TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-132-3p
miRNA Sequence: UAACAGUCUACAGCCAUGGUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531313 1225 1032 154 ----
NM_000024chr51542 ------
NM_000037chr82403 204 12428 ----
NM_000067chr8--1601 ----
NM_000081chr11212 --1375 --
NM_000084chrX66906 4767 4578 2777 505 409 --15502 --
NM_000091chr252560 2431 1128 295 201 32818 780 69 1568 --
NM_000092chr234192 3102 67 34320 3918 3819 12905 11241
NM_000098chr11570 ------
NM_000109chrX42493 515 400 241 ------
NM_000112chr565505 4032 3876 3585 3451 329 55576 4442 4323 3904 1446 ----
NM_000127chr8198 ------
NM_000138chr1522297 2274 22619 2042 --11938
NM_000161chr1441931 1916 622 383 196 11778 --
NM_000163chr53782 752 256 --1240 --
NM_000165chr61459 1491 ----
NM_000167chrX31746 1575 1569 11234 11561 --
NM_000176chr593848 3795 3501 3275 2808 2751 1330 603 107 13192 ----
NM_000192chr12--1415 ----
NM_000194chrX2504 175 1385 1225 --
NM_000202chrX42999 1582 1333 981 23143 1318 21459 795 --
NM_000210chr232134 1648 384 1339 ----
NM_000217chr1234980 4573 2132 24561 4254 14991 13516
NM_000222chr422114 1430 --11726 --
NM_000232chr451075 604 321 213 68 ------
NM_000240chrX52271 2159 2137 780 76 22092 140 ----
NM_000245chr732128 1629 561 1127 11767 --
NM_000248chr362966 2917 2349 1139 948 913 1701 ----
NM_000251chr2165 --1206 --
NM_000259chr1596332 4853 4682 4149 2392 2349 1356 853 379 35678 1743 490 11545 11822
NM_000264chr933060 611 148 2494 134 ----
NM_000267chr1723439 948 23203 2176 --11247
NM_000276chrX42158 2139 1378 318 ------
NM_000280chr114965 959 838 814 ----1106
NM_000313chr3----1856 --
NM_000314chr1032885 2199 2151 52925 2263 2101 1252 959 ----
NM_000325chr41636 ------
NM_000328chrX1414 ------
NM_000332chr6107177 7138 6326 5932 5445 4576 2185 1853 1133 1007 15378 ----
NM_000338chr153949 303 238 --11132 --
NM_000345chr43911 802 323 2979 940 ----
NM_000346chr1712002 ------
NM_000353chr1611259 11130 1133 --
NM_000368chr944878 3172 1220 37 23427 3191 ----
NM_000378chr1121169 1009 --1930 --
NM_000390chrX73188 3118 2828 1156 923 797 770 22291 301 176 --
NM_000393chr231891 1319 478 --172 --
NM_000408chr233288 3030 2615 ----13046
NM_000430chr1783729 3220 2720 2597 2515 1076 802 646 ----13627
NM_000436chr521517 151 --1421 --
NM_000459chr93322 200 190 ------
NM_000462chr1541604 751 566 125 11741 11459 --
NM_000474chr7153 --1650 --
NM_000480chr1131694 1418 295 21673 1556 ----
NM_000484chr211797 ------
NM_000489chrX62690 2584 1344 1178 1146 242 11330 12489 129
NM_000522chr71179 11301 ----
NM_000523chr23944 855 128 ------
NM_000555chrX107306 6424 6363 6219 6211 4758 2904 1588 794 557 --1357 --
NM_000586chr4174 ------
NM_000610chr1142880 2191 1212 871 32916 2910 2727 196 --
NM_000618chr1276537 6438 5016 4623 4356 411 221 --1449 --
NM_000618chr1276537 6438 5016 4623 4356 411 221 --1449 --
NM_000619chr123509 494 189 ------
NM_000633chr1864734 2051 1350 1329 794 513 13949 23715 103 --
NM_000641chr1961570 1539 1513 1483 1163 1056 ------
NM_000719chr1276491 6238 6058 5512 4238 1878 78 ------
NM_000722chr71287 ------
NM_000756chr81319 ------
NM_000780chr81790 1902 1492 --
NM_000793chr1433210 1687 28 ------
NM_000806chr521866 1228 ------
NM_000811chr51289 ------
NM_000813chr545651 4637 4115 391 11508 21048 876 --
NM_000814chr1553735 3212 2766 1354 1160 ----12909
NM_000817chr271177 1042 1006 931 802 425 384 1132 ----
NM_000824chr41126 ------
NM_000826chr431935 853 43 32349 758 453 ----
NM_000834chr1241027 890 809 46 --1840 --
NM_000838chr642626 1915 1831 1801 11009 --1908
NM_000845chr72371 342 ------
NM_000859chr521648 1499 11512 ----
NM_000868chrX1191 --1225 --
NM_000875chr1595550 5411 4290 2765 2137 2052 1446 1029 414 --26435 5297 1564
NM_000891chr1743658 3187 1211 154 --12683 --
NM_000899chr1224399 3271 23981 24 ----
NM_000908chr51249 --1613 --
NM_000910chr441721 1208 638 131 11275 ----
NM_000912chr853532 3359 2687 1158 515 --1633 --
NM_000921chr12--1172 ----
NM_000933chr2031348 682 74 1566 ----
NM_000935chr321170 163 ------
NM_000950chrX42840 1239 1156 877 --33163 2919 2856 11020
NM_000956chr1441083 920 342 59 ------
NM_000958chr54968 444 225 28 1502 ----
NM_000959chr153960 3427 2937 2748 2730 --23481 651 13522
NM_000961chr2013167 23139 2508 --13955
NM_000965chr311264 --11230 --
NM_001001323chr1263207 2814 1090 685 290 193 12725 11151 1693
NM_001001330chr101145 --11306 --
NM_001001349chr17--11741 ----
NM_001001389chr1142880 2191 1212 871 32916 2910 2727 196 --
NM_001001390chr1142880 2191 1212 871 32916 2910 2727 196 --
NM_001001391chr1142880 2191 1212 871 32916 2910 2727 196 --
NM_001001392chr1132926 2237 917 32962 2956 2773 1142 --
NM_001001394chr21638 ------
NM_001001395chr1222546 376 ------
NM_001001396chr123905 2755 23894 3806 1753 --
NM_001001419chr555218 4950 3912 3228 470 24626 31 --11043
NM_001001420chr555218 4950 3912 3228 470 24626 31 --11043
NM_001001433chr2062941 2836 2371 2070 328 205 23163 577 ----
NM_001001436chr16--1865 3356 179 113 --
NM_001001481chr873378 3256 2559 1316 609 576 505 --12883 --
NM_001001521chr21233 ------
NM_001001664chr243414 3203 2734 1004 ------
NM_001001665chr253087 907 440 235 110 23119 2896 ----
NM_001001668chr19104282 4035 3815 3795 2984 2792 1666 1025 490 113 13876 ----
NM_001001701chr442298 1773 1679 711 21808 895 ----
NM_001001791chr1041686 1538 1319 1290 ------
NM_001001890chr2134225 3787 958 13553 ----
NM_001001937chr18146 ------
NM_001001971chr1041231 953 557 126 --1355 --
NM_001001974chr1042128 1979 1586 851 12341 ----
NM_001002026chr362407 2381 1633 957 618 435 12501 ----
NM_001002257chr233107 2612 1154 43333 2637 1367 379 ----
NM_001002259chr121243 ------
NM_001002838chrX2331 268 11773 ----
NM_001002843chr153832 797 80 1471 ----
NM_001002860chr14114039 3967 3919 3903 3738 3178 3074 3050 1400 533 370 34654 4368 709 11531 --
NM_001003652chr18178474 8389 7976 7687 6957 6912 6570 6122 5281 5273 3234 2591 2309 1758 1359 1160 348 26231 2933 36374 3058 83 11259
NM_001003674chr18127008 6498 6447 5938 5892 5780 5679 1099 1067 776 662 620 36595 5901 1566 11905 --
NM_001003675chr18127008 6498 6447 5938 5892 5780 5679 1099 1067 776 662 620 36595 5901 1566 11905 --
NM_001003681chr2232043 166 94 --21689 66 --
NM_001003712chr1284002 3951 3667 3490 3047 1418 1175 360 33010 2516 502 13525 --
NM_001003760chr642256 1310 1109 112 ------
NM_001003792chr311113 ------
NM_001003793chr311113 ------
NM_001004196chr321213 1030 21152 759 ----
NM_001004317chr684421 3928 2884 1768 1683 993 889 747 ----1485
NM_001005266chr152681 110 1673 ----
NM_001005267chr152681 110 1673 ----
NM_001005268chr152681 110 1673 ----
NM_001005269chr152681 110 1673 ----
NM_001005335chr191316 ------
NM_001005366chr1241008 856 366 317 ------
NM_001005404chr1794477 4405 3885 3786 3736 3588 3184 1166 791 11527 ----
NM_001005463chr10--22535 1757 12557 --
NM_001005473chr586595 6234 5997 4886 4325 1901 451 146 14409 ----
NM_001005474chr321527 624 1528 ----
NM_001005782chr22374 157 ------
NM_001005845chr8147 ------
NM_001006117chrY1181 181 ----
NM_001006600chr52967 281 --1193 --
NM_001006610chr162313 307 ----1140
NM_001006612chrX1148 ------
NM_001006613chrX1148 ------
NM_001006614chrX1148 ------
NM_001007023chr1433210 1687 28 ------
NM_001007024chr1764385 4276 3309 503 410 85 12834 --13002
NM_001007025chr1764385 4276 3309 503 410 85 12834 --13002
NM_001007075chr42860 224 11082 ----
NM_001007097chr9105046 4513 1571 951 783 677 315 153 86 34 ------
NM_001007102chr631599 372 348 1481 --1469
NM_001007466chr655055 4702 3213 381 358 --11363 --
NM_001007559chr1831495 744 598 --2528 134 1295
NM_001007565chr31129 ------
NM_001007595chr151288 ------
NM_001007794chr12527 255 ------
NM_001008220chr573808 3194 2784 1388 1290 1252 1193 --13898 --
NM_001008225chr74568 504 299 219 --1514 --
NM_001008226chr1531761 1451 1184 --1193 --
NM_001008239chr18113584 3349 3312 3304 3278 2856 2575 2549 957 100 31 11361 ----
NM_001008392chr352930 2557 1044 978 871 12261 11274 11037
NM_001008393chr442399 589 582 455 --1755 --
NM_001008401chr1941343 593 530 424 11351 ----
NM_001008408chr7106343 5442 5345 5127 1787 1742 614 296 125 31 12154 43922 1589 938 520 --
NM_001008495chr892171 1900 1887 1507 776 648 482 261 22 22022 575 12147 --
NM_001008539chr875168 4601 4528 4494 4401 2076 2050 34104 2157 1222 11595 --
NM_001008541chr1042289 2054 1805 913 1680 11461 11564
NM_001008541chr1042289 2054 1805 913 1680 11461 11564
NM_001008660chr1121587 1158 ------
NM_001008738chr562875 2336 2248 2177 1098 802 --12829 --
NM_001008860chr152670 226 ----135
NM_001008892chr152670 226 ----135
NM_001008894chr152670 226 ----135
NM_001008895chr131227 ----11406
NM_001009555chr411319 11104 ----
NM_001009567chr10----180 --
NM_001009571chr751664 1434 1217 89 47 ------
NM_001009880chr2244041 3686 3574 415 ----14859
NM_001009881chr12417 205 --1193 --
NM_001009882chr12417 205 --1193 --
NM_001009899chr386344 5687 5378 5268 4865 2387 1820 93 16465 1344 --
NM_001009909chr1153897 3825 3553 2864 83 ----13974
NM_001009960chr742055 1127 988 663 1687 ----
NM_001009993chr264253 4126 3240 1028 581 416 14545 23575 3544 --
NM_001010000chr1873271 3191 2853 2675 949 654 599 23505 584 ----
NM_001010853chr642901 2698 2545 486 22028 852 12206 --
NM_001010854chr141231 ------
NM_001010861chr142276 1762 187 164 12377 ----
NM_001010888chrX24373 4324 21767 1756 ----
NM_001010891chr576609 5790 5580 4978 2247 1663 822 34909 2296 1102 138 --
NM_001010908chr101498 ------
NM_001010934chr721174 161 21026 857 ----
NM_001010984chr152463 2226 1914 875 330 ------
NM_001010986chrX32200 1699 621 ------
NM_001011553chr71285 --1315 --
NM_001011666chr735628 1177 1104 16469 26499 5120 --
NM_001011708chr242813 2481 753 458 11981 ----
NM_001011713chr141363 --1192 --
NM_001012337chr3145 ------
NM_001012393chr1165179 4806 3842 3812 910 587 --13455 --
NM_001012418chr674214 4165 3549 3243 2818 1607 1352 ------
NM_001012423chr1532196 425 241 ------
NM_001012751chr1041212 445 316 118 11693 11603 --
NM_001012755chrX74823 3414 1783 1591 979 510 472 ------
NM_001012761chr552532 2465 393 199 145 2656 599 1165 --
NM_001012989chrX----2521 220 --
NM_001013031chr1063087 2678 2474 2295 849 448 11321 13458 --
NM_001013406chr721452 1214 11571 ----
NM_001013415chr441549 1118 616 515 11241 ----
NM_001013620chr12168237 7380 6799 6574 5189 3156 2806 2510 1712 1615 1542 1090 916 619 609 231 37843 7665 5479 11926 11242
NM_001013632chr1127 ------
NM_001013699chr122178 84 --1150 1373
NM_001013843chr152915 765 ------
NM_001014283chr1332074 1976 1423 1449 ----
NM_001014380chr13125662 5293 5251 4802 4401 4393 3916 3769 1095 991 922 804 2513 436 15046 11832
NM_001014797chr10127536 7227 6461 6434 5738 5437 3115 2604 2269 1871 1470 946 1975 48052 2985 2663 1949 11316
NM_001015048chr1483159 2555 2434 2384 2263 985 948 30 11062 ----
NM_001015049chr1483159 2555 2434 2384 2263 985 948 30 11062 ----
NM_001015508chr82526 483 ------
NM_001017371chr221175 61 ------
NM_001017395chr373593 3471 2928 2879 2597 2384 22 1844 22898 1156 --
NM_001017396chr231944 1929 777 21331 582 --1392
NM_001017424chr131868 1245 317 11343 2263 66 --
NM_001017425chr131868 1245 317 11343 2263 66 --
NM_001017440chr797819 7732 7423 7174 5812 5201 5157 1149 204 16063 15331 --
NM_001017926chr821829 670 31455 680 455 ----
NM_001017930chrX111514 1452 1359 1344 1319 1247 1232 1207 1127 945 527 ------
NM_001017969chr93221 82 43 1617 ----
NM_001017977chr11156 ------
NM_001018009chr31215 21087 801 1153 1954
NM_001018037chr931429 1254 1156 --11126 --
NM_001018057chr1141276 1140 483 318 1886 21224 173 --
NM_001018064chr951647 1578 1423 566 557 1751 ----
NM_001018067chr1114805 4716 4682 1787 1635 1421 1356 1175 925 813 106 24432 593 ----
NM_001018068chr1114805 4716 4682 1787 1635 1421 1356 1175 925 813 106 24432 593 ----
NM_001018069chr1114805 4716 4682 1787 1635 1421 1356 1175 925 813 106 24432 593 ----
NM_001018074chr593848 3795 3501 3275 2808 2751 1330 603 107 13192 ----
NM_001018075chr593848 3795 3501 3275 2808 2751 1330 603 107 13192 ----
NM_001018076chr593848 3795 3501 3275 2808 2751 1330 603 107 13192 ----
NM_001018077chr593848 3795 3501 3275 2808 2751 1330 603 107 13192 ----
NM_001018090chr1522741 88 11751 ----
NM_001018091chr1522851 198 11861 ----
NM_001018102chr1522741 88 11751 ----
NM_001023567chr1572358 2345 1555 859 544 497 324 ------
NM_001024094chr593848 3795 3501 3275 2808 2751 1330 603 107 13192 ----
NM_001024649chr532162 877 772 --12951 --
NM_001024688chr832031 1487 174 --21792 785 --
NM_001024847chr352450 2098 891 645 505 ------
NM_001024934chr63513 505 262 1661 ----
NM_001024935chr63513 505 262 1661 ----
NM_001024936chr63513 505 262 1661 ----
NM_001024948chr183247 3230 3135 2762 1257 1050 188 115 12946 12603 --
NM_001025068chr321753 1543 --11849 --
NM_001025069chr321753 1543 --11849 --
NM_001025076chr1095870 5540 5060 4795 4021 3977 3803 742 128 11271 15854 --
NM_001025077chr10137228 6898 6418 6153 5379 5335 5161 4794 4704 2100 1486 991 654 22629 919 17212 --
NM_001025079chr373874 3643 3242 2773 1613 1069 94 13054 --1154
NM_001025105chr5----11324 --
NM_001025108chr273949 2710 2652 2553 1008 904 486 13834 ----
NM_001025252chr893126 3018 2015 1288 905 704 525 420 291 --11277 --
NM_001025253chr893126 3018 2015 1288 905 704 525 420 291 --11277 --
NM_001025266chr384860 4596 3450 3232 2993 916 709 83 --14760 --
NM_001025389chr1131694 1418 295 21673 1556 ----
NM_001025390chr1131694 1418 295 21673 1556 ----
NM_001025580chrX44258 954 777 404 24293 2730 ----
NM_001025595chr451529 1439 1244 1225 348 1167 ----
NM_001025780chr931512 1238 204 ------
NM_001029858chr663363 3140 3075 2768 2632 2196 43232 323 317 287 1755 --
NM_001029860chr82266 242 ------
NM_001029875chr522939 1977 1923 1216 12254
NM_001029882chr12469 448 ------
NM_001029882chr12469 448 ------
NM_001030007chr1643832 2896 403 194 32856 1562 167 12631 --
NM_001030055chr1433872 1830 1556 21488 747 ----
NM_001031679chr1242754 2747 570 194 2631 67 1479 --
NM_001031684chr211476 1310 11380 --
NM_001031690chr783119 2585 970 936 456 263 244 51 --32622 2542 501 --
NM_001031695chr22115445 4980 4738 4682 4195 3727 1915 1473 983 526 228 22076 1523 ----
NM_001031712chr61299 ------
NM_001031716chr2--2164 77 ----
NM_001031732chr463366 3311 2433 746 648 459 --125 --
NM_001031801chr22--1187 ----
NM_001031804chr1673967 3304 3116 3079 1736 1609 934 1741 21654 237 --
NM_001031812chr531997 1665 1655 1532 ----
NM_001031848chr181361 1318 ----
NM_001032280chr641517 1400 477 183 --11650 --
NM_001032288chr2031339 1065 608 ------
NM_001032380chr1022033 1852 --11451 --
NM_001032394chr632771 2695 1778 --1660 --
NM_001032395chr632638 2562 1645 --1527 --
NM_001032999chr2064664 4536 586 541 390 340 15330 24602 69 --
NM_001033057chr361955 1576 1445 1399 413 306 --1352 --
NM_001033087chr2043257 2464 2279 1288 ------
NM_001033518chr731052 260 136 --12787 --
NM_001033519chr731052 260 136 --12787 --
NM_001033520chr731052 260 136 --12787 --
NM_001033566chr173806 767 380 1332 ----
NM_001033568chr173806 767 380 1332 ----
NM_001033925chr1052148 1661 1468 605 337 ------
NM_001034841chr1662066 1626 605 547 455 264 15184 ----
NM_001037165chr7108897 8877 7405 5506 3550 2041 1972 1075 1021 216 ------
NM_001037172chr34867 480 464 121 ------
NM_001037317chr142276 1762 187 164 12377 ----
NM_001037331chr181601 ------
NM_001037334chr1841955 646 384 195 1867 ----
NM_001037954chr1123235 567 1710 ----
NM_001038493chr231382 1325 1288 21317 1302 ----
NM_001038702chr541919 830 166 74 12302 --12372
NM_001039348chr2--152 ----
NM_001039349chr2--152 ----
NM_001039538chr213051 23547 136 23687 1128 --
NM_001039585chr164217 3684 3194 3005 2987 109 --23738 908 13779
NM_001039590chrX83791 3243 3113 2549 1412 966 575 34 --14003 1266
