TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-135a-3p
miRNA Sequence: UAUAGGGAUUGGAGCCGUGGCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr13645 588 522 ------
NM_000052chrX73039 1112 802 745 562 529 432 --12803 --
NM_000055chr31423 ------
NM_000067chr81686 ------
NM_000081chr141613 1522 1231 750 ------
NM_000084chrX127008 6601 6548 5215 4743 2606 1863 1751 1535 1483 1220 130 12147 16675 14828
NM_000090chr21938 ------
NM_000091chr251946 1043 907 609 189 12772 12721 --
NM_000092chr294471 3616 3577 3052 3016 1799 158 61 43 1383 23364 2878 --
NM_000109chrX150 ------
NM_000112chr5105028 5011 4269 4131 3894 1731 1305 810 796 568 11417 13872 --
NM_000125chr6123750 3162 3103 1664 1643 1575 1559 1464 1288 1202 840 37 1590 23365 498 1776
NM_000138chr1532449 1891 347 --11784 --
NM_000163chr5----1200 --
NM_000165chr651300 1052 472 464 115 --11043 --
NM_000168chr762874 2649 2333 1294 1239 1102 --12302 --
NM_000176chr563460 3270 1282 1130 948 930 1413 12773 --
NM_000183chr2193 ----1382
NM_000192chr1251036 548 475 365 32 11554 21492 390 --
NM_000202chrX103545 2875 2806 2798 2686 2615 2523 2496 1497 1048 1476 13282 --
NM_000208chr1964676 4572 4260 4199 1661 448 ----1128
NM_000210chr242316 1827 720 276 11478 ----
NM_000216chrX134114 3467 2843 2816 2674 1553 1354 793 744 484 317 212 117 1623 ----
NM_000217chr1295229 4053 3821 3691 3360 1697 1616 678 128 1605 42066 1999 1525 830 --
NM_000218chr113969 844 687 ------
NM_000223chr17135 --2136 103 --
NM_000237chr841522 1207 607 365 ------
NM_000245chr722104 1967 1800 ----
NM_000248chr342889 2398 2214 2058 12623 ----
NM_000259chr1584965 3884 2030 1151 908 329 220 145 15298 ----
NM_000264chr9103364 3306 3276 3104 2915 1123 683 577 471 111 ----11199
NM_000267chr172901 419 --2729 66 --
NM_000274chr104549 251 73 29 ------
NM_000276chrX51959 1910 1807 323 143 ------
NM_000284chrX51785 1715 1250 520 407 --11513 --
NM_000289chr121285 ------
NM_000304chr171941 --1703 --
NM_000315chr11178 ------
NM_000321chr132445 163 ------
NM_000328chrX1297 ------
NM_000330chrX41645 1587 855 401 --11474 --
NM_000332chr666816 6266 6083 666 291 38 --15454 15563
NM_000337chr586502 6235 5116 4665 4614 1152 1129 934 --25318 4264 11260
NM_000346chr172756 146 11507 1434 --
NM_000361chr2041465 561 512 456 11893 ----
NM_000362chr2293491 3086 2837 2270 1434 1426 1256 1239 825 --32693 1218 299 --
NM_000378chr111828 ------
NM_000388chr361154 923 889 841 799 482 ----1930
NM_000390chrX52933 2911 2452 1350 292 11149 13046 1151
NM_000391chr11101708 1600 1448 1331 481 390 196 127 72 62 ------
NM_000399chr105939 914 735 335 171 ------
NM_000408chr233476 3454 309 --12691 --
NM_000428chr1442016 846 244 75 12150 ----
NM_000430chr1753487 3198 2550 2405 1178 ------
NM_000439chr552060 854 505 138 46 --1419 --
NM_000447chr12376 106 ------
NM_000449chr161104 1069 520 435 98 34 --1240 --
NM_000451chrX41886 1860 364 328 ------
NM_000461chr394283 4101 3941 1792 1700 1479 1191 301 29 --1939 --
NM_000489chrX31129 949 297 12723 13004 --
NM_000492chr711120 ------
NM_000495chrX41094 1087 822 59 --2932 197 --
NM_000509chr41198 --172 --
NM_000539chr371525 1483 1440 1128 542 498 123 1520 11141 --
NM_000540chr19143 ------
NM_000544chr6_cox_hap1133125 3107 2942 2593 2492 2430 2289 985 677 557 500 209 75 12437 --1484
NM_000555chrX87293 7004 6622 2779 2758 2582 2014 316 26800 1745 45666 2946 2271 1530 36182 5871 2693
NM_000572chr14724 689 402 105 2854 23 ----
NM_000574chr161355 967 956 862 249 50 --11070 --
NM_000599chr234107 1671 156 --14053 24277 1066
NM_000609chr1073140 2838 2797 2707 892 826 259 ----23033 2360
NM_000611chr11106015 5832 5795 5268 4743 2530 1498 1413 907 508 14884 25038 1103 --
NM_000615chr1162870 2776 2504 1096 290 136 ------
NM_000618chr1245844 5185 2384 290 --55077 4308 4065 2153 418 --
NM_000618chr1245844 5185 2384 290 --55077 4308 4065 2153 418 --
NM_000633chr1844619 3762 1462 562 --23624 1265 --
NM_000685chr33820 685 301 ------
NM_000685chr33820 685 301 ------
NM_000689chr92447 50 ----1486
NM_000719chr12115117 4669 4204 2648 2508 2487 2176 998 561 409 48 --24475 4423 --
NM_000721chr152419 2332 1896 1690 512 ------
NM_000722chr72255 190 1243 ----
NM_000726chr211330 ------
NM_000780chr831160 804 500 ----1830
NM_000788chr441271 574 484 354 ------
NM_000793chr14154942 4289 4280 4095 3922 3602 3214 3190 1114 1085 507 407 225 140 90 ----21495 1129
NM_000794chr51775 ------
NM_000806chr521832 153 --21285 119 11550
NM_000809chr4128839 8424 8029 7062 6342 6230 5699 3553 3334 2528 758 346 11708 38614 5632 1544 17535
NM_000813chr585275 4625 4555 1791 1697 1075 808 711 --23608 410 11092
NM_000816chr52626 87 ------
NM_000817chr2--169 --1244
NM_000818chr103529 477 33 ------
NM_000826chr432438 1814 780 ------
NM_000828chrX3818 583 174 11387 ----
NM_000831chr1135601 5492 5241 4934 4105 3858 1718 1504 937 726 707 583 77 ------
NM_000833chr162406 232 ----1339
NM_000838chr622412 1980 12659 12614 --
NM_000849chr183083 2817 2344 2233 2208 1095 757 204 --1323 --
NM_000855chr11------1342
NM_000859chr5----11376 --
NM_000861chr342385 2346 1799 637 --22093 37 --
NM_000866chr31250 ----1698
NM_000868chrX72577 2038 933 797 786 622 25 12503 22620 1717 --
NM_000875chr1596851 6308 5844 4967 2385 1480 1137 847 212 --56468 2393 420 319 309 --
NM_000891chr1763287 3205 3101 3068 2862 853 12634 43634 2969 2951 2846 --
NM_000899chr1283161 3147 2848 1725 1706 1688 1670 244 11137 13947 --
NM_000902chr3123180 3165 2759 2513 2463 2160 2079 1139 1015 693 304 66 --22389 2287 --
NM_000917chr10263 26 ------
NM_000919chr52466 181 --1520 --
NM_000933chr2031653 1445 519 --11705 --
NM_000935chr331135 1072 774 --21157 980 --
NM_000944chr441872 1657 406 320 ------
NM_000945chr231919 577 448 ----11404
NM_000948chr62137 38 ------
NM_000949chr53800 781 188 ------
NM_000958chr531000 395 368 142 ----
NM_000961chr20123730 3121 1360 1139 1039 785 531 486 392 360 199 122 ------
NM_001001323chr1222390 108 ----1792
NM_001001342chr1031491 1115 220 11137 11228 --
NM_001001395chr1232663 828 632 ------
NM_001001396chr164299 3467 1741 1631 1200 259 --1311 --
NM_001001419chr573998 3504 1403 1171 1082 927 820 ------
NM_001001420chr573998 3504 1403 1171 1082 927 820 ------
NM_001001481chr833421 2619 2236 --22785 687 --
NM_001001484chr1052125 1647 833 300 205 ------
NM_001001556chr15----1159 --
NM_001001557chr822229 1660 --2344 320 --
NM_001001586chr12388 61 ------
NM_001001664chr233758 1053 406 ------
NM_001001701chr431488 193 165 1669 ----
NM_001001890chr2183995 3899 2833 1499 1437 1114 506 466 --12719 --
NM_001001995chrX3352 331 148 ------
NM_001002033chr171791 ------
NM_001002259chr123258 128 111 ------
NM_001002814chr893913 3714 2953 2654 2370 1450 1124 913 654 ------
NM_001002909chr1742120 1754 1389 683 1818 ----
NM_001003407chr1055038 3126 984 618 261 --24937 4032 --
NM_001003408chr1055038 3126 984 618 261 --24937 4032 --
NM_001003652chr18128694 8666 8317 8292 7637 7404 7386 7308 7200 6327 2613 2178 23310 2116 37920 7646 75 31684 1620 162
NM_001003674chr1865729 4808 2561 2516 2508 1049 --15195 --
NM_001003675chr1865729 4808 2561 2516 2508 1049 --15195 --
NM_001003681chr2251926 1556 1361 581 30 ------
NM_001003712chr1263986 3911 2459 1561 1533 183 --11171 --
NM_001003792chr321198 1136 ------
NM_001003793chr321198 1136 ------
NM_001003800chr953388 3371 3194 1188 802 1608 ----
NM_001004051chrX133 --1305 --
NM_001004065chr942977 2921 1562 426 --22588 120 --
NM_001004304chr1293083 2368 2286 2093 2085 2025 1151 1062 245 12216 13066 1607
NM_001004317chr633704 3264 2843 13297 1959 --
NM_001004419chr1274590 4472 3598 3555 1535 491 442 --13579 --
NM_001005207chr171222 ------
NM_001005353chr121239 1079 ------
NM_001005353chr121239 1079 ------
NM_001005366chr124885 874 822 396 ------
NM_001005375chrY31828 1399 226 ------
NM_001005386chr22813 206 --1288 1278
NM_001005463chr101865 --11000 1448
NM_001005473chr586208 5490 5386 5202 2632 2438 1667 1359 35687 5374 497 2319 86 16321
NM_001005474chr331578 540 434 185 ----
NM_001005476chr21195 ------
NM_001005609chrX103578 3554 3520 3220 2735 2568 1219 976 778 38 1569 22441 294 --
NM_001005746chr211330 ------
NM_001005747chr211330 ------
NM_001005845chr831712 55 41 ----1230
NM_001006600chr51399 ------
NM_001006612chrX1411 ------
NM_001006613chrX1411 ------
NM_001006614chrX1411 ------
NM_001006623chr231620 335 199 --1754 --
NM_001007023chr14154942 4289 4280 4095 3922 3602 3214 3190 1114 1085 507 407 225 140 90 ----21495 1129
NM_001007024chr1784172 3755 3366 1671 1651 1052 537 257 ------
NM_001007025chr1784172 3755 3366 1671 1651 1052 537 257 ------
NM_001007067chr83257 243 195 --1675 --
NM_001007068chr83257 243 195 --1675 --
NM_001007069chr83257 243 195 --1675 --
NM_001007070chr83257 243 195 --1675 --
NM_001007097chr994940 4851 4327 3881 3162 3109 1733 1351 691 13289 --14961
NM_001007098chr12599 244 1644 ----
NM_001007214chr131854 464 147 --1693 --
NM_001007246chr2111441 11275 --11538
NM_001007466chr654457 3795 3392 1763 1328 --25157 5018 --
NM_001007468chr221243 ------
NM_001007527chr51217 190 ----
NM_001007793chr10269 48 --126 --
NM_001008239chr1822404 505 --23228 464 --
NM_001008392chr353334 3195 2350 388 78 13146 1292 --
NM_001008393chr482604 2271 1932 1777 1088 870 595 204 12022 1782 1565
NM_001008495chr851694 1493 755 514 362 12225 ----
NM_001008660chr1151443 533 421 314 60 --1598 --
NM_001008701chr1992756 2481 850 818 633 529 522 339 225 --12889 --
NM_001008707chr1411247 ------
NM_001008723chr101366 ------
NM_001008738chr542428 2381 2255 2163 ----12317
NM_001008925chr442928 2567 1150 21 32767 370 134 12855 --
NM_001009185chr5----1162 --
NM_001009899chr376252 5220 4481 2437 2305 690 259 --15506 --
NM_001009909chr1143372 2488 687 172 --13526 13253
NM_001009993chr263978 3936 3687 3528 1776 862 --14142 --
NM_001010000chr18103171 2753 2563 2536 2437 2364 965 745 299 98 ------
NM_001010853chr622365 457 1399 ----
NM_001010861chr132363 804 341 ------
NM_001010870chr61522 ------
NM_001010888chrX63799 3680 3146 1632 1412 142 14513 ----
NM_001010891chr566446 5723 5649 5056 5037 2280 --14810 --
NM_001010898chr183446 3436 2475 1020 909 677 207 170 --21110 805 1353
NM_001010908chr101751 1264 1234 --
NM_001010934chr7136 ----11160
NM_001010971chr12867 134 ------
NM_001011513chr483998 3165 3035 2944 2803 2739 1245 638 --13591 --
NM_001011515chr44891 714 690 96 --2697 139 --
NM_001011516chr44891 714 690 96 --2697 139 --
NM_001011538chr44946 391 302 238 1784 ----
NM_001011553chr71225 --1401 --
NM_001011666chr7106096 5235 5182 5168 4467 2446 2358 1793 1699 1082 --26362 639 15475
NM_001011708chr252887 2712 2423 2243 883 ----12683
NM_001011713chr142609 343 ------
NM_001012267chr93472 440 372 --11490 --
NM_001012393chr11104169 4132 1398 1159 1128 996 960 893 734 442 --24187 3791 --
NM_001012410chr3123 --1482 --
NM_001012420chr1542638 2619 1037 877 ------
NM_001012423chr1542638 2619 1037 877 ------
NM_001012426chr693421 3078 2910 2500 1375 1334 798 599 443 --23235 2741 --
NM_001012427chr693421 3078 2910 2500 1375 1334 798 599 443 --23235 2741 --
NM_001012732chr431265 1052 149 --1930 --
NM_001012751chr10--11673 11318 --
NM_001012753chr1961102 956 872 434 248 166 3789 351 83 ----
NM_001012761chr532335 1033 245 --1958 12290
NM_001012968chrX31135 334 318 --22715 2076 --
NM_001013031chr1063314 2985 1096 908 699 208 ------
NM_001013399chr621128 923 ------
NM_001013437chr182383 29 ------
NM_001013615chr191210 1193 1183 1074 794 323 190 151 144 --31199 1083 422 --
NM_001013620chr12128361 7929 7838 7704 7095 7085 5282 3151 1595 901 658 505 27206 2771 11553 26608 5694
NM_001013659chr1944917 4349 1639 358 --11518 --
NM_001014380chr13105817 5532 5319 4016 2146 1788 1679 1541 1519 324 --15520 --
NM_001014797chr1087266 7242 5835 3173 2782 2771 1808 486 --22909 2345 22483 441
NM_001014972chr21235 ------
NM_001015508chr81199 ------
NM_001015881chrX11209 --1411 --
NM_001017368chr1772165 935 856 806 768 553 312 ------
NM_001017371chr231347 1247 65 ------
NM_001017395chr343086 3027 1299 27 --32389 814 421 --
NM_001017415chr11120 ------
NM_001017416chr11120 ------
NM_001017424chr151579 532 506 481 281 --150 --
