TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-133b
miRNA Sequence: UUUGGUCCCCUUCAACCAGCUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX46258 6139 4239 2512 --15546 25575 1611
NM_000337chr556019 4646 4018 2088 2063 14540 --14563
NM_000555chrX77349 7342 6092 5227 4900 1156 184 17167 --22249 1227
NM_000629chr2163256 3231 3218 1324 281 272 22849 575 11638 11194
NM_001001664chr263751 3140 2745 1477 1319 284 23293 798 1821 --
NM_001003682chr12460 42 2960 916 165 158
NM_001007094chr1073992 3206 1507 1406 1397 980 176 11032 --21729 1065
NM_001007466chr664338 3841 1813 1619 906 72 24846 3299 1658 23579 196
NM_001008660chr113250 228 166 ----1408
NM_001010888chrX41482 1284 790 240 11431 23296 1381 13985
NM_001011666chr755641 2452 1464 1400 1199 15534 --14018
NM_001012756chr1913111 33102 2149 629 --1821
NM_001025076chr1055637 2318 2279 1619 1013 45819 4358 3812 2087 ----
NM_001025233chr1272691 2423 2095 1801 632 376 273 ----12244
NM_001033117chr354506 3062 1432 1243 833 54818 4729 3365 827 218 ----
NM_001033564chr641799 1511 765 139 21214 519 151 11927
NM_001034841chr1674152 3774 3508 3360 2200 2175 690 35356 5117 28 --13485
NM_001039199chr20154842 4800 4310 4301 4276 3892 3556 3547 1932 1874 1349 1317 1304 1152 885 34959 440 423 14605 1342
NM_001039618chr1155759 5517 5063 3618 1888 15285 21389 945 14738
NM_001039840chrX11596 --15692 35463 3806 788
NM_001040441chr1135090 5065 5052 4546 4512 3828 3522 3395 1724 1715 1691 869 837 33679 664 570 --14809
NM_001042406chr621064 37 ----1482
NM_001042473chr10--1374 1190 11851
NM_001042603chr1275127 4890 4687 4037 947 843 41 21653 1388 11618 1517
NM_001042604chr333282 1933 573 24213 2947 --1294
NM_001100108chr1107568 7454 6144 6135 6110 6097 5470 5169 1960 960 --36417 2772 737 --
NM_001364chr1163978 3143 1659 1187 1170 786 2828 801 33419 1462 600 1177
NM_001419chr1994904 4045 3310 3172 1436 599 580 268 196 11553 --1680
NM_001455chr633709 3366 1396 ----24813 4473
NM_001918chr1149294 7610 6808 2969 2889 2449 2440 2404 1706 1564 1539 387 378 353 13564 28029 1986 13222
NM_002247chr1042092 1586 1552 320 --12276 1214
NM_002336chr1254926 4758 3799 3359 345 2912 810 1477 --
NM_002645chr1142529 1259 1246 1056 42926 2584 2050 1941 1175 --
NM_002711chr75888 191 177 116 72 ------
NM_002731chr162301 1983 758 701 597 552 ------
NM_002844chr61538 11345 --1889
NM_003042chr341795 1741 1405 706 11639 --12156
NM_003108chr247332 6107 5162 598 36430 6196 792 --15272
NM_003369chr112595 159 ----32365 814 178
NM_003842chr852258 1553 922 533 235 22513 2351 --1999
NM_004171chr1159404 8698 2719 2076 1797 16041 ----
NM_004586chrX84257 4194 4078 3412 1574 1565 1540 735 21137 1074 --15285
NM_004817chr91535 ----2522 277
NM_004852chr18813328 12303 5341 2846 2649 2167 1584 941 18852 38995 3556 1428 213388 12160
NM_004992chrX86488 5244 3364 2711 1873 527 313 230 26877 298 26453 1776 16345
NM_005156chr964635 2146 1835 434 82 34 45038 4678 4116 3253 --14059
NM_005512chr1151938 1887 709 659 253 --32030 1653 503 21466 603
NM_005730chr1273351 3174 949 933 569 316 178 22401 2250 12815 12431
NM_005779chr543232 2518 2384 1181 21317 539 2613 137 13370
NM_005780chr1311042 --1659 2226 42
NM_006148chr1711024 --22528 481 22896 2106
