968
NM_173808chr1143756 3487 2932 2910 2879 2871 2863 2847 2837 2812 2769 1547 1480 830 --21018 744 --
NM_173851chr893635 3275 2773 2764 1303 913 819 159 97 33648 1314 428 1163 14031
NM_174911chr8113835 3193 3155 3007 2617 2460 998 870 415 400 134 12590 22820 2591 --
NM_174934chr1173167 2885 2721 512 423 237 224 22694 244 12695 12232
NM_175623chr12187579 7220 7146 7113 5884 5547 4716 2915 2143 1977 1817 1696 853 743 733 563 393 89 21662 901 ----
NM_175624chr12197674 7315 7241 7208 5979 5642 4811 3010 2238 2072 1912 1791 948 838 828 658 488 184 86 31757 996 54 ----
NM_175625chr12197674 7315 7241 7208 5979 5642 4811 3010 2238 2072 1912 1791 948 838 828 658 488 184 86 31757 996 54 ----
NM_175736chr12207576 7384 7305 7045 6686 6629 5799 5663 5065 2942 2905 2556 2342 2167 1546 1221 1141 726 600 523 21058 1025 66494 5752 2669 2500 650 339 16775
NM_175861chr12105423 5363 5157 3900 1173 1002 667 543 417 166 34928 3629 1396 150 1231
NM_175907chr1872778 2737 2372 2159 1870 954 34 --12712 31832 784 734
NM_178037chr12103202 3188 2751 2462 2356 829 786 678 598 250 31231 863 418 21177 356 1881
NM_178038chr12103202 3188 2751 2462 2356 829 786 678 598 250 31231 863 418 21177 356 1881
NM_178039chr12102837 2823 2386 2097 1991 1247 464 421 313 233 3866 498 53 1812 1516
NM_178040chr12102837 2823 2386 2097 1991 1247 464 421 313 233 3866 498 53 1812 1516
NM_178151chrX127792 7382 2997 2913 2880 2255 2239 1561 1349 675 479 212 46759 6538 6294 5991 ----
NM_178152chrX127792 7382 2997 2913 2880 2255 2239 1561 1349 675 479 212 46759 6538 6294 5991 ----
NM_178153chrX127792 7382 2997 2913 2880 2255 2239 1561 1349 675 479 212 46759 6538 6294 5991 ----
NM_181332chrX72487 2127 1715 823 575 64 57 32549 505 72 2709 461 488 86 82 70
NM_181481chr18186989 5799 5688 5226 4267 2829 2742 2250 2209 1900 1502 1297 852 838 546 425 396 33 45771 4295 2070 338 36325 2655 2073 --
NM_181482chr18186989 5799 5688 5226 4267 2829 2742 2250 2209 1900 1502 1297 852 838 546 425 396 33 45771 4295 2070 338 36325 2655 2073 --
NM_181483chr18186989 5799 5688 5226 4267 2829 2742 2250 2209 1900 1502 1297 852 838 546 425 396 33 45771 4295 2070 338 36325 2655 2073 --
NM_181486chr1211044 11416 21461 51 875 71 65 61 50 48 46 42
NM_181521chr16157280 7154 6247 5529 4485 2909 2532 2174 1895 1740 1378 1235 960 790 357 15092 22063 136 --
NM_181659chr2092884 2236 2158 1321 648 432 379 100 70 32791 1239 390 --11119
NM_181659chr2092884 2236 2158 1321 648 432 379 100 70 32791 1239 390 --11119
NM_182487chr9124113 3875 3365 3264 1598 1472 1452 1410 1223 1195 705 296 13069 13221 11446
NM_182501chr252646 2615 1167 850 352 22337 2129 52386 2342 1202 999 28 22341 2339
NM_182508chr1382257 2230 1885 1879 1868 1710 1038 976 --31841 320 301 11890
NM_182527chr2262254 2142 1762 700 298 253 11794 1843 41802 1800 1798 1796
NM_182762chr7196118 6020 5480 4705 4677 4590 4169 3783 2382 1832 1790 1709 1575 1028 801 789 601 318 151 56004 4926 4627 3870 1226 31702 1597 472 --
NM_182763chr182553 2438 2091 1853 724 286 195 180 12530 21922 159 12536
NM_182898chr7136381 6101 6040 5947 5909 5607 5451 5155 4579 1296 883 95 32 96541 4923 4380 2487 2211 1945 1221 1219 183 12492 16372
NM_182899chr7136381 6101 6040 5947 5909 5607 5451 5155 4579 1296 883 95 32 96541 4923 4380 2487 2211 1945 1221 1219 183 12492 16372
