TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-132-5p
miRNA Sequence: ACCGUGGCUUUCGAUUGUUACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000055chr31329 ------
NM_000075chr12------122
NM_000081chr131399 1211 420 11497 ----
NM_000084chrX66518 6254 5099 1690 1662 1640 149 ----
NM_000176chr533229 3077 3064 13176 ----
NM_000217chr1221350 88 ------
NM_000240chrX190 ------
NM_000259chr1524225 2511 ------
NM_000266chrX----1867 --
NM_000267chr171136 ------
NM_000310chr111181 1218 ----
NM_000334chr1741831 1707 682 186 11430 ----
NM_000337chr535897 2090 242 --14896 --
NM_000362chr2222828 245 --12854 --
NM_000368chr924448 4196 11493 11470 --
NM_000430chr1731437 1243 61 --23403 2863 12818
NM_000489chrX12772 ------
NM_000530chr1186 ------
NM_000599chr263567 3508 3135 3000 1847 834 --13596 --
NM_000633chr1825046 1204 --11315 --
NM_000641chr1911565 ------
NM_000793chr1431245 544 474 ----1788
NM_000801chr20------148
NM_000806chr5----11687 --
NM_000807chr41561 ------
NM_000813chr51433 ------
NM_000814chr1533972 3864 1658 ------
NM_000826chr4124 ------
NM_000829chr1142184 2116 1636 77 1448 ----
NM_000834chr1221091 869 --1258 172
NM_000845chr71147 ------
NM_000868chrX21950 28 ------
NM_000870chr551452 495 480 260 33 --11265 --
NM_000875chr1556442 4736 1572 1439 138 --22093 897 26148 6053
NM_000899chr1221470 954 ------
NM_000912chr822931 2314 11088 ----
NM_000933chr2021259 513 163 ----
NM_000945chr211771 ------
NM_001001331chr32934 297 ------
NM_001001502chr51446 ------
NM_001001669chr542482 2091 1902 1683 ----1564
NM_001002032chr17----192 --
NM_001002860chr14----12857 --
NM_001002919chr2135 ------
NM_001003674chr1856913 6165 6023 1728 1305 ------
NM_001003675chr1856913 6165 6023 1728 1305 ------
NM_001003712chr1233710 3582 1450 ------
NM_001003940chr1523335 585 --13213 1801
NM_001003942chr1523335 585 --13213 1801
NM_001003943chr1523339 589 --13217 1805
NM_001005354chr12168 --1179 --
NM_001005375chrY------11349
NM_001005463chr101315 ------
NM_001005476chr21663 ------
NM_001005732chr212410 81 --1488 --
NM_001005910chr31577 ------
NM_001005911chr31577 ------
NM_001005920chr164871 830 766 146 160 1411 --
NM_001006115chr3----11777 --
NM_001006617chr91263 --1191 --
NM_001006619chr91263 --1191 --
NM_001006620chr91263 --1191 --
NM_001006621chr91263 --1191 --
NM_001006624chr13721 428 130 1407 ----
NM_001006935chrX129 ------
NM_001006936chrX129 ------
NM_001006937chrX129 ------
NM_001007023chr1431245 544 474 ----1788
NM_001007237chr112278 1501 21779 1061 133
NM_001007471chr91305 ------
NM_001007794chr11248 ------
NM_001008541chr1011892 ------
NM_001008541chr1011892 ------
NM_001008564chr1311585 ------
NM_001008660chr1111063 ------
NM_001008701chr1932277 2194 1918 --1131 --
NM_001009899chr326222 149 ------
NM_001010854chr141171 ------
NM_001010942chr1211255 ------
NM_001010986chrX11002 ------
NM_001011537chr3--169 --11536
NM_001011708chr212378 ------
NM_001012329chr122294 1826 ----1691
NM_001012420chr151351 1859 ----
NM_001012423chr151351 ------
NM_001014431chr144898 766 111 61 ------
NM_001014432chr144898 766 111 61 ------
NM_001014435chr161444 --1532 --
NM_001014797chr1057611 7502 7295 5224 1674 --17111 --
NM_001015045chr41455 ------
NM_001017395chr313151 ------
NM_001017424chr111898 ------
NM_001017425chr111898 ------
NM_001017995chr553835 3543 3444 1816 141 ------
NM_001018074chr533229 3077 3064 13176 ----
NM_001018075chr533229 3077 3064 13176 ----
NM_001018076chr533229 3077 3064 13176 ----
NM_001018077chr533229 3077 3064 13176 ----
NM_001024094chr533229 3077 3064 13176 ----
NM_001024660chr3------11130
NM_001024680chr2----11566 --
NM_001025076chr1035628 2180 705 ------
NM_001025580chrX33449 1186 618 --1124 --
NM_001025780chr911111 ------
NM_001029858chr653215 2061 1342 710 43 --1935 --
NM_001029863chr611241 --12230 --
NM_001030007chr1653694 3180 1499 347 97 ----12883
NM_001030019chr7123 ------
NM_001030055chr1422975 503 ------
NM_001031695chr2214944 1328 25005 4278 --
NM_001031702chr33278 259 172 ------
NM_001031717chr32125 65 ------
NM_001031740chr111224 ------
NM_001032289chrX139 ------
NM_001032380chr1031986 663 627 --11383 --
NM_001033044chr121422 1403 --1747 --
NM_001033056chr121422 1403 --1747 --
NM_001033551chr1762946 1418 785 740 564 233 2342 119 23453 1219 --
NM_001033554chr17142 ------
NM_001035chr11320 ----1440
NM_001035254chr92600 436 ------
NM_001037290chr112657 396 --1402 --
NM_001039350chr761730 1160 1135 573 200 191 11786 1267 1438
NM_001039580chr4--11020 15066 --