NM_001017425chr151579 532 506 481 281 --150 --
NM_001017926chr821241 396 ------
NM_001017930chrX61397 1285 1173 953 455 227 31039 178 129 1540 --
NM_001017962chr10263 26 ------
NM_001018003chr81283 ------
NM_001018009chr31891 --1283 --
NM_001018054chr121246 1095 ------
NM_001018065chr9155329 4974 4905 4898 4616 4553 4376 4016 2412 1569 933 688 623 606 133 14425 35911 4779 760 --
NM_001018066chr9155329 4974 4905 4898 4616 4553 4376 4016 2412 1569 933 688 623 606 133 14425 35911 4779 760 --
NM_001018067chr155234 5043 4863 3831 1188 14333 --11290
NM_001018068chr155234 5043 4863 3831 1188 14333 --11290
NM_001018069chr155234 5043 4863 3831 1188 14333 --11290
NM_001018074chr563460 3270 1282 1130 948 930 1413 12773 --
NM_001018075chr563460 3270 1282 1130 948 930 1413 12773 --
NM_001018076chr563460 3270 1282 1130 948 930 1413 12773 --
NM_001018077chr563460 3270 1282 1130 948 930 1413 12773 --
NM_001018100chr153632 276 52 ------
NM_001018108chr1521567 530 --2894 853 --
NM_001020825chr51935 --1248 --
NM_001023587chr34873 852 319 149 --1988 --
NM_001024024chr1431028 792 248 ------
NM_001024070chr1431024 788 244 ------
NM_001024094chr563460 3270 1282 1130 948 930 1413 12773 --
NM_001024218chr141651 ------
NM_001024372chr872254 2245 1974 818 788 665 227 --11442 --
NM_001024463chr151102 ----11053
NM_001024596chr1953281 2447 1410 879 319 --13678 --
NM_001024660chr3--11529 11046 --
NM_001024808chr1242366 917 590 542 --31103 826 322 --
NM_001024847chr342534 2293 683 598 1352 --1126
NM_001024912chr194601 492 263 91 1213 --11770
NM_001024934chr61531 ----1107
NM_001024935chr61531 ----1107
NM_001024936chr61531 ----1107
NM_001024947chr51898 ------
NM_001025068chr331671 391 379 ------
NM_001025069chr331671 391 379 ------
NM_001025076chr10165554 5190 4833 4185 3944 2387 2271 1899 1691 1532 1187 1112 642 503 352 22 --24045 90 --
NM_001025077chr10166912 6548 6191 5543 5302 2890 2545 2470 2000 1861 1710 1401 1296 1167 980 22 --35403 4778 1448 --
NM_001025079chr343207 2955 1140 727 23955 1493 11173 12602
NM_001025203chr21121 ------
NM_001025204chr21121 ------
NM_001025252chr823048 174 1657 23122 3005 11220
NM_001025253chr823048 174 1657 23122 3005 11220
NM_001025366chr641805 1419 699 134 --1402 --
NM_001025366chr641805 1419 699 134 --1402 --
NM_001025367chr641805 1419 699 134 --1402 --
NM_001025367chr641805 1419 699 134 --1402 --
NM_001025368chr641805 1419 699 134 --1402 --
NM_001025368chr641805 1419 699 134 --1402 --
NM_001025369chr641821 1435 715 150 --1418 --
NM_001025369chr641821 1435 715 150 --1418 --
NM_001025370chr641805 1419 699 134 --1402 --
NM_001025370chr641805 1419 699 134 --1402 --
NM_001025580chrX63487 2617 1704 990 598 385 --1708 1262
NM_001025603chr161104 1069 520 435 98 34 --1240 --
NM_001029858chr653352 2572 2087 892 512 --1622 2846 735
NM_001029863chr672939 2774 2645 2470 1196 803 433 ----1209
NM_001029875chr532705 2078 1861 12039 1119 --
NM_001029998chr441462 926 288 238 1316 2888 463 --
NM_001030006chr1772508 2191 1760 1738 952 556 247 --12118 --
NM_001030007chr1662823 1237 888 732 295 138 ----13744
NM_001030055chr1444008 3210 1460 258 1302 31645 1636 148 --
NM_001030287chr111179 ------
NM_001031679chr1262819 2427 2242 2228 2214 786 --23538 559 --
NM_001031695chr22115267 5190 5148 5110 4964 4847 4722 4069 1770 1610 1139 186 35330 3924 1246 --
NM_001031700chr451724 1660 895 457 228 --2714 661 --
NM_001031709chr10121 --1346 --
NM_001031710chr741024 965 924 164 ----1132
NM_001031716chr231010 982 311 ------
NM_001031723chr4----1463 --
NM_001031732chr443586 3526 3345 2446 --1620 13507
NM_001031804chr1644123 2995 2910 1774 ------
NM_001031812chr532094 1679 182 --12320 12027
NM_001032281chr2125 ------
NM_001032283chr1221096 37 1945 ----
NM_001032284chr1221096 37 1945 ----
NM_001032296chr1332745 1872 679 --12727 --
NM_001032730chr12684 655 ------
NM_001033045chr253169 1489 1005 623 460 1330 12714 11019
NM_001033047chr441939 632 39 29 1778 ----
NM_001033057chr341751 666 366 114 ------
NM_001033117chr394805 4559 4405 4060 3459 1594 1545 334 260 24831 3811 ----
NM_001033507chr131974 1777 448 --21963 1741 --
NM_001033581chr1156 ------
NM_001033581chr1156 ------
NM_001033582chr1156 ------
NM_001033659chr173568 318 157 --11389 --
NM_001033723chr862707 2631 2467 2197 797 84 --12407 --
NM_001033756chr641739 1353 633 68 --1336 --
NM_001033756chr641739 1353 633 68 --1336 --
NM_001033925chr1031895 1528 448 --1546 --
NM_001034845chr421267 343 ------
NM_001034850chr51666 21324 321 1429 --
NM_001034915chr831220 339 169 --1450 --
NM_001034954chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_001034955chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_001034956chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_001034957chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_001035003chr42927 285 --11219 --
NM_001035004chr42927 285 --11219 --
NM_001035260chr1031157 488 340 ------
NM_001037131chr22503 374 ------
NM_001037132chr72448 34 1401 --11891
NM_001037133chr72448 34 1401 --11891
NM_001037174chr221417 336 ----11790
NM_001037317chr132363 804 341 ------
NM_001037332chr572198 2103 771 639 495 145 24 ------
NM_001037333chr572198 2103 771 639 495 145 24 ------
NM_001037334chr181433 22272 206 12064 --
NM_001037535chrX31437 1084 378 ----1541
NM_001037536chrX31437 1084 378 ----1541
NM_001037540chrX31437 1084 378 ----1541
NM_001037553chr21105077 4926 3572 3294 1268 1148 655 639 589 315 ------
NM_001037631chr2--1397 ----
NM_001037738chr51293 ------
NM_001037954chr1153006 2774 2640 2572 45 --23400 2420 --
NM_001038707chr1102244 1903 1558 841 724 527 442 434 375 294 --31535 730 121 --
NM_001038707chr1102244 1903 1558 841 724 527 442 434 375 294 --31535 730 121 --
NM_001039395chr962311 2305 1775 1768 644 69 1139 ----
NM_001039479chr1472057 1988 963 811 324 178 125 --11977 11619
NM_001039538chr221333 1007 --21189 928 --
NM_001039547chr3107801 7482 6089 5592 4882 3159 2160 1656 1246 519 --36916 1702 1006 --
NM_001039570chr22114156 4067 3952 3599 3524 3341 3128 1754 1464 1178 873 --1404 --
NM_001039571chr22114156 4067 3952 3599 3524 3341 3128 1754 1464 1178 873 --1404 --
NM_001039577chr153877 3517 3076 2786 1816 ----13727
NM_001039585chr173966 2740 2725 1636 835 203 114 1657 11614 1126
NM_001039590chrX104014 3930 3574 3512 3316 3063 2517 2476 1390 104 --12911 1833
NM_001039591chrX104014 3930 3574 3512 3316 3063 2517 2476 1390 104 --12911 1833
NM_001039616chr19----124 --
NM_001039618chr11105854 5293 5070 2228 2091 1199 1132 960 513 428 25945 5937 ----
NM_001039762chr1052315 2160 1775 544 416 1342 11956 --
NM_001039802chr151191 1142 954 548 369 ------
NM_001039840chrX105948 5259 5121 4838 4438 4295 3908 1998 1719 42 24112 323 11279 --
NM_001039937chr1373197 3133 3000 2684 1517 842 521 --14166 --
NM_001039938chr1321508 1352 --1981 --
NM_001039960chr1251482 1058 649 400 111 --11569 --
NM_001040020chr71227 11406 ----
NM_001040092chr81159 1397 ----
NM_001040100chr32427 295 --1118 --
NM_001040142chr231819 1658 941 --1524 --
NM_001040143chr231819 1658 941 --1524 --
NM_001040152chr775007 4774 3706 3642 1654 503 111 35088 4761 1147 25099 346 --
NM_001040153chr1311001 ------
NM_001040158chr51539 ------
NM_001040159chr41202 ------
NM_001040202chr451684 931 561 321 186 11598 --11872
NM_001040272chr922136 407 --11915 --
NM_001040284chr16105244 5179 4638 3924 1271 1202 1071 1064 967 749 ------
NM_001040402chr432910 2460 402 ------
NM_001040424chr2122836 912 --2847 418 12095
NM_001040429chr1332282 2254 1178 ----12386
NM_001040441chr195425 5121 4567 4122 3884 1745 1453 890 764 ----11286
NM_001040450chr1532754 1141 102 --22033 1898 --
NM_001040453chr1532754 1141 102 --22033 1898 --
NM_001040610chr15------132
NM_001040619chr121629 95 ------
NM_001040633chr72957 360 ------
NM_001040653chr352413 2016 1013 966 320 --12569 --
NM_001040665chr784580 3494 3092 1317 1162 803 765 257 14958 44324 3713 1682 1370 1504
NM_001040666chr71282 1660 126 --
NM_001040712chr953035 2661 2531 2289 1136 ------
NM_001040876chr431287 718 413 ------
NM_001042355chr1684759 4475 4310 3993 3586 3438 905 168 25257 1640 15308 --
NM_001042361chr1041510 619 595 180 ------
NM_001042364chr1041510 619 595 180 ------
NM_001042365chr1041510 619 595 180 ------
NM_001042369chr1182 ------
NM_001042387chr1041510 619 595 180 ------
NM_001042388chr18----1313 --
NM_001042393chr1041510 619 595 180 ------
NM_001042396chr1041510 619 595 180 ------
NM_001042397chr1041510 619 595 180 ------
NM_001042404chr121544 391 11434 21938 119 --
NM_001042412chr1684759 4475 4310 3993 3586 3438 905 168 25257 1640 15308 --
NM_001042473chr102614 220 --21781 1679 --
NM_001042492chr172901 419 --2729 66 --
NM_001042494chr1553524 2701 2406 1111 1005 13440 --1825
NM_001042495chr1553524 2701 2406 1111 1005 13440 --1825
NM_001042496chr1553524 2701 2406 1111 1005 13440 --1825
NM_001042497chr1553524 2701 2406 1111 1005 13440 --1825
NM_001042510chr831552 1522 677 2658 374 11469 31938 1869 1411
NM_001042511chr831552 1522 677 2658 374 11469 31938 1869 1411
NM_001042517chr132908 323 ------
NM_001042550chr93669 615 371 --1564 2649 595
NM_001042555chr12134778 4137 3972 3803 3546 3506 3211 3111 1859 1568 1493 890 174 1784 44541 4171 4161 3534 --
NM_001042599chr297138 6718 5938 5795 5162 2548 2529 694 447 --37026 1914 411 26191 5770
NM_001042601chr32789 107 --1435 1223
NM_001042603chr1244396 4238 3887 642 --34181 1454 177 --
NM_001042604chr344869 3758 3516 1722 ------
NM_001042683chr641249 720 546 109 ------
NM_001042723chr19143 ------
NM_001042749chrX1102 ----1629
NM_001042750chrX1102 ----1629
NM_001042751chrX1102 ----1629
NM_001043351chr141898 882 749 707 --1144 11876
NM_001044385chr253351 3041 1615 1488 1207 --23610 259 23720 3085
NM_001044722chr532094 1679 182 --12320 12027
NM_001044723chr532094 1679 182 --12320 12027
NM_001048183chr173719 2349 1274 1126 1069 839 484 ------
NM_001069chr6129 ------
NM_001079874chr141921 1497 625 131 ----11872
NM_001083620chr432436 1812 779 ------
NM_001083621chr1154483 4177 4109 3847 3504 3354 2893 1262 1068 959 757 589 532 260 81 ------
NM_001095chr1261829 1726 1624 1285 1251 173 ------
NM_001096chr171614 ------
NM_001100108chr1187893 6863 6794 6409 6165 5842 2791 2484 2420 1429 1384 1224 894 795 598 579 299 135 --22341 1158 --
NM_001106chr369713 9361 8134 7005 3484 1277 --23305 2857 13042
NM_001109977chr44579 283 183 163 1719 --1259
NM_001121chr1021812 656 --11630 --
NM_001124chr112566 192 ------
NM_001128chr1662823 1237 888 732 295 138 ----13744
NM_001146chr832005 302 187 --11504 --
NM_001148chr421933 740 --11505 --
NM_001149chr1021135 417 ------
NM_001160chr1232512 2227 224 ------
NM_001167chrX76121 5284 4498 4132 2203 1512 1199 ------
NM_001173chr1444008 3210 1460 258 1302 31645 1636 148 --
NM_001186chr2193297 3220 2669 2163 986 850 727 708 365 --1757 --
NM_001189chr471118 1054 984 883 335 265 216 ------
NM_001198chr662096 1905 1811 629 556 268 ------
NM_001200chr202802 225 ------
NM_001201chr453772 2745 2608 911 796 --1956 13753
NM_001202chr141182 ----1115
NM_001204chr295380 4934 4803 2091 1763 1333 1326 1140 558 --21241 690 --
NM_001206chr941201 1022 910 154 --11044 --
NM_001225chr11133 ------
NM_001233chr741924 938 584 89 --12224 --
NM_001237chr421070 413 11143 ----
NM_001237chr421070 413 11143 ----
NM_001256chr1722594 2150 ------
NM_001282chr1772508 2191 1760 1738 952 556 247 --12118 --
NM_001284chr51376 --1211 --
NM_001304chr1773320 3016 2670 2504 1534 468 177 11043 ----
NM_001315chr622020 1434 ------
NM_001326chr112412 128 ------
NM_001329chr1021407 1231 ------
NM_001331chr1152189 750 730 505 301 --32779 2214 949 1956
NM_001332chr531370 1267 1251 ------
NM_001343chr571540 1453 543 295 270 236 133 --1394 --
NM_001351chr341448 1373 634 138 ------
NM_001356chrX31623 627 189 ------
NM_001363chrX2811 40 ------
NM_001364chr1194394 4302 4036 3934 3897 3115 1674 1287 1141 13224 23236 3182 13354
NM_001386chr852412 1787 1632 785 210 11523 ----
NM_001392chr18------140
NM_001396chr213916 838 646 --22714 1039 --
NM_001399chrX103578 3554 3520 3220 2735 2568 1219 976 778 38 1569 22441 294 --
NM_001406chr176607 442 423 233 163 101 --1393 --