NM_001039591chrX83791 3243 3113 2549 1412 966 575 34 --14003 1266
NM_001039618chr11115809 5683 4896 4703 4690 3970 3920 2149 1471 1367 982 --14115 12138
NM_001039709chr2064664 4536 586 541 390 340 15330 24602 69 --
NM_001039762chr1052075 1909 1860 333 203 1945 ----
NM_001039802chr11355 ------
NM_001039840chrX96031 5613 4807 2369 2277 2119 1649 711 341 15891 ----
NM_001039888chr11682 ------
NM_001039935chr52320 306 ------
NM_001039937chr1354069 3152 1018 875 100 21637 900 24062 66 --
NM_001040001chr651992 1268 460 451 135 2770 750 1620 --
NM_001040113chr164956 942 651 247 ------
NM_001040142chr222234 38 22157 1645 1108 --
NM_001040143chr222234 38 22157 1645 1108 --
NM_001040152chr734540 1516 1219 25122 4056 13659 --
NM_001040158chr52207 155 ------
NM_001040159chr411499 11132 ----
NM_001040284chr1673816 2171 1217 874 579 99 22 25429 1329 15488 --
NM_001040402chr483042 2378 1006 470 265 175 106 71 33153 434 34 1897 12170
NM_001040424chr2162954 2919 2217 2199 1840 890 --12938 1775
NM_001040429chr1373608 3530 2764 2197 1062 400 371 ------
NM_001040441chr154235 3879 3358 2123 1991 1635 15462 --
NM_001040624chr852723 2595 737 548 237 --22461 840 --
NM_001040625chr852723 2595 737 548 237 --22461 840 --
NM_001040626chr852723 2595 737 548 237 --22461 840 --
NM_001040627chr852723 2595 737 548 237 --22461 840 --
NM_001040628chr852723 2595 737 548 237 --22461 840 --
NM_001040629chr852723 2595 737 548 237 --22461 840 --
NM_001040630chr852723 2595 737 548 237 --22461 840 --
NM_001040633chr7----2893 202 --
NM_001040647chr772119 1815 1771 1725 774 586 402 --176 --
NM_001040648chr772119 1815 1771 1725 774 586 402 --176 --
NM_001040665chr734481 3853 3180 --14154 --
NM_001040668chr191135 ------
NM_001040712chr942657 2646 1182 1112 1666 ----
NM_001040875chr842398 1929 893 657 12313 ----
NM_001042353chr201159 ------
NM_001042404chr121475 223 ------
NM_001042413chr983864 3763 3261 2748 1143 886 291 234 12939 1862 --
NM_001042414chr13--194 ----
NM_001042424chr432896 554 525 12308 12941 --
NM_001042425chr641517 1400 477 183 --11650 --
NM_001042473chr102853 64 ------
NM_001042475chr61264 ------
NM_001042481chr1472398 2326 2224 1847 918 504 38 12437 21961 1072 --
NM_001042492chr1723439 948 23203 2176 --11247
NM_001042494chr1553741 2962 852 716 650 13059 ----
NM_001042495chr1553741 2962 852 716 650 13059 ----
NM_001042496chr1553741 2962 852 716 650 13059 ----
NM_001042497chr1553741 2962 852 716 650 13059 ----
NM_001042510chr84763 693 141 93 11993 ----
NM_001042511chr84763 693 141 93 11993 ----
NM_001042537chrX3627 163 49 12285 11622 --
NM_001042550chr951910 1850 1731 1574 1444 11520 ----
NM_001042555chr1294631 4026 1890 1396 1351 1061 956 805 606 24088 1015 24300 791 --
NM_001042599chr257815 5678 5065 2204 1213 26653 2770 17354 --
NM_001042601chr363083 3029 774 706 460 256 ----11138
NM_001042603chr1233797 1040 995 21247 469 11178 13997
NM_001042604chr3124263 4231 3604 3378 3127 1559 1117 1053 938 750 170 159 ------
NM_001042683chr651830 1525 182 132 105 21422 742 ----
NM_001042749chrX41842 1681 1495 471 21614 250 ----
NM_001042750chrX41842 1681 1495 471 21614 250 ----
NM_001042751chrX41842 1681 1495 471 21614 250 ----
NM_001043318chr1444098 3758 190 137 ----13962
NM_001044385chr272930 2749 2716 1441 1171 946 166 --11015 --
NM_001044722chr531997 1665 1655 1532 ----
NM_001044723chr531997 1665 1655 1532 ----
NM_001046chr522151 411 ------
NM_001068chr3--1226 ----
NM_001077628chr11697 ------
NM_001079874chr141843 1577 845 264 --1113 --
NM_001083620chr431933 852 43 32347 757 452 ----
NM_001085487chr1175 ------
NM_001099678chr3106401 6016 5923 5890 5847 5219 4135 4047 1920 1887 16008 11534 1683
NM_001100108chr1168257 7901 7824 7803 7370 7304 6808 5885 5118 3048 2530 2376 2369 1887 1835 829 38198 5789 494 21081 480 --
NM_001106chr3129177 9108 8024 6533 3713 3594 3420 2878 1671 1288 1233 1050 29355 8411 48120 7817 5985 3322 1442
NM_001113490chrX53582 3115 3072 427 241 --12931 1269
NM_001117chr183374 331 156 22489 2207 ----
NM_001122679chr531313 1225 1032 154 ----
NM_001128chr1643832 2896 403 194 32856 1562 167 12631 --
NM_001146chr872250 2143 2110 1958 483 239 70 11789 --12189
NM_001160chr1252857 1966 377 266 101 32265 2099 367 --12331
NM_001167chrX75507 5112 4453 2614 2601 2440 442 46554 1779 756 213 1470 --
NM_001173chr1433872 1830 1556 21488 747 ----
NM_001177chr1252385 2299 2139 536 498 12430 ----
NM_001187chr211558 --1418 --
NM_001201chr453115 3010 1403 1323 274 22583 287 ----
NM_001204chr247692 6651 2312 1084 26373 2911 ----
NM_001206chr933020 482 161 --1249 --
NM_001219chr722299 70 --1658 189
NM_001222chr10----1245 --
NM_001233chr762195 881 758 578 95 75 ------
NM_001239chr51122 ------
NM_001241chr262258 1827 1767 556 476 197 42345 979 151 76 ----
NM_001241chr262258 1827 1767 556 476 197 42345 979 151 76 ----
NM_001256chr1742669 724 695 151 ------
NM_001259chr7115244 4467 2384 2340 2031 1997 1614 1521 1186 944 168 34918 4836 1397 ----
NM_001270chr531132 759 309 21115 122 ----
NM_001300chr101299 ------
NM_001304chr1723641 3087 13135 ----
NM_001310chr1232720 1032 297 13071 ----
NM_001326chr113416 381 346 ------
NM_001343chr541667 633 398 370 ------
NM_001356chrX2719 380 --11658 --
NM_001358chr41343 ------
NM_001364chr1134427 4130 1842 --1648 --
NM_001378chr21413 ------
NM_001387chr543113 2792 2735 688 22671 2060 145 23188 1956
NM_001390chr1863531 3135 2994 2410 927 465 23522 378 --13209
NM_001395chrX1988 ----1205
NM_001412chrX73568 3269 2787 2366 712 375 42 --22471 763 --
NM_001416chr171454 ------
NM_001419chr1984687 3256 3000 1820 1771 1604 816 322 13464 11571 --
NM_001429chr2211007 11099 --11072
NM_001438chr163280 3131 2756 2483 2458 838 13575 13177 --
NM_001448chrX31622 618 186 --11756 --
NM_001453chr641720 1090 684 257 11748 ----
NM_001463chr23603 256 105 2784 290 ----
NM_001465chr51438 1191 ----
NM_001483chr72905 190 ----1948
NM_001514chr1--1445 ----
NM_001522chrX176 ------
NM_001527chr663632 3065 1881 903 472 112 24664 4359 13195 --
NM_001530chr1421138 876 ------
NM_001533chr191316 ------
NM_001543chr564588 4541 3610 1162 404 322 --13670 --
NM_001584chr1141119 402 389 117 1255 ----
NM_001587chrX42158 2139 1378 318 ------
NM_001604chr114965 959 838 814 ----1106
NM_001614chr172204 161 1652 --1520
NM_001614chr172204 161 1652 --1520
NM_001616chr252826 1083 798 511 445 ----23480 2841
NM_001621chr742558 1090 535 79 22729 989 ----
NM_001621chr742558 1090 535 79 22729 989 ----
NM_001635chr7----11002 --
NM_001649chrX72476 2352 1914 898 869 803 275 ----1130
NM_001656chr541848 1604 1328 1277 11485 ----
NM_001660chr33640 288 146 ------
NM_001668chr14810 340 218 46 --31812 799 144 --
NM_001682chr1242921 2528 804 399 12439 21079 865 1407
NM_001690chr322131 2017 12593 ----
NM_001695chr842750 931 404 373 ------
NM_001698chr91340 ------
NM_001730chr1341499 1295 1011 388 11212 ----
NM_001730chr1341499 1295 1011 388 11212 ----
NM_001731chr121871 ------
NM_001743chr2143 1498 ----
NM_001746chr532162 877 772 --12951 --
NM_001754chr2134225 3787 958 13553 ----
NM_001755chr16--11692 1864 --
NM_001759chr1264743 4445 4033 1363 985 248 1947 13755 --
NM_001777chr373874 3643 3242 2773 1613 1069 94 13054 --1154
NM_001783chr191315 ------
NM_001786chr10--158 ----
NM_001788chr71285 --1315 --
NM_001791chr11355 ------
NM_001792chr182860 177 ------
NM_001797chr162762 308 ------
NM_001839chr11499 ------
NM_001854chr1--1407 --11174
NM_001855chr93766 346 82 ------
NM_001858chr673951 3694 3206 1648 1284 826 611 --13618 --
NM_001859chr943927 3428 2896 201 --23918 1600 --
NM_001866chrX130 ------
NM_001892chr5----11324 --
NM_001895chr201378 ------
NM_001901chr6----2998 833 --
NM_001918chr1108978 8374 8189 7559 6121 2820 2115 740 202 147 16542 16371 --
NM_001931chr11--1928 ----
NM_001935chr22279 232 ------
NM_001938chr131650 1415 767 21525 1474 ----
NM_001949chr642262 873 693 353 --22215 801 --
NM_001957chr441792 1745 1426 622 --11557 1274
NM_001966chr3----21033 93 --
NM_001977chr451656 1413 662 157 41 --1578 --
NM_001980chr1232288 825 749 --21727 662 --
NM_001992chr532209 2145 528 ------
NM_001999chr511397 ------
NM_002006chr464428 4136 1716 1701 1694 754 1220 --14296
NM_002009chr151943 --158 --
NM_002015chr1352667 762 356 237 41 22608 2277 ----
NM_002025chrX99010 8938 6919 6673 5791 5706 2572 1802 291 --26710 2566 13104
NM_002026chr22805 668 ------
NM_002031chr63593 540 288 --1346 --
NM_002035chr1821398 98 --23500 28 12742
NM_002039chr42304 220 ------
NM_002041chr15145 ------
NM_002063chrX21058 253 --1343 --
NM_002074chr141405 1283 1233 621 11743 ----
NM_002076chr1272594 2027 1189 925 530 209 60 --12927 --
NM_002077chr932086 1701 129 ------
NM_002092chr444007 3777 3194 3150 14831 45058 3617 2028 166 --
NM_002114chr63527 350 142 ------
NM_002136chr122514 172 --1584 --
NM_002137chr772419 2401 843 592 479 274 230 --11711 --
NM_002147chr17--1199 ----
NM_002157chr21145 ------
NM_002158chr263604 3534 2723 2693 1500 1430 1168 ----
NM_002188chr51688 ------
NM_002196chr2011100 21069 772 ----
NM_002196chr2011100 21069 772 ----
NM_002210chr283583 3170 2977 2681 1209 836 758 322 11015 ----
NM_002211chr10----1452 --
NM_002214chr744761 4100 3743 211 24782 41 1897 14716
NM_002222chr31188 ------
NM_002223chr1263736 3098 1572 1126 989 97 11546 11451 33962 3447 2991
NM_002233chr11--1145 ----
NM_002264chr364326 3573 1512 1212 930 114 11949 13115 --
NM_002266chr17159 ------
NM_002269chr62365 347 1253 ----
NM_002270chr534735 3804 2068 ------
NM_002285chr273949 2710 2652 2553 1008 904 486 13834 ----
NM_002296chr141517 1302 684 388 ------
NM_002303chr11115 ------
NM_002310chr596114 6037 5909 5575 2624 2572 2214 1308 332 46383 5326 1903 105 22064 1156 16529
NM_002332chr12--1772 ----
NM_002336chr1274357 4326 3584 1953 1873 895 612 24458 1492 31944 1365 948 --
NM_002349chr22455 236 --11058 --
NM_002374chr213051 23547 136 23687 1128 --
NM_002387chr5105111 4956 4948 4378 4280 1308 900 651 318 187 13241 --14233
NM_002397chr531903 899 266 1399 11666 --
NM_002401chr1732142 772 97 ----11583
NM_002408chr142627 243 ------
NM_002411chr111121 ------
NM_002427chr1131177 1017 474 1776 ----
NM_002438chr10----180 --
NM_002448chr41701 ------
NM_002451chr963686 3312 3187 954 632 386 22520 1289 13453 --
NM_002460chr652861 2581 1114 1044 275 12921 11242 --
NM_002467chr81426 ------
NM_002480chr1251494 1482 1140 227 100 11211 ----
NM_002481chr197712 6493 6041 5740 5106 2010 1194 894 234 11631 26948 1075 --
NM_002482chr12271 99 1709 ----
NM_002485chr832031 1487 174 --21792 785 --
NM_002509chr20----1575 --
NM_002515chr141804 1368 126 11823
NM_002527chr12178 --1287 --
NM_002545chr1165179 4806 3842 3812 910 587 --13455 --
NM_002577chr353499 1553 1212 768 562 14002 ----
NM_002581chr995648 5577 5530 5476 5204 4379 3784 3639 1276 15100 11335 --
NM_002588chr51687 ------
NM_002595chr1261809 1734 1577 1411 1344 423 --1158 --
NM_002613chr1685106 4893 4833 4627 4590 4155 1893 1206 14867 ----
NM_002623chr20148 ------
NM_002628chr331077 987 928 1975 ----
NM_002635chr122295 157 ------
NM_002643chr23197 160 126 ------
NM_002645chr1143140 839 330 221 1948 ----
NM_002655chr835055 4693 892 13228 --14034
NM_002656chr61896 ------
NM_002657chr2073269 3226 2417 1249 1182 1068 658 1629 13592 --
NM_002670chr321278 514 11257 11482 --
NM_002703chr421356 434 183 --2653 628
NM_002709chr263169 3076 3014 2387 1398 1145 --1594 --
NM_002715chr561281 1170 890 465 369 224 ------
NM_002716chr1153583 3445 3159 2482 248 --1178 --
NM_002719chr1431963 1827 825 --22238 2181 1454
NM_002721chr91158 ------
NM_002729chr103789 749 739 ------
NM_002731chr162967 2649 838 633 516 412 ------
NM_002736chr741937 1873 1588 272 11788 ----
NM_002738chr16--1868 ----
NM_002745chr22134543 4472 4425 4068 4060 3590 3531 3096 1411 1184 1137 501 271 33709 3351 1455 --11386
NM_002747chr18--21888 1871 ----
NM_002787chr71501 1156 1120 --
NM_002811chr161518 ------
NM_002814chrX2217 200 --2277 209 --
NM_002816chr171287 ----157
NM_002821chr61752 ------
NM_002834chr1243930 3850 562 405 1868 2899 694 --
NM_002835chr73615 602 540 ----1114
NM_002837chr1264622 4586 3552 2970 2794 984 ------
NM_002839chr942657 2646 1182 1112 1666 ----
NM_002843chr1173388 3149 2206 367 268 184 174 --13182 --
NM_002845chr181545 ------
NM_002848chr1231163 925 398 1452 161 --
NM_002851chr73763 588 39 ------
NM_002852chr31395 1403 ----
NM_002857chr132688 2402 136 --12230 --
NM_002865chr81191 ------
NM_002869chr1142076 2062 1589 852 11934 ----
NM_002874chr962445 2269 753 496 464 64 22248 766 1118 --
NM_002886chr394432 4231 4219 3468 3284 1977 1496 1376 1064 13829 --1703
NM_002892chr1451556 1481 1282 1139 136 ------
NM_002901chr112139 29 1409 160 --
NM_002912chr63906 227 59 ------
NM_002923chr12486 62 1532 ----
NM_002924chr12616 188 1124 ----
NM_002938chr421524 1495 --197 --
NM_002951chr201277 ------
NM_002956chr1221358 1039 ------
NM_002971chr351219 1198 907 487 100 --21134 227 --
NM_002977chr273340 3007 2466 945 872 326 23 --13024 --
NM_002994chr42531 395 2452 247 --1315
NM_003016chr1761999 1736 594 452 252 215 11639 31674 1550 203 --
NM_003031chr162313 307 ----1140
NM_003042chr3--11656 1359 1387
NM_003043chr363808 3782 1473 591 351 40 ------
NM_003045chr1354088 3097 3068 1160 813 13957 1376 14455
NM_003046chr875168 4601 4528 4494 4401 2076 2050 34104 2157 1222 11595 --
NM_003051chr121981 1230 1435 1621 --
NM_003068chr811113 ------
NM_003069chrX3638 519 491 ------
NM_003070chr91318 ------
NM_003074chr31420 12075 ----
NM_003079chr171857 ------
NM_003099chr1546249 5844 1683 877 46478 5233 2072 1621 15855 --
NM_003107chr642366 2292 2243 1787 --32593 959 286 --
NM_003108chr266188 5467 1279 797 727 448 36768 1261 515 46641 6018 2854 1668 --
NM_003111chr221175 61 ------
NM_003112chr753038 2751 2129 1266 896 12696 ----
NM_003128chr272836 2691 2655 650 318 289 269 12786 ----
NM_003129chr8------1239
NM_003140chrY197 ------
NM_003144chr661405 740 562 543 316 271 11458 --11562
NM_003150chr1722107 344 ------
NM_003155chr822291 589 12669 --11967
NM_003161chr1783574 3457 2714 2454 1226 1125 341 328 1672 ----
NM_003174chr101188 1134 ----
NM_003176chr12249 218 ------
NM_003176chr12249 218 ------
NM_003185chr2041316 1088 942 75 11193 ----
NM_003188chr65726 661 270 188 148 --1853 --
NM_003189chr173190 2706 2630 2284 2253 843 708 ------
NM_003199chr1844588 4274 3954 1140 25060 4313 25572 4977 --
NM_003211chr1231480 1398 1192 11777 11542 --
NM_003220chr641517 1400 477 183 --11650 --
NM_003221chr633900 3617 1367 24146 535 14212 --
NM_003222chr2011222 ------
NM_003236chr282878 2608 2493 2417 1322 471 423 35 13518 ----
NM_003242chr352450 2098 891 645 505 ------
NM_003246chr1552049 1888 1790 1405 490 1516 ----
NM_003262chr324238 3287 32116 768 330 24967 1345 --
NM_003274chr2172803 2428 2177 1876 994 648 57 12949 ----
NM_003295chr131155 ------
NM_003298chr366206 6187 6125 5250 4033 2382 --22491 2177 15545
NM_003304chr321350 455 ------
NM_003305chr41154 ------
NM_003309chr631627 282 211 ----11341
NM_003319chr25969 874 365 291 166 1957 ----
NM_003338chr103181 88 81 11644 ----
NM_003339chr511260 ----11129
NM_003340chr461298 1271 919 901 885 59 1451 ----
NM_003342chr1793294 3192 3055 2777 2768 406 297 228 65 --12784 --
NM_003345chr164549 531 442 383 ----1223
NM_003348chr1221604 1411 --2519 220 --
NM_003349chr2031339 1065 608 ------
NM_003350chr82749 404 ------
NM_003352chr22374 157 ------
NM_003369chr1152644 2561 2428 2306 1125 1165 ----
NM_003387chr22366 340 12694 22299 2272 12760
NM_003392chr362822 2804 1600 1537 1342 778 21275 755 ----
NM_003400chr22824 174 ------
NM_003405chr222639 509 ------
NM_003409chr1831175 573 563 --11153 --
NM_003412chr393061 2329 2019 1019 971 768 536 443 394 ------