NM_001039619chr141242 ------
NM_001039840chrX12067 --1599 --
NM_001039937chr132967 726 14153 ----
NM_001039960chr1221114 133 ------
NM_001040059chr171588 ------
NM_001040152chr741960 1752 953 125 ------
NM_001040172chr551452 495 480 260 33 --11265 --
NM_001040173chr551452 495 480 260 33 --11265 --
NM_001040214chr63770 491 447 131 ----
NM_001040441chr124069 1483 14003 ----
NM_001040624chr842658 1918 1019 515 ------
NM_001040625chr842658 1918 1019 515 ------
NM_001040626chr842658 1918 1019 515 ------
NM_001040627chr842658 1918 1019 515 ------
NM_001040628chr842658 1918 1019 515 ------
NM_001040629chr842658 1918 1019 515 ------
NM_001040630chr842658 1918 1019 515 ------
NM_001040709chr132584 1805 204 --12182 --
NM_001042473chr10----1489 1479
NM_001042492chr171136 ------
NM_001042493chr61245 ------
NM_001042517chr132303 48 ------
NM_001042555chr1224319 3938 ------
NM_001042599chr236793 5344 1310 11381 ----
NM_001042604chr323456 1322 ------
NM_001042646chr341651 1473 495 406 21813 360 ----
NM_001042681chr152562 2515 947 605 380 ------
NM_001042682chr152562 2515 947 605 380 ------
NM_001042682chr152562 2515 947 605 380 ------
NM_001044385chr223298 1358 ------
NM_001046chr51603 --12675 --
NM_001083620chr4124 ------
NM_001106chr358178 8037 7179 3556 286 1570 12739 --
NM_001113490chrX53458 3353 2321 858 842 ------
NM_001116chr1672857 2809 2325 1168 1131 650 576 ------
NM_001128chr1653694 3180 1499 347 97 ----12883
NM_001148chr422131 888 --1835 --
NM_001149chr101277 ------
NM_001173chr1422975 503 ------
NM_001198chr621580 932 ------
NM_001204chr225620 1855 ----17321
NM_001251chr171588 ------
NM_001256chr1712384 --12054 --
NM_001260chr13186 ------
NM_001280chr191268 ------
NM_001290chr41770 ------
NM_001293chr111394 ------
NM_001310chr12--153 --12418
NM_001316chr201107 ------
NM_001351chr3------11323
NM_001364chr1143723 1592 1115 157 ------
NM_001389chr211426 ------
NM_001396chr211190 ------
NM_001406chr1711207 --31699 646 206 --
NM_001420chr1942375 940 820 779 1113 13127 11054
NM_001423chr1211615 --1715 --
NM_001440chr832758 2730 2364 ------
NM_001448chrX21363 1220 --21387 1201 --
NM_001527chr614825 ------
NM_001542chr112278 1501 21779 1061 133
NM_001552chr1721084 917 ------
NM_001584chr111239 ------
NM_001650chr1812673 ------
NM_001677chr11377 ------
NM_001683chr32934 297 ------
NM_001731chr12----1595 --
NM_001755chr1621721 155 --1202 --
NM_001798chr1211006 ------
NM_001830chrX62995 2979 2934 874 807 646 --12625 --
NM_001842chr91219 ------
NM_001901chr61156 ------
NM_001923chr11----2533 91 --
NM_001936chr761730 1160 1135 573 200 191 11786 1267 1438
NM_001964chr521175 234 ----1420
NM_002015chr1313103 ------
NM_002025chrX36188 1832 1662 ------
NM_002063chrX21142 215 ------
NM_002065chr121422 1403 --1747 --
NM_002072chr92965 770 ------
NM_002074chr1----1665 126
NM_002076chr1212113 ----12954
NM_002092chr424027 3611 ------
NM_002093chr3172 ------
NM_002126chr1722757 276 --12858 --
NM_002137chr7----121 --
NM_002147chr172856 738 ------
NM_002165chr201285 ------
NM_002193chr231330 238 71 --11932 1458
NM_002205chr121790 ------
NM_002211chr10----189 --
NM_002226chr14280 49 ------
NM_002264chr314382 --14985 14770
NM_002267chr131137 ------
NM_002268chr311422 ------
NM_002270chr524121 1845 ------
NM_002349chr21174 ------
NM_002353chr1170 ------
NM_002372chr51186 ------
NM_002383chr161841 ------
NM_002387chr5132 --21433 171 --
NM_002399chr151204 ------
NM_002401chr1722278 632 1107 12410 --
NM_002446chr19270 34 ------
NM_002451chr953307 3019 2793 2664 2381 13617 ----
NM_002480chr1211219 ------
NM_002507chr1731870 1456 614 ----1423
NM_002515chr14----1650 --
NM_002527chr121281 ------
NM_002539chr21116 ------
NM_002574chr1142 ------
NM_002613chr1625181 3516 ------
NM_002655chr834099 941 901 ------
NM_002656chr61312 ------
NM_002657chr2023454 2774 11555 12812 --
NM_002698chr192651 307 ------
NM_002732chr91466 ------
NM_002736chr721852 1680 ------
NM_002740chr312533 ------
NM_002755chr152582 50 ------
NM_002827chr20----2561 81 11817
NM_002830chr21281 ------
NM_002833chr15------198
NM_002834chr12----12508 11352
NM_002837chr1224440 366 ------
NM_002869chr1121469 824 ----1545
NM_002885chr12974 152 ----1910
NM_002892chr1411733 ----141
NM_002941chr311150 ------
NM_002977chr233323 1324 1015 --1602 --
NM_003012chr833166 441 171 --1195 --
NM_003062chr5161 ------
NM_003085chr51446 ------
NM_003099chr1565795 5419 4863 4614 938 354 14038 ----
NM_003106chr32782 343 ------
NM_003131chr631933 1414 291 ------