NM_001407chr361549 1507 642 626 428 363 ------
NM_001412chrX61437 1413 1272 1089 968 289 --22958 1192 --
NM_001418chr111667 ------
NM_001418chr111667 ------
NM_001419chr1974384 3867 3654 3567 3302 1940 1751 ------
NM_001422chr112267 214 --11297 --
NM_001423chr1241905 768 243 163 11377 11663 --
NM_001426chr22274 265 --1231 --
NM_001430chr241951 1710 1517 644 --1186 --
NM_001438chr161328 832 683 556 294 272 ------
NM_001448chrX31451 523 287 --21652 506 --
NM_001449chrX31304 1069 58 172 ----
NM_001453chr631688 419 188 --21196 1166 --
NM_001461chr15597 488 229 149 23 ------
NM_001482chr153779 198 118 ------
NM_001493chrX2709 124 --1187 --
NM_001498chr621240 527 ----1987
NM_001546chr621054 926 ------
NM_001587chrX51959 1910 1807 323 143 ------
NM_001616chr21359 1226 --12356
NM_001618chr13769 297 158 ------
NM_001620chr11------170
NM_001621chr742477 2081 806 658 --2442 334 --
NM_001621chr742477 2081 806 658 --2442 334 --
NM_001622chr32366 144 ------
NM_001642chr1141299 1259 1248 1030 ------
NM_001650chr18113472 3378 3019 2979 2948 2740 2699 1060 494 354 36 12989 ----
NM_001655chr1141920 1794 681 668 12135 ----
NM_001659chr12102541 2402 2233 2223 2176 2156 1998 1883 784 190 --42671 419 390 365 --
NM_001663chr14----3554 418 383 --
NM_001664chr3126 ------
NM_001668chr12873 166 --31528 599 261 --
NM_001674chr111179 ------
NM_001682chr1212104 ----1506
NM_001684chr184016 3184 1642 1602 1554 1458 1348 917 --128 --
NM_001690chr3150 --32546 323 144 --
NM_001695chr844223 3815 340 120 --1285 --
NM_001699chr1951460 361 120 113 95 11611 ----
NM_001709chr1132056 1897 631 11152 12708 --
NM_001718chr641313 277 130 45 ------
NM_001730chr131444 --11544 --
NM_001730chr131444 --11544 --
NM_001731chr12------1926
NM_001742chr71490 ------
NM_001743chr23182 155 92 ------
NM_001748chr11933 ------
NM_001754chr2183995 3899 2833 1499 1437 1114 506 466 --12719 --
NM_001755chr1631944 1845 420 ------
NM_001759chr1274628 4168 4000 3772 3327 1132 591 25063 4907 11724 11255
NM_001773chr141371 1206 566 195 ------
NM_001777chr343207 2955 1140 727 23955 1493 11173 12602
NM_001788chr71225 --1401 --
NM_001789chr351597 1406 1384 1280 302 --1201 --
NM_001791chr151191 1142 954 548 369 ------
NM_001806chr1911889 --22929 2152 --
NM_001825chr51135 ------
NM_001830chrX44032 4007 3841 228 --3764 673 426 --
NM_001843chr12--1241 ----
NM_001845chr13--1127 ----
NM_001858chr665123 3851 3565 1307 833 154 --35010 3192 931 1161
NM_001881chr103407 377 203 ------
NM_001884chr52526 219 ------
NM_001891chr4----131 --
NM_001901chr6--1943 ----
NM_001903chr52867 798 ------
NM_001921chr431265 1052 149 --1930 --
NM_001938chr1146 --11360 11742
NM_001941chr1861173 1032 934 704 533 236 --12638 12797
NM_001942chr1851537 1479 587 424 179 11648 ----
NM_001949chr683199 3008 1299 1271 1155 402 86 25 ------
NM_001950chr16------1708
NM_001955chr621122 49 --1795 1982
NM_001962chr51433 ----1551
NM_001964chr52254 138 ------
NM_001968chr42798 750 ------
NM_001969chr1473525 3149 2940 2528 2416 1160 353 1622 12818 --
NM_001982chr121907 11119 31232 231 74 --
NM_001987chr1253991 3792 3281 3109 1196 --23314 397 --
NM_002006chr465019 2212 2021 1946 1576 1436 --1478 15710
NM_002009chr1532297 1962 916 --32706 895 356 --
NM_002017chr11--11269 --1860
NM_002024chrX31815 698 646 ----131
NM_002025chrX138739 8300 7956 7550 6684 6335 5623 1862 1432 1404 1265 1052 281 18030 22522 655 --
NM_002035chr1843238 3053 800 590 11568 ----
NM_002040chr2132071 1214 349 1870 ----
NM_002041chr15--199 ----
NM_002044chr15----1159 --
NM_002048chr92897 513 ------
NM_002056chr21662 --1117 --
NM_002061chr131641 1338 206 11809 ----
NM_002063chrX11071 ------
NM_002069chr731653 677 499 ------
NM_002076chr1263248 2967 2173 1156 1003 33 12510 23184 2202 --
NM_002077chr971872 1718 1491 846 535 458 154 ------
NM_002086chr1731809 744 125 --21522 378 11427
NM_002092chr454730 3803 3654 1472 733 ----13382
NM_002114chr6172 ------
NM_002126chr1773855 3584 1634 1188 865 792 736 12740 ----
NM_002130chr521687 180 11237 ----
NM_002137chr711726 11795 ----
NM_002158chr222664 2479 --23611 665 12503
NM_002192chr72452 199 ------
NM_002193chr221785 1729 ------
NM_002201chr151114 1105 ----
NM_002214chr795071 4930 4868 3574 1924 1889 1837 395 325 13987 23886 1930 --
NM_002221chr182443 2232 1871 472 414 277 163 70 12706 ----
NM_002223chr1243480 3233 2473 1479 --13068 --
NM_002228chr121211 405 --1883 --
NM_002232chr161254 1004 950 383 285 148 1472 1553 --
NM_002240chr211539 ------
NM_002247chr1052245 1924 1689 1576 949 21964 95 2803 84 --
NM_002264chr364800 3336 1217 572 543 247 --11137 14139
NM_002265chr172858 828 ------
NM_002266chr17165 --1207 --
NM_002267chr1382418 2074 858 729 263 247 228 206 --22148 257 --
NM_002268chr3--1344 ----
NM_002270chr564553 3907 2003 1611 1473 666 14045 --14956
NM_002309chr22103069 2915 2877 2762 2678 2067 1140 1133 1081 729 --22385 2058 --
NM_002310chr595795 5280 5239 5092 4401 1887 1794 1362 508 --11943 45853 5165 4681 2339
NM_002312chr131770 ------
NM_002313chr1055038 3126 984 618 261 --24937 4032 --
NM_002334chr1161798 1311 800 738 132 21 ------
NM_002336chr1254765 3386 721 678 548 ----11235
NM_002355chr122879 195 1448 1178 --
NM_002356chr6----22859 2361 --
NM_002359chr17113981 3931 3850 3312 2915 2789 2761 1685 1603 126 67 --13759 11637
NM_002374chr221333 1007 --21189 928 --
NM_002384chr181958 ------
NM_002395chr621038 27 ------
NM_002397chr512141 --11791 --
NM_002398chr21433 11075 ----
NM_002401chr1742376 1837 1710 596 11721 21897 1693 --
NM_002430chr2242061 655 138 48 ------
NM_002480chr1231419 1019 1001 ------
NM_002481chr1147454 6808 6573 5965 5927 2798 2159 1959 858 624 606 545 196 180 1145 14926 --
NM_002486chr962082 1758 1624 696 273 184 ------
NM_002499chr1522438 1550 --1933 --
NM_002500chr21191 --1492 --
NM_002501chr1943398 3247 2988 456 13411 --13841
NM_002508chr14617 479 371 180 21822 526 1363 --
NM_002514chr831186 122 111 --1458 --
NM_002515chr14----11843 1214
NM_002519chr1151459 1071 551 354 162 ------
NM_002526chr621689 1654 1213 1646 --
NM_002545chr11104169 4132 1398 1159 1128 996 960 893 734 442 --24187 3791 --
NM_002546chr82752 241 ------
NM_002547chrX74103 3364 1671 1645 1274 342 117 --11451 1241
NM_002552chr211320 --31278 1238 1099 --
NM_002553chr72442 101 ------
NM_002556chr1172125 1853 1789 1776 1662 1579 1456 --11726 --
NM_002568chr82438 140 ------
NM_002577chr313727 1526 2724 506 --
NM_002578chrX2399 149 ------
NM_002581chr9115351 4696 4294 4139 3685 3627 2255 2142 1231 858 112 1864 34198 1218 1212 14873
NM_002583chr121398 --181 --
NM_002594chr2062339 1622 1539 908 223 184 --22430 2273 11644
NM_002601chr22510 413 ------
NM_002605chr151962 ----1993
NM_002610chr242459 2234 2088 851 --12317 --
NM_002613chr16124972 4824 4056 3675 3258 1563 1528 1521 1435 1420 730 344 --2592 550 --
NM_002618chr21381 ------
NM_002634chr175870 723 609 222 156 ------
NM_002641chrX--1126 --21646 267
NM_002644chr161446 613 354 120 93 23 --1184 --
NM_002645chr1142690 1984 906 640 ------
NM_002646chr191966 1859 1425 1378 1355 800 598 500 68 ------
NM_002649chr791730 1697 1489 1131 477 452 291 146 130 --1283 --
NM_002655chr823251 1604 43605 2002 1719 1063 1568 --
NM_002657chr2073662 3582 3186 3042 2867 2651 1464 --22554 1275 --
NM_002667chr611255 ------
NM_002709chr263623 3237 3209 3084 749 445 11039 11288 --
NM_002716chr1153488 3384 2282 2238 1194 --13222 --
NM_002717chr8------172
NM_002718chr372571 2036 1867 651 369 349 307 --22213 819 --
NM_002719chr1432436 2122 868 ------
NM_002731chr142190 908 843 302 1264 23102 2240 --
NM_002736chr731895 1632 886 ------
NM_002737chr17105504 5252 5000 2664 2386 1436 1357 1070 272 67 15920 ----
NM_002744chr1156 ------
NM_002745chr2263895 3028 1450 1222 472 210 ----13919
NM_002748chr151372 ------
NM_002763chr11514 ------
NM_002787chr71493 ------
NM_002790chr1156 ------
NM_002803chr7--150 ----
NM_002825chr71442 ------
NM_002829chr941036 867 297 275 ------
NM_002833chr1581430 1328 1179 1117 373 246 220 40 --11354 --
NM_002839chr953035 2661 2531 2289 1136 ------
NM_002841chr31638 ------
NM_002844chr6------1477
NM_002847chr711441 --21585 1509 --
NM_002849chr123959 726 290 --1688 1935
NM_002855chr1163432 3043 2711 2704 1038 298 13033 22672 1384 --
NM_002858chr141399 442 374 349 --1238 --
NM_002868chr1252245 1670 617 320 65 --1394 --
NM_002869chr1122069 426 --1418 --
NM_002871chr171778 1667 566 292 280 217 166 --11614 --
NM_002873chr51390 ------
NM_002888chr3145 ------
NM_002906chr1152373 1916 1899 777 638 ------
NM_002912chr6----1796 --
NM_002918chr193886 758 150 ------
NM_002940chr431287 718 413 ------
NM_002941chr351588 1249 1240 1082 188 --1210 --
NM_002942chr321077 470 ------
NM_002948chr331174 1166 947 1307 ----
NM_002959chr173997 3939 3492 2944 1267 897 423 13421 24062 62 --
NM_002968chr162907 412 ------
NM_002971chr33865 459 420 1372 ----
NM_002977chr242850 1274 1205 141 --12289 --
NM_002994chr43583 520 373 --1606 1660
NM_002998chr831924 1853 445 --2304 22 --
NM_003010chr1752382 2291 1875 1544 717 --11811 11756
NM_003014chr721232 39 ----11187
NM_003016chr1731419 603 102 ------
NM_003029chr1258 52 --11022 --
NM_003030chr331383 230 142 --11415 --
NM_003032chr342615 1834 1094 582 1373 1555 1183
NM_003034chr12108141 8103 5317 4916 3126 3076 2375 1492 600 194 37375 7118 6904 27034 3052 15467
NM_003042chr311804 11899 1688 22057 837
NM_003043chr363940 3761 3448 3148 1603 1516 24308 700 13095 14206
NM_003045chr1354982 4063 3419 2021 1543 11166 33342 1611 343 --
NM_003051chr13738 535 160 ------
NM_003060chr521036 922 ------
NM_003069chrX1669 --1764 --
NM_003070chr95859 748 717 553 49 ------
NM_003071chr321905 551 --11385 11952
NM_003073chr221243 ------
NM_003074chr391791 1690 1609 849 735 642 525 259 237 ------
NM_003076chr1261682 1606 1045 619 180 53 2523 427 31537 1376 681 --
NM_003077chr171685 1182 ----
NM_003079chr171325 --1694 --
NM_003106chr3------11041
NM_003108chr256073 5692 5103 4912 1866 1858 11615 --
NM_003111chr231347 1247 65 ------
NM_003112chr743018 1154 823 468 ----23221 416
NM_003134chr15--1391 ----
NM_003140chrY1126 ------
NM_003149chr331377 1247 1213 --11157 --
NM_003155chr822216 506 --21138 110 --
NM_003161chr1773516 3465 3129 2444 2203 2195 258 11203 --11147
NM_003168chr173938 244 96 2781 395 --1695
NM_003178chr321755 1466 11491 1139 --
NM_003188chr61613 170 ----
NM_003189chr152827 1013 742 695 336 --21298 328 --
NM_003199chr1862232 1704 811 588 92 51 11439 11768 --
NM_003201chr101677 ----1338
NM_003211chr1251783 1639 1342 619 506 11677 ----
NM_003216chr2293256 3139 2500 1074 943 661 406 331 184 ----165
NM_003217chr1262032 1895 1671 1242 777 136 --11445 --
NM_003221chr684112 3892 3884 3639 3111 2897 1346 1049 11301 ----
NM_003234chr31233 21784 1547 22348 1556 --
NM_003236chr283573 3539 3445 3325 3161 2789 1412 108 --12387 --
NM_003238chr11215 ------
NM_003242chr342534 2293 683 598 1352 --1126
NM_003257chr1531245 1215 68 ------
NM_003262chr384351 3873 3693 3671 3527 3239 2027 1908 --23921 1070 11463
NM_003269chr61504 11129 ----
NM_003272chr13725 173 89 ------
NM_003275chr911486 ------
NM_003286chr2031176 425 180 ------
NM_003290chr194836 275 254 237 ------
NM_003300chr141332 ------
NM_003320chr1194241 4133 3992 3978 3584 3576 794 604 133 13726 34380 3605 1406 --
NM_003336chrX4186 164 144 67 ------
NM_003337chr571609 1444 1196 1126 607 479 326 --1451 --
NM_003342chr1762789 2260 1085 993 968 945 13266 21216 398 --
NM_003344chr741762 1678 531 41 ------
NM_003348chr1221627 252 ----11214
NM_003360chr41117 ------
NM_003368chr11120 ------
NM_003373chr1081868 1432 1355 1259 1251 502 340 243 ------
NM_003376chr641805 1419 699 134 --1402 --
NM_003376chr641805 1419 699 134 --1402 --
NM_003387chr252422 2107 1984 357 76 --12058 12807
NM_003392chr332710 1314 1182 --34059 2971 2936 12699
NM_003403chr141201 ------
NM_003404chr2031356 820 704 11546 --11448
NM_003406chr841758 1752 1653 1630 --11230 --
NM_003409chr1821280 383 ------
NM_003410chrX62884 2254 2047 681 562 250 12490 ----
NM_003411chrY41843 1503 1328 174 ------
NM_003412chr352679 2111 992 865 32 --12855 --
NM_003420chr35650 579 262 111 53 190 ----