NM_003413chrX51985 1802 1607 744 505 --1398 --
NM_003423chr1941896 1050 456 73 12582 ----
NM_003439chr752877 1084 816 790 560 ------
NM_003472chr651283 395 296 226 170 ------
NM_003478chr1141098 747 553 215 22250 412 ----
NM_003483chr1242842 2665 2260 284 12311 12655 --
NM_003489chr2142809 2391 1132 820 1410 ----
NM_003505chr731679 1673 264 --1249 --
NM_003508chr71293 ------
NM_003557chr111596 --11276 --
NM_003565chr1211789 ------
NM_003566chr1253449 3039 2313 1213 413 1536 ----
NM_003574chr18135668 5508 5397 4321 3530 2303 2171 2061 894 313 276 182 23 45426 4540 597 369 ----
NM_003583chr1293906 3739 3683 2631 2612 2491 919 770 701 --33878 1275 1126 1877
NM_003589chr131227 ----11406
NM_003590chr273031 2740 1387 778 753 328 35 ------
NM_003592chr72519 23 ------
NM_003603chr451968 1415 536 411 340 ------
NM_003615chr373764 3714 3132 2870 2664 549 95 33977 3591 1116 ----
NM_003618chr221306 530 1211 ----
NM_003622chr124734 210 100 92 22229 1806 ----
NM_003626chr1121102 542 11266 ----
NM_003629chr173409 3369 2722 2575 2321 2158 1161 --1456 11301
NM_003633chr552057 1842 1816 1714 679 12555 1771 1646
NM_003645chr152208 91 ------
NM_003648chr262232 2114 1864 630 570 365 ------
NM_003659chr24910 440 308 298 ------
NM_003663chr373455 2892 2698 1106 608 478 63 1176 32863 2252 513 --
NM_003671chr973074 2223 1023 779 609 514 235 12845 --11234
NM_003672chr151889 1713 689 428 27 ------
NM_003677chr124467 355 301 276 ------
NM_003690chr21551 1505 --1445
NM_003692chr92919 119 --3875 645 162 1784
NM_003701chr131904 1402 ----
NM_003716chr33874 840 242 ------
NM_003722chr342092 989 641 390 ------
NM_003735chr51687 ------
NM_003736chr51687 ------
NM_003749chr1352235 1628 224 122 73 ------
NM_003763chr2062941 2836 2371 2070 328 205 23163 577 ----
NM_003774chr1241252 950 185 79 12477 12682 --
NM_003778chr31110 ------
NM_003787chr1851560 1509 1430 1424 572 ------
NM_003794chr341089 913 885 336 --1260 --
NM_003797chr111149 ------
NM_003798chr91152 ------
NM_003800chr64674 631 94 56 ------
NM_003822chr12861 836 ----12856
NM_003850chr134559 283 104 76 --1178 --
NM_003870chr151849 11954 12078 --
NM_003873chr1062420 2222 1010 937 599 69 --22232 514 --
NM_003876chr171310 ------
NM_003884chr321682 1427 ------
NM_003885chr1762636 2245 2167 1007 587 548 12536 ----
NM_003887chr23879 169 90 11599 ----
NM_003901chr1042188 1972 1016 254 ------
NM_003909chr862886 2668 2432 2378 2187 352 --1861 --
NM_003913chr673677 3299 2894 2625 1003 759 379 --34198 1206 208 --
NM_003922chr151353 ------
NM_003927chr181841 ------
NM_003930chr732592 2464 1633 1528 --1128
NM_003931chr63513 505 262 1661 ----
NM_003939chr1054151 3309 3214 1285 792 ------
NM_003953chr142184 2098 2027 252 1598 ----
NM_003958chr663047 2967 709 673 584 318 23401 2445 --11466
NM_003966chr5117759 7361 6884 5361 2323 2308 1943 1716 786 608 210 11153 67332 6891 6648 6626 6359 2580 --
NM_003983chr1694443 4177 3975 3343 1487 1478 849 671 578 13421 14063 --
NM_003994chr1224399 3271 23981 24 ----
NM_004006chrX42493 515 400 241 ------
NM_004007chrX42493 515 400 241 ------
NM_004009chrX42493 515 400 241 ------
NM_004010chrX42493 515 400 241 ------
NM_004011chrX42493 515 400 241 ------
NM_004012chrX42493 515 400 241 ------
NM_004013chrX42493 515 400 241 ------
NM_004014chrX42493 515 400 241 ------
NM_004015chrX42493 515 400 241 ------
NM_004016chrX42407 429 314 155 ------
NM_004017chrX42493 515 400 241 ------
NM_004018chrX42407 429 314 155 ------
NM_004020chrX42493 515 400 241 ------
NM_004021chrX42407 429 314 155 ------
NM_004022chrX42407 429 314 155 ------
NM_004023chrX42407 429 314 155 ------
NM_004040chr251251 1048 878 870 291 ------
NM_004046chr18146 ------
NM_004065chrX2278 260 ------
NM_004080chr731384 1255 1099 --11292 --
NM_004087chr342056 1911 1295 492 11853 ----
NM_004090chr1743389 3090 2657 1352 11335 ----
NM_004093chr1362872 1232 979 691 346 221 1915 11047 --
NM_004100chr631926 950 450 ------
NM_004105chr2--152 ----
NM_004114chrX3829 364 54 21136 972 ----
NM_004117chr632176 1799 230 ----1342
NM_004124chr1423343 331 2215 94 22842 2563 1620
NM_004133chr842617 2038 972 483 22377 116 ----
NM_004136chr1562015 1227 1063 738 656 376 ------
NM_004161chr23644 205 136 --1275 --
NM_004170chr921789 1675 41852 1609 634 289 11309 --
NM_004171chr11109447 7714 7172 6697 6479 6313 2305 1584 1326 1032 17596 18314 16244
NM_004215chr81521 ------
NM_004227chr793161 3110 2352 2324 2264 2096 918 734 460 12553 ----
NM_004229chrX31796 1582 317 ------
NM_004232chr1873564 3041 2869 2768 1039 948 750 12374 ----
NM_004237chr51224 --1247 --
NM_004274chr1453043 2874 2866 1050 469 --12109 --
NM_004279chr742079 2027 1984 298 --122 --
NM_004290chr521340 1293 --134 --
NM_004293chr933293 3152 476 33820 3403 1053 12672 13284
NM_004294chr131262 1586 ----
NM_004302chr1232833 1984 876 ------
NM_004331chr821011 238 ------
NM_004338chr18127008 6498 6447 5938 5892 5780 5679 1099 1067 776 662 620 36595 5901 1566 11905 --
NM_004370chr622148 1494 ------
NM_004379chr221362 1214 11385 ----
NM_004384chr531997 1665 1655 1532 ----
NM_004397chr1153686 3303 3121 3028 1236 42781 2684 1692 1635 --12960
NM_004412chr1065038 4426 4281 3756 1140 599 25663 205 --15737
NM_004414chr2131092 258 188 11201 11404 --
NM_004440chr651983 1423 638 627 465 1364 21449 794 --
NM_004441chr311222 ------
NM_004447chr122303 30 ------
NM_004457chr241515 1217 486 231 ------
NM_004458chrX72599 2491 1765 1740 1007 557 153 22008 85 ----
NM_004459chr1741495 621 402 388 ------
NM_004464chr454270 4084 3466 593 510 ------
NM_004496chr1411269 21249 536 --1171
NM_004500chr1431497 711 115 11845 ----
NM_004501chr111480 13903 161 1651
NM_004504chr242499 2055 637 71 1348 ----
NM_004516chr1911196 ------
NM_004521chr102337 104 ------
NM_004537chr1251132 1010 519 359 260 1960 ----
NM_004538chrX4792 644 319 236 --1202 --
NM_004540chr212193 178 1636 ----
NM_004566chr1032276 1734 344 12419 1478 --
NM_004571chr2143045 2777 1043 251 13001 13409 --
NM_004586chrX115309 4987 4495 4390 4114 3438 3405 636 624 597 129 25123 750 --1177
NM_004595chrX193 ------
NM_004598chr532518 673 106 12110 ----
NM_004607chr51182 ------
NM_004612chr974005 3593 3381 633 589 467 74 ------
NM_004627chr212632 75 ----1579
NM_004630chr111109 ------
NM_004654chrY21106 925 --11373 1269
NM_004655chr173457 63 29 11062 1559 --
NM_004660chrY22127 378 --21602 520 --
NM_004663chr1531178 253 29 ----1638
NM_004681chrY3737 205 134 1252 ----
NM_004684chr41333 ------
NM_004685chr1361856 1155 978 908 805 657 --12833 --
NM_004703chr1751909 601 514 277 150 ------
NM_004709chrX31835 1758 1159 11736 ----
NM_004713chr141717 ------
NM_004718chr22694 201 165 ----
NM_004719chr1242818 1815 759 263 11161 ----
NM_004726chrX115644 4992 4723 4691 4316 3609 2135 1589 711 689 97 --11077 1898
NM_004727chr152868 359 ------
NM_004733chr31444 ------
NM_004734chr1332270 706 295 --183 --
NM_004735chr21271 ----1153
NM_004736chr1--11800 1282 --
NM_004741chr1041518 1221 514 258 11207 ----
NM_004742chr361840 1794 1777 1695 1177 259 31666 533 277 ----
NM_004744chr42846 335 13778 ----
NM_004745chr896941 6702 6351 5195 5124 4674 2695 2115 1327 22387 2278 --14801
NM_004748chr1553674 3032 2962 1390 826 1136 ----
NM_004768chr121162 1065 --1301 --
NM_004772chr521304 501 ----11320
NM_004775chr1841761 727 372 86 1553 31723 1589 1472 --
NM_004781chr161533 1230 609 574 438 28 31402 584 91 ----
NM_004781chr161533 1230 609 574 438 28 31402 584 91 ----
NM_004788chr1162676 2567 2326 1883 364 55 --1704 --
NM_004798chr2083391 3361 2843 2651 2618 916 165 101 ----13292
NM_004807chr262630 2492 2467 2345 1929 80 --12513 --
NM_004815chr194825 3756 3744 1950 1898 1791 1758 1223 943 1385 11178 --
NM_004834chr263396 2647 1304 1243 973 238 12972 ----
NM_004836chr21383 ------
NM_004841chr12369 316 ------
NM_004844chr31215 21087 801 1153 1954
NM_004849chr621327 1186 --11635 --
NM_004857chr1423994 3050 43974 3059 971 496 --13766
NM_004859chr1763009 2782 2470 909 850 471 12972 --11226
NM_004863chr1465087 3845 1946 1750 1018 765 24263 4051 11275 --
NM_004865chr6--1314 1296 --
NM_004866chr5114824 4808 3981 3505 3377 1404 985 970 898 477 36 21219 24 24003 3433 --
NM_004867chrX1448 ------
NM_004869chr1821678 80 1394 11608 --
NM_004871chr1764385 4276 3309 503 410 85 12834 --13002
NM_004872chr12168 141 ------
NM_004873chr1483159 2555 2434 2384 2263 985 948 30 11062 ----
NM_004893chr52207 155 ------
NM_004904chr735628 1177 1104 16469 26499 5120 --
NM_004912chr721452 1214 11571 ----
NM_004932chr551768 1510 1298 1249 385 ------
NM_004938chr921257 372 ------
NM_004947chr312198 ------
NM_004956chr774410 3354 952 742 657 568 169 1511 31778 1464 523 13323
NM_004968chr73694 220 88 ------
NM_004972chr921021 453 --1959 --
NM_004973chr6101516 1390 1377 1324 1137 484 325 252 230 159 ------
NM_004985chr1273574 3119 2858 2830 2770 1053 532 ----1123
NM_004992chrX88003 7843 7718 7209 5355 5313 307 52 ----16894
NM_004992chrX88003 7843 7718 7209 5355 5313 307 52 ----16894
NM_004999chr652777 1711 1502 1435 309 11075 1733 --
NM_005020chr72582 423 ------
NM_005023chr521348 1105 ------
NM_005034chr81180 --167 --
NM_005037chr31144 ------
NM_005045chr71391 --1858 --
NM_005056chr1244041 1284 1239 67 21491 713 11422 14241
NM_005066chr11636 ------
NM_005079chr893126 3018 2015 1288 905 704 525 420 291 --11277 --
NM_005093chr2064664 4536 586 541 390 340 15330 24602 69 --
NM_005095chr162063 1954 1740 460 312 67 31888 1868 623 ----
NM_005096chrX61265 1233 1168 1150 1100 890 ------
NM_005109chr332220 2056 681 --2729 443 --
NM_005112chr42847 647 ------
NM_005114chr42501 201 ------
NM_005116chr2074585 4469 4116 3751 1827 1093 780 --24284 536 --
NM_005121chr1732807 2765 136 1858 11173 --
NM_005135chr1553741 2962 852 716 650 13059 ----
NM_005139chr42319 131 ------
NM_005151chr1841955 646 384 195 1867 ----
NM_005153chr161624 --1217 --
NM_005156chr964568 1631 1590 1574 1350 864 13297 35186 4689 2057 --
NM_005160chr2265051 5034 2229 1882 1725 1073 25461 4590 25760 2402 --
NM_005168chr221691 1346 11656 ----
NM_005171chr1211313 ------
NM_005180chr1031412 389 281 11537 1195 --
NM_005188chr1167090 6990 3255 2054 832 770 13192 26412 2806 --
NM_005197chr1455478 5204 4539 3940 243 24613 955 21605 672 --
NM_005201chr341060 420 306 195 --1855 --
NM_005229chrX31281 1217 111 ------
NM_005233chr372160 2117 1755 877 665 656 41 1580 22091 1776 --
NM_005235chr257815 5678 5065 2204 1213 26653 2770 17354 --
NM_005238chr1162919 2407 2169 1369 991 708 182 ----
NM_005249chr141833 ----1807
NM_005252chr145767 756 582 233 144 ------
NM_005254chr1531266 1135 286 --21176 254 --
NM_005257chr1811147 ------
NM_005259chr221219 972 11380 --1408
NM_005277chr41741 ------
NM_005279chr23851 116 76 ------
NM_005313chr1551292 426 378 172 156 ------
NM_005316chr11----1303 1973
NM_005327chr42679 133 ------
NM_005339chr484196 3201 3047 1672 1393 953 409 380 23855 3831 12932 --
NM_005342chrX92739 2435 2216 2025 1895 677 492 464 288 ------
NM_005358chr1341540 1476 350 27 ------
NM_005359chr18126352 6116 5431 5365 4217 2381 1573 1244 1095 901 599 441 --1726 --
NM_005369chrX1437 ------
NM_005375chr621030 872 --1960 --
NM_005385chr322234 488 2403 130 22600 2517 --
NM_005386chr201826 --1789 --
NM_005388chr96415 263 225 95 58 34 21585 1223 ----
NM_005399chr174341 4068 3868 3616 1495 841 263 --11667 --
NM_005400chr243074 2747 2577 2241 12620 ----
NM_005406chr1841587 1286 564 130 11233 186 --
NM_005429chr41284 ------
NM_005433chr1822637 2438 1358 ----
NM_005436chr1083878 3720 3060 1231 840 648 404 263 23509 3343 11059 --
NM_005458chr952456 2103 1699 889 440 ------
NM_005475chr1233225 641 213 1117 ----
NM_005476chr931404 1091 954 ------
NM_005487chr2232043 166 94 --21689 66 --
NM_005494chr72545 220 --1175 --
NM_005499chr19--2580 154 --164
NM_005502chr953042 2961 914 871 654 22665 721 12013 --
NM_005504chr12126053 5679 5148 5121 4581 4150 2629 1975 1946 934 644 499 16167 2146 65 --
NM_005509chr511668 ------
NM_005517chr151465 1459 516 151 41 ------
NM_005520chr5------1257
NM_005522chr71280 1890 ----
NM_005544chr221042 641 ------
NM_005562chr121114 344 11498 11360 --
NM_005578chr353967 3480 969 547 439 13393 14683 --
NM_005595chr11625 1963 3845 321 167 --
NM_005596chr946433 5941 5286 1708 36353 5847 5120 12150 26347 4389
NM_005600chr11229 ------
NM_005604chr622396 715 --21893 98 --
NM_005611chr1621241 1116 ------
NM_005613chr141953 1533 1440 1415 --1293 --
NM_005614chr71758 1324 --1966
NM_005626chr11550 1134 ----
NM_005637chr1831495 744 598 --2528 134 1295
NM_005651chr42292 103 ------
NM_005657chr15147 ------
NM_005665chr184538 4071 3334 3138 1256 1034 496 437 ------
NM_005668chr574600 4573 4562 4332 3335 3290 1479 11437 23472 1712 --
NM_005669chr541991 1689 314 72 12330 ----
NM_005721chr21189 ------
NM_005733chr51244 ------
NM_005737chr232405 910 541 22487 1843 ----
NM_005739chr1532377 169 133 ------
NM_005744chr151132 ------
NM_005746chr722606 385 12538 ----
NM_005748chr1233184 883 582 22165 520 ----
NM_005751chr71123 ------
NM_005754chr53836 795 461 ------
NM_005756chrX41231 1150 1103 351 ----11111
NM_005759chr264772 3606 3313 3135 889 731 11153 ----
NM_005779chr543408 2429 843 813 --22485 358 --
NM_005795chr252860 2686 1940 352 27 22334 609 11995 --
NM_005807chr11182 ------
NM_005808chr352930 2557 1044 978 871 12261 11274 11037
NM_005813chr22680 80 --22380 576 --
NM_005819chr163376 3088 2890 2856 907 339 ------
NM_005822chr62532 336 --31461 891 814 --
NM_005826chr13610 474 86 1521 ----
NM_005828chr17104860 4625 4497 4470 3811 3772 3493 3478 1183 327 1125 23650 1500 --
NM_005829chr1521614 769 --1141 1573
NM_005832chr34390 196 147 46 ------
NM_005836chr8--133 ----
NM_005842chr133606 489 126 198 ----
NM_005843chr21453 1630 11319 --
NM_005859chr511458 ------
NM_005863chr1021396 121 1178 137 --
NM_005868chr73984 264 180 1907 21882 882 --
NM_005869chr5167 ------
NM_005870chr131367 1242 --1937
NM_005875chr31259 ------
NM_005880chr1611132 --1202 --
NM_005888chr122295 157 ------
NM_005891chr6--1195 ----
NM_005897chr111186 ------
NM_005898chr1132482 2224 580 13143 22196 123 --
NM_005901chr18178474 8389 7976 7687 6957 6912 6570 6122 5281 5273 3234 2591 2309 1758 1359 1160 348 26231 2933 36374 3058 83 11259
NM_005902chr1554422 4361 3033 1500 89 14564 24375 3517 --
NM_005903chr555218 4950 3912 3228 470 24626 31 --11043
NM_005935chr485259 5239 4855 4631 3332 1137 861 599 14589 21777 1752 --
NM_005941chr883698 3214 1568 1053 798 727 209 79 172 1633 --
NM_005944chr321213 1030 21152 759 ----
NM_005955chr183814 3452 2190 869 829 650 238 107 14656 24031 3941 --
NM_005962chr1042289 2054 1805 913 1680 11461 11564
NM_005962chr1042289 2054 1805 913 1680 11461 11564
NM_005966chr242374 1764 913 728 11640 11808 1902
NM_005977chr1331055 58 27 ------
NM_006015chr13482 394 307 --166 --
NM_006016chr671665 1610 1583 607 512 427 225 1789 1899 11780
NM_006037chr2104705 3679 3296 1820 1749 1575 1527 905 512 21 ------
NM_006047chr2083545 3394 3114 2434 2354 2262 811 616 --3150 100 64 --
NM_006048chr11375 ------
NM_006060chr753704 3643 3518 776 131 --13568 --
NM_006070chr31129 ------
NM_006080chr732490 915 819 21938 1114 ----
NM_006089chrX11241 21592 47 ----
NM_006090chr12527 255 ------
NM_006094chr852338 2230 1612 698 216 ------
NM_006095chr443218 346 331 321 14509 11354 --
NM_006106chr1133247 2447 257 23412 172 1534 --
NM_006107chr172487 43 ------
NM_006113chr141843 1577 845 264 --1113 --
NM_006134chr2131571 1304 94 ----1185
NM_006135chr131188 312 144 ------
NM_006139chr242826 2459 2383 553 ------
NM_006141chr1611765 1559 --22484 2315
NM_006147chr12456 64 ------
NM_006152chr121235 ------
NM_006153chr34644 239 224 98 ------
NM_006154chr1542058 1971 1119 623 ------
NM_006162chr1851708 1471 1348 1106 596 11264 11159 --