NM_003144chr6185 ------
NM_003155chr81266 ----1470
NM_003162chr211007 ------
NM_003215chr421431 1289 ----11061
NM_003246chr1511388 ------
NM_003247chr6----144 --
NM_003253chr211144 ------
NM_003326chr122303 109 ------
NM_003339chr51477 --11542 --
NM_003340chr41968 ------
NM_003392chr323471 1074 ------
NM_003405chr221706 ------
NM_003413chrX1171 ------
NM_003453chr131291 ------
NM_003474chr1052195 2116 1806 962 270 --12143 --
NM_003483chr12----192 --
NM_003502chr16----159 --
NM_003557chr111399 --1647 --
NM_003574chr1833672 567 95 --12283 --
NM_003583chr1222836 307 ------
NM_003590chr213924 ------
NM_003592chr71331 ------
NM_003626chr1121173 464 ------
NM_003628chr21663 ------
NM_003629chr142945 2785 2544 197 ------
NM_003663chr321125 325 ------
NM_003692chr91146 1254 ----
NM_003709chr2157 --127 --
NM_003737chr11----1103 --
NM_003759chr413683 --11312 --
NM_003794chr31267 ------
NM_003802chr17----126 --
NM_003818chr20----1230 --
NM_003873chr1011806 ------
NM_003888chr15----21191 97 --
NM_003924chr411453 --21484 111 --
NM_003941chr712386 ------
NM_003947chr3----1179 --
NM_003969chr191140 --273 28 --
NM_003994chr1221470 954 ------
NM_004028chr1812673 ------
NM_004071chr21115 ------
NM_004080chr71349 ----151
NM_004081chrY------11349
NM_004093chr1352514 629 378 280 254 --12327 --
NM_004124chr141466 ------
NM_004134chr51479 ------
NM_004171chr1159364 9061 3830 2814 606 26441 6433 12188 --
NM_004232chr1813678 ------
NM_004255chr151129 ------
NM_004274chr1422142 788 1265 ----
NM_004296chr1453614 3568 1057 871 328 33931 602 37 ----
NM_004302chr124598 469 319 57 --11000 --
NM_004321chr253488 3413 2259 1165 610 13274 12298 12465
NM_004338chr1856913 6165 6023 1728 1305 ------
NM_004370chr631903 1377 275 11345 ----
NM_004380chr1622245 1780 ----1113
NM_004383chr151647 ----1221
NM_004393chr312132 ----1784
NM_004429chrX------11235
NM_004431chr12245 73 ------
NM_004449chr211210 ------
NM_004450chr141361 ------
NM_004480chr141662 ------
NM_004484chrX1125 ------
NM_004494chr11233 1156 174 --
NM_004496chr14136 --1876 --
NM_004504chr222390 750 ------
NM_004586chrX44213 3916 3841 31 13615 ----
NM_004588chr1183292 2845 896 840 803 730 617 201 ------
NM_004598chr532824 1118 951 ------
NM_004602chr201418 11307 1515 --
NM_004615chrX2735 192 ------
NM_004643chr14------1252
NM_004687chr1711314 ------
NM_004717chr7------11477
NM_004725chr10127 ------
NM_004737chr22193 ------
NM_004745chr8115902 5246 5117 4618 4583 4572 2658 2512 1395 738 222 1171 --12761
NM_004768chr121137 381 ------
NM_004822chr1762774 2529 1242 555 273 206 --33610 3579 1191 182
NM_004827chr42685 233 ------
NM_004831chr191148 ------
NM_004840chrX12259 ------
NM_004841chr11233 ------
NM_004872chr11314 ------
NM_004884chr15----11203 --
NM_004947chr31169 --21588 1004 --
NM_004949chr18----12060 --
NM_004958chr12885 81 ------
NM_004977chr19----1600 --
NM_004999chr61132 --141 --
NM_005027chr1931022 372 291 ----176
NM_005028chr1021842 1547 ------
NM_005063chr1023330 610 ----23716 2702
NM_005096chrX41239 1203 190 54 ------
NM_005105chr141870 1863 1521 1414 --11585 --
NM_005116chr2053799 1745 1350 1264 1195 24035 435 33604 584 240 --
NM_005124chr621028 994 ------
NM_005137chr2242425 2119 1885 104 --22390 326 --
NM_005163chr144898 766 111 61 ------
NM_005180chr102553 479 ------
NM_005182chr161444 --1532 --
NM_005221chr71272 ------
NM_005233chr312459 12264 ----
NM_005235chr236793 5344 1310 11381 ----
NM_005254chr151136 --184 --
NM_005308chr101438 ------
NM_005324chr17----11834 --
NM_005328chr81299 ------
NM_005342chrX12138 --21970 183 --
NM_005359chr1826152 469 11473 ----
NM_005380chr1------1150
NM_005402chr711617 ------
NM_005433chr18----12020 --
NM_005442chr31572 ------
NM_005458chr92792 110 ----1367
NM_005502chr942845 613 533 431 --1746 --
NM_005503chr151244 ----1110
NM_005507chr11----1461 --
NM_005509chr5------11634
NM_005544chr21806 ------
NM_005596chr925070 559 ------
NM_005599chr1------154
NM_005607chr81827 ------
NM_005613chr142001 698 242 131 1754 ----
NM_005639chr12199 ------
NM_005650chr2211149 1249 11293 --
NM_005670chr61374 ------
NM_005723chr41235 ------
NM_005730chr1252883 2674 922 415 264 13391 ----
NM_005734chr11----178 --
NM_005759chr224055 3106 ------
NM_005779chr543134 159 115 107 ------
NM_005801chr172718 175 ------
NM_005859chr5------11221
NM_005909chr51742 13355 --13943
NM_005911chr2------11326
NM_005920chr122814 774 11104 --13656
NM_005943chr631588 1492 577 ------
NM_005962chr1011892 ------
NM_005962chr1011892 ------
NM_005964chr17----190 --