NM_003432chr5174 ------
NM_003452chr91749 --1918 --
NM_003453chr131658 ------
NM_003463chr653134 2671 2654 2254 430 12696 --12361
NM_003469chr2--1322 ----
NM_003474chr1042166 1962 531 370 --22049 1566 1887
NM_003489chr2152999 2783 1166 1075 929 ------
NM_003558chr92593 198 ------
NM_003566chr1242937 1136 923 911 --23440 2306 --
NM_003574chr1875691 5220 4864 3974 1592 1233 551 --15600 13926
NM_003576chr1332745 1872 679 --12727 --
NM_003580chr83596 404 38 ------
NM_003583chr1211240 ----13028
NM_003590chr263341 2869 2815 1608 955 581 --23705 637 1206
NM_003597chr23925 472 178 ------
NM_003603chr421579 219 --11630 --
NM_003607chr173303 1106 917 896 745 422 39 --34193 3854 493 --
NM_003615chr3----32713 781 478 --
NM_003618chr21990 ------
NM_003626chr112998 356 ------
NM_003628chr21195 ------
NM_003629chr163190 2817 2490 1201 911 184 ------
NM_003632chr172836 69 1849 1220 --
NM_003633chr562220 2089 1890 1883 1746 536 ------
NM_003635chr103516 429 43 --1530 --
NM_003654chr11178 ------
NM_003657chr202777 55 ------
NM_003663chr392789 2583 2282 2202 2129 1343 925 498 318 ------
NM_003670chr321356 49 --11028 --
NM_003671chr983496 3236 2766 2712 2585 2228 952 411 --1317 1927
NM_003672chr131942 633 484 --1685 --
NM_003692chr9191 ------
NM_003701chr134679 312 273 234 ------
NM_003716chr32659 56 1989 1282 --
NM_003722chr33888 270 87 1319 125 --
NM_003749chr1352423 2019 1920 1665 556 ----1954
NM_003750chr101818 1148 ----
NM_003758chr1541616 1526 1018 1009 --11084 --
NM_003758chr1541616 1526 1018 1009 --11084 --
NM_003759chr4123855 3821 3136 3074 2987 1245 1166 1042 818 436 423 321 --1753 24198 700
NM_003762chr121361 228 ------
NM_003768chr141814 748 602 369 --11563 11793
NM_003787chr1831514 1323 1126 ------
NM_003794chr331029 772 368 1440 --1384
NM_003796chr191563 ------
NM_003799chr1873916 3521 3417 3254 3180 3050 260 ------
NM_003800chr61481 12088 --1500
NM_003819chr1381 70 39 ------
NM_003822chr162997 2975 2896 2843 823 522 ------
NM_003825chr1521559 1145 ------
NM_003829chr91164 ------
NM_003842chr842424 1942 1914 34 22532 846 22437 596 --
NM_003861chr1432743 603 424 --12713 --
NM_003862chr52255 103 ------
NM_003864chr41169 ------
NM_003877chr122645 212 ------
NM_003884chr32716 598 ------
NM_003887chr232257 884 113 ------
NM_003888chr1521360 103 ------
NM_003895chr21--1870 31846 1389 278 12069
NM_003899chr1332458 2166 553 ------
NM_003913chr684159 3623 3534 3111 3078 831 627 397 12931 --14055
NM_003916chrX--11057 ----
NM_003918chrX3590 372 117 ------
NM_003927chr182867 50 ------
NM_003930chr732525 821 749 --1557 --
NM_003931chr61531 ----1107
NM_003932chr223211 134 56 --11863 --
NM_003934chr9--11293 11170 --
NM_003983chr1684121 3545 2790 1744 1564 1155 498 475 --44253 3244 2700 1305 1372
NM_003986chr111105 ------
NM_003992chr151293 ------
NM_003993chr1------1119
NM_003994chr1283161 3147 2848 1725 1706 1688 1670 244 11137 13947 --
NM_004006chrX150 ------
NM_004007chrX150 ------
NM_004009chrX150 ------
NM_004010chrX150 ------
NM_004011chrX150 ------
NM_004012chrX150 ------
NM_004013chrX150 ------
NM_004014chrX150 ------
NM_004015chrX150 ------
NM_004017chrX150 ------
NM_004020chrX150 ------
NM_004024chr121538 95 ------
NM_004028chr18113472 3378 3019 2979 2948 2740 2699 1060 494 354 36 12989 ----
NM_004035chr1764733 3181 1820 1438 1286 1036 --24649 3889 --
NM_004055chr114747 525 286 266 --11722 --
NM_004061chr51638 1228 ----
NM_004081chrY31828 1399 226 ------
NM_004085chrX1241 1670 --2519 305
NM_004086chr141643 ------
NM_004089chrX11209 --1411 --
NM_004093chr1372809 2707 2570 2178 492 478 205 --23288 1269 --
NM_004096chr1051919 795 616 438 298 1335 22134 192 1460
NM_004098chr1021182 938 ------
NM_004100chr642663 2638 466 194 ------
NM_004109chr111789 1578 --1441
NM_004112chr1761640 1257 1241 1102 442 29 ------
NM_004113chr341827 1779 1635 1599 11593 ----
NM_004124chr1423496 2742 --13047 2635 202
NM_004134chr54618 586 217 130 ------
NM_004136chr1552958 958 796 547 72 22291 2033 --1817
NM_004161chr241446 1364 1161 992 ------
NM_004171chr11158885 7462 7437 7396 6453 2529 2519 2031 1477 1439 1401 923 657 407 49 36518 3501 1223 35952 3442 1239 --
NM_004172chr541802 1341 1274 632 2717 299 ----
NM_004229chrX52173 2057 1909 706 456 ------
NM_004236chr153479 57 29 ------
NM_004249chr4182 ------
NM_004253chr92917 874 ------
NM_004261chr1239 23 ------
NM_004272chr521429 649 ------
NM_004279chr722040 375 ------
NM_004290chr561255 1035 490 437 412 42 --11162 --
NM_004293chr992989 2677 2461 1417 1291 1089 1071 348 287 11451 13004 11127
NM_004301chr31238 ------
NM_004304chr2139 --1289 --
NM_004319chr1102767 2628 2431 2039 1283 560 381 365 295 151 --1653 --
NM_004323chr932446 184 125 --11853 --
NM_004329chr1041363 1258 1107 510 ------
NM_004331chr861739 905 481 317 223 110 1188 ----
NM_004338chr1865729 4808 2561 2516 2508 1049 --15195 --
NM_004349chr841267 1201 1046 118 --1292 --
NM_004352chr162119 108 --1178 --
NM_004370chr61491 12166 ----
NM_004380chr1621848 85 12589 11637 1801
NM_004384chr532094 1679 182 --12320 12027
NM_004385chr51279 --168 --
NM_004392chr1342400 1875 907 540 --22259 1740 11899
NM_004397chr1164082 3706 2884 1199 463 403 1852 ----
NM_004417chr5----1104 --
NM_004426chr1251680 1590 1318 691 304 21952 721 --1793
NM_004430chr81896 22537 397 12770 --
NM_004432chr922060 1569 ----12200
NM_004434chr1411247 ------
NM_004440chr631898 387 273 ------
NM_004447chr121254 ------
NM_004451chr112692 586 ------
NM_004454chr341730 1649 275 95 ------
NM_004460chr2--145 ----
NM_004481chr152413 2225 2028 984 874 11808 42162 1696 850 641 --
NM_004482chr22928 660 ------
NM_004485chr1103792 3390 2863 2792 2781 1416 1204 1171 376 102 151 12702 --
NM_004486chr95863 779 374 120 66 11054 ----
NM_004492chr151230 ------
NM_004496chr1421038 416 ------
NM_004500chr1442050 1927 1269 369 21483 223 1649 --
NM_004501chr133850 3638 977 ----13306
NM_004505chr1732014 1636 1314 ------
NM_004515chr13355 231 23 ------
NM_004521chr101262 1330 ----
NM_004525chr221040 983 --1115 1414
NM_004529chr91390 ------
NM_004532chr33374 162 46 ------
NM_004537chr1231554 1186 57 ------
NM_004540chr213717 309 60 --1698 --
NM_004554chr1441656 1155 643 596 --11364 --
NM_004571chr2152648 2175 1183 569 291 --12949 --
NM_004575chr421386 483 ------
NM_004576chr51312 ----1107
NM_004586chrX135156 4912 4686 4617 4434 3656 2179 1953 1940 1595 1009 850 833 --14922 --
NM_004588chr11103716 3613 3101 3071 3065 3059 2735 1228 1054 260 156 ----
NM_004595chrX1103 ------
NM_004598chr552942 2533 2271 1127 1056 --23190 54 3637 558 116
NM_004600chr121333 232 ------
NM_004612chr9----33248 1358 701 14811
NM_004622chr22813 792 --1486 --
NM_004626chr11----1603 --
NM_004631chr121246 1095 ------
NM_004654chrY--11352 1895 --
NM_004655chr1731120 364 303 11187 ----
NM_004660chrY31632 623 182 ------
NM_004686chr831385 680 514 ------
NM_004687chr1721386 442 ----12121
NM_004690chr62505 136 ------
NM_004696chr13831 788 552 ------
NM_004698chr11187 ------
NM_004703chr1732199 1888 324 ------
NM_004717chr741524 1401 356 55 --1254 1377
NM_004719chr1232031 883 504 ------
NM_004725chr1021290 1269 --11247 11397
NM_004726chrX84435 3806 1502 978 813 569 277 238 25634 359 13642 --
NM_004730chr531672 224 89 ----22124 768
NM_004734chr1332159 925 667 ------
NM_004736chr141729 1429 143 38 11626 11774 --
NM_004742chr381872 1819 1771 1678 1486 435 112 47 --21260 624 --
NM_004745chr8196224 5977 5910 5728 5175 5008 4793 4626 2426 2326 1939 1912 1668 1120 957 932 795 513 421 26313 1799 14899 36964 2023 1783
NM_004748chr1534216 1429 1148 23178 710 11437 --
NM_004759chr161614 1568 673 232 70 62 --11420 --
NM_004770chr81248 ------
NM_004772chr5------1450
NM_004775chr1852173 1846 657 200 181 ------
NM_004781chr141110 468 445 97 --11087 --
NM_004781chr141110 468 445 97 --11087 --
NM_004788chr1141818 714 296 175 ------
NM_004796chr1441616 744 549 188 --12301 1767
NM_004797chr363046 2824 2756 2606 1296 690 1289 22744 710 --
NM_004801chr241427 1165 628 222 --11448 --
NM_004804chr252146 944 808 563 377 1658 12694 --
NM_004808chr1073179 3014 2934 2593 2106 1213 826 ------
NM_004815chr1104853 4540 4107 4100 4037 3419 3260 3243 3225 313 13590 13895 --
NM_004831chr191943 1270 ----
NM_004834chr223419 3009 ------
NM_004835chr33820 685 301 ------
NM_004835chr33820 685 301 ------
NM_004841chr131157 1084 50 --21031 204 --
NM_004844chr31891 --1283 --
NM_004845chrX94137 4048 3916 3812 3371 1388 848 771 280 11214 11662 --
NM_004849chr63510 359 35 --1525 --
NM_004850chr221622 704 ----1156
NM_004857chr14114380 4256 3916 3584 3457 3019 1905 747 602 504 105 13139 14152 --
NM_004859chr1752603 2035 769 671 171 ------
NM_004866chr555062 4208 3545 1078 586 --33403 1429 412 --
NM_004867chrX1110 2702 685 ----
NM_004869chr1821495 182 ------
NM_004871chr1784172 3755 3366 1671 1651 1052 537 257 ------
NM_004893chr51539 ------
NM_004896chr1031072 403 255 ------
NM_004897chr102363 266 --1793 --
NM_004898chr432303 1975 630 --1538 --
NM_004904chr7106096 5235 5182 5168 4467 2446 2358 1793 1699 1082 --26362 639 15475
NM_004932chr511415 ------
NM_004952chr13896 306 286 1630 --1638
NM_004956chr753467 3228 3002 1840 445 ------
NM_004985chr1243513 1322 1009 510 22764 496 2854 357 --
NM_004990chr12----168 --
NM_004992chrX198248 8145 8088 7912 7078 6359 5976 5383 3049 2875 2513 2506 2237 2228 2106 1511 1404 1291 862 28549 8259 57778 3064 2458 2012 67 18517
NM_004992chrX198248 8145 8088 7912 7078 6359 5976 5383 3049 2875 2513 2506 2237 2228 2106 1511 1404 1291 862 28549 8259 57778 3064 2458 2012 67 18517
NM_004993chr142995 453 --11348 --
NM_005010chr72448 34 1401 --11891
NM_005021chr61108 --1278 --
NM_005032chrX1824 ------
NM_005056chr1244640 4482 4131 886 --34425 1698 421 --
NM_005057chr121749 1569 21615 499 1365 --
NM_005065chr1445239 4875 898 134 --13726 --
NM_005074chr6----144 --
NM_005079chr823048 174 1657 23122 3005 11220
NM_005096chrX7897 886 441 424 382 145 136 --11087 --
NM_005114chr4132 ----1238
NM_005116chr2054149 3539 3458 2920 566 --3978 906 191 1345
NM_005121chr1762847 2803 1464 1303 510 185 ------
NM_005126chr331925 1685 199 --1313 12153
NM_005134chr18----1313 --
NM_005135chr1553524 2701 2406 1111 1005 13440 --1825
NM_005151chr181433 22272 206 12064 --
NM_005153chr163766 752 521 ------
NM_005155chr62515 441 --1605 1697
NM_005156chr985355 5342 4321 3429 3352 1059 1006 448 1342 14105 1283
NM_005160chr22116727 6101 6013 4950 4778 4750 4705 2734 2504 1134 157 14254 24273 1630 --
NM_005171chr12156 ------
NM_005180chr101168 ------
NM_005181chr8181 ----1238
NM_005188chr11107286 6791 5789 5552 3056 2834 2741 2276 1920 1292 27116 5958 37932 6496 2367 13286
NM_005190chr621128 923 ------
NM_005192chr142123 50 ------
NM_005197chr1485379 4569 3832 3822 2220 2007 1928 807 23796 1142 1758 --
NM_005201chr31276 ------
NM_005203chr101408 ------
NM_005214chr2--1360 ----
NM_005215chr182511 216 ------
NM_005233chr341801 589 494 175 12227 ----
NM_005235chr297138 6718 5938 5795 5162 2548 2529 694 447 --37026 1914 411 26191 5770
NM_005239chr212719 136 ----11973
NM_005241chr321190 1162 196 ----
NM_005244chr201475 ------
NM_005252chr143190 119 87 ------
NM_005256chr112946 825 ------
NM_005257chr1811102 --1887 --
NM_005259chr231333 433 29 --1526 1261
NM_005274chr11144 --140 199
NM_005302chr7------181
NM_005308chr102348 54 ------
NM_005313chr1551126 1102 909 363 149 11183 ----
NM_005316chr113959 946 440 ------
NM_005324chr1722120 1670 ------
NM_005328chr82706 250 1283 1557 --
NM_005339chr474314 4069 3161 1616 1035 245 156 --14078 --
NM_005347chr921447 1208 ------
NM_005359chr1895178 4071 3976 2370 2201 1953 749 713 31 --15350 11686
NM_005370chr1921261 1170 ------
NM_005373chr161505 1327 635 478 69 28 ------
NM_005374chr1782269 2249 1911 1606 874 801 442 93 ------
NM_005385chr342712 2505 538 309 ------
NM_005392chr921591 1552 ------
NM_005399chr173583 1515 1252 1086 618 555 335 24014 1129 --1489
NM_005407chr14101585 1533 1386 1258 1211 451 275 146 125 101 --11278 --
NM_005409chr421078 421 ------
NM_005410chr51598 1736 --1678
NM_005413chr21433 ------
NM_005433chr1832168 2151 1948 11934 1909 12377
NM_005437chr1041107 1043 391 307 ------