NM_006164chr21412 ----1475
NM_006166chr1222451 653 --11802 --
NM_006178chr1731596 1431 567 ------
NM_006180chr951647 1578 1423 566 557 1751 ----
NM_006183chr12131 1523 ----
NM_006190chr231033 884 781 --1366 --
NM_006194chr1441233 1120 394 124 ------
NM_006195chr941113 473 431 241 ------
NM_006197chr842206 1963 1795 481 12263 ----
NM_006203chr565163 3957 3464 1235 795 49 ------
NM_006206chr452756 1974 475 391 380 1673 ----
NM_006212chr1115430 4813 4503 4396 4235 3847 3687 3553 1316 514 185 14061 21669 1017 --
NM_006218chr3--152 1277 --
NM_006226chr231333 968 378 ------
NM_006237chr1311837 --1366 --
NM_006241chr352073 1715 880 521 28 11592 --12348
NM_006243chr121024 321 ------
NM_006246chr1451335 1297 486 437 235 1402 1962 --
NM_006251chr543273 2340 2283 1217 22625 2398 ----
NM_006252chr1147279 7018 6646 6133 5589 5133 4687 2140 2078 1117 1083 1019 581 357 36011 5193 2334 26929 5741 --
NM_006256chr121720 422 1770 ----
NM_006265chr821502 1293 ----11119
NM_006275chr2021852 381 12080 ----
NM_006281chr82818 310 1260 ----
NM_006281chr82818 310 1260 ----
NM_006282chr2084707 4304 3585 1362 1299 893 850 335 --23356 991 1512
NM_006283chr875004 4994 4841 3643 1700 1509 1092 24680 453 13619 --
NM_006300chr1962196 1913 396 303 170 136 ------
NM_006306chrX45904 3660 1742 1646 24251 2016 21802 1543 11485
NM_006310chr1741300 1264 1081 1060 1314 ----
NM_006315chr442928 1583 1492 821 22971 2951 33822 1361 1303 --
NM_006353chr631241 1203 45 --1239 --
NM_006359chrX3627 163 49 12285 11622 --
NM_006364chr1431320 1218 1163 ------
NM_006366chr631334 1169 144 1469 ----
NM_006367chr111020 ------
NM_006371chr394323 3994 3858 3535 3314 2124 2046 1991 1882 14905 180 --
NM_006386chr2242489 2123 1827 421 ------
NM_006389chr1151383 1320 1195 869 208 11369 1392 --
NM_006393chr1074002 3857 3612 2980 1489 1347 318 24557 4219 ----
NM_006415chr9------1120
NM_006416chr62728 213 ------
NM_006421chr821085 432 ------
NM_006459chr1031789 1698 775 --11714 --
NM_006464chr2104514 4472 4083 3663 1570 1206 444 423 247 49 ------
NM_006482chr1293906 3739 3683 2631 2612 2491 919 770 701 --33878 1275 1126 1877
NM_006489chr141804 1368 126 11823
NM_006520chrX21640 1465 ------
NM_006526chr2072106 1412 1391 1369 733 586 121 1601 ----
NM_006534chr2043155 2162 1078 79 23178 2835 ----
NM_006538chr244011 2832 2790 2760 ------
NM_006544chr1465582 4307 3792 1560 1432 280 1466 11023 --
NM_006546chr1766662 6508 6075 2410 2200 114 11097 35769 4445 263 --
NM_006547chr731373 601 466 1402 ----
NM_006557chr931133 1081 346 21713 371 ----
NM_006561chr1095870 5540 5060 4795 4021 3977 3803 742 128 11271 15854 --
NM_006572chr1772811 1376 1146 939 695 564 174 13287 13008 1478
NM_006577chr21990 11127 ----
NM_006593chr21537 ------
NM_006597chr11128 ------
NM_006599chr16137701 7364 7190 7170 6429 5195 3084 2408 1569 1058 485 454 401 66660 3278 3143 2919 2418 269 15234 25755 2846
NM_006603chrX41842 1681 1495 471 21614 250 ----
NM_006605chr221128 ------
NM_006609chr232491 2470 327 ------
NM_006614chr383484 2981 2599 1223 1183 1011 782 210 12248 ----
NM_006624chr1062061 1919 1468 472 390 80 --21964 1691 --
NM_006625chr13962 935 739 11085 ----
NM_006625chr13962 935 739 11085 ----
NM_006625chr13962 935 739 11085 ----
NM_006628chr1554090 3756 1445 1209 695 14296 ----
NM_006629chr1822110 1904 12498 ----
NM_006633chr52786 133 ------
NM_006644chr131640 ------
NM_006646chr1332965 422 225 23003 2174 ----
NM_006650chr573808 3194 2784 1388 1290 1252 1193 --13898 --
NM_006654chr1294631 4026 1890 1396 1351 1061 956 805 606 24088 1015 24300 791 --
NM_006699chr122718 287 --1139 --
NM_006713chr54835 288 254 33 ------
NM_006717chr973428 3043 2926 2868 2224 1244 1049 --12995 13005
NM_006718chr61896 ------
NM_006722chr362966 2917 2349 1139 948 913 1701 ----
NM_006729chrX75511 3858 1771 1438 1385 1028 270 ------
NM_006750chr16107259 4896 2982 1139 1098 356 319 300 224 32 ------
NM_006756chr831211 1156 937 --11038 --
NM_006759chr21233 ------
NM_006761chr171840 ------
NM_006766chr872127 2010 1826 1079 1066 820 379 22292 555 ----
NM_006775chr673038 2901 2242 2132 788 531 169 12766 ----
NM_006791chr152628 510 ------
NM_006813chr61199 --1670 --
NM_006826chr23938 322 119 ----1893
NM_006873chr242359 1193 938 128 22416 267 1323 --
NM_006885chr1684189 3310 2957 2680 2638 1440 555 540 --23076 866 --
NM_006888chr14123436 3193 2953 2923 2784 807 776 770 668 661 635 294 ------
NM_006908chr71342 ------
NM_006914chr91287 --1359 --
NM_006915chrX42493 987 681 137 ------
NM_006920chr251353 355 270 215 37 --21839 107 --
NM_006924chr1784007 3890 3229 789 439 410 244 89 34324 2762 772 23949 211 --
NM_006930chr531769 124 58 1770 1733 --
NM_006931chr1232110 1659 1515 12140 ----
NM_006940chr1211331 1115 1329 1103
NM_006951chr102248 36 ------
NM_006981chr94870 818 728 336 22860 2493 1589 11957
NM_006999chr531820 465 426 ------
NM_007006chr1673532 3337 3000 2412 709 418 138 12558 ----
NM_007007chr12113734 2988 1789 1685 1593 1541 951 696 449 423 204 14121 14753 --
NM_007008chr22760 147 1841 ----
NM_007011chr15126838 6190 6140 4827 4663 2531 2525 2385 1708 1493 928 751 1219 ----
NM_007017chr51924 ------
NM_007023chr23904 885 79 ------
NM_007033chr132172 632 473 154 12274 --
NM_007038chr2194934 4705 3683 1803 1759 1636 1302 561 384 33916 1600 1166 25068 1209 --
NM_007042chr331932 666 432 --11692 1577
NM_007050chr2098071 7980 7182 7109 5888 5465 2640 2425 1513 ------
NM_007054chr553644 745 447 410 214 1427 1205 --
NM_007068chr22------11043
NM_007073chr673962 3579 2682 2636 1534 279 202 --11288 --
NM_007107chr362164 2140 1808 968 751 661 1324 2174 159 --
NM_007111chr131714 --2586 155 --
NM_007115chr22491 460 175 ----
NM_007124chr641568 416 208 127 ------
NM_007129chr132984 801 ------
NM_007137chrX65443 5206 5037 4724 1537 1307 33698 3542 303 ----
NM_007145chr1921201 878 ------
NM_007146chr1742316 1930 639 464 ------
NM_007147chr1921226 916 ------
NM_007159chr331665 1617 1406 1599 ----
NM_007166chr1121587 1158 ------
NM_007172chr2243234 3206 2476 393 12080 12684 --
NM_007175chr893480 3236 3013 2991 2824 2722 2539 1168 98 ------
NM_007185chr1----11095 --
NM_007195chr1823513 116 22724 907 13637 --
NM_007197chr12--1872 ----
NM_007204chr11630 --2225 159 --
NM_007214chr631277 1233 54 ------
NM_007220chrX24429 3903 44940 4001 1604 65 ----
NM_007222chr821829 670 31455 680 455 ----
NM_007231chrX3527 209 28 11954 --11975
NM_007235chr123454 212 101 ------
NM_007236chr1552445 2406 455 357 117 --21858 857 --
NM_007249chr13149231 8170 8164 8045 7211 6205 6135 3627 3517 3024 1689 1153 1086 249 --1662 --
NM_007269chr14530 432 390 140 ------
NM_007271chr63709 616 342 ------
NM_007276chr711087 ------
NM_007294chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007295chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007296chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007297chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007298chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007299chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007300chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007302chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007303chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007304chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007305chr1751317 1258 1126 1026 849 11349 21248 328 --
NM_007345chr1821705 197 11556 11995 --
NM_007347chr1553238 3053 2216 631 195 21208 605 ----
NM_007362chr321567 1460 11235 ----
NM_007373chr1041365 478 393 28 --11580 --
NM_012089chr121305 1130 31514 1120 308 1144 --
NM_012090chr141145 1062 1034 506 194 ----
NM_012096chr353266 2674 1248 567 326 ----12328
NM_012120chr63572 547 246 32757 2405 811 11913 1748
NM_012129chr762210 2159 2062 567 476 328 12329 ----
NM_012141chr1354069 3152 1018 875 100 21637 900 24062 66 --
NM_012153chr1152576 2156 1628 679 452 --12242 --
NM_012154chr82760 24 1835 ----
NM_012156chr2032819 1029 395 ------
NM_012158chr1331632 1404 520 --1138 11151
NM_012175chr115816 727 325 119 81 --2745 165 145
NM_012193chr1174957 1937 1261 1053 723 543 327 --13491 --
NM_012199chr174154 3539 3454 3332 2912 1721 1536 13075 23465 1809 --
NM_012207chr101147 ------
NM_012210chr941540 1511 1040 382 ------
NM_012214chr2106362 6347 5684 5144 4131 4021 1138 1047 937 126 25636 292 15701 --
NM_012215chr1031821 1355 710 --21926 580 --
NM_012223chr241187 1130 843 205 1520 ----
NM_012229chr1021362 1226 ------
NM_012234chr342305 1415 896 211 ------
NM_012238chr1041752 1401 247 30 --31686 1620 140 --
NM_012242chr102610 538 ----1321
NM_012247chr103919 677 248 1236 1838 --
NM_012248chr16174 ------
NM_012249chr253006 2398 2314 871 403 13299 13603 13081
NM_012250chr1131258 982 313 1378 --11173
NM_012255chr202394 155 ------
NM_012261chr201528 ------
NM_012262chr164197 3751 1699 1062 710 443 65214 4069 3783 3446 1636 1091 25127 1337 --
NM_012281chr752350 2277 762 616 42 1733 ----
NM_012287chr373511 3362 1558 1023 930 752 637 --14207 --
NM_012288chr695681 5419 5379 4845 4559 4439 2269 1589 1102 --14834 --
NM_012289chr19152 ------
NM_012294chr753945 2493 1554 753 277 13647 ----
NM_012297chr442564 2177 1752 350 22393 193 12311 --
NM_012300chr531587 679 287 22524 2367 1560 --
NM_012302chr131155 957 267 ------
NM_012325chr2021520 1096 --11342 --
NM_012328chr7--11072 ----
NM_012329chr1731109 378 151 ------
NM_012330chr1021737 1572 ------
NM_012334chr584682 4607 3549 3447 3203 2982 1348 814 22951 726 ----
NM_012347chr61171 11197 --12034
NM_012382chr564493 3988 3638 1613 1330 1225 1708 --11018
NM_012395chr763407 2926 2695 2414 1094 551 --1682 --
NM_012399chr2231702 1400 39 ------
NM_012432chr1----167 --
NM_012464chr472836 2170 2095 1847 937 923 854 22855 2845 ----
NM_012482chr1----1598 --
NM_013229chr1252857 1966 377 266 101 32265 2099 367 --12331
NM_013230chrY51728 561 547 495 355 ------
NM_013233chr251409 1159 538 406 129 21352 1110 1258 --
NM_013253chr1141276 1140 483 318 1886 21224 173 --
NM_013261chr463699 3611 3436 3297 2394 1292 12902 12791 --
NM_013262chr63937 484 74 ------
NM_013280chr111223 ------
NM_013283chr53853 359 317 ------
NM_013309chr1522259 222 2691 574 21993 1704 --
NM_013316chr72302 225 ------
NM_013320chr121129 ------
NM_013336chr331947 533 257 --1512 --
NM_013341chr242813 2481 753 458 11981 ----
NM_013361chr192162 138 ------
NM_013374chr352288 2138 907 581 195 32124 795 494 ----
NM_013381chr121587 22122 860 ----
NM_013386chr111655 1671 ----
NM_013411chr131958 772 405 ------
NM_013437chr841056 311 221 25 --1253 --
NM_013445chr2132 ------
NM_013446chr711393 ------
NM_013448chr14143 ------
NM_013449chr1231200 1137 1078 11966 ----
NM_013450chr21783 ------
NM_013989chr1433210 1687 28 ------
NM_013995chrX32309 676 619 42238 2115 1672 207 ----
NM_014011chr262364 2219 2112 911 780 263 2589 147 ----
NM_014021chr122663 2587 12617 13286 --
NM_014023chr1072768 2555 2256 1810 951 412 29 ------
NM_014028chr642439 2308 1174 1049 1457 1967 --
NM_014048chr1675118 4787 3690 3249 2080 1075 94 ------
NM_014106chr1562887 2832 2741 2240 289 260 12733 ----
NM_014112chr874398 4159 3578 2052 1619 626 429 44320 4241 1872 1290 12141 --
NM_014117chr1642673 565 520 106 ------
NM_014154chr331461 1270 349 11132 133 --
NM_014155chr1186447 5878 5154 2739 2165 1686 1049 1018 32540 2455 557 27380 1561 --
NM_014170chr3189 ------
NM_014181chr252187 1805 998 790 157 11074 42024 1872 512 53 --
NM_014191chr121970 --156 --
NM_014211chr531721 430 161 --1284 --
NM_014217chr131868 1245 317 11343 2263 66 --
NM_014228chr511114 11428 ----
NM_014241chr101102 ------
NM_014243chr442122 1578 471 257 --1535 --
NM_014250chr2232043 166 94 --21689 66 --
NM_014253chrX4655 583 368 164 ------
NM_014267chr112797 621 145 ----
NM_014278chr41356 ------
NM_014283chr151280 1245 1195 1131 155 ------
NM_014293chr2274149 2760 2533 1276 442 337 118 13455 ----
NM_014309chr22115435 4970 4728 4672 4185 3717 1905 1463 973 516 218 22066 1513 ----
NM_014317chr102262 42 1272 ----
NM_014319chr1231218 758 436 11860 --130
NM_014333chr1142507 2493 677 189 11794 ----
NM_014345chr62838 332 ------
NM_014363chr1311118 31262 948 100 1118 --
NM_014372chr1--11712 --11904
NM_014382chr321557 578 11476 ----
NM_014415chr341475 1085 302 82 21282 1250 1118 --
NM_014423chr555076 4750 1880 1018 466 35376 5158 4539 33415 1897 1458 23896 3699
NM_014445chr32888 622 11538 --21772 237
NM_014447chr451528 1438 1243 1224 348 1167 ----
NM_014458chr111371 11094 ----
NM_014469chr11--1200 ----
NM_014478chr772119 1815 1771 1725 774 586 402 --176 --
NM_014487chr4------1253
NM_014494chr1631575 1555 1513 12355 ----
NM_014503chr121433 ------
NM_014554chr1282118 1983 1580 1474 793 613 514 100 11564 11967 --
NM_014570chr222935 660 --1102 --
NM_014571chr172943 2735 2586 2221 2074 1012 208 1173 1381 --
NM_014574chr1441538 1475 1450 636 ------
NM_014577chr22165 ------
NM_014585chr241071 980 951 137 ------
NM_014606chr431403 1207 153 ------
NM_014608chr151435 --1221 --
NM_014612chr981499 1488 1472 1453 1099 1086 516 422 ------
NM_014615chr1613307 1845 --1713
NM_014630chr1583845 3763 3184 2864 1449 1397 741 336 13479 ----
NM_014636chr974131 3921 2888 2687 1165 806 87 ------
NM_014637chr841504 1480 940 81 1430 11287 --
NM_014644chr1------1991
NM_014660chr72807 310 ------
NM_014666chr511190 11047 1140 --
NM_014670chr22617 143 --11497 --
NM_014682chr812266 31679 1615 1606 ----
NM_014683chr1721535 679 --11753 --
NM_014690chr783119 2585 970 936 456 263 244 51 --32622 2542 501 --
NM_014701chr1573291 3097 3082 3031 952 810 400 13050 ----
NM_014705chr741405 843 586 542 ----11544
NM_014707chr732248 2073 1531 2455 301 ----
NM_014709chr23627 564 55 ------
NM_014711chr1611980 1635 11496 --
NM_014717chr191677 ------
NM_014720chr1041830 1576 480 290 21840 329 ----
NM_014721chr687059 6085 5373 5018 2404 1555 1424 1306 --15587 --
NM_014729chr852019 1947 1501 876 204 12320 ----
NM_014730chr1275200 4477 4033 3344 1149 651 338 ------
NM_014730chr1275200 4477 4033 3344 1149 651 338 ------
NM_014733chr522071 705 --11667 --
NM_014735chrX--1331 ----
NM_014743chr472319 1968 1262 1085 958 234 27 1202 12299 1831
NM_014746chr254249 3554 1187 706 450 1684 ----
NM_014747chr175609 4494 4059 1626 1033 500 154 --35731 4819 987 --
NM_014751chr841561 869 582 36 ------
NM_014755chr2104215 4192 3888 3813 1709 1656 1069 963 607 586 13748 21484 522 --
NM_014764chr1211188 ----11202
NM_014772chr1863037 2834 2436 2369 781 445 ----12270
NM_014781chr811140 1969 ----
NM_014783chr151552 ----1100
NM_014790chr5150 ------
NM_014791chr91246 ----164
NM_014795chr22917 82 3417 180 50 --11310
NM_014802chr122891 323 --1873 --
NM_014803chr1042120 937 675 130 11913 11078 --
NM_014812chr121475 223 ------
NM_014819chr552447 2328 1912 1677 379 12389 ----
NM_014835chr2062200 2157 1851 1756 801 161 ------
NM_014836chr1022033 1852 --11451 --
NM_014838chr2282693 2615 2227 2114 1806 685 552 90 ------
NM_014839chr132330 850 102 12123 ----
NM_014846chr8133 1272 ----
NM_014873chr1114717 4454 4440 4269 4253 3888 3586 3462 1789 1662 1246 ------
NM_014874chr151799 1408 1245 481 185 --1670 11200
NM_014877chr1766579 6557 4938 2924 1753 660 1253 26814 801 --
NM_014892chr61173 ------
NM_014893chrY31919 930 530 ------
NM_014897chr172387 189 11187 11036 12271
NM_014906chr1763422 3263 3120 2573 684 647 23722 2624 --11628
NM_014912chr1062970 2961 2658 2638 2492 1236 23420 3163 1376 --
NM_014913chr1831492 594 190 11127 11430 --
NM_014918chr1541327 1120 484 430 ----1378
NM_014920chr643258 3197 2329 589 13459 32963 1148 520 --
NM_014923chr13--1151 11740 --
NM_014934chr1384013 3838 3824 2873 2820 1134 1128 992 ------
NM_014945chr521988 634 --11332 --
NM_014946chr252592 2469 2152 606 438 ----1810
NM_014947chr173063 2969 2872 2275 2264 2241 236 --13104 --