NM_005966chr211561 ------
NM_006015chr12851 843 ------
NM_006037chr244112 3542 508 77 --1140 --
NM_006038chr2031948 643 59 12025 ----
NM_006048chr11864 ------
NM_006090chr11248 ------
NM_006095chr423798 933 ------
NM_006109chr141242 ------
NM_006135chr11333 ------
NM_006139chr21532 12327 1226 --
NM_006154chr1511875 ------
NM_006158chr821588 262 ------
NM_006172chr1--1289 --1106
NM_006186chr21356 ------
NM_006195chr91522 ------
NM_006216chr2146 ------
NM_006256chr11251 ------
NM_006277chr21117 ------
NM_006306chrX95647 5430 5413 5380 5005 4961 4333 3818 2160 15357 15682 15617
NM_006321chr321602 200 --21875 669 --
NM_006322chr132159 127 ------
NM_006373chr172938 55 ------
NM_006375chrX11870 ----11668
NM_006380chr1714045 --13997 --
NM_006415chr9------172
NM_006465chr151397 ------
NM_006474chr13721 428 130 1407 ----
NM_006480chr5188 --2115 58 --
NM_006482chr1222836 307 ------
NM_006489chr14----1650 --
NM_006519chr6164 ------
NM_006538chr261338 1020 976 403 256 72 ------
NM_006540chr811164 ------
NM_006546chr1725097 4906 21361 982 21089 1012 --
NM_006549chr122476 35 22032 87 --1408
NM_006561chr1035628 2180 705 ------
NM_006565chr161489 ------
NM_006595chr111221 ----11984
NM_006599chr1626121 3206 ------
NM_006621chr121891 1331 ------
NM_006640chr1751847 1691 1631 1328 1207 --1185 --
NM_006654chr1224319 3938 ------
NM_006717chr912596 ----11367
NM_006718chr61312 ------
NM_006766chr822595 2475 ------
NM_006772chr6----11170 --
NM_006775chr62849 621 ------
NM_006777chrX32909 929 564 ------
NM_006802chr1----1998 --
NM_006805chr511362 ------
NM_006807chr1711268 ------
NM_006832chr1441049 931 225 30 ------
NM_006838chr1211828 ------
NM_006861chr1221884 1596 161 31725 1573 730 --
NM_006885chr1612977 ------
NM_006902chr11299 --125 --
NM_006922chr231969 1806 390 ------
NM_006939chr1421123 743 ------
NM_006948chr211807 ------
NM_006993chr10238 28 ------
NM_007008chr22179 140 ------
NM_007038chr2124106 3694 --15014 --
NM_007039chr1432291 2072 1708 ------
NM_007050chr2057327 3243 3077 1951 146 36671 2504 2275 ----
NM_007064chr3------11130
NM_007111chr131692 ------
NM_007124chr641858 1686 1590 95 ----1284
NM_007125chrY1488 ------
NM_007137chrX34486 3775 806 14072 13413 --
NM_007159chr3----11195 --
NM_007166chr1111063 ------
NM_007212chr111568 ------
NM_007246chr41981 ------
NM_007249chr1337969 2307 612 27038 2826 ----
NM_012072chr2043941 2949 743 172 1833 1218 --
NM_012081chr513364 ------
NM_012098chr9156 ------
NM_012102chr152562 2515 947 605 380 ------
NM_012129chr712056 --12404 --
NM_012134chr141299 411 146 35 --1124 --
NM_012141chr132967 726 14153 ----
NM_012153chr1121661 157 ------
NM_012154chr81546 ------
NM_012161chr421160 287 1334 ----
NM_012164chr955789 4675 2356 668 629 16566 11085 --
NM_012193chr1134773 4557 2170 ------
NM_012199chr114392 ------
NM_012214chr246418 6375 5321 5089 --14238 --
NM_012219chr342802 2561 2303 372 --1657 --
NM_012249chr232763 1405 467 ------
NM_012252chr723638 2093 1223 ----
NM_012257chr71780 ------
NM_012294chr712547 --147 --
NM_012296chr1163381 2898 2567 1405 1165 237 12946 1655 --
NM_012300chr5154 --1867 --
NM_012330chr1021313 29 ------
NM_012384chr2052409 1798 1684 403 107 --156 --
NM_012396chr11192 ------
NM_012419chr61167 --1434 --
NM_012471chrX21486 485 ------
NM_013254chr121253 ------
NM_013261chr413497 ----1797
NM_013281chr2011253 ------
NM_013312chr191109 ------
NM_013341chr212378 ------
NM_013357chr8----1661 --
NM_013381chr121247 ------
NM_013382chr1431495 895 82 1212 ----
NM_013433chr191303 ------
NM_013989chr1431245 544 474 ----1788
NM_014021chr112285 ----13145
NM_014056chr332256 1716 924 ------
NM_014089chr1311585 ------
NM_014112chr81541 --14089 11389
NM_014217chr111898 ------
NM_014231chr1242053 1518 1466 379 ------
NM_014240chr333415 3008 25 ------
NM_014253chrX1293 ------
NM_014267chr11----1151 --
NM_014280chr1----1858 --
NM_014309chr2214934 1318 24995 4268 --
NM_014319chr12----1492 --
NM_014325chr1212180 ------
NM_014363chr1311042 ------
NM_014449chr12----1214 --
NM_014454chr61119 ------
NM_014456chr101267 ------
NM_014517chr3143 --1243 --
NM_014552chr22315 90 --11319 --
NM_014554chr1212060 ------
NM_014572chr1311694 ----1472
NM_014585chr21309 ------
NM_014587chr1621082 1026 11296 ----
NM_014614chr21489 ------
NM_014615chr1631117 386 118 ------
NM_014655chr1--11707 21864 1452 11900
NM_014667chr352323 2029 733 416 338 ------
NM_014670chr211147 ----1652
NM_014671chr71233 --1426 --
NM_014677chr82559 404 ----1266
NM_014683chr1721986 1681 ------