NM_005442chr32546 137 ------
NM_005443chr44228 153 126 106 ------
NM_005445chr102269 232 ------
NM_005458chr951768 1624 1541 250 193 --2807 208 --
NM_005475chr1232996 2275 781 --31262 267 209 --
NM_005486chr172264 51 ------
NM_005487chr2251926 1556 1361 581 30 ------
NM_005497chr17146139 5870 5579 5239 4526 4335 3962 1932 1585 1574 1294 928 881 673 --14684 1405
NM_005502chr952237 1112 1087 732 268 22637 2464 22497 766 --
NM_005504chr1265718 5192 4026 1293 1147 969 36515 850 680 45820 5369 2129 1190 --
NM_005509chr511189 1413 179 --
NM_005544chr2------1758
NM_005546chr572264 2203 2121 2033 1818 1608 134 12286 11596 --
NM_005578chr384826 4704 4174 3682 3202 1842 954 415 --33486 1605 293 11534
NM_005584chr13177 --2246 50 --
NM_005585chr151314 ------
NM_005595chr11306 ------
NM_005596chr975762 4961 4945 2195 1408 793 776 --26421 395 --
NM_005603chr1871777 1471 1244 760 613 315 197 --11672 --
NM_005604chr6185 ----12532
NM_005613chr162116 1927 1888 1833 220 41 --12068 --
NM_005625chr83257 243 195 --1675 --
NM_005639chr123604 337 107 ------
NM_005647chrX83482 2909 2603 2326 2245 653 435 71 --13305 12780
NM_005664chr1521037 185 1925 2947 67 --
NM_005665chr164658 4142 1903 1512 1476 1436 14010 14454 11491
NM_005715chr632148 1774 73 11137 ----
NM_005722chr22813 206 --1288 1278
NM_005725chr11643 1708 11920 12228
NM_005734chr111542 --1712 --
NM_005739chr1552448 369 328 154 53 ----1778
NM_005742chr22634 79 ------
NM_005746chr712783 22483 582 ----
NM_005748chr1243426 2915 1039 318 --12777 13023
NM_005754chr521063 948 ------
NM_005766chr1331160 977 354 ----1939
NM_005775chr81283 ------
NM_005776chr14----1133 1560
NM_005801chr171794 ------
NM_005802chr91114 --1632 --
NM_005808chr353334 3195 2350 388 78 13146 1292 --
NM_005826chr12490 221 ------
NM_005828chr1724989 4637 14756 --13274
NM_005832chr331440 470 108 1445 1993 --
NM_005840chrX157033 6872 6866 6563 6242 4717 2176 1362 1353 1194 1097 722 682 664 547 56288 6172 5104 1835 1325 45227 5096 4763 467 12921
NM_005841chr43863 459 122 --21060 100 --
NM_005843chr241949 584 298 266 ------
NM_005853chr161114 ------
NM_005857chr131384 1361 542 ------
NM_005859chr52344 303 1584 ----
NM_005862chr321037 34 ------
NM_005868chr762294 2062 524 436 206 85 ------
NM_005871chr101281 1763 11023 2886 60
NM_005895chr1294158 3746 2826 2742 2622 1601 1561 1277 1106 --1404 --
NM_005898chr1172886 2659 2301 1976 1244 915 419 12001 21068 833 --
NM_005901chr18128694 8666 8317 8292 7637 7404 7386 7308 7200 6327 2613 2178 23310 2116 37920 7646 75 31684 1620 162
NM_005902chr1544559 3572 3471 3282 --23143 1569 --
NM_005903chr573998 3504 1403 1171 1082 927 820 ------
NM_005906chr631311 1159 150 ------
NM_005911chr26488 463 432 304 193 84 --1548 1498
NM_005920chr1103286 3014 2912 1491 1214 1155 980 848 69 32 1898 --13388
NM_005923chr62550 170 ------
NM_005924chr7----1839 --
NM_005927chr52455 202 1406 ----
NM_005933chr11112914 2715 1188 1058 846 812 738 656 555 506 273 1147 22527 2154 --
NM_005941chr821647 84 22674 1145 ----
NM_005955chr174493 4267 4092 4035 3801 1703 1592 14302 35114 3875 423 --
NM_005964chr1711231 11180 ----
NM_005966chr222046 1662 --1955 --
NM_006011chr1594093 3431 3141 2966 2765 1359 1211 1118 932 --23887 3681 --
NM_006016chr642198 1896 481 271 ------
NM_006036chr242293 917 487 233 1523 ----
NM_006047chr2042983 1318 635 70 ------
NM_006064chrX4397 120 113 43 --1329 --
NM_006079chr61232 ------
NM_006080chr741151 856 189 172 --1257 --
NM_006095chr434272 1676 38 11082 ----
NM_006106chr1142689 997 893 142 ------
NM_006113chr141921 1497 625 131 ----11872
NM_006122chr1532451 2156 1962 11104 ----
NM_006135chr141253 463 387 327 ------
NM_006136chr711012 --1865 --
NM_006139chr221963 109 12814 2698 542 11908
NM_006141chr1642789 2452 1081 1029 ------
NM_006153chr3----1201 --
NM_006154chr1542559 762 537 321 ------
NM_006157chr111277 ------
NM_006158chr821820 1249 ----11466
NM_006162chr1821428 407 ------
NM_006178chr1741398 557 320 109 --1163 --
NM_006203chr584400 4005 1878 1620 1584 1531 1311 1110 1757 11973 --
NM_006206chr462902 2590 2554 2474 2252 745 ----1806
NM_006209chr81159 1397 ----
NM_006210chr1941172 1107 271 136 ----1916
NM_006224chr17102430 2409 2396 2067 1724 857 672 653 501 136 --2934 620 11753
NM_006226chr22550 223 21363 106 ----
NM_006239chr4173 ------
NM_006246chr1441228 1164 1101 148 --1323 1449
NM_006251chr522245 428 ----11287
NM_006265chr81485 11025 ----
NM_006267chr241616 699 585 522 --11246 --
NM_006275chr202502 43 ------
NM_006281chr821111 284 --1360 --
NM_006281chr821111 284 --1360 --
NM_006283chr864197 1490 618 556 247 72 11558 --14375
NM_006300chr1941659 782 286 220 12454 21818 1812 12115
NM_006306chrX125086 4990 4728 4582 4346 4340 1894 985 635 585 36 25 12023 45926 5918 4367 3951 --
NM_006317chr51109 1132 284 72 --
NM_006343chr22484 95 ------
NM_006350chr5--1249 --2355 324
NM_006352chr111269 ----158
NM_006364chr141374 1103 ----
NM_006371chr354911 4822 3677 709 138 15030 31129 567 174 --
NM_006380chr1793712 3282 3150 3060 2770 1696 1665 1417 130 23865 559 1146 --
NM_006390chr1211739 ----11379
NM_006393chr1083624 2920 1475 1333 765 749 581 195 11618 23225 823 13397
NM_006419chr4141 1188 --1752
NM_006420chr2043247 2965 2533 2485 --21182 692 12696
NM_006421chr83964 797 73 --1259 --
NM_006422chr12150 190 ----
NM_006424chr431374 728 565 21549 1529 1405 --
NM_006434chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_006451chr5------1178
NM_006457chr483998 3165 3035 2944 2803 2739 1245 638 --13591 --
NM_006459chr1061755 1650 1545 757 646 322 21551 215 11899 --
NM_006460chr1751407 1350 1188 302 242 11167 ----
NM_006469chr111506 1428 ----
NM_006482chr1211240 ----13028
NM_006489chr14----11843 1214
NM_006496chr111501 --11894 --
NM_006520chrX21169 644 ------
NM_006526chr2041934 622 466 270 --1260 --
NM_006544chr1462015 1375 1085 754 262 99 25257 1198 25472 4406 --
NM_006546chr17116199 5990 5918 4937 2647 2634 2441 1518 1056 868 600 --44667 4097 2507 1880 --
NM_006547chr721673 84 ------
NM_006549chr1262546 2503 1894 1171 871 815 ------
NM_006559chr11146 ------
NM_006561chr10165554 5190 4833 4185 3944 2387 2271 1899 1691 1532 1187 1112 642 503 352 22 --24045 90 --
NM_006572chr1793523 3249 2493 2190 1112 921 892 462 352 12689 23131 3023 --
NM_006575chr14--11263 21350 473 --
NM_006591chr1131819 421 338 --11828 1555
NM_006595chr1152043 1918 1891 1603 540 ------
NM_006599chr16127293 6583 5868 5803 5651 5639 3154 2589 1156 295 280 213 1929 ----
NM_006601chr121220 ------
NM_006603chrX1102 ----1629
NM_006614chr352783 2637 2563 1239 580 --13224 13430
NM_006618chr11212 --21459 132 --
NM_006621chr13654 500 307 ----1111
NM_006626chr952436 617 592 323 237 --22152 796 --
NM_006628chr1584095 4027 3197 1606 1244 1010 818 49 14259 24015 372 --
NM_006629chr1872512 1855 1813 1786 1099 351 208 12460 --12186
NM_006633chr51581 ------
NM_006654chr12134778 4137 3972 3803 3546 3506 3211 3111 1859 1568 1493 890 174 1784 44541 4171 4161 3534 --
NM_006675chr1293209 2253 1316 1168 1115 942 630 527 41 ------
NM_006690chr2081688 1643 1520 941 862 541 304 244 11552 22003 21 --
NM_006691chr1161056 403 208 197 120 53 11122 1186 --
NM_006698chr202920 148 1196 ----
NM_006704chr131319 ------
NM_006706chr52298 220 ------
NM_006708chr631197 1141 954 --2995 137 --
NM_006717chr943387 3377 2650 104 --13300 --
NM_006720chr1055038 3126 984 618 261 --24937 4032 --
NM_006722chr342889 2398 2214 2058 12623 ----
NM_006726chr421137 1118 --11076 --
NM_006729chrX105604 5189 4990 4572 4313 3492 2036 1696 1606 423 11192 23685 885 14020
NM_006734chr611112 ------
NM_006738chr1574452 4428 3892 3697 3113 864 317 --12843 --
NM_006746chrX31437 1084 378 ----1541
NM_006750chr16167943 7493 7055 6644 5847 5458 5192 2820 2358 1432 1353 975 820 635 612 583 27972 7836 15118 26711 376
NM_006751chr23993 920 267 --1173 --
NM_006754chr731213 1129 162 ------
NM_006756chr831402 1173 149 ------
NM_006758chr21121 ------
NM_006763chr172007 1884 1685 1303 571 464 454 ------
NM_006765chr81202 139 ----
NM_006766chr832417 537 469 ------
NM_006775chr621161 354 ----1816
NM_006811chr202990 917 ------
NM_006818chr16810 754 375 365 340 99 ------
NM_006826chr21975 --163 182
NM_006827chr1433295 2473 2365 --12849 --
NM_006832chr144985 907 355 217 ------
NM_006838chr1211870 ------
NM_006850chr13782 698 241 --3829 75 48 --
NM_006851chr1262776 2752 2709 2612 160 153 --1384 --
NM_006852chr1752545 1025 825 555 341 ------
NM_006854chr721996 190 ------
NM_006856chr1241069 1051 807 403 ------
NM_006873chr243582 3065 2441 2258 --21285 246 --
NM_006884chr331383 230 142 --11415 --
NM_006885chr1652872 2600 996 304 242 11120 12699 13446
NM_006888chr1433476 1073 262 12595 ----
NM_006892chr2011427 ------
NM_006892chr2011427 ------
NM_006896chr7----1389 1891
NM_006901chr151506 ------
NM_006908chr731104 439 267 ------
NM_006915chrX3496 332 309 ------
NM_006920chr221965 125 1494 ----
NM_006922chr232424 908 477 1741 ----
NM_006924chr1744046 3652 2849 578 22796 536 43769 3687 1625 1222 --
NM_006930chr512006 ----1645
NM_006939chr14------1919
NM_006941chr2281135 1038 851 822 783 377 292 59 ------
NM_006947chr42442 308 ------
NM_006948chr2132046 205 88 --11989 --
NM_006965chr182938 453 1383 1100 --
NM_006981chr96982 906 808 717 161 100 --1743 --
NM_006997chr10----1453 --
NM_006999chr531799 1654 202 --1533 --
NM_007010chr1741610 1216 708 632 ------
NM_007011chr15205850 5494 5361 4922 4704 4670 4648 2559 2316 2251 2110 1909 1874 1805 1165 580 560 408 359 64 --1306 --
NM_007013chr81220 ------
NM_007026chr172519 446 ------
NM_007036chr52825 32 1904 ----
NM_007038chr2126036 4290 24363 4063 36056 4201 1262 --
NM_007039chr1452282 2034 1988 1723 1668 1474 1305 --
NM_007045chr6----2178 101 --
NM_007050chr20268122 8049 6653 6488 6379 6162 5591 5469 5348 5233 3232 3155 3130 2254 1784 1529 1453 1370 1314 1162 1025 822 783 542 388 137 --47427 6620 5752 1732 16660
NM_007054chr563702 3635 3278 1275 642 415 --13326 189
NM_007064chr3--11529 11046 --
NM_007067chr1721335 1222 ----1430
NM_007106chr1342630 2520 1992 920 --12118 --
NM_007107chr342154 2070 1607 516 ------
NM_007114chr332594 2313 1314 22177 813 ----
NM_007125chrY2366 348 --1292 --
NM_007144chr1711087 ------
NM_007146chr1732711 1851 1802 --2842 561 1384
NM_007166chr1151443 533 421 314 60 --1598 --
NM_007175chr843649 3189 1424 1034 --13018 13258
NM_007192chr1421116 451 --1912 --
NM_007195chr1863476 3244 3152 2657 2606 821 12954 ----
NM_007200chr1574452 4428 3892 3697 3113 864 317 --12843 --
NM_007203chr942977 2921 1562 426 --22588 120 --
NM_007212chr12910 498 ----1630
NM_007214chr621189 839 --11249 --
NM_007217chr31281 ------
NM_007222chr821241 396 ------
NM_007231chrX42051 1538 729 64 --1250 --
NM_007236chr1552441 2376 1892 792 430 3987 538 200 22064 439 --
NM_007249chr1389408 9137 9020 8150 7640 6309 2734 1030 12040 59292 8086 7413 5771 3752 --
NM_007250chrX2592 459 ------
NM_007271chr62288 22 ------
NM_007278chr171104 ------
NM_007282chr31675 ------
NM_007285chr162387 155 ------
NM_007287chr3123180 3165 2759 2513 2463 2160 2079 1139 1015 693 304 66 --22389 2287 --
NM_007288chr3123180 3165 2759 2513 2463 2160 2079 1139 1015 693 304 66 --22389 2287 --
NM_007289chr3123180 3165 2759 2513 2463 2160 2079 1139 1015 693 304 66 --22389 2287 --
NM_007292chr1764733 3181 1820 1438 1286 1036 --24649 3889 --
NM_007294chr1751279 411 402 388 309 --11163 --
NM_007295chr1751279 411 402 388 309 --11163 --
NM_007296chr1751279 411 402 388 309 --11163 --
NM_007297chr1751279 411 402 388 309 --11163 --
NM_007298chr1751279 411 402 388 309 --11163 --
NM_007299chr1751279 411 402 388 309 --11163 --
NM_007300chr1751279 411 402 388 309 --11163 --
NM_007302chr1751279 411 402 388 309 --11163 --
NM_007303chr1751279 411 402 388 309 --11163 --
NM_007304chr1751279 411 402 388 309 --11163 --
NM_007305chr1751279 411 402 388 309 --11163 --
NM_007325chrX3818 583 174 11387 ----
NM_007345chr1852135 1947 1926 1625 823 ------
NM_007350chr1283742 3440 3353 3258 3033 2904 1736 421 --11448 --
NM_007358chr1----11785 --
NM_007361chr14--1579 1682 --
NM_007372chr172898 36 1352 ----
NM_009585chr33820 685 301 ------