NM_014950chr1421755 1611 ------
NM_014953chr1343394 1388 652 154 13701 --12845
NM_014961chr442224 2207 380 183 ------
NM_014962chr2032471 1086 900 22263 1832 12098 --
NM_014974chr1031180 412 48 --11830 --
NM_014978chr1051836 1786 1771 1456 202 ------
NM_014988chr452469 2252 1840 1780 181 ------
NM_014989chr651755 1419 817 523 86 1150 ----
NM_014990chr142900 360 21082 877 ----
NM_014999chr1231688 1668 1088 ------
NM_015000chr1233127 2310 1211 13100 11929 --
NM_015008chr373593 3471 2928 2879 2597 2384 22 1844 22898 1156 --
NM_015015chr1951437 517 471 369 315 ------
NM_015018chr61186 ------
NM_015020chr16103899 3731 3483 3234 2931 2723 1048 892 570 34 ----13407
NM_015025chr242470 2175 1938 519 22285 1047 ----
NM_015027chr169733 607 568 506 498 418 101 38 25 21412 1335 ----
NM_015032chr1352718 2108 1877 1122 1044 12482 1345 --
NM_015035chr2076503 6049 5987 5810 5755 2534 1363 16000 16230 --
NM_015045chr1031583 1498 375 1344 11457 1233
NM_015049chr253236 2441 2391 2069 1109 12841 ----
NM_015051chr912404 --12148 11314
NM_015061chr92598 75 1675 --1717
NM_015068chr763392 1510 1215 1114 368 71 23974 2908 12511 --
NM_015071chr586275 5993 5938 5671 2376 1402 897 545 ------
NM_015074chr154860 4457 4258 3258 885 34972 4331 1048 24510 1889 23816 1396
NM_015076chr664343 3956 3656 1804 1182 488 34072 3174 520 --14491
NM_015087chr1352549 2318 2271 700 663 22691 670 ----
NM_015092chr16124664 4551 4166 4100 3354 3022 1825 1748 1508 1407 1096 260 1765 1801 --
NM_015097chr362382 2280 1966 1590 320 106 11554 ----
NM_015100chr1--1455 12078 --
NM_015107chrX52313 839 833 827 514 ------
NM_015115chr483042 2378 1006 470 265 175 106 71 33153 434 34 1897 12170
NM_015130chr441310 344 310 157 11155 21202 440 --
NM_015137chr842057 761 466 357 32413 2291 276 ----
NM_015138chr1562268 1922 1901 869 683 100 ----12064
NM_015141chr382747 2501 2390 2257 2090 1693 508 97 1813 ----
NM_015153chr6188 141 ----
NM_015158chr93701 238 52 ------
NM_015176chr131412 1251 547 1616 --11392
NM_015187chr41282 ------
NM_015192chr2082813 2564 2220 2087 742 690 644 438 ------
NM_015199chr332649 2407 248 22470 2159 22303 792 --
NM_015200chr442594 1633 842 753 ------
NM_015203chr1168 ------
NM_015206chr1563710 3549 3277 3222 2363 1268 13149 ----
NM_015208chr1843017 2663 1318 621 1104 ----
NM_015213chr112552 85 ------
NM_015215chr162283 2059 1168 557 441 347 12874 150 --
NM_015231chr11--1687 ----
NM_015238chr55689 245 161 54 41 ------
NM_015245chr632490 270 191 12603 ----
NM_015250chr9--21733 1463 ----
NM_015252chr23299 113 76 1812 ----
NM_015264chr2244041 3686 3574 415 ----14859
NM_015265chr222161 490 22661 1797 --12669
NM_015269chr12417 205 --1193 --
NM_015271chr453531 2778 1565 1089 537 --13019 --
NM_015272chr1622136 1950 ------
NM_015275chr1221576 89 41638 1333 568 47 ----
NM_015278chr663346 3262 2928 2773 2258 1228 ------
NM_015286chr1562415 2184 1813 977 944 813 12353 1499 --
NM_015291chr133429 1181 1156 11053 ----
NM_015296chr131922 2820 803 ----
NM_015308chr112757 35 ------
NM_015310chr858265 8159 6252 5168 162 68060 7536 6111 3315 822 336 ----
NM_015314chr762471 2241 1704 1572 577 383 12359 ----
NM_015317chr21710 --12722 --
NM_015323chr621639 1561 ------
NM_015326chr132940 1906 1096 ----152
NM_015328chr733087 2865 2005 ------
NM_015335chr1222352 1760 --11890 --
NM_015344chr821968 523 2767 687 ----
NM_015347chr1222760 2339 1345 ----
NM_015349chr62581 520 23033 3004 ----
NM_015355chr1721740 656 1110 1346 --
NM_015358chr2121341 196 --11215 --
NM_015359chr8102982 2931 2829 2402 2332 1878 805 778 698 124 ------
NM_015365chrX44258 954 777 404 24293 2730 ----
NM_015379chr71284 --196 --
NM_015387chr242092 1739 1559 1389 ------
NM_015394chr122809 427 22440 2214 11727 --
NM_015397chr951761 1384 1331 678 254 --11890 --
NM_015423chr1161540 1377 586 451 418 36 21707 1332 --11318
NM_015429chr341034 934 766 292 ------
NM_015435chr81582 11171 ----
NM_015443chr1731221 1012 282 ------
NM_015455chr563643 2914 2861 1024 518 456 ----13969
NM_015457chr111981 1332 ----
NM_015458chr855232 5107 4753 3433 1839 1738 14865 --
NM_015461chr183754 592 142 2708 85 ----
NM_015464chr731010 263 87 --1277 --
NM_015483chr72962 879 1275 ----
NM_015497chr152772 358 1448 11003 11034
NM_015520chr372653 2274 2143 2097 1742 1111 1004 11757 11050 --
NM_015525chr62918 247 ------
NM_015528chr171192 ------
NM_015532chr1522741 88 11751 ----
NM_015534chr12921 179 159 ----
NM_015535chr244040 619 551 335 ------
NM_015554chr1542370 1972 1908 472 --12903 --
NM_015565chr2141842 1772 1698 1557 --11616 12151
NM_015567chr1341274 1185 1013 956 --11115 --
NM_015568chr2053529 3411 3105 2741 1490 14318 33059 1501 1100 --
NM_015569chr173910 3440 3229 3011 1696 1343 600 11844 ----
NM_015570chr731736 1531 1407 1580 11714 --
NM_015577chr531453 677 82 1720 --11180
NM_015578chr1952056 1890 1566 1556 572 --21683 1356 --
NM_015601chr1031014 996 688 1177 ----
NM_015602chr131459 718 46 1645 ----
NM_015610chr731052 260 136 --12787 --
NM_015622chr7--1274 ----
NM_015635chr921993 592 12156 193 135
NM_015640chr1114805 4716 4682 1787 1635 1421 1356 1175 925 813 106 24432 593 ----
NM_015652chr102617 32 ------
NM_015678chr1341535 1465 1230 264 ------
NM_015695chr652134 2041 1633 1374 748 ------
NM_015869chr31144 ------
NM_015878chr841913 1796 1766 569 --22001 643 --
NM_015879chr1858506 2209 1944 1587 102 28168 840 32557 2019 32 --
NM_015881chr1141276 1140 483 318 1886 21224 173 --
NM_015886chr845748 5483 3834 1019 14033 --11757
NM_015906chr194824 4660 4591 3279 2926 1928 556 311 26 21555 1461 --1287
NM_015980chr521077 205 --1258 --
NM_015990chr42860 224 11082 ----
NM_015995chr1555536 3992 1999 1830 1011 --14169 --
NM_016002chr11108 ------
NM_016003chr731052 260 136 --12787 --
NM_016009chr1104902 4818 4782 4309 4153 4139 1317 1048 1023 286 24707 4601 ----
NM_016021chr692982 2963 2658 2651 2591 2513 1874 164 77 1647 ----
NM_016022chr111089 ------
NM_016025chr1631858 1640 1536 31634 1464 1414 1356 --
NM_016040chr132515 2346 2270 21878 60 --11999
NM_016045chr2011245 ------
NM_016048chr53916 340 58 --1700 --
NM_016072chr1242275 2171 1675 461 ------
NM_016073chr1541200 1065 883 814 ------
NM_016078chr17--11039 1419 --
NM_016081chr421841 497 --12190 --
NM_016083chr643536 939 786 124 33900 3693 1118 --13789
NM_016090chr1161075 1014 992 886 858 22 ------
NM_016096chr84763 693 141 93 11993 ----
NM_016097chr18----3985 818 298 1280
NM_016100chr201159 1373 ----
NM_016101chr1651102 948 327 228 30 1310 ----
NM_016127chr81741 ------
NM_016132chr1583330 3161 2947 2473 2111 998 760 235 1903 12690 --
NM_016147chr1141050 788 390 176 ------
NM_016152chr311264 --11230 --
NM_016203chr7----2893 202 --
NM_016205chr41902 ------
NM_016206chr3148792 8435 8409 8100 7176 6710 3030 3006 1842 1753 1660 749 655 480 28287 2894 12004 --
NM_016227chr151280 1245 1195 1131 155 ------
NM_016247chr33434 142 96 ------
NM_016248chr1373977 3958 3783 3772 1001 839 772 22610 795 11497 --
NM_016260chr287078 5944 2313 1683 942 695 215 125 26146 506 11154 --
NM_016272chr2222775 1058 12506 ----
NM_016275chr342752 2270 1789 1067 21731 101 --11708
NM_016290chr5186 ------
NM_016297chr233179 2680 111 ----13328
NM_016303chrX1148 ------
NM_016319chr121745 ------
NM_016322chr993235 2442 2365 2352 1996 1277 974 947 396 22777 1172 11252 --
NM_016351chr72429 36 ------
NM_016374chr161472 1246 1073 444 203 118 11209 21238 40 --
NM_016374chr161472 1246 1073 444 203 118 11209 21238 40 --
NM_016376chr1774036 3779 1101 756 456 196 176 11246 --13625
NM_016395chr1541940 1358 1314 1225 1159 --21901 421
NM_016396chr1532929 1961 82 12807 ----
NM_016424chr1771992 1548 780 364 201 79 47 ------
NM_016436chr2031911 969 889 12119 11744 --
NM_016441chr271947 1808 1637 882 854 105 95 --1944 --
NM_016470chr20--1500 ----
NM_016486chr1--1370 1349 --
NM_016505chr11649 ------
NM_016507chr1741125 965 852 403 ------
NM_016513chr643258 3197 2329 589 13459 32963 1148 520 --
NM_016530chr1553880 3595 2721 1233 1224 11269 ----
NM_016531chr443887 3335 1691 1149 32620 1353 1131 13116 --
NM_016559chr331116 598 46 --1410 --
NM_016570chr12--1489 ----
NM_016577chr374410 4115 3713 3271 1695 1106 810 22820 260 --1193
NM_016587chr711087 ------
NM_016603chr552025 758 743 255 215 ------
NM_016613chr432684 2091 317 --1386 1440
NM_016626chr1811527 ----1103
NM_016641chr1641669 1447 1354 203 ------
NM_016654chr1531266 1135 286 --21176 254 --
NM_016655chr15145 ------
NM_016931chr113358 337 270 1257 ----
NM_016936chr1632213 2132 462 --1710 12183
NM_016950chr411499 11132 ----
NM_016953chr285955 5602 5491 4499 3816 1927 1533 452 25276 1856 1278 --
NM_017412chr851140 995 915 119 34 ------
NM_017415chr584456 4192 4141 3769 3373 3320 1484 687 ----14448
NM_017420chr1472990 2898 2623 1173 763 745 394 13678 11351 --
NM_017435chr121698 1733 ----
NM_017440chr12--1150 ----
NM_017488chr211534 ------
NM_017491chr42847 647 ------
NM_017578chr3145 ------
NM_017580chr1021631 305 11850 11670 12124
NM_017595chr17--11741 ----
NM_017628chr454629 3579 3346 954 858 1729 11939 --
NM_017633chr673898 3716 3329 3299 3003 2749 1276 12595 ----
NM_017634chr8--1437 ----
NM_017637chr999075 9049 7937 5988 5761 3599 2621 2153 1373 39316 2094 619 38117 1815 402 --
NM_017644chr365079 4422 3404 1666 1535 838 11156 14653 --
NM_017645chr953176 2550 1994 443 104 12043 12035 --
NM_017650chr756063 5868 5751 5210 4199 --15906 --
NM_017658chr1421380 668 44229 4179 3256 1654 ----
NM_017661chr153832 797 80 1471 ----
NM_017666chrX41663 854 549 409 22226 168 1308 --
NM_017672chr1561379 1261 1070 962 371 82 ----1886
NM_017676chr531891 464 27 ------
NM_017686chr13426 141 82 --1333 1249
NM_017737chr161956 1939 1844 1471 341 171 11655 ----
NM_017742chr1811404 11724 ----
NM_017745chrX----1605 --
NM_017747chr51315 ------
NM_017752chrX1829 --1863 11711
NM_017757chr1821099 815 ------
NM_017762chr1532325 1836 247 22229 608 12529 --
NM_017769chr1463089 2838 2516 2287 868 322 22940 2486 12427 --
NM_017770chr62694 326 --22995 707 11854
NM_017778chr821261 1108 --31082 1044 285 --
NM_017813chr865704 5299 4994 3828 3692 1788 34215 338 296 ----
NM_017824chr1052615 2587 1686 332 199 ------
NM_017831chr1874796 4461 4318 4247 2922 1600 1092 34559 246 138 13085 --
NM_017845chr4----2246 100 --
NM_017847chr112214 22288 909 ----
NM_017848chrX64375 3729 3497 2989 834 726 --11610 --
NM_017849chr282880 2840 2260 1192 1006 869 579 388 --21976 814 --
NM_017866chr82863 452 11144 --193
NM_017890chr811736 21788 1550 ----
NM_017915chr123987 438 145 --11125 --
NM_017919chr954372 4229 3746 3576 60 25706 914 ----
NM_017925chr941955 1262 750 324 ------
NM_017926chr143774 590 299 1833 ----
NM_017938chrX1677 1863 1582 --
NM_017944chr1162111 2071 1091 908 689 169 ------
NM_017953chr131223 887 847 --170 11244
NM_017954chr751664 1434 1217 89 47 ------
NM_017972chr143774 590 299 1833 ----
NM_017974chr211282 ------
NM_017987chr1042072 738 722 177 --1301 --
NM_017988chr121936 ------
NM_017994chr712611 12276 22706 880 11820
NM_017998chr92507 383 11063 2492 134 --
NM_018011chr132493 206 1469 ----
NM_018027chr1033133 2604 22 22923 1002 ----
NM_018046chr531600 1461 570 ------
NM_018061chr14632 401 236 76 1192 21098 219 --
NM_018063chr102418 80 ------
NM_018084chr243242 2433 801 514 33089 1023 267 1878 --
NM_018101chr121266 80 --11296 --
NM_018103chr11271 ------
NM_018112chr92976 169 1753 ----
NM_018113chr121387 ------
NM_018133chr331905 374 296 1645 --12093
NM_018151chr21695 ------
NM_018155chr343453 3395 2261 513 1632 --12990
NM_018159chrX41463 1409 1081 648 ------
NM_018171chr121298 --1262 --
NM_018176chr4--11558 ----
NM_018182chr1751605 1595 1553 1434 754 ------
NM_018189chr331649 1371 339 ------
NM_018191chr1321673 45 --1515 1457
NM_018206chr16181 ------
NM_018227chr452659 2248 2094 1180 811 ------
NM_018230chr1124 ------
NM_018243chr433816 3257 605 23870 3510 23472 1358 --
NM_018246chr831830 1758 502 --11796 --
NM_018247chr622017 1077 12632 2922 860 --
NM_018254chr141960 1835 1612 1543 ------
NM_018257chr2032046 1865 73 --3325 276 230 --
NM_018287chr10--1878 ----
NM_018293chr352695 2003 1187 569 505 ------
NM_018298chr16877 366 332 323 303 141 1902 1194 1101
NM_018299chr873378 3256 2559 1316 609 576 505 --12883 --
NM_018307chr173806 767 380 1332 ----
NM_018312chr1151654 595 583 314 235 ------
NM_018313chr342430 2342 1776 545 11715 ----
NM_018315chr441549 1118 616 515 11241 ----
NM_018326chr72809 539 ------
NM_018330chr1041071 685 383 292 --21540 1227 --
NM_018351chr1273252 1725 1429 1168 1135 331 136 13812 ----
NM_018361chr841568 1389 293 75 ------
NM_018362chr1153807 1231 1117 232 88 11520 ----
NM_018364chr141499 775 726 369 14054 ----
NM_018374chr785129 5045 3503 3357 2018 1236 1198 1048 45211 4510 983 461 --24648 4074
NM_018416chr1242617 2371 1000 434 ------
NM_018429chr572774 2731 1924 1918 1788 1092 914 22503 2088 ----
NM_018439chr1842608 2428 846 649 22645 392 ----
NM_018440chr888146 5827 5631 2745 2737 1823 1436 942 28410 1219 25329 141 --
NM_018442chr11156 ------
NM_018448chr121157 --1135 --
NM_018452chr6_random43810 3107 1315 962 43364 2857 1240 869 12680 13640
NM_018464chr101356 --152 --
NM_018466chrX1678 ------
NM_018469chr1771502 1447 1385 1312 1287 1102 105 ------
NM_018471chr21560 ------
NM_018490chr1121262 478 2626 353 --11509
NM_018555chr1941611 842 569 549 21848 541 ----
NM_018557chr241728 1467 390 129 ------
NM_018566chr154676 4246 3968 1205 722 11766 ----
NM_018569chr441542 1139 1027 73 ------
NM_018638chr12105558 4950 4515 4302 3618 2064 1828 937 808 540 25426 5027 1323 --
NM_018640chr1222546 376 ------
NM_018650chr11484 --1894 --
NM_018695chr52967 281 --1193 --
NM_018698chrX41942 1844 1516 72 --11854 --
NM_018710chr821400 179 ------
NM_018712chr1151406 1350 1142 171 103 ------
NM_018717chr432290 618 584 ------
NM_018719chr7----1146 --
NM_018834chr51734 ------
NM_018841chr132607 640 249 --12951 --
NM_018847chr961670 1534 680 439 266 190 ------
NM_018890chr71342 ------
NM_018912chr51687 ------
NM_018913chr51687 ------
NM_018914chr51687 ------
NM_018915chr51687 ------
NM_018916chr51687 ------
NM_018917chr51687 ------
NM_018918chr51687 ------
NM_018919chr51687 ------
NM_018920chr51687 ------
NM_018921chr51687 ------
NM_018922chr51687 ------
NM_018923chr51687 ------
NM_018924chr51687 ------
NM_018925chr51687 ------
NM_018926chr51687 ------
NM_018927chr51687 ------
NM_018928chr51687 ------
NM_018929chr51687 ------
NM_018945chr643197 2727 948 613 1887 ----
NM_018948chr141276 955 913 438 1160 11024 --
NM_018958chr1573452 3353 2867 1576 1163 635 446 1977 --11389
NM_018970chr763127 2936 2813 2160 1033 446 ----13157
NM_018972chr842398 1929 893 657 12313 ----
NM_018975chr164795 724 291 126 --1582 --
NM_018999chr1084834 4176 4106 4084 4078 3903 1750 1324 --23819 677 13706
NM_019001chr3124263 4231 3604 3378 3127 1559 1117 1053 938 750 170 159 ------
NM_019004chr712121 32390 1603 815 --11517
NM_019027chr432378 2079 2044 ------
NM_019035chr432010 1274 300 2497 481 ----
NM_019060chr11285 ------
NM_019063chr242138 1436 407 95 21729 385 ----
NM_019072chr553974 3634 3060 1704 813 1593 ----
NM_019084chr1021798 1030 1518 ----
NM_019087chr521535 668 ------
NM_019091chr231027 865 852 168 ----
NM_019098chr851744 406 326 61 49 11408 ----
NM_019114chr942199 2147 2026 1731 --1389 12510
NM_019116chr1683757 2659 2418 1440 1337 1330 893 833 ------
NM_019555chr31317 --1331 --
NM_019593chr2093125 2660 2259 2034 1137 937 780 76 43 1795 1879 --
NM_019600chr151206 1770 ----
NM_019610chr131971 1530 473 ------
NM_019860chr10--11626 ----
NM_019884chr19------1385
NM_020066chr14847 764 328 153 ------
NM_020116chr451416 1262 451 142 62 --11440 --
NM_020122chr275106 4615 2409 1579 714 625 88 1817 34172 1835 862 --
NM_020123chr1031554 1283 199 ------