NM_014689chr21222 ------
NM_014720chr101201 ------
NM_014731chr20------1416
NM_014751chr8----1607 --
NM_014752chr1121697 326 ------
NM_014767chr1042871 2777 1315 975 ------
NM_014772chr1853234 2969 2744 2657 30 1315 22350 568 13552
NM_014779chr32808 96 1327 ----
NM_014787chr111875 ------
NM_014798chr17----11581 --
NM_014807chr111767 --1136 --
NM_014828chr141870 --11605 --
NM_014836chr1031986 663 627 --11383 --
NM_014839chr11400 ------
NM_014844chr1444172 3815 575 21 --11261 --
NM_014859chr1731089 933 42 ----1918
NM_014883chr41455 ------
NM_014901chr532110 1798 459 11479 --1231
NM_014903chr121606 --11777 --
NM_014921chr1932277 2194 1918 --1131 --
NM_014932chr311697 ------
NM_014974chr1031589 1257 162 123 ----
NM_014982chr141381 ------
NM_014991chr42778 29 ------
NM_014992chr141302 ------
NM_015008chr313151 ------
NM_015023chr111313 ------
NM_015025chr232077 1812 235 ----1723
NM_015026chr12------11190
NM_015033chr942018 778 388 224 ------
NM_015035chr2064331 4135 2297 607 518 53 --26376 2371 --
NM_015039chr131047 542 156 --11721 --
NM_015042chr1533232 2700 38 --23002 1227 --
NM_015069chr161130 ------
NM_015071chr546385 4736 4070 714 ------
NM_015074chr11980 --1581 14965
NM_015090chr125470 4388 --11716 16136
NM_015136chr31132 ------
NM_015144chr1642630 2623 961 279 11267 23631 3459 138
NM_015149chr111594 ------
NM_015158chr91636 ------
NM_015176chr11647 ------
NM_015192chr2022649 2613 1286 ----
NM_015199chr322282 994 ------
NM_015250chr931321 638 298 ------
NM_015270chr1232213 1507 338 --12087 --
NM_015272chr1612120 ------
NM_015299chr1453194 3180 2791 1033 482 ------
NM_015315chr543180 2620 2194 60 ------
NM_015318chr1961666 1639 1441 717 224 208 --1396 --
NM_015328chr732738 895 207 ----11152
NM_015335chr1222305 845 ----1918
NM_015349chr623041 850 ------
NM_015365chrX33449 1186 618 --1124 --
NM_015374chr22----1382 --
NM_015435chr8----11313 --
NM_015455chr533923 2623 1612 ------
NM_015472chr3131 ------
NM_015472chr3131 ------
NM_015530chr23882 832 44 ------
NM_015567chr13----1429 --
NM_015570chr711853 ------
NM_015578chr1911663 ----11307
NM_015630chr21360 ------
NM_015646chr1211255 ------
NM_015657chr21671 ------
NM_015695chr621341 825 ------
NM_015895chr61210 ------
NM_015904chr22589 545 ------
NM_015906chr113213 ------
NM_016025chr161328 ------
NM_016037chr11412 ------
NM_016041chr17----1334 --
NM_016081chr411477 ------
NM_016147chr111103 ------
NM_016169chr1031275 561 152 ----1463
NM_016224chr642053 1480 788 30 ------
NM_016289chr212274 --1246 --
NM_016290chr5152 ------
NM_016356chr622765 626 ------
NM_016436chr2012030 ------
NM_016577chr344469 3229 857 600 ------
NM_016598chr311422 ------
NM_016603chr51844 ------
NM_016607chrX11668 ------
NM_016621chr1133364 3158 325 --126 --
NM_016628chr101259 --1250 --
NM_016654chr151136 --184 --
NM_017415chr534175 458 329 --14122 --
NM_017452chr201418 11307 1515 --
NM_017453chr201418 11307 1515 --
NM_017454chr201418 11307 1515 --
NM_017488chr211012 ------
NM_017572chr19163 ------
NM_017602chrX----1616 --
NM_017623chr242754 2328 1799 108 ------
NM_017626chr1021714 287 --1216 --
NM_017629chr12738 87 ------
NM_017631chr42175 57 ------
NM_017633chr612913 ------
NM_017637chr937090 3355 2316 16684 --11268
NM_017645chr912514 ------
NM_017650chr725857 437 --1779 --
NM_017658chr1414003 ----1589
NM_017734chr11133 ------
NM_017799chr1431488 1263 352 ------
NM_017813chr835421 5027 1378 --11048 15278
NM_017849chr243149 2199 1247 889 ------
NM_017938chrX12160 ------
NM_017944chr112793 397 ------
NM_018008chr31344 ------
NM_018027chr101374 --1906 --
NM_018061chr11305 ------
NM_018078chr4----1303 --
NM_018098chr321137 800 ------
NM_018133chr31306 ------
NM_018176chr431581 1525 1228 ------
NM_018184chr3----11492 --
NM_018206chr162569 506 ------
NM_018243chr42394 66 ------
NM_018268chr5----1631 --
NM_018313chr311948 ----1303
NM_018357chr151377 --1168 --
NM_018364chr123538 691 ------
NM_018373chr1426145 73 16346 ----
NM_018403chr333885 3057 1115 ------
NM_018440chr897410 7355 5801 5519 2635 2239 967 921 545 ----15871
NM_018457chr12168 --1179 --
NM_018566chr114419 ------
NM_018569chr411537 ------
NM_018652chr151419 ------
NM_018667chr164986 427 420 61 ------
NM_018834chr511012 ------
NM_018836chr121162 413 161 ----
NM_018847chr911220 ------
NM_018970chr732361 1985 1010 ------
NM_019001chr323456 1322 ------
NM_019004chr7------21770 755
NM_019046chr101853 ------
NM_019049chr11625 ------
NM_019050chr41804 ------
NM_019063chr212036 ------