NM_009585chr33820 685 301 ------
NM_012072chr2084271 3920 3588 3427 1200 1004 417 138 1239 23756 1333 --
NM_012081chr553732 3181 2967 2869 162 12367 ----
NM_012090chr131232 355 133 1208 ----
NM_012095chr1063110 2949 2939 2501 2197 497 --12290 --
NM_012097chr221417 336 ----11790
NM_012104chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_012104chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_012120chr652525 2486 1863 604 202 --11022 --
NM_012129chr7----12166 12087
NM_012141chr1373197 3133 3000 2684 1517 842 521 --14166 --
NM_012153chr1161773 1039 1018 968 728 272 1200 --1857
NM_012158chr131191 --1351 --
NM_012164chr9107146 6784 6217 6164 5356 5180 2751 1555 1524 911 1603 26933 2863 --
NM_012193chr1144453 4335 1844 1266 24764 3677 12136 --
NM_012199chr164082 3649 3600 744 676 631 --21609 1079 1786
NM_012208chr52685 542 ------
NM_012210chr921280 391 --21133 1014 --
NM_012214chr246214 2160 1365 702 --26244 2392 14522
NM_012232chr1771907 1623 1457 877 856 460 401 --1243 --
NM_012234chr343338 3106 227 81 --11508 --
NM_012243chr12791 292 ------
NM_012247chr10154 ------
NM_012249chr273228 3196 2856 2591 1392 1180 163 ----13274
NM_012257chr72394 221 ------
NM_012262chr184403 4301 3876 3807 3652 3356 865 46 13668 13183 --
NM_012281chr711878 --2983 518 1811
NM_012287chr332973 444 270 --12757 --
NM_012288chr6115333 4190 3759 2031 1916 1887 1471 1021 369 329 74 14265 1358 --
NM_012290chr211710 ------
NM_012294chr794040 3448 3327 3237 3055 3026 2928 1021 474 21119 25 ----
NM_012296chr1183406 3093 2691 2653 1498 1310 315 103 ----12492
NM_012297chr4----12439 --
NM_012301chr741533 1464 809 610 12071 --12087
NM_012308chr1141958 563 413 339 --2688 677 --
NM_012309chr1194254 4107 4059 3552 3379 1869 1573 1172 582 --24620 3632 --
NM_012316chr1135466 5039 4723 4488 4469 3880 3804 1570 1460 1070 849 246 156 --11644 --
NM_012325chr2021251 84 1602 ----
NM_012328chr741292 980 254 201 ------
NM_012329chr1741544 1375 1322 1086 ------
NM_012333chr121446 1247 --21301 1281 1406
NM_012382chr584247 4201 4053 3855 3189 3050 1459 724 --11688 --
NM_012388chr1542804 1094 845 87 1518 21996 116 --
NM_012395chr743165 2337 520 169 12960 22111 125 --
NM_012405chr163441 2956 2582 844 617 40 --1193 --
NM_012413chr21122 1111 ----
NM_012425chr1032300 718 69 --12108 12065
NM_012428chr152753 134 ------
NM_012460chr141238 ------
NM_012461chr144746 480 468 60 ------
NM_012463chr1231613 1455 112 ------
NM_012479chr772665 2218 1931 1753 987 688 273 --32306 678 521 --
NM_012481chr17127 --1574 --
NM_012482chr12504 91 ------
NM_012486chr12376 106 ------
NM_013229chr1232512 2227 224 ------
NM_013231chr14104131 3624 3304 3241 2733 1642 709 702 541 320 ----1468
NM_013233chr241253 971 210 111 ------
NM_013243chr15----1226 --
NM_013249chr112436 127 2180 58 ----
NM_013261chr442699 876 846 66 --12730 --
NM_013262chr631192 382 358 ------
NM_013269chr1274517 4399 3525 3482 1462 418 369 --13506 --
NM_013272chr151407 ------
NM_013281chr2041377 1199 622 72 ------
NM_013286chr3103653 3642 3409 3213 2631 2610 2479 1128 381 72 --43702 2682 2670 1358 --
NM_013293chr73635 101 94 ------
NM_013296chr1166 ------
NM_013309chr1562680 2350 2191 524 94 30 --12396 --
NM_013341chr252887 2712 2423 2243 883 ----12683
NM_013352chr62913 211 ----1753
NM_013372chr1552964 1027 894 771 547 --1229 --
NM_013374chr332570 2218 1021 23021 712 12396 --
NM_013381chr1231877 217 200 ------
NM_013396chr2121566 971 ------
NM_013400chr72368 257 ----2996 972
NM_013410chr121239 1079 ------
NM_013423chrX1972 1270 ----
NM_013427chrX1972 1270 ----
NM_013436chr22734 650 ----1222
NM_013437chr83364 329 166 1457 ----
NM_013438chr921810 601 1379 ----
NM_013444chrX3844 280 203 --1259 --
NM_013446chr751219 510 496 166 57 1503 1188 --
NM_013448chr142650 605 ------
NM_013449chr1262931 2135 534 330 316 162 31073 730 349 1691 --
NM_013450chr241014 867 171 116 ------
NM_013943chr12797 57 11068 12610 --
NM_013989chr14154942 4289 4280 4095 3922 3602 3214 3190 1114 1085 507 407 225 140 90 ----21495 1129
NM_013995chrX22466 358 ----12394
NM_014000chr1081868 1432 1355 1259 1251 502 340 243 ------
NM_014016chr321272 1262 ------
NM_014021chr131358 918 90 11323 22957 132 --
NM_014028chr673044 3038 2969 2903 554 517 508 11290 11045 22734 1337
NM_014031chr52239 119 ------
NM_014034chr63471 198 60 --11331 --
NM_014043chr32283 136 ------
NM_014044chr21164 ------
NM_014057chr931525 1321 506 --1308 1480
NM_014106chr1532042 413 334 ------
NM_014112chr855151 4742 3923 3515 113 ------
NM_014117chr1672608 2556 2136 1899 934 527 417 1709 32366 1039 768 --
NM_014141chr765235 5209 4206 3620 1017 98 24350 509 14227 --
NM_014154chr31508 --21087 338 --
NM_014155chr11126879 6609 6169 6039 5787 5648 5033 2209 2157 1876 1597 444 --24691 1223 --
NM_014157chr1682975 2798 1436 984 695 661 648 630 --191 --
NM_014169chr14252 22 ------
NM_014181chr262768 1937 1160 1119 859 829 --12828 --
NM_014217chr151579 532 506 481 281 --150 --
NM_014232chr172500 229 1138 ----
NM_014232chr172500 229 1138 ----
NM_014233chr1731424 1352 645 --11812 --
NM_014240chr393787 3229 2674 1476 1355 990 720 677 639 ------
NM_014243chr431957 1928 1903 11823 1428 195
NM_014250chr2251926 1556 1361 581 30 ------
NM_014253chrX22113 362 --3635 339 333 --
NM_014263chr1031519 1181 601 ------
NM_014267chr112276 40 ------
NM_014268chr1811024 --11235 --
NM_014271chrX2111 28 1837 ----
NM_014279chr92359 257 1767 ----
NM_014283chr11290 --1340 1206
NM_014294chr821085 464 ------
NM_014309chr22115257 5180 5138 5100 4954 4837 4712 4059 1760 1600 1129 176 35320 3914 1236 --
NM_014323chr222702 394 1338 ----
NM_014331chr4157466 7077 6256 6170 5845 5716 4859 4848 3142 3008 2505 2104 1458 300 182 13116 66463 6124 5476 2220 2180 2140 24931 3046
NM_014333chr1152067 1991 425 239 41 ------
NM_014372chr14736 576 354 116 --21631 767 --
NM_014374chr72368 257 ----2996 972
NM_014376chr572198 2103 771 639 495 145 24 ------
NM_014388chr1135886 5878 5847 5653 5192 4804 4043 3745 1794 1220 1146 369 165 24788 4742 13967 --
NM_014397chr9122 1293 11080 --
NM_014400chr193499 459 107 ------
NM_014421chr41777 11352 --11914
NM_014423chr554320 4305 2131 1450 1405 11384 11849 --
NM_014432chr6----21309 141 --
NM_014445chr342152 1939 1653 975 1462 1122 --
NM_014450chr9----2208 134 --
NM_014494chr1642076 520 494 203 ------
NM_014497chr21235 ------
NM_014504chr721515 151 12014 2793 267 --
NM_014517chr32408 295 21599 1590 ----
NM_014521chr241472 1440 1367 510 --11765 --
NM_014554chr1241450 637 311 231 --1567 1582
NM_014571chr192863 2768 2656 2582 2194 2064 2049 690 526 ------
NM_014572chr1311239 --21400 1378 --
NM_014573chr1761836 1739 1341 1277 439 286 ------
NM_014606chr441322 1121 965 955 1405 ----
NM_014613chr541935 642 157 38 --11229 --
NM_014615chr16103656 3435 3377 3164 2880 2738 2725 2281 591 339 ----13284
NM_014616chr352810 2447 438 66 44 1768 --23522 3277
NM_014623chr63229 69 28 122 ----
NM_014636chr964180 3439 3386 2716 851 612 --21258 725 12881
NM_014647chr1621677 252 11529 ----
NM_014659chr151102 ----11053
NM_014660chr71765 --2803 254 --
NM_014667chr342283 2183 688 245 11743 11903 --
NM_014670chr241047 639 323 86 ----196
NM_014674chr373650 3560 3508 3490 1455 951 197 22742 1119 22657 586 --
NM_014679chr1131189 992 415 ------
NM_014683chr1752196 1771 1658 1392 188 ------
NM_014701chr1511214 --21185 23 --
NM_014702chr6103296 3204 2955 2737 2567 2464 1341 1291 1011 861 --11403 --
NM_014705chr7----1422 1784
NM_014707chr711489 --31748 63 45 1150
NM_014709chr21196 ------
NM_014721chr687228 7070 6996 5722 5207 4836 1959 778 25768 4912 41326 1285 885 312 35465 5442 2087
NM_014730chr12154984 4770 4609 3802 3715 3601 3542 3521 3243 1476 1444 1315 929 786 629 13708 63735 3381 2030 1713 1331 554 --
NM_014730chr12154984 4770 4609 3802 3715 3601 3542 3521 3243 1476 1444 1315 929 786 629 13708 63735 3381 2030 1713 1331 554 --
NM_014733chr52637 368 12181 --11711
NM_014735chrX41956 1669 605 440 --11777 --
NM_014739chr643660 3066 2855 1520 --33897 732 339 --
NM_014746chr273826 1576 1550 616 546 101 29 --21670 1641 1701
NM_014747chr1115676 5473 4694 3960 1957 1939 1751 1401 1369 1228 638 25649 69 31460 1123 702 --
NM_014752chr1111271 11523 41945 622 386 116 --
NM_014755chr273251 2777 2682 1597 1559 1289 1201 23716 448 11302 --
NM_014757chr562298 1842 1637 1623 703 620 141 ----
NM_014758chr1182536 1759 1678 956 612 457 348 320 --21925 206 --
NM_014764chr1251232 1087 989 356 193 ------
NM_014766chr793811 3195 3031 2737 2591 1256 887 596 524 --13783 --
NM_014774chr172561 2145 1315 1141 841 305 212 --1722 --
NM_014776chr12112989 2509 2116 1112 907 633 592 468 419 326 190 22603 779 13051 --
NM_014779chr3----2347 317 --
NM_014795chr211001 --127 --
NM_014803chr1042010 1147 375 184 1489 ----
NM_014810chr132611 780 434 --11048 --
NM_014812chr121544 391 11434 21938 119 --
NM_014819chr531960 738 639 --12213 11730
NM_014826chr173303 1106 917 896 745 422 39 --34193 3854 493 --
NM_014829chr52717 386 ----12392
NM_014830chr1273672 3543 3507 3369 1392 314 193 12597 12583 --
NM_014839chr162015 1972 927 884 499 386 --11983 --
NM_014840chr1263071 2743 2618 2591 330 220 ------
NM_014846chr8138 ------
NM_014850chr394805 4559 4405 4060 3459 1594 1545 334 260 24831 3811 ----
NM_014860chr251796 641 519 123 78 --22525 617 --
NM_014862chr1583864 3056 2889 1674 1399 1346 698 280 --24141 1500 --
NM_014870chr1154483 4177 4109 3847 3504 3354 2893 1262 1068 959 757 589 532 260 81 ------
NM_014873chr183753 3554 3258 1457 1130 898 402 233 14028 2669 477 --
NM_014877chr1777696 7583 7534 6779 5882 1168 980 32790 2302 1496 35834 2454 1323 17059
NM_014888chr71227 11406 ----
NM_014893chrY123 21665 449 1885 11991
NM_014897chr1742969 2762 906 82 --12046 --
NM_014899chr572785 2739 2447 2361 1022 808 372 12226 --11973
NM_014903chr1232114 1934 98 12444 1807 1944
NM_014904chr1053186 2821 641 615 246 ------
NM_014906chr1762914 2713 1338 1004 677 142 --23954 222 --
NM_014912chr101730 --1565 --
NM_014914chr22503 374 ------
NM_014918chr1531322 1306 297 ------
NM_014920chr653799 3242 2692 2419 30 --11363 11241
NM_014921chr1992756 2481 850 818 633 529 522 339 225 --12889 --
NM_014923chr13127 --11903 --
NM_014926chr321153 119 ------
NM_014934chr1333083 2941 473 --13255 23845 1332
NM_014936chr622393 2132 --1722 1463
NM_014945chr581940 1853 1254 608 396 300 170 57 ------
NM_014947chr163163 3033 945 530 220 207 ------
NM_014948chr20112364 2277 2154 2061 1816 924 908 781 329 227 219 --1979 --
NM_014949chr11154 --1174 11024
NM_014953chr1353901 3871 2829 1535 373 24292 1546 11129 --
NM_014961chr441462 830 781 220 ----31941 1768 647
NM_014962chr2032366 2089 1127 12040 ----
NM_014969chr12823 123 ------
NM_014978chr1021295 567 ------
NM_014982chr1442128 1659 274 105 --1291 1674
NM_014991chr452085 915 800 257 225 --1344 --
NM_014996chr33937 417 365 --1150 --
NM_014997chr752977 2862 2174 2155 114 --12896 --
NM_015000chr1263069 2913 2497 2452 2222 487 --12398 --
NM_015001chr11937 --1909 --
NM_015008chr343086 3027 1299 27 --32389 814 421 --
NM_015020chr16113598 2824 1416 1391 1252 1221 1135 1016 791 737 194 --13354 --
NM_015025chr212753 11730 11039 --
NM_015026chr1274603 3757 3624 3168 1717 1220 586 --14288 --
NM_015032chr1311935 ----12558
NM_015035chr20136718 6614 6572 6417 6307 5921 5838 5737 5035 2568 1123 998 424 1336 26191 1777 --
NM_015039chr1114072 3551 3330 1680 1507 1430 1299 1010 903 107 55 --22834 166 1515
NM_015040chr253324 2766 2530 1183 1099 --1778 --
NM_015042chr1584289 3720 3269 2948 1497 1345 1245 491 --14375 --
NM_015045chr1052142 861 764 554 48 --11437 --
NM_015046chr982682 1999 1768 739 726 546 375 135 --22390 2263 --
NM_015049chr293282 2817 2716 2405 2052 1221 1124 602 500 ----22955 2493
NM_015056chr2162297 2161 1972 1820 883 669 12021 1662 --
NM_015057chr131451 ------
NM_015068chr773859 3626 2558 2494 1246 1172 506 23940 3613 13951 --
NM_015071chr596378 4975 4629 4190 4101 1197 575 460 358 --26508 6366 --
NM_015074chr164290 3954 3451 1670 1185 591 ----11519
NM_015076chr653812 3797 2935 959 216 1132 24261 3636 14253
NM_015087chr1331023 117 35 12441 22486 2235 --