NM_020127chr151817 1233 474 320 98 ----173
NM_020144chr722101 549 1423 ----
NM_020148chr1862957 2913 863 424 300 142 ------
NM_020159chr431655 1189 1072 11558 21634 278 --
NM_020177chr592973 2732 2474 2229 610 420 280 199 69 127 1554 --
NM_020179chr112450 401 ------
NM_020180chr1841147 941 184 114 ------
NM_020198chr17----1372 --
NM_020209chr19189 ------
NM_020240chr541919 830 166 74 12302 --12372
NM_020245chr654961 4608 3119 287 264 --11269 --
NM_020337chr462801 2503 2177 2095 506 424 23105 1149 ----
NM_020341chr2011794 ------
NM_020362chr1----1333 --
NM_020390chr3104350 3275 3169 3034 645 573 445 129 119 27 14590 11427 --
NM_020422chr163639 166 109 1387 1350 --
NM_020438chr921405 1395 ------
NM_020440chr143314 3148 2777 2709 11296 ----
NM_020443chr176841 6798 6557 5945 5014 4437 2274 --26124 2351 --
NM_020449chrX3645 249 40 1169 ----
NM_020455chr632771 2695 1778 --1660 --
NM_020457chr163247 157 66 ------
NM_020466chr694936 4576 3756 1845 1781 1735 968 626 342 11135 ----
NM_020475chr82340 141 12365 ----
NM_020476chr82340 141 12365 ----
NM_020477chr82340 141 12365 ----
NM_020478chr82403 204 12428 ----
NM_020480chr82340 141 12365 ----
NM_020529chr141446 ------
NM_020532chr22760 147 1841 ----
NM_020647chr832085 656 489 ------
NM_020651chr251704 1471 1416 336 314 11657 ----
NM_020654chr321470 164 --11585 --
NM_020659chr191578 ------
NM_020673chr2077748 7691 7563 6742 5460 2443 2129 1418 ----
NM_020689chr20----31716 493 393 --
NM_020698chr1262793 1967 983 767 121 89 22509 2279 1963 --
NM_020699chr174947 4171 4026 3699 2177 2044 1425 --31492 1036 1025 --
NM_020717chrX43331 3220 1422 1026 31854 1701 843 ----
NM_020718chr16104455 4432 4036 1907 1841 1744 647 437 172 119 24073 4023 ----
NM_020734chr1243314 2807 2655 82 12757 ----
NM_020739chr1553674 3032 2962 1390 826 1136 ----
NM_020747chr5----1769 --
NM_020751chr1331264 1004 122 ------
NM_020752chr1031950 749 560 2723 632 11844 --
NM_020765chr1--1105 ----
NM_020766chrX84533 4369 4274 3053 585 414 338 130 --13970 --
NM_020771chr641091 462 287 255 ------
NM_020772chr17158678 8486 8031 7256 6827 6681 6176 5661 5633 2997 2818 1667 1594 1108 952 ------
NM_020774chr1875247 5110 1742 1539 1398 645 133 25620 4982 11549 --
NM_020796chr552601 2466 2335 902 710 12640 13050 --
NM_020801chr572170 2120 2026 894 864 743 734 --12524 --
NM_020808chr121071 111 21099 929 ----
NM_020810chr1463583 3000 2903 865 845 666 23575 1148 13617 --
NM_020815chr4----1410 --
NM_020819chr61188 1891 1295 --
NM_020824chr101790 289 43 ----
NM_020825chr1643474 1370 479 109 23789 2445 32779 917 307 --
NM_020830chr233241 2558 1120 22993 754 1407 --
NM_020841chr1284002 3951 3667 3490 3047 1418 1175 360 33010 2516 502 13525 --
NM_020843chr153347 155 73 ------
NM_020853chr1212197 12789 12182 --
NM_020854chr1821493 456 1388 ----
NM_020858chr1542316 2257 1881 1778 --11652 --
NM_020859chr463168 2960 1237 914 84 35 43967 3473 3268 474 1962 --
NM_020860chr44979 884 745 463 11116 ----
NM_020865chr3156 ------
NM_020866chr1311015 --1687 --
NM_020870chr42827 293 ------
NM_020872chr331684 1209 508 11564 ----
NM_020873chr31294 1699 --1244
NM_020899chr1722229 2150 ------
NM_020917chr1963349 2817 1529 1358 1205 1108 1981 2903 608 --
NM_020918chr1063350 2415 2292 1333 997 875 12579 --1941
NM_020922chrX2331 268 11773 ----
NM_020927chr1632164 153 143 --22211 1760 --
NM_020935chr244580 4379 677 625 12891 22943 705 --
NM_020940chr1032624 285 231 12643 ----
NM_020948chr121206 597 1789 12834 --
NM_020964chr1854743 1827 511 60 35 11881 13247 --
NM_021005chr1561116 988 930 417 174 146 1877 ----
NM_021007chr222234 38 22157 1645 1108 --
NM_021033chr1363421 3375 3264 3122 3029 144 1583 ----
NM_021038chr362914 2246 715 677 547 195 --13015 --
NM_021069chr451968 1415 536 411 340 ------
NM_021072chr541981 841 776 592 1456 11998 --
NM_021077chr15141 ------
NM_021088chr231944 1929 777 21331 582 --1392
NM_021090chr22144943 4589 4384 4037 3979 3861 3378 3157 1756 1131 784 736 150 39 12015 ----
NM_021097chr252991 2011 1153 965 774 11234 --12853
NM_021116chr7128660 7981 7458 7171 6016 5611 2578 2297 999 960 290 221 --13252 18946
NM_021120chrX52924 923 295 230 102 1985 ----
NM_021139chr43438 423 378 ------
NM_021140chrX2854 828 11144 ----
NM_021141chr21777 1222 ----
NM_021148chr721708 50 11864 ----
NM_021165chr1----2832 673 --
NM_021167chr742212 2071 1081 258 ------
NM_021183chrX42050 1831 1804 689 11944 ----
NM_021190chr121202 38 2378 139 163 --
NM_021191chr1252507 2335 2034 1973 648 1948 12535 --
NM_021194chr1--1343 1216 --
NM_021202chr2053060 2683 2315 1222 653 ----13054
NM_021204chr41228 ------
NM_021252chr102687 108 --21652 1606 --
NM_021255chr1464022 3174 1652 993 761 89 23494 3398 ----
NM_021614chr5----1220 --
NM_021620chr61769 ------
NM_021622chr1042128 1979 1586 851 12341 ----
NM_021629chr395024 4750 4343 3542 1949 1428 869 558 252 ----11374
NM_021637chrX41338 1221 305 297 1916 ----
NM_021639chr14876 772 619 170 ------
NM_021644chr101147 ------
NM_021722chr72388 36 ------
NM_021723chr72429 36 ------
NM_021728chr142852 372 ------
NM_021738chr101188 1134 ----
NM_021813chr6105626 5496 4347 4303 4241 3882 1981 422 142 72 1602 15668 --
NM_021814chr651395 368 265 227 42 11686 ----
NM_021911chr545651 4637 4115 391 11508 21048 876 --
NM_021912chr1553735 3212 2766 1354 1160 ----12909
NM_021914chr1422430 789 2638 194 1183 --
NM_021935chr33954 688 66 ------
NM_021946chrX21143 469 1209 1157 --
NM_021954chr1383581 3553 2509 1275 1094 316 299 177 1872 ----
NM_021961chr1146962 5237 1986 91 26119 4603 ----
NM_021964chr375583 5138 4675 1979 689 365 300 --25946 1729 --
NM_021979chr142349 103 ------
NM_021988chr2031339 1065 608 ------
NM_022037chr21166 ------
NM_022041chr1661918 1898 1001 520 231 184 12446 ----
NM_022048chr1595158 2226 1945 1699 1171 1111 716 280 229 15818 11512 --
NM_022051chr1--2628 44 2594 514 --
NM_022079chr1031014 996 688 1177 ----
NM_022091chr632099 1716 844 22267 2021 ----
NM_022103chr191942 ------
NM_022114chr194731 4355 3588 3087 2989 1903 1723 535 227 14197 ----
NM_022131chr311307 ------
NM_022133chr821768 1208 11224 21429 1388 --
NM_022138chr611521 --1154 --
NM_022143chr741598 1556 1324 972 ------
NM_022154chr411347 ------
NM_022166chr1685821 4311 4087 3928 3859 1627 1079 228 ------
NM_022173chr21166 ------
NM_022307chr73694 220 88 ------
NM_022351chr853438 3035 2863 2674 562 --1731 --
NM_022442chr2031339 1065 608 ------
NM_022443chr3----136 --
NM_022458chr732412 1985 307 13123 13106 12063
NM_022465chr1211946 ------
NM_022474chr1431958 966 440 12791 ----
NM_022475chr4----1616 176
NM_022477chr201595 31749 1499 1129 11660 11405
NM_022484chr721231 394 11395 ----
NM_022497chr363732 3114 2956 2625 1562 1234 ------
NM_022648chr274330 4262 2898 2888 1856 1710 965 ------
NM_022716chr153163 1168 1065 628 321 ------
NM_022719chr22123583 3285 3197 2784 1196 612 588 393 216 209 144 110 ------
NM_022726chr621513 22 ----11214
NM_022735chr121754 561 11528 21854 540 --
NM_022753chr172660 2651 2361 1833 419 382 77 ------
NM_022763chr333006 2798 2564 --1981 --
NM_022780chr241802 1726 695 638 ------
NM_022781chr953070 3016 1168 856 621 11298 1424 1189
NM_022783chr81280 ------
NM_022831chr141562 1539 698 314 1717 2655 636 --
NM_022832chr471996 1654 925 625 293 218 130 ------
NM_022840chr1821145 37 --11248 --
NM_022841chr1552765 2460 2431 2398 195 1269 1368 --
NM_022844chr164956 942 651 247 ------
NM_022845chr16--11646 1818 --
NM_022900chr72481 407 11043 ----
NM_022912chr263049 2997 2927 1888 1108 334 --12580 --
NM_022918chr1131800 1778 1664 11563 11839 --
NM_022977chrX72599 2491 1765 1740 1007 557 153 22008 85 ----
NM_023000chr1451556 1481 1282 1139 136 ------
NM_023001chr1451556 1481 1282 1139 136 ------
NM_023039chr52392 383 --1420 --
NM_023073chr551331 1298 1087 1060 1008 11043 ----
NM_023075chr183785 170 164 --1384 --
NM_023925chr121243 ------
NM_023927chr51995 ------
NM_023929chr8--12319 32260 1117 66 --
NM_024007chr562613 2433 2356 2244 1933 642 13076 --23104 750
NM_024016chr17--1686 ----
NM_024036chr111268 ------
NM_024315chr71358 ------
NM_024337chr51298 ------
NM_024345chr946053 4950 4073 4065 75485 5059 4395 4044 1070 576 527 26078 1192 --
NM_024424chr1121169 1009 --1930 --
NM_024425chr1121169 1009 --1930 --
NM_024426chr1121169 1009 --1930 --
NM_024429chr7----2893 202 --
NM_024492chr621113 118 --130 21133 480
NM_024524chr332681 2057 414 12403 --1268
NM_024546chr1361231 1192 1137 841 334 165 1361 ----
NM_024563chr551767 1738 1687 1680 1591 ------
NM_024569chr142261 2175 2104 329 1675 ----
NM_024581chr6--1205 --265 36
NM_024582chr41360 ------
NM_024583chr23921 746 719 ------
NM_024613chr821528 1277 1510 ----
NM_024615chr5--193 ----
NM_024617chr9--1154 1847 --
NM_024626chr111606 139 ----
NM_024639chr621894 1084 --1824 --
NM_024664chr1132 ------
NM_024665chr394493 4435 4323 4137 3702 3500 3147 1647 58 ------
NM_024669chr52320 306 ------
NM_024670chr1031787 1458 502 --1617 --
NM_024674chr11442 --12929 --
NM_024689chrX21853 1269 --1274 11261
NM_024713chr1521123 414 --1247 --
NM_024721chr862324 1955 1767 1733 1638 1069 --22167 131 --
NM_024743chr421344 1337 --1261 --
NM_024755chr152915 765 ------
NM_024761chr9145241 4889 4800 4590 4446 4390 4324 3860 3813 3350 1555 925 541 37 12139 25032 4983 --
NM_024769chr112709 387 --1747 --
NM_024770chr294408 4318 2588 1204 1017 877 348 69 38 24974 4764 --14706
NM_024779chr121262 ------
NM_024780chr1621051 388 --1240 --
NM_024814chr72322 303 --174 --
NM_024824chr1441615 1337 1317 283 11065 11486 --
NM_024828chr921167 1065 11415 1148 --
NM_024834chr102290 82 11284 21696 331 --
NM_024841chr1132223 955 185 ----12161
NM_024852chr11253 --1163 --
NM_024909chr611364 ------
NM_024911chr1--1255 ----
NM_024941chr511360 11089 --11226
NM_024947chr3169575 9507 8974 8894 8389 8040 7404 6573 6464 3120 2711 2571 1669 1456 1255 912 48564 7849 5954 3770 ----
NM_024949chr474718 4636 4096 1842 1153 398 324 --1336 --
NM_024953chr1242604 2405 2315 716 --1807 --
NM_024969chr23162 129 80 --1214 1343
NM_024989chr2188019 7881 7536 7066 6647 6397 5896 5843 5479 5329 3178 3138 3049 2116 1632 1296 1124 470 42985 1480 1013 733 --1865
NM_024993chr221511 1177 --1353 --
NM_024997chr1641253 317 269 100 11380 ----
NM_025047chr3158 --1369 --
NM_025054chr863580 3105 2635 1283 855 373 1216 ----
NM_025073chr1124727 4689 4184 3554 3447 3159 2895 1740 672 392 156 29 24748 4233 ----
NM_025083chr1551753 1544 1382 513 302 ----11424
NM_025107chr622292 2156 ------
NM_025113chr1341268 1142 487 80 --129 --
NM_025126chr123696 517 511 ------
NM_025134chr1621663 938 12368 ----
NM_025135chr18----1433 --
NM_025146chr33974 701 196 32735 1016 528 --1709
NM_025147chr21825 2785 419 ----
NM_025191chr173530 3414 3398 2931 2603 2196 1058 ------
NM_025203chr221156 231 1384 --11488
NM_025222chr332188 1854 652 22909 2029 --12082
NM_025237chr17--21584 1338 188 --
NM_030594chr1511239 ------
NM_030621chr1464123 3083 2982 2759 721 553 11175 1993 --
NM_030623chr221693 695 ------
NM_030625chr1052589 1727 683 570 463 161 21916 593 --
NM_030627chr563678 3286 3012 2954 2840 1222 33487 2814 358 ----
NM_030631chr144704 679 181 112 ------
NM_030640chr122905 891 ------
NM_030647chr745070 4669 4510 1033 24192 678 15860 --
NM_030648chr453886 3400 2006 1413 161 ------
NM_030665chr1741371 1356 1301 1210 --11464 --
NM_030667chr1231163 925 398 1452 161 --
NM_030668chr1231163 925 398 1452 161 --
NM_030669chr1231163 925 398 1452 161 --
NM_030670chr1262195 1957 1719 1430 658 392 11484 ----
NM_030671chr1262195 1957 1719 1430 658 392 11484 ----
NM_030674chr1285700 5583 5319 4990 2076 1316 846 209 --11678 --
NM_030751chr1031569 1183 359 21166 643 ----
NM_030751chr1031569 1183 359 21166 643 ----
NM_030755chr1431910 876 118 ------
NM_030763chrX2779 585 ------
NM_030771chr11161 ------
NM_030777chr2032067 1858 1796 ------
NM_030799chr522081 1893 11913 22218 118 --
NM_030803chr211282 ------
NM_030806chr157837 6867 2815 762 309 39421 3651 204 39162 5820 3616 11779
NM_030809chr121650 --1146 --
NM_030816chr122598 2304 13257 13074 --
NM_030817chr1283403 3055 2698 1480 1220 1038 850 128 --12335 --
NM_030881chr2242489 2123 1827 421 ------
NM_030885chr321921 825 --1724 --
NM_030915chr232240 286 97 ------
NM_030918chr1115411 5369 5113 4869 4840 4809 4130 1579 1175 309 74 11900 ----
NM_030922chr152670 226 ----135
NM_030940chr931410 415 80 ------
NM_030949chr611484 ------
NM_030954chr8--1346 ----
NM_030962chr1131029 566 418 --11003 --
NM_030964chr543238 2586 2293 897 23761 443 ----
NM_031157chr122514 172 --1584 --
NM_031216chr1851605 908 654 619 30 12110 1472 --
NM_031243chr772419 2401 843 592 479 274 230 --11711 --
NM_031268chr1685106 4893 4833 4627 4590 4155 1893 1206 14867 ----
NM_031296chr442450 2014 530 117 12745 ----
NM_031314chr1431497 711 115 11845 ----
NM_031362chr252486 2357 1054 221 127 22744 706 1494 --
NM_031365chr252622 2493 1190 357 263 32880 842 131 1630 --
NM_031366chr252622 2493 1190 357 263 32880 842 131 1630 --
NM_031371chr161472 1246 1073 444 203 118 11209 21238 40 --
NM_031371chr161472 1246 1073 444 203 118 11209 21238 40 --
NM_031372chr441655 1465 607 538 1620 --11508
NM_031407chrX142 ------
NM_031419chr321527 624 1528 ----
NM_031424chr201159 ------
NM_031431chr1331849 1468 1453 --11301 --
NM_031442chrX62993 2881 2440 1024 807 146 42579 2203 942 402 1449 --
NM_031445chr243239 3138 2828 1231 11348 11057 --
NM_031461chr811981 1729 1282 --
NM_031468chr797819 7732 7423 7174 5812 5201 5157 1149 204 16063 15331 --
NM_031471chr111391 ------
NM_031483chr2063423 3318 2731 1435 717 511 11034 23573 655 --
NM_031844chr111480 13903 161 1651
NM_031845chr213051 23547 136 23687 1128 --
NM_031847chr213051 23547 136 23687 1128 --
NM_031866chr101910 ------
NM_031890chr2292439 2414 2397 2362 2293 2236 2182 1925 373 --12917 --
NM_031953chr41355 1398 ----
NM_031954chr1222613 170 ------
NM_032013chr201595 31749 1499 1129 11660 11405
NM_032021chr1121042 70 1923 ----
NM_032041chr852723 2595 737 548 237 --22461 840 --
NM_032042chr542825 2773 2088 603 1826 199 1750
NM_032047chr31157 42337 2289 778 392 ----
NM_032052chr2241446 1333 1071 1011 11106 21250 313 --
NM_032088chr51687 ------
NM_032092chr51687 ------
NM_032102chr1173139 3064 2825 1178 998 980 717 --1297 --
NM_032105chr197845 6626 6174 5873 5239 2143 1327 1027 367 11764 27081 1208 --
NM_032116chr13125662 5293 5251 4802 4401 4393 3916 3769 1095 991 922 804 2513 436 15046 11832
NM_032119chr51280 ------
NM_032124chr184502 423 360 282 1771 ----
NM_032143chr21309 ------
NM_032145chr641813 1725 1485 158 21832 495 ----
NM_032153chr322561 1044 22344 1918 12645 --
NM_032156chr121243 ------
NM_032160chr1863375 3224 1535 1457 773 722 --1146 --
NM_032189chr1364206 1913 1482 757 332 28 24913 703 ----
NM_032199chr1072738 2533 1011 786 716 567 531 22807 521 13560 13485
NM_032208chr252906 2728 2694 2548 2221 23576 1160 ----
NM_032228chr1131330 1301 1144 23531 740 22605 810 12147
NM_032229chr131427 ------
NM_032231chr15134 ------
NM_032236chr14976 905 391 144 1765 ----
NM_032256chr122328 159 ------
NM_032291chr131593 1579 351 1208 ----
NM_032295chr751225 1130 174 64 48 ------
NM_032312chr21269 ------
NM_032320chr112805 768 ------
NM_032329chr294419 4189 3762 3695 3417 3068 2748 1738 381 ------
NM_032373chr1065848 5301 4712 1873 1750 856 45650 4218 1027 863 1318 --
NM_032375chr191130 ------
NM_032379chr111840 1306 1740 --
NM_032403chr51687 ------
NM_032410chr821154 447 --21189 911 --
NM_032420chr52794 360 ------
NM_032435chr141618 589 181 76 32293 904 166 ----
NM_032438chr631599 372 348 1481 --1469
NM_032439chr101572 ------
NM_032440chr1052913 2704 2577 2361 58 11844 ----
NM_032445chr1532600 486 167 32345 1641 432 ----
NM_032446chr543221 396 161 50 32867 469 221 1330 11178