NM_019091chr2------1407
NM_019094chr122202 110 ------
NM_019096chr62429 63 11012 ----
NM_019556chrX----1465 --
NM_019595chr21117 ------
NM_019605chr12121 110 ------
NM_019848chrX1138 ------
NM_019852chr14----138 --
NM_019858chr12----1214 --
NM_020148chr1842551 2068 870 32 ------
NM_020248chr122294 1826 ----1691
NM_020348chr102896 557 ------
NM_020362chr12537 295 1155 ----
NM_020381chr61210 11739 ----
NM_020403chr131185 1138 11503 --
NM_020420chrY------11349
NM_020425chr61245 ------
NM_020440chr142987 2569 1065 200 12186 ----
NM_020443chr162436 1883 1678 1049 1027 1004 44765 4524 2628 2157 --26109 2528
NM_020463chr21419 ------
NM_020465chr1631860 1410 571 ----1298
NM_020532chr22179 140 ------
NM_020647chr82573 245 ------
NM_020651chr211523 ------
NM_020699chr111864 ----13597
NM_020702chr941848 1803 1648 728 ------
NM_020734chr1222281 288 ------
NM_020748chr1721377 326 ------
NM_020760chr21307 ----11690
NM_020769chrX1348 ------
NM_020770chr11328 ------
NM_020772chr1726485 452 ------
NM_020795chr1711823 11763 --11925
NM_020809chr111921 1417 1630 --
NM_020810chr1422645 919 ------
NM_020813chr193409 366 351 1264 1788 --
NM_020831chr222820 178 --1774 --
NM_020841chr1233710 3582 1450 ------
NM_020845chr1252430 1996 1911 1872 32 --1709 --
NM_020871chrX1111 ------
NM_020935chr212909 ----23353 863
NM_020952chr91305 ------
NM_020956chr1944767 4344 3623 3514 --1925 --
NM_020977chr422131 888 --1835 --
NM_020987chr101277 ------
NM_021033chr131892 ------
NM_021064chr61425 ------
NM_021159chr41508 ----11416
NM_021198chr22294 93 --1118 --
NM_021244chr6159 ------
NM_021643chr2------11682
NM_021728chr141274 ------
NM_021871chr42186 35 ------
NM_021911chr51433 ------
NM_021912chr1533972 3864 1658 ------
NM_021947chr17----1497 --
NM_021960chr122514 1728 ------
NM_021961chr1166880 6861 6818 5585 2822 2043 --1369 --
NM_021976chr6187 ------
NM_022037chr21840 ------
NM_022048chr1564670 4434 4334 4112 1648 1208 26090 1864 ----
NM_022080chr2022342 308 22775 2325 ----
NM_022114chr1144038 3796 3406 2997 2945 1881 1851 1190 1046 941 855 241 129 49 ------
NM_022140chr521581 343 22226 1909 1423 --
NM_022166chr1684611 4566 2308 2107 1275 921 550 484 21418 654 ----
NM_022173chr21840 ------
NM_022373chr7----1336 --
NM_022485chr32302 68 ------
NM_022497chr333645 2620 658 11297 1571 1702
NM_022566chr152498 155 ------
NM_022574chr71874 --1512 --
NM_022648chr223248 1421 --132 --
NM_022731chr11274 ------
NM_022737chr194888 384 363 35 ------
NM_022739chr171212 ------
NM_022780chr221178 326 ------
NM_022845chr1621675 109 --1156 --
NM_022898chr14----1914 13398
NM_022910chr1631860 1410 571 ----1298
NM_023000chr1411733 ----141
NM_023001chr1411733 ----141
NM_023012chr12155 ------
NM_023037chr13148 ------
NM_023076chr1612753 163 22647 2543 --
NM_024007chr512691 ------
NM_024015chr172826 23 --1200 --
NM_024117chr91263 --1191 --
NM_024513chr353800 3006 1318 440 344 ------
NM_024541chr1021762 707 11471 ----
NM_024563chr521903 284 --11285 --
NM_024572chr2----131 --
NM_024613chr81101 ------
NM_024636chr7------1251
NM_024664chr12387 74 ------
NM_024665chr321528 98 1378 --123
NM_024798chr1532575 2328 533 1350 --12719
NM_024863chrX129 ------
NM_024871chr331331 957 23 1324 2564 72 --
NM_024947chr338488 2208 254 ------
NM_024971chr91305 ------
NM_025073chr134307 3208 1654 --11639 --
NM_025113chr1311164 ------
NM_025191chr111012 ------
NM_025208chr11----1161 --
NM_025222chr332105 793 594 1134 ----
NM_025243chr232139 2095 2060 ------
NM_025248chr1722587 2241 1420 --1699
NM_025250chr731981 1016 688 --22891 2293 --
NM_030576chr1732370 797 500 12503 --1435
NM_030621chr14--1875 --1366
NM_030627chr513073 ------
NM_030629chr1611900 ------
NM_030647chr735845 5294 1451 ------
NM_030648chr435324 4494 1218 ------
NM_030756chr101115 ------
NM_030758chr2231175 1157 406 --1304 --
NM_030762chr121324 ------
NM_030766chr12----1232 1319
NM_030802chr171357 ------
NM_030806chr159150 8255 3330 3125 1402 ------
NM_030816chr112783 ------
NM_030906chr111130 ------
NM_030918chr125247 4384 --11759 --
NM_030940chr9184 ------
NM_030981chr1111032 ------
NM_031243chr7----121 --
NM_031268chr1625181 3516 ------
NM_031296chr41130 ------
NM_031309chr841904 1522 1492 1457 --22248 1927 --
NM_031431chr1311429 ------
NM_031445chr222122 535 --12571 --
NM_031469chr613334 ----1127
NM_031476chr1622760 406 ----12351
NM_031890chr2222647 1073 --22319 869 --
NM_031938chr112657 396 --1402 --
NM_032041chr842658 1918 1019 515 ------
NM_032138chr13------140
NM_032144chr231326 1226 473 ------