NM_015090chr1145931 4850 4724 4621 4090 3984 3824 2133 1358 1338 1136 1077 1008 435 ------
NM_015091chr141673 2313 156 ----
NM_015092chr1694435 3668 3292 3196 2984 1842 1377 650 368 14365 14043 1736
NM_015094chr22134299 4099 3937 3708 3621 3311 2959 1591 1513 824 817 594 553 ------
NM_015097chr31459 ----11513
NM_015101chr182638 2502 2378 2249 2072 2061 832 775 12514 1576 --
NM_015107chrX62173 1978 1888 1650 1559 81 1417 22390 657 12452
NM_015115chr432910 2460 402 ------
NM_015129chrX41710 1260 443 111 11341 157 --
NM_015130chr421082 542 1479 ----
NM_015132chr731785 1769 1719 1560 --11230
NM_015143chr411295 ------
NM_015144chr1683343 2800 2676 1559 1251 848 456 125 --13235 --
NM_015147chr243184 1069 288 154 12677 ----
NM_015153chr62305 201 ------
NM_015154chr1563320 3041 2508 2394 1143 247 --1675 --
NM_015161chr1621045 1031 --21463 1319 --
NM_015172chr131656 509 428 --1314 11325
NM_015176chr141658 1642 1213 1168 ------
NM_015185chrX83021 2214 1893 1097 1065 676 384 306 --22751 700 --
NM_015186chr91124 ------
NM_015191chr1162533 2506 2385 1947 291 103 12717 21676 53 --
NM_015192chr20------12530
NM_015198chr711073 ------
NM_015199chr3102956 2745 2174 2042 1986 1832 1155 902 859 799 --1946 --
NM_015205chr1395219 3956 3934 3895 3353 1470 734 706 662 14138 11407 --
NM_015206chr15103629 3256 2943 2778 2714 2648 2635 2616 488 240 11414 23618 1345 --
NM_015208chr1823914 401 11367 --1784
NM_015225chr962856 2587 2540 2339 2143 442 12654 1192 --
NM_015226chr1662781 2731 2272 977 937 133 --13278 12394
NM_015230chr421751 1168 ------
NM_015247chr1684759 4475 4310 3993 3586 3438 905 168 25257 1640 15308 --
NM_015250chr961690 1673 1496 379 255 36 ------
NM_015254chr892859 2754 2503 2471 2249 2057 935 326 152 --12985 12788
NM_015256chr5----1162 --
NM_015263chr151179 ------
NM_015265chr221854 637 --42068 668 615 270 1428
NM_015271chr443249 3087 1684 152 13373 23386 3098 --
NM_015272chr1641854 1315 402 59 --21607 181 --
NM_015278chr621054 294 1643 13416 --
NM_015285chr1862530 2180 858 564 250 39 --32461 1889 746 11826
NM_015299chr14113817 3473 2721 2528 1556 1389 1285 970 711 376 31 1806 21362 1081 1904
NM_015310chr8148150 7560 5813 3299 3207 3043 2493 2113 1764 1534 1448 1425 1031 989 15776 1865 --
NM_015313chr1164403 4095 3636 3457 1625 937 13350 13464 13246
NM_015314chr742176 757 586 175 --1213 --
NM_015317chr232870 2363 2232 --1448 --
NM_015323chr641458 1226 346 99 --11139 --
NM_015326chr142160 2007 1057 864 12178 21140 67 --
NM_015328chr762782 2431 1965 1921 367 123 12952 22705 361 --
NM_015329chr1982632 2341 1909 972 925 558 146 107 ----22942 2599
NM_015332chr763429 3416 3030 615 74 48 1559 11400 --
NM_015336chr1212653 ------
NM_015347chr1252197 2069 1857 510 245 12227 ----
NM_015349chr642695 2150 2116 2098 --32261 1922 652 --
NM_015365chrX63487 2617 1704 990 598 385 --1708 1262
NM_015367chr2231665 420 385 ------
NM_015375chr1124553 4048 3533 3455 3265 2008 1803 1548 1522 803 618 29 --24229 1046 --
NM_015382chr141586 ------
NM_015385chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_015387chr242084 1746 730 701 ----11929
NM_015393chr442973 2817 2621 109 --1496 --
NM_015415chr11173 ------
NM_015429chr32899 416 --2390 246 11064
NM_015446chr1------1347
NM_015455chr563733 2592 1357 1246 1132 929 14066 1258 --
NM_015458chr842065 1033 973 370 25147 5140 ----
NM_015465chr53492 277 95 ------
NM_015475chr21756 ------
NM_015488chr291704 1590 1376 1227 640 583 552 537 303 ------
NM_015497chr1521079 808 ------
NM_015508chr321560 1012 --1452 11156
NM_015509chr1231428 399 169 --21327 1174 --
NM_015520chr352449 1798 1064 812 554 ------
NM_015542chr102987 890 ------
NM_015550chr753584 3292 2292 773 682 31061 664 344 23171 863 21142 648
NM_015554chr1531016 295 137 21179 266 ----
NM_015560chr332674 2036 208 ----1698
NM_015564chr573523 3405 3340 2459 2433 2186 836 ------
NM_015565chr213739 444 27 1567 11515 --
NM_015568chr2094274 3855 3579 3305 2860 1657 1644 1132 289 13025 ----
NM_015569chr174404 3904 3688 3607 1942 753 544 1255 24550 1140 --
NM_015571chr612504 1641 1768 --
NM_015576chr382970 2653 2243 862 744 623 489 178 --1870 --
NM_015577chr541325 1168 651 303 1563 1217 --
NM_015578chr1921374 754 ----12011
NM_015605chr1041510 619 595 180 ------
NM_015609chr182761 2629 2461 2319 1887 956 895 663 --1483 --
NM_015640chr155234 5043 4863 3831 1188 14333 --11290
NM_015677chr22637 454 --1572 --
NM_015678chr1321647 540 ------
NM_015686chrX62361 1875 1811 1765 459 436 --12335 --
NM_015687chr61411 ------
NM_015691chrX62908 2516 2372 1862 1823 832 ----11086
NM_015695chr622001 857 ------
NM_015713chr851369 1316 642 592 507 2734 26 ----
NM_015726chr161746 1140 585 540 522 211 --11787 --
NM_015844chr181958 ------
NM_015846chr181958 ------
NM_015847chr181958 ------
NM_015878chr831771 1543 1367 ------
NM_015879chr18118184 7061 7032 7018 6825 6385 2192 1727 1395 560 519 --56237 3308 1926 483 471 --
NM_015886chr875264 4536 4449 4126 1241 1160 306 --25706 1515 11838
NM_015888chr122531 55 --13089 --
NM_015905chr71146 ------
NM_015906chr114612 12941 11064 --
NM_015949chr71872 ------
NM_015955chr21161 ------
NM_015995chr15105497 4999 4757 4271 3450 2105 846 607 473 48 ------
NM_016002chr11731 --154 --
NM_016004chr20----2178 80 --
NM_016019chr75885 772 336 37 28 ------
NM_016021chr652326 2198 2188 916 465 --12686 1303
NM_016040chr142024 1718 759 262 1513 1491 --
NM_016045chr2021410 293 1377 31645 1334 1129 --
NM_016061chr241625 1453 588 237 ------
NM_016070chr172223 102 ------
NM_016071chr72240 97 ------
NM_016072chr1232167 1998 310 22331 1765 ----
NM_016073chr153856 760 450 ------
NM_016081chr411469 --22029 1715 --
NM_016083chr611280 --1624 1965
NM_016096chr831552 1522 677 2658 374 11469 31938 1869 1411
NM_016100chr20181 ------
NM_016107chr51282 --1993 --
NM_016129chr4--192 ----
NM_016131chr251881 1492 1485 771 516 ----1415
NM_016185chr171791 ------
NM_016201chr361511 911 839 724 240 52 21765 852 ----
NM_016203chr72957 360 ------
NM_016205chr421225 87 ------
NM_016206chr3118628 8577 8053 7181 6839 3365 2588 2266 1779 546 386 --46469 5676 3597 2115 22866 1132
NM_016224chr631798 759 80 --1231 --
NM_016227chr11290 --1340 1206
NM_016231chr172671 423 1561 ----
NM_016234chr103739 624 95 --1396 --
NM_016255chr642487 1286 1110 67 --13065 1976
NM_016260chr265916 2554 2437 2354 568 28 11217 11988 16788
NM_016261chr172567 122 ------
NM_016275chr351809 1721 1698 651 490 2575 559 ----
NM_016287chr13286 235 112 --11805 1690
NM_016300chr31502 ------
NM_016303chrX1411 ------
NM_016320chr117724 429 397 362 318 123 58 --1805 --
NM_016338chr51392 --1978 --
NM_016356chr651022 958 813 530 359 ------
NM_016376chr1742963 1081 1043 867 --23637 2976 13851
NM_016422chr1153055 2586 2548 1058 881 22189 1980 43014 2822 2020 220 13143
NM_016424chr1721263 729 ------
NM_016436chr2062261 2078 2017 878 539 409 ------
NM_016441chr22717 636 --2964 410 --
NM_016448chr131850 1699 1302 196 --1299
NM_016472chr141453 ------
NM_016485chr641983 1714 657 61 1288 11529 12095
NM_016507chr1763068 2812 2348 1094 687 646 --22126 38 12222
NM_016513chr653799 3242 2692 2419 30 --11363 11241
NM_016531chr473963 1080 916 905 421 190 174 --11371 --
NM_016544chr293722 2943 2778 2569 1494 1231 701 483 53 2432 216 11036 12929
NM_016545chr11800 ------
NM_016557chr331023 945 806 ------
NM_016577chr3114231 4001 3924 3337 2735 1714 1477 711 520 441 71 --22765 57 --
NM_016589chr31200 ------
NM_016605chr552083 1900 1785 489 261 1980 42605 2497 1749 235 --
NM_016620chr121471 1456 --11442 --
NM_016621chr11124463 4296 4037 3628 3605 3551 1480 1365 1294 724 674 398 --33486 3021 285 --
NM_016626chr1831410 1216 83 ----134
NM_016649chr202196 41 ------
NM_016655chr15--199 ----
NM_016656chrX4397 120 113 43 --1329 --
NM_016824chr1021812 656 --11630 --
NM_016830chr123587 472 174 ------
NM_016929chr694340 3366 3259 1653 1366 1287 955 666 179 ------
NM_016946chr152580 1224 560 196 95 --22874 2518 --
NM_016950chr41202 ------
NM_016952chr1184091 4042 3952 3626 3605 3384 2919 2794 --13525 --
NM_016954chrX1149 ------
NM_017412chr811051 ------
NM_017415chr594071 3692 3589 3417 1587 1488 1330 1232 349 --64354 3625 3499 1288 669 340 --
NM_017420chr1452933 2871 2841 2474 1514 23629 287 ----
NM_017423chr431931 1837 1705 ------
NM_017437chr1421873 276 21729 616 ----
NM_017440chr12192 ------
NM_017447chr211324 11073 13836 --
NM_017455chr152753 134 ------
NM_017522chr121246 1095 ------
NM_017548chr341904 1447 167 131 ----11523
NM_017551chr1062540 2421 2179 1846 1837 1751 --12146 --
NM_017558chr164373 298 40 28 --1395 --
NM_017563chr376090 5801 5195 2152 1968 1167 70 15552 46141 6128 1636 1185 15212
NM_017575chr1761625 1395 1222 653 568 516 ------
NM_017580chr1032074 1974 152 --22043 1754 --
NM_017582chr121149 326 ----1285
NM_017596chr1104652 4352 4243 3505 3437 3320 3298 2838 1142 923 11289 ----
NM_017610chr1551768 749 724 547 485 --12024 --
NM_017629chr131956 1949 763 11612 11552 --
NM_017633chr663736 2631 1484 1433 947 95 --23589 2952 --
NM_017634chr851918 1472 1274 550 410 --21295 50 --
NM_017637chr9119211 8358 7912 6829 6194 3611 3424 3108 1325 874 656 16514 ----
NM_017643chr1742815 2217 854 783 --11162 --
NM_017644chr374496 4376 4082 3416 1150 1048 698 --34892 4020 364 24566 178
NM_017650chr775932 5899 5544 4911 2346 1891 263 --24664 4515 --
NM_017658chr1454351 4116 3555 643 363 --13500 21574 872
NM_017660chr1953219 3044 2661 1105 598 --2569 446 13077
NM_017666chrX41684 607 179 55 ------
NM_017672chr1511033 ----1184
NM_017680chr9272 49 1983 ----
NM_017686chr12976 348 ----1705
NM_017709chr163618 3370 3298 3003 908 847 --32647 1317 554 --
NM_017714chr201771 --1107 --
NM_017715chr7177 ------
NM_017741chr452180 698 335 279 146 --32566 2012 1991 --
NM_017742chr1821245 104 --11870 --
NM_017744chr182389 2230 2211 1891 1708 1666 762 161 1630 ----
NM_017752chrX22110 605 ------
NM_017754chr6114931 4886 4515 4503 3175 1700 1194 904 895 834 226 33928 1123 726 24825 3237 --
NM_017776chrX51147 1067 490 325 241 1409 ----
NM_017791chr141600 --21265 1190 --
NM_017798chr2021080 266 ------
NM_017799chr1422013 1714 ------
NM_017801chr33952 900 519 --11040 --
NM_017811chr962818 2452 2234 571 296 143 123 12467 --
NM_017812chr7164 1709 ----
NM_017824chr1022021 922 1111 139 --
NM_017842chr121679 ------
NM_017845chr42163 26 ------
NM_017848chrX104477 4332 3979 3864 3686 2848 1532 1246 154 129 24018 339 31397 766 473 --
NM_017851chr153375 69 45 ------
NM_017870chr111203 ------
NM_017902chr10164617 4534 4516 4477 4193 3830 3712 1536 1511 1172 1161 987 825 785 412 180 --33622 1885 371 --
NM_017913chr91384 ------
NM_017919chr974679 1918 1824 1107 731 508 265 --11569 35049 4904 857
NM_017922chr141188 ------
NM_017926chr142875 242 ------
NM_017933chr241487 1329 406 365 ------
NM_017938chrX62062 433 414 405 274 218 ------
NM_017946chr731303 365 132 1348 ----
NM_017958chr263009 2970 2889 859 259 42 --12233 11140
NM_017972chr142875 242 ------
NM_017987chr1031464 265 87 --122 1839
NM_017994chr721975 282 ------
NM_017998chr931376 339 49 ------
NM_018003chr1562362 1947 1904 1646 680 275 --12346 --
NM_018004chr3--1310 ----
NM_018010chr321461 1131 ----11625
NM_018011chr13----1194 --
NM_018013chr642472 2412 2177 1885 ----1981
NM_018014chr231074 1068 502 ------
NM_018017chr1042279 2140 1111 63 12297 --12431
NM_018027chr1072791 2021 1284 1138 840 818 42 --12733 --
NM_018036chr1474355 4345 4061 3945 3369 1352 228 ------
NM_018043chr113575 378 319 ----11051
NM_018048chr1282060 1835 1812 1803 747 427 306 160 --21257 621 --
NM_018063chr10------2471 58
NM_018067chr1--1150 1431 --
NM_018084chr222398 534 ------
NM_018092chr163634 418 198 --2641 224 --
NM_018121chr1033174 3012 690 --11986 --
NM_018133chr321950 201 ------
NM_018155chr363071 2824 2319 461 326 260 11258 12150 --
NM_018157chr1282537 2394 1070 821 684 322 160 76 ----1626
NM_018159chrX31269 536 300 --1152 11691
NM_018178chr171836 1803 1766 1410 1352 193 184 ------
NM_018182chr1741843 1454 911 789 11516 22135 1639 --
NM_018184chr341331 671 158 93 ------
NM_018195chr1141758 1569 1429 614 ----12064
NM_018200chr1541791 640 619 263 --31784 214 200 --
NM_018224chr72229 52 ------