NM_032457chr423728 559 22852 163 ----
NM_032471chr61293 --11111 --
NM_032505chr332795 2035 498 12264 1587 --
NM_032523chr22546 484 --1384 --
NM_032547chr41522 ------
NM_032557chr41693 ----155
NM_032558chr911368 ------
NM_032574chr21229 ------
NM_032580chr171230 ------
NM_032594chr1431100 814 228 --1789 --
NM_032622chr41235 ------
NM_032632chr143680 482 316 1501 11917 --
NM_032682chr353087 2812 2219 1353 84 12703 ----
NM_032717chr43205 121 81 199 ----
NM_032765chr53882 382 99 1625 ----
NM_032804chr1092229 2106 1802 1790 798 511 460 435 60 12431 1202 --
NM_032828chr1934368 3581 1143 ------
NM_032829chr1211171 ------
NM_032834chr1231102 925 231 ----11254
NM_032838chr191340 1370 ----
NM_032857chr151203 ------
NM_032858chr11132 ------
NM_032873chr1154165 3999 3315 3272 153 13652 11326 --
NM_032918chr121125 ------
NM_032943chr111840 1306 1740 --
NM_032961chr421272 378 --1393 --
NM_032967chrX5924 912 287 241 53 --1356 --
NM_032968chrX74224 3976 3966 3359 2976 612 340 ----11006
NM_032969chrX74224 3976 3966 3359 2976 612 340 ----11006
NM_032971chrY5951 939 314 268 80 --1383 --
NM_032972chrY5951 939 314 268 80 --1383 --
NM_032973chrY74216 3968 3958 3354 2971 612 340 ----11006
NM_032975chr1863531 3135 2994 2410 927 465 23522 378 --13209
NM_032980chr1863531 3135 2994 2410 927 465 23522 378 --13209
NM_033012chr131904 1402 ----
NM_033020chr194824 4660 4591 3279 2926 1928 556 311 26 21555 1461 --1287
NM_033030chr231065 506 190 1556 --11639
NM_033031chrX1207 ------
NM_033044chr141145 1062 1034 506 194 ----
NM_033055chr131035 852 104 ------
NM_033056chr101513 ------
NM_033089chr202464 458 11317 --11479
NM_033114chr122854 615 1261 ----
NM_033116chr141198 ------
NM_033119chr161816 3119 103 85 ----
NM_033121chr1241419 452 47 40 1615 ----
NM_033132chr1321678 536 11543 21904 773 --
NM_033143chr464601 4415 3797 924 841 223 ------
NM_033181chr643536 939 786 124 33900 3693 1118 --13789
NM_033211chr551886 1839 1607 640 137 ----1236
NM_033222chr941257 963 427 415 ------
NM_033224chr752963 2154 1923 709 439 --27817 874 11013
NM_033254chr3136 ------
NM_033281chr52742 200 ------
NM_033285chr894397 4157 3701 3115 3029 1799 1333 1243 986 13872 13105 --
NM_033305chr931429 1254 1156 --11126 --
NM_033326chr113997 352 124 21651 194 12524 --
NM_033331chr973074 2223 1023 779 609 514 235 12845 --11234
NM_033342chr51115 ------
NM_033360chr1273695 3240 2979 2951 2891 1174 653 ----1244
NM_033379chr10--158 ----
NM_033389chr17114822 3968 3727 3417 1868 1641 1493 1343 1011 287 117 21118 1063 --14629
NM_033402chr81186 1347 ----
NM_033407chr11540 1204 --1153
NM_033425chr1123235 567 1710 ----
NM_033430chr453253 3113 2995 606 259 23857 237 --13651
NM_033437chr453253 3113 2995 606 259 23857 237 --13651
NM_033480chr61171 11197 --12034
NM_033481chr61171 11197 --12034
NM_033505chr2136787 6717 6551 6447 5772 5333 5246 4606 4096 2197 2066 768 701 22141 1395 26611 4522 --
NM_033512chr822938 2515 12883 22767 216 --
NM_033547chr111154 ------
NM_033632chr441549 1118 616 515 11241 ----
NM_033637chr1054151 3309 3214 1285 792 ------
NM_033642chrX3829 364 54 21136 972 ----
NM_033644chr531587 679 287 22524 2367 1560 --
NM_033645chr531587 679 287 22524 2367 1560 --
NM_033656chr2165501 5063 4519 4022 3854 604 14160 --34061 151 66
NM_052832chr832837 2759 1076 --12302 22490 2155
NM_052851chr1322374 2115 12295 ----
NM_052879chr1253857 3812 985 692 71 24000 1402 ----
NM_052900chr831531 1327 503 11181 ----
NM_052905chr231713 1420 316 ------
NM_052907chr1264139 3687 2719 2711 1472 813 23404 298 ----
NM_052911chr182275 172 ----1780
NM_052917chr232688 1089 129 ------
NM_052918chr1063286 2877 2673 2494 1048 647 --13657 --
NM_052937chr872673 1946 1776 1091 910 782 474 31718 841 352 ----
NM_052950chr1342186 649 262 251 ----12126
NM_052996chr1621383 1373 ------
NM_053016chr996963 6022 5508 1896 1257 1027 860 769 464 11503 17910 --
NM_053024chr331399 1309 1250 11297 ----
NM_053042chr452222 1220 1166 1071 91 ----12771
NM_053043chr7106343 5442 5345 5127 1787 1742 614 296 125 31 12154 43922 1589 938 520 --
NM_053064chr1412679 12925 ----
NM_054012chr9168 ------
NM_057175chr442080 1920 749 398 ----1310
NM_057749chr821366 1348 31225 911 196 ----
NM_058237chr142714 350 1760 ----
NM_058241chr262158 1727 1667 456 376 97 32245 879 51 ----
NM_058241chr262158 1727 1667 456 376 97 32245 879 51 ----
NM_078469chr10------1407
NM_079420chr2127 ------
NM_079422chr2127 ------
NM_080392chr1181 ------
NM_080629chr1--1407 --11174
NM_080630chr1--1407 --11174
NM_080645chr622148 1494 ------
NM_080647chr221311 ------
NM_080651chr82246 44 ------
NM_080676chr2043257 2464 2279 1288 ------
NM_080717chr12--1415 ----
NM_080742chr6193 ------
NM_080743chr672561 2488 2445 2344 2142 419 390 ------
NM_080867chr1484600 4101 3592 1696 1527 1086 896 167 1935 ----
NM_080872chr854018 3806 3068 962 404 ------
NM_080927chr343290 2716 507 382 11123 23097 2044 12581
NM_130391chr942657 2646 1182 1112 1666 ----
NM_130392chr942657 2646 1182 1112 1666 ----
NM_130393chr942657 2646 1182 1112 1666 ----
NM_130439chr1042289 2054 1805 913 1680 11461 11564
NM_130439chr1042289 2054 1805 913 1680 11461 11564
NM_130782chr121064 284 ------
NM_130838chr1541604 751 566 125 11741 11459 --
NM_130839chr1541604 751 566 125 11741 11459 --
NM_130847chr1185791 5657 5328 3879 2308 1557 1002 902 --14382 --
NM_130902chr4131 ------
NM_133170chr2098071 7980 7182 7109 5888 5465 2640 2425 1513 ------
NM_133171chr2011242 ------
NM_133264chr1732586 2566 1475 22717 332 12939 --
NM_133265chrX53582 3115 3072 427 241 --12931 1269
NM_133329chr231644 759 474 --11197 --
NM_133330chr432896 554 525 12308 12941 --
NM_133331chr432896 554 525 12308 12941 --
NM_133334chr4156407 6202 6123 5810 5383 4996 4324 4265 2299 2219 2212 1184 883 442 285 25203 5135 15271 --
NM_133335chr432896 554 525 12308 12941 --
NM_133370chr463366 3311 2433 746 648 459 --125 --
NM_133372chr562875 2336 2248 2177 1098 802 --12829 --
NM_133378chr25969 874 365 291 166 1957 ----
NM_133432chr25969 874 365 291 166 1957 ----
NM_133433chr53737 242 176 ------
NM_133437chr25969 874 365 291 166 1957 ----
NM_133445chr923795 3487 21393 361 33712 2304 625 --
NM_133468chr742017 1638 812 222 ----2982 560
NM_133477chr433238 2632 1138 22482 1240 ----
NM_133478chr21549 12402 ----
NM_133486chrX1400 ------
NM_133493chr624529 4506 14614 158 --
NM_133496chr151400 1204 1121 553 517 ------
NM_133507chr12--1735 ----
NM_133647chr1553741 2962 852 716 650 13059 ----
NM_134428chr91326 --190 1334
NM_134442chr221362 1214 11385 ----
NM_138270chrX62690 2584 1344 1178 1146 242 11330 12489 129
NM_138288chr1441971 890 839 379 --1278 --
NM_138290chr72296 92 ------
NM_138316chr1031256 940 442 ------
NM_138333chr932404 1640 926 11804 ----
NM_138340chr18178 ----1198
NM_138391chr15906 737 400 300 84 ------
NM_138423chr1542214 2134 1778 762 11601 --11573
NM_138426chr772399 2373 1858 893 856 798 786 ------
NM_138444chr1384904 4419 3988 3069 1848 1205 894 369 ------
NM_138455chr82264 146 ------
NM_138459chr633231 2283 370 12437 ----
NM_138468chr265942 4732 2068 370 199 80 --35659 5627 5132 --
NM_138473chr1244943 4872 3964 719 13459 ----
NM_138485chr3189 ------
NM_138494chr742055 1127 988 663 1687 ----
NM_138554chr942452 2142 813 315 --12558 --
NM_138609chr52207 155 ------
NM_138610chr52207 155 ------
NM_138621chr244011 2832 2790 2760 ------
NM_138638chr1422430 789 2638 194 1183 --
NM_138639chr191135 ------
NM_138689chr11--1187 ----
NM_138711chr31144 ------
NM_138712chr31144 ------
NM_138713chr16137701 7364 7190 7170 6429 5195 3084 2408 1569 1058 485 454 401 66660 3278 3143 2919 2418 269 15234 25755 2846
NM_138714chr16137701 7364 7190 7170 6429 5195 3084 2408 1569 1058 485 454 401 66660 3278 3143 2919 2418 269 15234 25755 2846
NM_138731chr1463760 2900 2724 1120 837 653 13601 --1677
NM_138771chr731513 1405 1332 1430 ----
NM_138782chr532316 1972 1616 ----12298
NM_138819chrX1463 1381 ----
NM_138927chr211342 --1390 --
NM_138959chr1115130 4902 4716 4151 2219 2038 2015 1934 911 795 176 ------
NM_138966chr182421 46 ------
NM_138992chr212919 52 --11009 --
NM_139035chrX3638 519 491 ------
NM_139045chr91318 ------
NM_139057chr1512743 21898 175 ----
NM_139076chr4166 ------
NM_139135chr13482 394 307 --166 --
NM_139168chr571896 1732 1426 649 564 525 395 ------
NM_139201chr121717 ------
NM_139207chr1251806 1684 1596 1494 461 31634 530 302 ----
NM_139239chr19----1247 --
NM_139276chr1722107 344 ------
NM_139283chr1222500 1598 1824 --22272 295
NM_139316chr7----11002 --
NM_139319chr1231863 1295 1151 --1572 --
NM_139321chr2074075 3221 1371 436 335 324 89 ------
NM_144498chr2062200 2157 1851 1756 801 161 ------
NM_144563chr22821 648 1169 ----
NM_144563chr22821 648 1169 ----
NM_144567chr12498 44 12257 ----
NM_144571chr486386 6301 5746 5718 2315 1446 1289 1199 25440 5068 21633 1020 --
NM_144574chr141548 ------
NM_144578chr1495476 4422 4156 3790 3568 1978 1823 1343 1319 1337 23551 1068 --
NM_144582chr272580 2556 944 741 487 420 192 --21690 613 --
NM_144590chr1043034 534 500 169 ------
NM_144591chr102453 393 ------
NM_144599chr1555224 4623 3467 1130 513 --1399 --
NM_144600chr1621192 207 ------
NM_144609chr1751009 433 210 169 117 ------
NM_144632chr231755 1667 759 ------
NM_144633chr31400 ----1373
NM_144643chr41125 1404 ----
NM_144644chr41184 ------
NM_144660chr101394 ------
NM_144664chr1132503 914 871 --22551 1635 --
NM_144778chr1342178 2041 1093 1024 158 ----
NM_144949chr262364 2219 2112 911 780 263 2589 147 ----
NM_144963chr81842 ----1288
NM_144967chrX1975 ----11046
NM_144973chr1255174 4815 4638 1006 547 35190 4210 440 ----
NM_144979chr4172 1653 ----
NM_144982chr121793 --1611 --
NM_145005chr92131 90 --21073 104 --
NM_145010chr1041632 1584 478 96 129 ----
NM_145012chr102970 685 ------
NM_145025chr621124 141 ------
NM_145044chr351684 1602 1472 386 362 --11811 --
NM_145049chr531055 975 891 ------
NM_145055chr18113584 3349 3312 3304 3278 2856 2575 2549 957 100 31 11361 ----
NM_145117chr1163291 2973 2907 2329 755 241 ------
NM_145176chr632891 2794 1095 22292 764 ----
NM_145206chr1022747 658 13353 11059 --
NM_145251chr14--11646 21164 377 --
NM_145259chr297056 6599 6084 5501 5281 4399 2781 1668 584 15140 35950 4745 2270 15264
NM_145263chr442131 786 421 237 ------
NM_145274chr171312 --1620 --
NM_145284chrX52468 1023 773 618 36 12041 12241 12332
NM_145305chrX--11321 11221 --
NM_145307chr1094700 1828 1780 1759 1721 644 511 338 247 13492 ----
NM_145331chr65726 661 270 188 148 --1853 --
NM_145332chr64874 809 336 296 --11001 --
NM_145333chr64874 809 336 296 --11001 --
NM_145686chr263396 2647 1304 1243 973 238 12972 ----
NM_145687chr263396 2647 1304 1243 973 238 12972 ----
NM_145698chr102853 64 ------
NM_145728chr1562415 2184 1813 977 944 813 12353 1499 --
NM_145735chr1372776 2370 2031 861 515 300 73 ------
NM_145739chr22546 484 --1384 --
NM_145753chr341596 1455 594 279 ------
NM_145805chr15--2571 116 ----
NM_145808chr752813 1028 902 338 169 ----12578
NM_145909chr641419 242 236 70 1339 1352 --
NM_145913chr122701 310 ------
NM_147147chr673962 3579 2682 2636 1534 279 202 --11288 --
NM_147171chr71123 ------
NM_147185chr71123 ------
NM_147189chr842308 2184 1887 259 ------
NM_148174chr841913 1796 1766 569 --22001 643 --
NM_148674chr224438 414 147 33 ----1404
NM_148955chr1546249 5844 1683 877 46478 5233 2072 1621 15855 --
NM_148977chr1031256 940 442 ------
NM_148978chr1031256 940 442 ------
NM_152261chr123771 643 87 --22145 1933 --
NM_152271chr821094 61 ------
NM_152277chr552078 1894 1676 1463 312 ------
NM_152282chr34867 480 464 121 ------
NM_152298chr12271 99 1709 ----
NM_152323chr121153 ------
NM_152330chr1472398 2326 2224 1847 918 504 38 12437 21961 1072 --
NM_152342chr161475 ------
NM_152387chr21212 ------
NM_152388chr272930 2749 2716 1441 1171 946 166 --11015 --
NM_152390chr23638 532 217 ------
NM_152408chr5--188 ----
NM_152409chr573120 2727 2254 1346 1130 449 41 --23037 296 --
NM_152412chr811448 11494 173 --
NM_152424chrX94585 4115 3551 3520 3480 1784 1746 1615 1314 14386 ----
NM_152429chr1041520 1453 1243 395 ------
NM_152433chr1151741 1278 1163 1154 307 21695 397 11503 --
NM_152437chr1222360 116 12429 ----
NM_152447chr142319 97 ------
NM_152450chr1541834 1606 1436 800 --2333 95 --
NM_152455chr1552544 2155 2092 131 46 ------
NM_152522chr23167 103 23 1874 146 --
NM_152556chr721860 1604 1227 22027 1728 --
NM_152564chr811736 21788 1550 ----
NM_152574chr92338 153 ------
NM_152594chr1522021 1901 ----11983
NM_152608chr162315 1904 1820 1768 825 150 ------
NM_152613chr221932 ------
NM_152622chr532932 2543 839 23270 1330 13139 --
NM_152624chr5157135 7089 6217 5953 5200 5047 4824 2946 2669 2126 2078 1857 1685 1665 265 11773 17432 --
NM_152629chr983864 3763 3261 2748 1143 886 291 234 12939 1862 --
NM_152641chr1252837 2719 2396 1781 235 22632 59 11804 --
NM_152665chr12326 51 1511 ----
NM_152676chr18122 ------
NM_152678chr331047 573 141 ------
NM_152682chr431531 1339 223 ----11153
NM_152688chr62282 169 1919 ----
NM_152699chr363667 3260 2653 1147 845 179 1124 12601 --
NM_152707chr102911 321 21047 339 ----
NM_152721chr181689 ----1727
NM_152723chr1141051 800 438 147 ------
NM_152727chr16--1281 ----
NM_152733chr686367 5328 5316 4792 4778 4599 1487 843 ------
NM_152737chr6--12131 11407 --
NM_152739chr751111 955 848 381 368 ------
NM_152744chr732462 1216 955 1858 ----
NM_152754chr711396 13826 13872 --
NM_152756chr531676 1624 121 54359 3929 3506 2687 857 ----
NM_152765chr832366 1919 418 --12014 --
NM_152773chr3--165 ----
NM_152787chrX42437 1404 1168 1065 23377 307 ----
NM_152793chr795072 3821 3783 3766 3513 3177 1771 1461 755 11177 1662 --
NM_152826chr1546249 5844 1683 877 46478 5233 2072 1621 15855 --
NM_152835chr142921 2910 2430 1082 12748 ----
NM_152836chr821768 1208 11224 21429 1388 --
NM_152837chr821768 1208 11224 21429 1388 --
NM_152838chr2083545 3394 3114 2434 2354 2262 811 616 --3150 100 64 --
NM_152854chr202657 555 ------
NM_152857chr63856 819 776 ------
NM_152858chr63856 819 776 ------
NM_152879chr262232 2114 1864 630 570 365 ------
NM_152905chr122151 77 ------
NM_152924chr15126838 6190 6140 4827 4663 2531 2525 2385 1708 1493 928 751 1219 ----
NM_152989chr1211331 1115 1329 1103
NM_152996chr131327 447 333 --12092 --
NM_152999chr734481 3853 3180 --14154 --
NM_153013chr532010 374 95 32400 2259 684 ----
NM_153020chr63466 365 29 ------
NM_153050chr22144943 4589 4384 4037 3979 3861 3378 3157 1756 1131 784 736 150 39 12015 ----
NM_153051chr22144943 4589 4384 4037 3979 3861 3378 3157 1756 1131 784 736 150 39 12015 ----
NM_153181chr182421 46 ------
NM_153184chr31156 11548 11872 --
NM_153186chr93701 238 52 ------
NM_153188chr534735 3804 2068 ------
NM_153201chr11128 ------
NM_153207chr1253335 3167 2833 2537 1426 44056 1299 1235 662 ----
NM_153353chr32129 43 ------
NM_153354chr52619 371 1206 --1199
NM_153371chr1341892 806 467 137 12267 ----
NM_153426chr41636 ------
NM_153427chr41636 ------
NM_153456chr1376348 6237 3893 1223 1187 508 104 32346 1808 799 22497 502 14756
NM_153464chr191789 ------
NM_153605chr321505 634 ------
NM_153607chr573171 2794 2085 2076 1124 392 123 --1898 --
NM_153616chr1542316 2257 1881 1778 --11652 --
NM_153617chr1542316 2257 1881 1778 --11652 --
NM_153618chr1542316 2257 1881 1778 --11652 --
NM_153619chr1563554 3495 3119 3016 2247 503 --12890 --
NM_153620chr71671 11281 ----
NM_153634chr1281488 1366 1232 579 512 422 295 206 ------
NM_153645chr2243234 3206 2476 393 12080 12684 --
NM_153686chr432078 1790 617 ------
NM_153689chr252285 800 687 445 291 22072 317 ----
NM_153700chr15128 ------
NM_153809chr91578 ------
NM_153810chr10134521 4415 4389 4283 4105 4091 3922 3838 3334 3096 1209 115 61 23799 1526 ----
NM_153828chr22760 147 1841 ----
NM_153836chr25496 472 448 321 310 --12105 --