NM_006315chr484114 3534 3418 3102 3030 3017 901 760 24535 746 --199
NM_006591chr112603 52 21749 1456 --21496 531
NM_006599chr1668034 6808 5681 2632 1474 325 22807 492 12957 --
NM_006682chr752221 949 807 670 410 42530 1950 1840 420 ----
NM_007038chr2155076 4930 4695 4257 1737 33963 477 157 ----
NM_007050chr20167325 7317 7173 7062 6060 5925 5644 5497 3100 2629 2456 2311 1331 1232 775 48 17751 32328 1756 520 --
NM_007137chrX85554 5186 4770 4601 4164 3752 1001 823 11675 --21418 1236
NM_007347chr152924 36 12526 --11046
NM_012223chr21140 1507 --11037
NM_012262chr125175 615 ----1990
NM_012288chr654146 1450 1441 1097 527 15754 --25555 997
NM_012316chr1105018 4694 4671 4426 4238 4143 1830 1335 1117 661 11262 34030 1349 311 --
NM_013231chr1474199 3332 3122 2909 2875 982 971 33031 2936 1337 1762 --
NM_013449chr1222973 2242 12235 22550 2143 1233
NM_014755chr244036 2908 833 129 12743 --23943 743
NM_014873chr134089 3033 1336 ----14105
NM_014920chr653086 2773 1532 984 601 23324 879 ----
NM_014938chr1262575 2550 2328 2289 2200 847 ----2983 648
NM_015044chr1643224 2449 865 631 1963 2646 69 13170
NM_015170chr851673 711 604 465 353 --1117 --
NM_015310chr857058 6544 6449 5700 2540 46155 5552 5261 1571 15418 --
NM_015375chr164898 4199 1386 782 750 608 23606 3159 24741 4156 --
NM_016009chr164477 3447 3438 3413 1105 1030 ----14768
NM_016083chr663556 1546 1333 1152 1050 778 11003 11294 12857
NM_016308chr121638 699 ----1419
NM_017633chr631571 1461 1454 --23218 3186 23857 729
NM_017637chr978841 7078 6823 5855 5827 1054 547 37038 2331 1752 --16914
NM_017799chr143365 350 168 1406 21798 1315 11845
NM_018045chr192148 1251 1088 551 410 401 258 249 211 22594 2316 ----
NM_018312chr1142148 1398 1361 117 1392 22066 124 1609
NM_018945chr643133 3086 2865 2820 --1571 12411
NM_020778chr1554264 3132 1637 406 41 --34892 3737 3517 23056 1423
NM_020782chr1263395 3293 1197 272 186 78 13253 2999 262 1314
NM_020899chr1792541 2497 2339 2180 2078 1601 1595 868 248 2956 857 --1477
NM_021183chrX11938 11703 --12244
NM_021190chr111222 ----21040 82
NM_021629chr374248 3279 3270 3247 1798 1760 1303 1198 1206 11642
NM_021638chr473346 3108 1617 1373 934 706 475 ----14553
NM_022048chr15144791 2495 2486 2461 2448 2403 2049 1908 1343 1117 860 444 424 150 15227 16283 --
NM_024639chr652742 2630 2223 1148 648 12869 --1114
NM_024811chr1141899 1679 1256 549 --21242 472 21499 70
NM_024989chr256342 2598 2312 951 46 36714 5206 3064 ----
NM_032932chr1796453 5841 5575 4902 4754 4568 4530 4390 4381 26052 3965 21504 44 --
NM_033133chr1753362 2512 1344 888 276 --21039 260 33397 2844 241
NM_052840chr1531480 1325 356 ----1350
NM_144571chr426032 1246 46814 6712 957 638 --16438
NM_144599chr1585410 4748 4729 4422 4076 3547 1074 950 11159 --13953
NM_144618chr141296 1264 1147 1133 ----2221 205
NM_152253chr22103253 1632 1457 1406 776 444 403 356 331 85 13420 13334 --
NM_152265chr121480 31 ----11606
NM_152729chr62330 107 ----11594
NM_173468chr424585 2385 15906 --14411
NM_173495chrX32184 551 301 21935 47 --2873 614
NM_173642chr158522 6657 2764 2357 2346 19053 38126 3480 77 --
NM_177402chr12858 156 1947 1363 1756
NM_194291chr822526 612 1855 --1109
NM_206853chr674108 3366 2932 2868 2790 1568 823 --13572 --
NM_213589chr253765 3378 1541 1486 1208 ----1353