NM_032153chr31588 --22673 111 1604
NM_032193chr1131767 1748 1551 ------
NM_032211chr1021118 64 ----1926
NM_032217chr411206 ------
NM_032281chr1942375 940 820 779 1113 13127 11054
NM_032288chr3--169 --11536
NM_032352chr14159 ------
NM_032439chr101641 ------
NM_032457chr412381 ------
NM_032557chr4131 ------
NM_032574chr2174 ------
NM_032813chr131722 ------
NM_032826chr731767 1252 327 --11135 --
NM_033020chr113213 ------
NM_033081chr2031268 79 37 1243 1442 --
NM_033135chr11----1161 --
NM_033136chr511642 ------
NM_033137chr511642 ------
NM_033143chr444560 4279 455 215 ------
NM_033161chr911740 --11676 --
NM_033225chr832884 1038 274 1180 ----
NM_033274chr52578 60 13503 23586 3319 167
NM_033285chr843656 3546 2762 898 --14286 1502
NM_033429chr15--12119 22294 170 --
NM_033503chr1523335 585 --13213 1801
NM_033535chr421160 287 1334 ----
NM_033551chr543180 2620 2194 60 ------
NM_033644chr5154 --1867 --
NM_033645chr5154 --1867 --
NM_052827chr1211006 ------
NM_052845chr1221199 38 --1866 --
NM_052874chr161132 --1645 1169
NM_052897chr121221 ------
NM_052899chr53285 209 201 ------
NM_052905chr221628 71 ------
NM_052925chr191901 ------
NM_057175chr42864 64 ------
NM_058172chr421277 378 ------
NM_078469chr1021038 395 ------
NM_078470chr1022684 2636 ------
NM_078625chr61192 --1532 --
NM_080491chr1163381 2898 2567 1405 1165 237 12946 1655 --
NM_080645chr631903 1377 275 11345 ----
NM_080671chr21895 ----21885 229
NM_080867chr14----24834 4795 --
NM_100264chr101259 --1250 --
NM_100486chr101259 --1250 --
NM_130436chr211190 ------
NM_130438chr212767 93 1145 ----
NM_130439chr1011892 ------
NM_130439chr1011892 ------
NM_130459chr931225 518 430 1377 11301 1362
NM_130797chr761730 1160 1135 573 200 191 11786 1267 1438
NM_130830chr312596 187 23729 222 --
NM_133170chr2057327 3243 3077 1951 146 36671 2504 2275 ----
NM_133171chr202918 246 ------
NM_133265chrX53458 3353 2321 858 842 ------
NM_133631chr311150 ------
NM_133642chr22193 ------
NM_138270chrX12772 ------
NM_138415chr2221401 312 130 21471 1329 --
NM_138417chr1----127 --
NM_138444chr1323724 3023 1585 ----
NM_138473chr122231 96 ------
NM_138479chr11237 ------
NM_138576chr14----1914 13398
NM_138621chr261338 1020 976 403 256 72 ------
NM_138713chr1626121 3206 ------
NM_138714chr1626121 3206 ------
NM_139057chr1532647 656 82 22815 433 ----
NM_139135chr12851 843 ------
NM_139207chr121214 ------
NM_144571chr436518 6122 2032 1815 ----
NM_144574chr142431 149 ------
NM_144579chr242557 565 304 71 1822 11950 --
NM_144583chr231751 1556 1489 ------
NM_144628chr2032984 2859 2848 2808 54 12403 --
NM_144633chr31544 ------
NM_144775chr1734958 1194 831 ------
NM_144982chr12----1526 --
NM_144994chr23496 215 23 11535 21510 1347 --
NM_145029chr6141 ------
NM_145117chr113574 552 384 ----11142
NM_145159chr14280 49 ------
NM_145206chr1023185 357 11012 ----
NM_145246chr1021216 1165 ------
NM_145341chr101267 ------
NM_145698chr10----1489 1479
NM_145727chr641120 1056 559 125 1218 ----
NM_145891chr16----11458 --
NM_145892chr16----11458 --
NM_145893chr16142 --11580 --
NM_147156chr1011041 ------
NM_147164chr91219 ------
NM_147686chr6136 ------
NM_148170chr1135221 1745 38 14794 ----
NM_148955chr1565795 5419 4863 4614 938 354 14038 ----
NM_152253chr2253579 3492 1680 709 256 1780 ----
NM_152287chr1662415 1906 1019 950 721 645 ------
NM_152331chr14199 ------
NM_152344chr1711437 ------
NM_152388chr223298 1358 ------
NM_152409chr512824 ------
NM_152450chr152614 105 ------
NM_152462chr171551 --1293 --
NM_152496chr11880 ------
NM_152594chr151161 ------
NM_152622chr512378 ------
NM_152636chr1112443 ------
NM_152663chr11211 ------
NM_152665chr1------1992
NM_152667chr2011122 --1980 --
NM_152678chr31113 ------
NM_152744chr752435 2243 2196 1290 796 --11339 12855
NM_152748chr71121 ------
NM_152758chr812858 11021 ----
NM_152782chr7123 ------
NM_152787chrX13692 ------
NM_152826chr1565795 5419 4863 4614 938 354 14038 ----
NM_152835chr132452 475 347 126 ----
NM_152860chr12----11078 --
NM_152904chr17142 ------
NM_153006chr17155 ------
NM_153026chr121437 ------
NM_153042chr62407 300 --11706 1284
NM_153184chr321404 637 ------
NM_153186chr91636 ------
NM_153188chr524121 1845 ------
NM_153235chr612156 ------
NM_153273chr3----11777 --
NM_153331chr3------1573
NM_153350chr163506 292 38 --1586 --
NM_153367chr1043541 3525 1568 1442 ------
NM_153499chr122574 133 22130 185 --2506 88
NM_153500chr122574 133 22130 185 --2506 88
NM_153607chr5146 ------
NM_153619chr154753 406 380 288 ----1413
NM_153757chr41378 ------