NM_170606chr751583 1575 1440 1407 321 1727 ----
NM_170665chr12104533 3739 3549 3445 3283 777 684 613 509 56 ------
NM_170675chr1531077 883 428 11029 1390 --
NM_170676chr1531077 883 428 11029 1390 --
NM_170679chr511074 175 138 --
NM_170692chr12369 316 ------
NM_170750chrX2363 346 --1355 --
NM_170775chr5----1220 --
NM_171998chrX42426 1571 339 222 ------
NM_172071chr197431 6960 6571 6561 5972 5705 5158 2079 1847 21511 574 11284 --
NM_172103chr631926 950 450 ------
NM_172105chr631926 950 450 ------
NM_172127chr46747 720 644 378 263 217 21514 432 ----
NM_172128chr46703 676 600 334 219 173 21470 388 ----
NM_172164chr12271 99 1709 ----
NM_172169chr10----1245 --
NM_172170chr10----1245 --
NM_172171chr10----1245 --
NM_172173chr10----1245 --
NM_172337chr142852 372 ------
NM_172344chr231644 759 474 --11197 --
NM_172373chr132165 30 1113 ----
NM_172387chr1851661 1424 1301 1059 549 11217 11112 --
NM_172388chr1851708 1471 1348 1106 596 11264 11159 --
NM_172389chr1851708 1471 1348 1106 596 11264 11159 --
NM_173054chr71391 --1858 --
NM_173074chr23341 304 270 ------
NM_173082chr621567 1262 21159 479 ----
NM_173083chr12143 38 11271 ----
NM_173172chr23486 178 106 --11328 --
NM_173198chr94870 818 728 336 22860 2493 1589 11957
NM_173200chr94870 818 728 336 22860 2493 1589 11957
NM_173214chr16137701 7364 7190 7170 6429 5195 3084 2408 1569 1058 485 454 401 66660 3278 3143 2919 2418 269 15234 25755 2846
NM_173359chr33528 324 177 ------
NM_173468chr445414 5246 4650 26 15082 33813 1126 91 --
NM_173469chr1531431 561 380 1526 ----
NM_173470chrX32943 1012 269 1154 12753 --
NM_173475chr162479 444 1553 11262 1388
NM_173478chr17--1870 ----
NM_173495chrX52594 2028 1992 978 426 12259 ----
NM_173510chr2252356 2103 1934 652 431 12896 ----
NM_173511chr263181 2824 1026 748 538 91 23899 2954 2565 22 --
NM_173536chr475094 4889 3797 2002 1346 1005 358 24833 1513 11416 1422
NM_173550chr9152 ------
NM_173552chr3--32428 560 282 ----
NM_173557chr182266 196 ------
NM_173560chr62408 120 ------
NM_173567chr1299 62 ------
NM_173576chr1041660 1615 694 500 ------
NM_173582chr1175069 2421 2260 2103 2095 2078 1581 25981 2049 14370 1463
NM_173591chr124974 958 218 95 4983 856 787 243 ----
NM_173602chr1243623 732 709 528 --13171 --
NM_173607chr1431993 532 198 ------
NM_173609chr152681 110 1673 ----
NM_173642chr1107975 7963 7573 7416 6429 3653 3326 2399 2155 289 11522 49188 7565 6750 3597 --
NM_173644chr2051981 1886 1843 1302 750 11754 11954 --
NM_173645chr2--1140 ----
NM_173653chr321271 591 ------
NM_173665chr5--1200 ----
NM_173667chr552328 2164 2111 1664 275 1544 ----
NM_173672chr65962 777 632 179 55 ------
NM_173683chr821736 1647 --11277 --
NM_173797chr521375 914 ------
NM_173803chr16----1386 --
NM_173808chr163905 3673 3457 756 571 330 23386 1491 ----
NM_173822chr241961 1613 719 688 21538 102 ----
NM_173825chr333038 1038 405 --12872 --
NM_173830chr62735 246 ------
NM_173848chr85919 838 721 597 353 ------
NM_173851chr873243 3135 2816 1562 1104 655 271 12450 --13192
NM_174900chr4169 ------
NM_174911chr8102974 2965 2579 1462 1397 956 918 838 158 38 ------
NM_174921chr43442 127 91 ------
NM_175056chr362214 2150 1869 1860 1820 771 --1309 --
NM_175061chr72376 306 ------
NM_175854chr1331968 983 621 2554 149 --1207
NM_175856chr52553 51 2102 82 ----
NM_175866chr11421 ------
NM_176081chr1065038 4426 4281 3756 1140 599 25663 205 --15737
NM_176083chr1065038 4426 4281 3756 1140 599 25663 205 --15737
NM_176812chr203705 227 35 ----1648
NM_176823chr133746 850 446 --13577 --
NM_176824chr431267 1143 411 --1264 --
NM_177422chr11253 --1163 --
NM_177438chr1464123 3083 2982 2759 721 553 11175 1993 --
NM_177538chr258285 6963 6925 3441 1371 23411 27 17651 --
NM_177559chr201378 ------
NM_177560chr201378 ------
NM_177966chr331584 1300 154 11803 ----
NM_177968chr231526 1360 743 ----1515
NM_177974chr1542214 2134 1778 762 11601 --11573
NM_177990chr2011794 ------
NM_177996chr2032819 1029 395 ------
NM_178006chr1322374 2115 12295 ----
NM_178007chr1322374 2115 12295 ----
NM_178010chr1211331 1115 1329 1103
NM_178011chr1062663 1289 876 714 617 170 1828 1474 13084
NM_178033chr1--1537 ----
NM_178120chr231204 1147 1110 21139 1124 ----
NM_178151chrX107306 6424 6363 6219 6211 4758 2904 1588 794 557 --1357 --
NM_178152chrX107306 6424 6363 6219 6211 4758 2904 1588 794 557 --1357 --
NM_178153chrX107306 6424 6363 6219 6211 4758 2904 1588 794 557 --1357 --
NM_178313chr231889 1440 866 ------
NM_178424chr51661 ------
NM_178426chr14910 440 318 146 --31912 899 244 --
NM_178427chr14810 340 218 46 --31812 799 144 --
NM_178544chr192394 243 11637 ----
NM_178558chr72936 208 ----184
NM_178566chr941843 1419 731 716 ------
NM_178586chr1431963 1827 825 --22238 2181 1454
NM_178815chr1022103 580 --22686 634 --
NM_181054chr1431284 1022 65 ------
NM_181077chr1572338 1553 1408 859 544 497 324 ------
NM_181291chr142644 511 ------
NM_181302chr141548 ------
NM_181308chr141548 ------
NM_181358chr121548 186 23047 612 1302 --
NM_181361chr34390 196 147 46 ------
NM_181427chr15145 ------
NM_181443chr2032471 1086 900 22263 1832 12098 --
NM_181481chr18127008 6498 6447 5938 5892 5780 5679 1099 1067 776 662 620 36595 5901 1566 11905 --
NM_181482chr18127008 6498 6447 5938 5892 5780 5679 1099 1067 776 662 620 36595 5901 1566 11905 --
NM_181483chr18127008 6498 6447 5938 5892 5780 5679 1099 1067 776 662 620 36595 5901 1566 11905 --
NM_181486chr12--1415 ----
NM_181504chr553210 3049 2901 903 182 14011 11089 11046
NM_181523chr553210 3049 2901 903 182 14011 11089 11046
NM_181524chr553210 3049 2901 903 182 14011 11089 11046
NM_181527chr201159 1373 ----
NM_181659chr2043155 2162 1078 79 23178 2835 ----
NM_181659chr2043155 2162 1078 79 23178 2835 ----
NM_181672chrX41990 1808 1465 310 11562 ----
NM_181673chrX41990 1808 1465 310 11562 ----
NM_181689chr201826 --1789 --
NM_181713chr21276 ------
NM_181714chr631947 1271 381 11992 ----
NM_181723chr872275 2139 1478 680 642 566 426 32111 2044 893 ----
NM_181780chr332099 1910 436 11581 11632 --
NM_181782chr6----1657 --
NM_181787chr853685 3679 3394 1480 586 23442 131 ----
NM_181794chr61293 --11111 --
NM_181795chr61293 --11111 --
NM_181836chr522586 460 31980 903 408 ----
NM_181838chr511260 ----11129
NM_181846chr1962996 1905 840 663 262 147 12071 ----
NM_181861chr1252857 1966 377 266 101 32265 2099 367 --12331
NM_181868chr1252857 1966 377 266 101 32265 2099 367 --12331
NM_181869chr1262942 2051 462 351 186 42 32350 2184 452 --12416
NM_181872chr9--1214 ----
NM_181886chr461298 1271 919 901 885 59 1451 ----
NM_181887chr461298 1271 919 901 885 59 1451 ----
NM_181888chr461298 1271 919 901 885 59 1451 ----
NM_181889chr461298 1271 919 901 885 59 1451 ----
NM_181890chr461298 1271 919 901 885 59 1451 ----
NM_181891chr461298 1271 919 901 885 59 1451 ----
NM_181892chr461345 1318 966 948 932 106 1498 ----
NM_181893chr461298 1271 919 901 885 59 1451 ----
NM_182485chr493740 3436 3127 2949 2737 2665 1449 1434 456 13623 ----
NM_182503chr651895 1804 467 100 68 23585 695 ----
NM_182511chr182301 276 11274 1116 --
NM_182515chr1964233 4217 4140 2484 2270 551 46235 6145 6027 5825 14403 --
NM_182540chrX2202 64 1782 ----
NM_182551chr233107 2612 1154 43333 2637 1367 379 ----
NM_182580chr152256 2036 1702 472 148 ------
NM_182641chr1741495 621 402 388 ------
NM_182643chr852338 2230 1612 698 216 ------
NM_182646chr493740 3436 3127 2949 2737 2665 1449 1434 456 13623 ----
NM_182648chr14143 ------
NM_182691chr741408 1371 256 138 ------
NM_182692chr741408 1371 256 138 ------
NM_182710chr112412 312 ------
NM_182734chr2083060 2811 2467 2334 989 937 891 685 ------
NM_182762chr7126097 5656 5549 5127 5099 4762 4649 3828 2244 1492 922 385 13811 ----
NM_182765chr102679 359 22092 604 ----
NM_182796chr53853 359 317 ------
NM_182797chr2031368 702 94 1586 ----
NM_182848chr1331427 135 51 --1640 --
NM_182898chr735628 1177 1104 16469 26499 5120 --
NM_182899chr735628 1177 1104 16469 26499 5120 --
NM_182943chr321170 163 ------
NM_182948chr162967 2649 838 633 516 412 ------
NM_182964chr1163291 2973 2907 2329 755 241 ------
NM_182972chr171015 955 896 699 644 277 122 11764 ----
NM_182976chr12706 228 1294 ----
NM_183043chr1331055 58 27 ------
NM_183044chr1331055 58 27 ------
NM_183078chr662953 2873 615 579 490 224 23307 2351 --11372
NM_183376chr1562227 2096 1976 1930 961 727 22324 1773 ----
NM_183393chr33874 840 242 ------
NM_183394chr33874 840 242 ------
NM_183398chr521340 1293 --134 --
NM_183399chr521340 1293 --134 --
NM_183400chr521340 1293 --134 --
NM_183401chr521340 1293 --134 --
NM_183416chr121904 1377 1133 ----
NM_183419chr81582 11171 ----
NM_194247chr233904 1465 193 31522 1341 491 13627 14307
NM_194259chr164549 531 442 383 ----1223
NM_194260chr164549 531 442 383 ----1223
NM_194261chr164549 531 442 383 ----1223
NM_194271chr123696 517 511 ------
NM_194278chr1444098 3758 190 137 ----13962
NM_194283chr554193 3876 2963 636 29 1960 ----
NM_194285chr1183366 3059 2415 2328 1304 317 238 143 1713 --12274
NM_194291chr872851 2349 2298 2004 800 210 186 1471 ----
NM_194292chr121655 197 1115 ----
NM_194301chr142728 188 1910 ----
NM_194314chr175331 5098 4719 4015 3960 1032 437 55150 4551 1845 978 685 ----
NM_194328chr953070 3016 1168 856 621 11298 1424 1189
NM_194329chr953070 3016 1168 856 621 11298 1424 1189
NM_194330chr953070 3016 1168 856 621 11298 1424 1189
NM_194332chr953070 3016 1168 856 621 11298 1424 1189
NM_194434chr18135668 5508 5397 4321 3530 2303 2171 2061 894 313 276 182 23 45426 4540 597 369 ----
NM_194442chr141517 1302 684 388 ------
NM_194454chr721452 1214 11571 ----
NM_194455chr721452 1214 11571 ----
NM_194456chr721452 1214 11571 ----
NM_197970chr231065 506 190 1556 --11639
NM_198047chr21588 ------
NM_198074chr151145 1133 282 241 100 ------
NM_198120chr81521 ------
NM_198123chr831531 1327 503 11181 ----
NM_198124chr831531 1327 503 11181 ----
NM_198158chr362966 2917 2349 1139 948 913 1701 ----
NM_198159chr362966 2917 2349 1139 948 913 1701 ----
NM_198177chr362966 2917 2349 1139 948 913 1701 ----
NM_198178chr362966 2917 2349 1139 948 913 1701 ----
NM_198196chr342423 2343 2032 773 --12500 --
NM_198212chr762157 843 720 540 57 37 ------
NM_198215chr1051437 1231 953 557 126 --1355 --
NM_198225chr1022033 1852 --11451 --
NM_198240chr1221358 1039 ------
NM_198268chr121548 186 23047 612 1302 --
NM_198269chr121548 186 23047 612 1302 --
NM_198273chr512325 43089 2989 1951 853 ----
NM_198281chr443436 2521 2496 2214 3642 428 143 13097 --
NM_198395chr53836 795 461 ------
NM_198399chr321753 1543 --11849 --
NM_198400chr1542058 1971 1119 623 ------
NM_198404chr132697 302 ------
NM_198439chr1151741 1278 1163 1154 307 21695 397 11503 --
NM_198465chrX52980 2950 2610 2074 713 ------
NM_198468chr673771 3417 3360 3310 892 484 55 --21587 928 --
NM_198485chr342449 2075 1663 725 21628 252 31936 1730 841 --
NM_198503chr141780 856 424 264 11848 ----
NM_198513chr812047 --11359 11654
NM_198521chr12--1107 ----
NM_198569chr632638 2562 1645 --1527 --
NM_198581chr267499 6005 2517 1903 198 58 25955 2392 17145 --
NM_198584chr841964 706 537 36 ----12663
NM_198793chr373870 3639 3238 2769 1609 1065 90 13050 --1150
NM_198829chr71342 ------
NM_198859chr3114221 4135 3457 1794 1581 1494 1287 989 908 302 67 1667 35081 1921 1433 --
NM_198896chr1142076 2062 1589 852 11934 ----
NM_198935chr2053231 2715 2605 2121 699 --13084 --
NM_198968chr1384013 3838 3824 2873 2820 1134 1128 992 ------
NM_198992chr122993 149 ------
NM_199000chr7--12145 ----
NM_199039chr42860 224 11082 ----
NM_199072chr741031 897 874 654 22360 112 ----
NM_199129chr201427 ------
NM_199144chr2031339 1065 608 ------
NM_199188chr1253857 3812 985 692 71 24000 1402 ----
NM_199189chr51734 ------
NM_199190chr1253857 3812 985 692 71 24000 1402 ----
NM_199203chr2031339 1065 608 ------
NM_199320chr42442 217 ----2918 721
NM_199320chr42442 217 ----2918 721
NM_199324chr463193 2866 2748 1055 521 235 22454 2441 1737 --
NM_199342chr11289 ------
NM_199355chr1631210 1182 437 1262 1684 --
NM_199421chr1484600 4101 3592 1696 1527 1086 896 167 1935 ----
NM_199436chr252592 2469 2152 606 438 ----1810
NM_199454chr194731 4355 3588 3087 2989 1903 1723 535 227 14197 ----
NM_199461chr1062866 1160 1015 797 474 292 ------
NM_199482chr242092 1739 1559 1389 ------
NM_201413chr211797 ------
NM_201414chr211797 ------
NM_201437chr831211 1156 937 --11038 --
NM_201439chr12163 ------
NM_201440chr12163 ------
NM_201515chr12163 ------
NM_201591chr41741 ------
NM_201592chr41741 ------
NM_201599chrX61265 1233 1168 1150 1100 890 ------
NM_203301chr1441521 1226 641 256 ------
NM_203327chr2074585 4469 4116 3751 1827 1093 780 --24284 536 --
NM_203349chr1572041 1998 1926 1633 702 627 610 ------
NM_203351chr1732142 772 97 ----11583
NM_203372chr241515 1217 486 231 ------
NM_203391chrX31746 1575 1569 11234 11561 --
NM_203403chr941248 1109 440 146 1918 ----
NM_203406chr531811 664 167 52740 1829 1140 499 155 ----
NM_203417chr2131092 258 188 11201 11404 --
NM_203418chr2131092 258 188 11201 11404 --
NM_203434chr921241 1015 --11250 --
NM_203454chr12887 422 1458 ----
NM_203458chr193689 3658 3017 2983 2832 2338 1250 750 119 23399 1416 13641 --
NM_203459chr132483 1611 754 --22438 795 12420
NM_203500chr19152 ------
NM_203504chr442564 2177 1752 350 22393 193 12311 --
NM_203505chr442564 2177 1752 350 22393 193 12311 --
NM_205860chr12861 836 ----12856
NM_206594chr163280 3131 2756 2483 2458 838 13575 13177 --
NM_206595chr163280 3131 2756 2483 2458 838 13575 13177 --
NM_206839chr152628 510 ------
NM_206853chr683841 3532 3300 2638 1372 810 513 241 23562 688 ----
NM_206854chr6135102 4793 4561 3899 3752 3514 2071 1774 1502 661 434 156 68 34823 1949 36 13328 --
NM_206855chr6166067 5758 5526 4864 4717 4479 4176 3934 2467 1626 1399 1121 1033 688 603 364 35788 4218 1001 14293 --
NM_206876chr263169 3076 3014 2387 1398 1145 --1594 --
NM_206907chr543273 2340 2283 1217 22625 2398 ----
NM_206909chr858265 8159 6252 5168 162 68060 7536 6111 3315 822 336 ----
NM_206927chr111840 1306 1740 --
NM_206928chr111840 1306 1740 --
NM_206929chr111840 1306 1740 --
NM_206930chr111840 1306 1740 --
NM_206933chr152603 1793 888 404 100 --1137 --
NM_207121chr201159 ------
NM_207123chr42304 220 ------
NM_207171chr1--1455 12078 --
NM_207292chr362914 2246 715 677 547 195 --13015 --
NM_207293chr362914 2246 715 677 547 195 --13015 --
NM_207294chr362914 2246 715 677 547 195 --13015 --
NM_207295chr362914 2246 715 677 547 195 --13015 --
NM_207296chr362914 2246 715 677 547 195 --13015 --
NM_207297chr362939 2271 740 702 572 220 --13040 --
NM_207303chr1094112 3596 2953 1477 1019 319 274 62 35 14168 ----
NM_207304chr1342065 1928 980 911 ------
NM_207325chr1911912 ------
NM_207337chr122357 311 ------
NM_207361chr1375238 1757 471 399 356 130 102 24232 929 --12045
NM_207406chr4126253 6211 6047 5945 5869 4979 4418 2545 2387 2349 2228 592 22236 679 --15264
NM_207422chrX31401 1220 249 ------
NM_207481chr221335 1000 --11187 --
NM_207491chr441423 1270 1112 463 --21468 381 --
NM_207517chr1531945 1902 545 1147 11691 --
NM_207520chr22760 147 1841 ----
NM_207521chr22760 147 1841 ----
NM_207647chr952054 1922 1596 1032 570 ------
NM_207660chr1441615 1337 1317 283 11065 11486 --
NM_207661chr1441615 1337 1317 283 11065 11486 --
NM_207662chr1441615 1337 1317 283 11065 11486 --
NM_212474chr22805 668 ------
NM_212475chr22805 668 ------
NM_212476chr22805 668 ------
NM_212478chr22805 668 ------
NM_212482chr22805 668 ------
NM_212543chr31110 ------
NM_212558chr953819 3589 2813 1486 1044 33359 2910 96 12843 --
NM_212559chrX--1735 ----
NM_213589chr275349 5125 5024 1888 1819 836 714 35032 1944 1596 24708 3862 --
NM_213606chr1032686 2489 123 ----1527
NM_213611chr122295 157 ------
NM_213651chr111655 1671 ----
NM_213654chr331461 1270 349 11132 133 --