NM_194283chr5104183 4076 3794 3605 3480 3442 2764 879 116 75 33715 3102 777 23492 3307 --
NM_194285chr1162546 2468 2121 1287 1234 336 33157 1070 114 1823 13140
NM_194286chr12166075 5593 5409 5392 5036 4908 4267 4158 3984 1284 1227 735 552 268 234 143 24809 806 52371 1492 817 471 135 --
NM_194434chr1844977 2084 948 760 --15490 35489 5487 4222
NM_198273chr583153 2809 2726 2204 2058 1072 261 129 31143 526 99 21233 531 --
NM_198484chr3116156 5676 5574 5043 4843 4639 4185 2013 1592 1513 599 55508 4875 2446 1184 238 26161 77 --
NM_198581chr276203 4559 2956 2884 2851 2024 1300 22983 2002 36991 5983 2787 11571
NM_198595chr484756 4598 4509 3667 1308 710 263 252 --34180 3609 394 21485 954
NM_198715chr195236 4588 4268 4152 4097 2385 2077 1635 716 36100 5960 4698 26185 2360 34851 4274 2189
NM_198859chr3104974 4538 4050 3222 1786 1736 1273 1151 1097 705 44721 3998 1202 115 24722 1295 --
NM_198900chr12207576 7384 7305 7045 6686 6629 5799 5663 5065 2942 2905 2556 2342 2167 1546 1221 1141 726 600 523 21058 1025 66494 5752 2669 2500 650 339 16775
NM_199003chr871528 1095 989 627 351 188 126 1604 1231 1210
NM_199160chr951972 1594 713 661 607 2682 634 --31322 691 507
NM_199320chr452768 2046 1814 1088 209 11048 --21140 574
NM_199320chr452768 2046 1814 1088 209 11048 --21140 574
NM_199421chr1494850 4151 3530 3168 3155 1938 1476 1217 993 ----14333
NM_199423chr165572 489 466 368 362 2951 387 1349 --
NM_199437chr1131909 1688 251 32125 489 414 --7859 857 855 853 851 811 724
NM_199438chr1131909 1688 251 32125 489 414 --7859 857 855 853 851 811 724
NM_199439chr1131909 1688 251 32125 489 414 --7859 857 855 853 851 811 724
NM_199462chr1174559 4487 4109 4001 3841 3707 3548 3465 3254 3235 1611 1553 1296 688 669 290 169 24924 3610 14093 11479
NM_199478chrX61593 1559 802 395 371 340 31878 1641 138 21722 1463 2724 598
NM_201266chr262574 1941 719 377 368 57 --12867 21089 1069
NM_201279chr262574 1941 719 377 368 57 --12867 21089 1069
NM_201428chr1171621 1230 1092 322 296 225 78 21500 312 1290 --
NM_201429chr1171621 1230 1092 322 296 225 78 21500 312 1290 --
NM_201430chr1171547 1156 1018 625 248 222 151 21426 238 1216 --
NM_203451chr1342402 2394 1544 84 22048 781 1609 22168 473
NM_203458chr1113766 3567 3458 3299 2389 1509 1470 621 456 405 317 13343 23572 1383 11382
NM_203463chr2124440 4171 3965 3672 3608 3450 3202 1740 1540 1101 937 292 44384 3463 1403 869 23355 781 34570 3910 339
NM_205860chr172725 2082 1183 1177 1146 77 65 21039 41 --11189
NM_206594chr142894 1007 989 549 73590 3260 932 666 568 566 45 11426 1670
NM_206595chr142894 1007 989 549 73590 3260 932 666 568 566 45 11426 1670
NM_206855chr6115840 5478 4635 4487 4118 2427 2222 981 753 92 66 14913 ----
NM_206909chr8218416 8369 8034 7659 7144 7115 7030 6961 6886 6847 6776 6710 6398 6380 5948 5675 5484 5304 5206 1049 723 26273 6077 66686 6078 3182 2535 2056 685 11376
NM_207292chr363227 2675 2530 765 38 32 32848 2472 983 ----
NM_207293chr363227 2675 2530 765 38 32 32848 2472 983 ----
NM_207294chr363227 2675 2530 765 38 32 32848 2472 983 ----
NM_207295chr363227 2675 2530 765 38 32 32848 2472 983 ----
NM_207296chr363227 2675 2530 765 38 32 32848 2472 983 ----
NM_207297chr363252 2700 2555 790 63 57 32873 2497 1008 ----
NM_207481chr241346 898 132 124 2155 98 --1560
NM_213589chr275037 4756 3874 1778 1449 1223 1120 44400 4211 4010 219 2294 222 35407 1677 221