NM_153828chr22179 140 ------
NM_153831chr81827 ------
NM_170674chr151204 ------
NM_170677chr151204 ------
NM_170692chr11233 ------
NM_170696chr15----21191 97 --
NM_170697chr15----21191 97 --
NM_170706chr131047 542 156 --11721 --
NM_171998chrX21004 370 ------
NM_172020chr721554 1292 ------
NM_172070chr2142 ------
NM_172127chr442059 1766 639 233 ------
NM_172128chr442015 1722 595 189 ------
NM_172216chr122476 35 22032 87 --1408
NM_172226chr122574 133 22130 185 --2506 88
NM_172231chr19194 ------
NM_172315chr151204 ------
NM_172316chr151204 ------
NM_172337chr141274 ------
NM_172375chr14------1315
NM_173074chr2173 ------
NM_173076chr21671 ------
NM_173171chr21356 ------
NM_173173chr21356 ------
NM_173214chr1626121 3206 ------
NM_173468chr436109 3857 1352 ------
NM_173476chr1651929 1853 1684 437 199 ------
NM_173517chr71417 ------
NM_173582chr1112411 ------
NM_173595chr12----13228 --
NM_173623chr171730 ------
NM_173658chr3----1279 --
NM_173667chr531888 220 76 1362 11629 --
NM_173683chr831617 1491 504 ------
NM_173814chr152160 118 ------
NM_174938chr9----185 --
NM_175873chr51932 ------
NM_177438chr14--1875 --1366
NM_177539chr14663 561 256 124 ------
NM_177947chrX11668 ------
NM_177948chrX11668 ------
NM_177999chr953636 3057 2549 2434 255 --12319 --
NM_178154chr141662 ------
NM_178155chr141662 ------
NM_178156chr141662 ------
NM_178157chr141662 ------
NM_178313chr211986 ------
NM_178526chr1931929 766 572 162 ----
NM_178585chr42778 29 ------
NM_178812chr821301 1212 ------
NM_178835chr42869 614 ----183
NM_178864chr111539 ------
NM_181050chr16----159 --
NM_181302chr142431 149 ------
NM_181308chr142431 149 ------
NM_181353chr201542 ------
NM_181481chr1856913 6165 6023 1728 1305 ------
NM_181482chr1856913 6165 6023 1728 1305 ------
NM_181483chr1856913 6165 6023 1728 1305 ------
NM_181492chr2211087 1187 11231 --
NM_181504chr51333 --14051 --
NM_181523chr51333 --14051 --
NM_181524chr51333 --14051 --
NM_181671chr171292 ------
NM_181696chr1142 ------
NM_181697chr1142 ------
NM_181704chr2111331 --11161 --
NM_181782chr6------1408
NM_181838chr51477 --11542 --
NM_181886chr41968 ------
NM_181887chr41968 ------
NM_181888chr41968 ------
NM_181889chr41968 ------
NM_181890chr41968 ------
NM_181891chr41968 ------
NM_181892chr421015 44 ------
NM_181893chr41968 ------
NM_182314chrX11870 ----11668
NM_182481chr2111236 --11066 --
NM_182482chr2111236 --11066 --
NM_182484chr2111331 --11161 --
NM_182503chr645447 5199 5025 440 ------
NM_182507chr1252347 2260 1820 832 664 --11560 --
NM_182744chr1------1150
NM_182763chr122503 1717 ------
NM_182764chr202918 246 ------
NM_182767chr12----12042 --
NM_182797chr2021279 533 183 ----
NM_182830chr1421922 632 1401 --1810
NM_182907chr621580 932 ------
NM_182918chr211210 ------
NM_182920chr321070 339 11278 11225 --
NM_182964chr113574 552 384 ----11142
NM_183419chr8----11313 --
NM_194286chr1286240 5587 3779 1666 1649 1179 1014 894 11939 26137 926 --
NM_194434chr1833672 567 95 --12283 --
NM_197941chr552947 2596 2532 2410 2022 ------
NM_197956chr93242 97 30 151 ----
NM_197968chr131291 ------
NM_198181chr152736 437 ------
NM_198182chr22315 90 --11319 --
NM_198225chr1031986 663 627 --11383 --
NM_198261chr12155 ------
NM_198262chr12155 ------
NM_198390chr1611900 ------
NM_198391chr2011253 ------
NM_198400chr1511875 ------
NM_198490chr322768 450 --2675 652 --
NM_198889chr411206 ------
NM_198896chr1121469 824 ----1545
NM_198935chr203583 451 116 ------
NM_199040chr122202 110 ------
NM_199078chr242754 2328 1799 108 ------
NM_199131chr10189 ------
NM_199189chr511012 ------
NM_199421chr14----24834 4795 --
NM_199454chr1144038 3796 3406 2997 2945 1881 1851 1190 1046 941 855 241 129 49 ------
NM_201280chr61558 --1620 --
NM_201599chrX41239 1203 190 54 ------
NM_203305chr92600 436 ------
NM_203327chr2053799 1745 1350 1264 1195 24035 435 33604 584 240 --
NM_203351chr1722278 632 1107 12410 --
NM_203446chr2122263 817 ------
NM_203487chr131185 1138 11503 --
NM_205836chr51532 ------
NM_206944chr91305 ------
NM_206945chr91305 ------
NM_206946chr91305 ------
NM_206947chr91305 ------
NM_207043chr121964 1448 ------
NM_207044chr121964 1448 ------
NM_207047chr121964 1448 ------
NM_207337chr121876 ------
NM_207343chr111107 ------
NM_207371chr1011510 ------
NM_207406chr466532 5975 2161 1772 1755 365 14219 ----
NM_207520chr22179 140 ------
NM_207521chr22179 140 ------
NM_212464chr1541960 1803 1591 1334 ------
NM_212467chr1572537 2380 2168 1911 945 696 334 --1711 1379
NM_213609chr311038 1198 ----