NM_018241chr421039 188 --1744 --
NM_018247chr662465 2026 1129 1093 154 51 --21232 1000 --
NM_018254chr121770 401 --21539 462 --
NM_018293chr331194 969 88 ------
NM_018299chr833421 2619 2236 --22785 687 --
NM_018312chr1121486 732 ------
NM_018313chr332039 1710 624 --12471 --
NM_018323chr4--21347 208 ----
NM_018325chr931105 577 199 ----1614
NM_018327chr2011200 ------
NM_018330chr1041493 1134 450 403 ------
NM_018340chr1674680 3791 3532 3163 1643 393 156 13630 ----
NM_018348chr162162 71 ------
NM_018351chr12114239 4148 3469 3105 2899 1747 1672 1655 1215 1096 835 14439 24325 1387 11072
NM_018358chr31114 ------
NM_018362chr1132451 885 414 21377 865 22861 752 --
NM_018364chr173742 2968 2763 1444 1277 822 771 ----33245 2844 1610
NM_018367chr1142298 1020 987 70 ------
NM_018370chr1261828 1673 663 193 175 145 ------
NM_018373chr1466182 6074 5943 4026 1226 1051 26276 681 2832 551 --
NM_018374chr774858 4281 3633 3466 1651 1061 75 1277 --151
NM_018375chr1451485 783 274 121 109 ------
NM_018387chr92167 131 --124 --
NM_018403chr3133927 3820 3574 3559 3181 3072 2861 1386 1039 977 854 820 747 ------
NM_018406chr33374 162 46 ------
NM_018416chr1252509 774 592 285 213 11976 31950 1926 616 --
NM_018425chr1072660 2625 2433 2227 1659 318 304 --1331 --
NM_018433chr21204 ------
NM_018439chr1831856 1056 343 ----12528
NM_018440chr897635 7133 6961 6245 2365 1741 647 244 133 --48155 7686 7373 6039 21915 1564
NM_018444chr821793 618 11972 --11871
NM_018445chr151121 --1380 --
NM_018448chr1211253 21187 313 1963 --
NM_018462chr34604 352 321 93 ------
NM_018464chr10--1289 ----
NM_018482chr832306 2158 367 --1258 --
NM_018489chr132391 606 503 --1422 1376
NM_018490chr112438 63 ------
NM_018534chr21627 ------
NM_018557chr221066 652 ------
NM_018561chr62627 219 ------
NM_018566chr1134833 4264 4030 3829 3444 3281 3254 3143 1288 1258 1091 741 729 ----14797
NM_018569chr421155 1037 ------
NM_018571chr21604 127 ----
NM_018638chr1223957 976 --35083 656 648 24892 4743
NM_018640chr1232663 828 632 ------
NM_018657chr3----1527 --
NM_018684chrX41233 508 152 109 --1305 --
NM_018685chr71253 ------
NM_018689chr1562410 1900 1859 1809 975 269 11821 ----
NM_018695chr51399 ------
NM_018698chrX21961 670 1205 ----
NM_018712chr112599 324 ------
NM_018715chr182034 1874 1739 1569 1542 1480 255 134 --21458 790 --
NM_018718chr752139 1929 1519 569 398 --3238 142 136 --
NM_018841chr183829 3416 2881 2635 2456 1380 1187 863 --32941 1030 146 --
NM_018846chr73965 924 164 ----1132
NM_018847chr91547 11521 21567 1344 --
NM_018890chr731104 439 267 ------
NM_018947chr764690 4429 4243 3428 3302 1844 ----1523
NM_018979chr1242461 1967 1957 640 ------
NM_018999chr10114790 4334 4042 3259 3215 3098 3051 3024 1066 707 193 --23201 3166 --
NM_019000chr51666 21324 321 1429 --
NM_019001chr344869 3758 3516 1722 ------
NM_019004chr731762 363 306 --11833 --
NM_019008chr2293557 3149 2979 2376 1283 1193 422 330 167 13676 41408 891 362 189 --
NM_019027chr442638 2353 775 640 --12374 --
NM_019035chr451719 1683 1363 506 276 1213 ----
NM_019050chr41393 1668 ----
NM_019058chr101281 ------
NM_019071chr71767 1136 ----
NM_019072chr522831 782 --1425 13095
NM_019080chr13--11407 ----
NM_019084chr1021670 673 ----1220
NM_019091chr22830 200 1948 ----
NM_019106chr2272842 2598 2562 2540 1373 1363 234 ----1850
NM_019114chr962110 1858 1659 894 677 208 --12341 --
NM_019556chrX31032 444 398 --172 --
NM_019557chr12662 297 1344 1844 --
NM_019558chr21304 ------
NM_019593chr2063186 3161 2869 2688 2064 1944 --22070 1993 --
NM_019600chr153705 326 302 --1679 --
NM_019610chr131359 819 283 --2298 127 --
NM_019854chr121306 ------
NM_019885chr2142746 2442 2358 2180 1910 1850 1823 1108 1005 716 654 635 173 137 --32327 2234 530 --
NM_019903chr1021812 656 --11630 --
NM_020039chr1261829 1726 1624 1285 1251 173 ------
NM_020122chr285848 4809 4011 1901 1137 638 617 299 25549 5273 14204 --
NM_020132chr21105077 4926 3572 3294 1268 1148 655 639 589 315 ------
NM_020134chr221065 794 --1142 11130
NM_020144chr731367 671 181 --3771 173 128 1590
NM_020148chr1832453 2292 282 --22564 703 --
NM_020150chr1041923 1477 1395 50 11449 --22072 820
NM_020151chr261592 701 669 533 164 42 ------
NM_020154chr15--1240 ----
NM_020156chr7------1119
NM_020159chr421685 396 ------
NM_020177chr543237 2446 752 405 --2531 455 --
NM_020198chr1721534 1001 --1126 --
NM_020199chr511221 1227 ----
NM_020205chr173364 3154 2488 2319 1379 1361 723 12812 22373 1373 --
NM_020231chr32703 477 --1130 --
NM_020232chr181204 125 ----
NM_020239chr1102244 1903 1558 841 724 527 442 434 375 294 --31535 730 121 --
NM_020245chr664363 3701 3298 2004 1669 1234 --25063 4924 --
NM_020310chr1792384 2257 2232 1968 838 716 657 327 288 11812 22041 1742 --
NM_020337chr462572 2455 1117 906 733 276 --12993 --
NM_020342chr232613 568 170 --1892 11695
NM_020346chr1111745 ----11110
NM_020357chr321391 377 1414 1501 --
NM_020362chr13835 731 212 ------
NM_020381chr611420 --1300 --
NM_020382chr12--1206 ----
NM_020390chr394342 4265 3526 3397 1967 1674 1330 1286 482 1596 24169 1734 1218
NM_020403chr1321254 85 ------
NM_020416chr472283 2192 2184 798 527 175 161 ------
NM_020420chrY31828 1399 226 ------
NM_020423chr13595 456 385 ------
NM_020426chr172170 76 ------
NM_020440chr193188 2895 2638 2529 1260 1091 725 536 110 ------
NM_020443chr1126432 5570 5262 5231 4829 4312 2491 2416 2227 1988 362 180 24491 4474 36375 4256 1512 16164
NM_020449chrX1117 ------
NM_020473chrX--1126 --21646 267
NM_020474chr1842032 1301 744 152 ------
NM_020526chr111548 11558 11598 --
NM_020640chr311490 ----11633
NM_020647chr852250 1889 1605 870 524 11881 --1812
NM_020648chr1832258 2067 1842 --22858 653 --
NM_020651chr221459 1193 ------
NM_020666chr52750 35 ------
NM_020682chr102873 219 ------
NM_020696chr3----171 --
NM_020699chr165142 4631 3878 3772 3346 1223 --13902 --
NM_020718chr16146381 6025 5683 5575 5558 5488 5467 4990 4542 4333 2171 997 426 188 11872 1715 --
NM_020734chr121836 --1481 --
NM_020739chr1534216 1429 1148 23178 710 11437 --
NM_020742chrX72120 2021 1925 448 272 221 178 --123 --
NM_020752chr1042707 2155 1023 783 ------
NM_020755chr611620 1266 ----
NM_020766chrX73466 3218 3077 2891 2847 1773 119 ----13211
NM_020769chrX2952 739 ----1936
NM_020772chr17127458 7243 7037 5868 5549 5264 3283 2878 2858 2837 2291 1266 --11970 --
NM_020773chr451971 1929 744 684 119 1801 ----
NM_020776chr1882878 2679 1993 1911 1200 1069 1028 785 --13093 --
NM_020778chr1574606 4585 3151 1785 1763 1614 779 --1699 --
NM_020786chr1631914 1453 616 ----1194
NM_020794chr12586 150 1168 ----
NM_020796chr572676 2487 2449 2049 1854 757 727 ------
NM_020801chr5----12625 --
NM_020805chr1821768 1610 1652 ----
NM_020806chr141651 ------
NM_020808chr12902 457 --1808 --
NM_020809chr1151980 1607 1542 558 507 ------
NM_020810chr1441442 1234 117 26 --23483 181 --
NM_020819chr6------1820
NM_020830chr283253 3214 2351 2036 1256 1098 727 216 12592 1497 23124 2491
NM_020839chr331257 320 46 ------
NM_020841chr1263986 3911 2459 1561 1533 183 --11171 --
NM_020850chr1692935 2755 2605 2408 2140 1300 1231 906 729 --12146 --
NM_020856chr1951515 1307 1138 983 477 ------
NM_020858chr1532095 1515 970 --12199 12311
NM_020860chr4----1793 --
NM_020870chr451717 1550 726 546 487 ------
NM_020872chr331782 1680 1303 1622 --31652 1642 1497
NM_020899chr17122377 2020 1756 1663 751 550 439 417 308 79 70 44 22462 2014 2919 559 --
NM_020919chr221029 300 ----1914
NM_020921chr1443019 2703 949 155 --13518 --
NM_020935chr274423 4354 3950 3828 1061 766 224 --1523 --
NM_020940chr1011041 32900 2471 1923 ----
NM_020943chr2--135 ----
NM_020956chr19114635 4456 3782 3661 3004 1137 666 609 372 311 289 ------
NM_020962chr1542440 834 365 122 --1529 12498
NM_020975chr102660 620 --21881 474 --
NM_020977chr421933 740 --11505 --
NM_020980chr1541494 1389 252 180 --11748 --
NM_020987chr1021135 417 ------
NM_020993chr1242366 917 590 542 --31103 826 322 --
NM_021003chr143818 756 721 ------
NM_021007chr231819 1658 941 --1524 --
NM_021032chr341827 1779 1635 1599 11593 ----
NM_021033chr132424 123 ------
NM_021035chr2051244 1139 930 216 59 --11293 --
NM_021069chr421579 219 --11630 --
NM_021090chr2274272 3822 1766 1598 1517 1200 189 21968 1488 33553 3459 44 --
NM_021097chr252174 1967 868 841 268 --12581 12946
NM_021105chr33738 730 314 ------
NM_021116chr7268979 8726 8417 7550 7465 7449 7364 7235 7001 6863 6351 5537 5484 3646 3506 3441 2711 2615 2359 1853 1840 1527 1136 721 440 242 --78618 8580 6905 2402 1571 1071 890 --
NM_021140chrX1766 --1307 --
NM_021145chr72343 122 1998 1241 --
NM_021159chr45490 277 149 82 34 --11308 --
NM_021183chrX1473 --21837 124 --
NM_021190chr11864 ------
NM_021191chr1252553 2378 2133 691 263 1859 2728 96 --
NM_021194chr1--1275 ----
NM_021202chr2063076 2405 469 446 359 334 --42918 1227 283 47 12191
NM_021216chr1941388 1244 500 172 11094 1478 --
NM_021239chr144587 565 507 158 ------
NM_021249chr1431284 1175 654 1282 1314 --
NM_021252chr1031777 1429 351 --21813 554 --
NM_021629chr395060 4741 4531 3577 3300 3137 1213 1126 874 185 14796 --
NM_021637chrX21113 136 --1488 --
NM_021648chr672657 2500 2187 1730 953 319 38 --12302 --
NM_021813chr695027 4655 4395 4113 3736 1511 1156 1098 342 --35608 4094 1650 --
NM_021814chr621535 272 --11476 --
NM_021911chr585275 4625 4555 1791 1697 1075 808 711 --23608 410 11092
NM_021913chr1951460 361 120 113 95 11611 ----
NM_021935chr32815 653 --21061 238 --
NM_021942chr42700 190 ------
NM_021943chr62450 56 ------
NM_021954chr1393409 3019 2923 2666 2514 1243 1176 449 385 --12768 --
NM_021960chr162772 2214 1886 962 493 91 ------
NM_021961chr11106281 6049 5873 4707 2785 2123 1995 1817 741 325 --46618 2576 1755 247 --
NM_021964chr376551 6484 5301 5218 4993 4954 305 35664 1646 487 35103 5049 708 11329
NM_021965chr921393 183 ------
NM_021970chr4129 ------
NM_022048chr15106078 4843 4770 4677 4364 2516 2275 1413 1368 1029 12360 1651 --
NM_022068chr181606 ------
NM_022073chr1451446 1236 1096 1065 107 --1135 --
NM_022082chr2031064 250 142 ------
NM_022085chr621177 195 ------
NM_022114chr184677 3856 1628 1464 1388 987 175 85 --1669 --
NM_022118chr13----1576 --
NM_022121chr61946 ----1248
NM_022138chr64938 342 310 28 ------
NM_022154chr42366 82 --1975 --
NM_022166chr1695619 5605 5015 4524 2367 2298 2277 719 216 --45317 2485 1885 1299 --
NM_022169chr1131116 348 246 179 31478 1443 1282 --
NM_022336chr241538 816 628 501 1719 1362 22125 1470
NM_022340chr3103418 3322 3106 2410 2347 1467 1219 885 499 473 --1398 --
NM_022351chr823268 502 --1580 --
NM_022374chr21434 --126 --
NM_022465chr1262026 1177 1057 1024 682 163 --163 --
NM_022469chr163066 2171 717 463 367 73 22349 1157 --1796
NM_022473chr15114257 3950 3412 3092 2955 1684 1390 1102 1061 666 154 --14050 --
NM_022475chr42670 480 1209 1256 --
NM_022483chr561765 1629 1253 1212 721 344 ------
NM_022491chr1262873 2665 1107 1079 365 74 --21237 453 --
NM_022496chr121339 ------
NM_022497chr393824 2911 2811 2665 2475 1075 227 200 98 13298 ----
NM_022566chr151396 ------
NM_022572chr291704 1590 1376 1227 640 583 552 537 303 ------
NM_022648chr2104407 3415 2872 1850 1410 1212 1175 1102 875 392 13510 44559 1757 1265 1196 --
NM_022733chr121204 90 1751 ----
NM_022735chr11105 ------
NM_022739chr1731174 275 30 --1750 1939
NM_022745chr142759 2458 157 121 22312 336 ----
NM_022753chr142366 2116 1820 569 --2671 34 --
NM_022763chr342741 2351 2163 1199 --22555 1104 --
NM_022781chr963031 2834 2313 1314 1183 261 2503 373 13295 --
NM_022784chr152843 125 ------
NM_022802chr1021407 1231 ------
NM_022828chr531580 1155 685 11696 11558 --
NM_022845chr1631898 1799 374 ------
NM_022893chr232979 619 402 1565 22202 599 190
NM_022894chr211323 ----1701
NM_022898chr14114746 3945 3932 3817 3632 3427 3170 3121 3107 1093 162 --21621 1310 --
NM_022912chr262832 2257 2153 841 680 384 ----12963
NM_023012chr12--1797 1683 --
NM_023034chr82587 111 ------
NM_023039chr51370 ----151
NM_023068chr2031583 1235 990 --21170 538 --
NM_023071chr1231050 802 30 --1153 --
NM_023079chr1741495 555 504 324 11236 11165 --
NM_023923chr173719 2349 1274 1126 1069 839 484 ------
NM_023925chr123258 128 111 ------
NM_023929chr83917 307 293 1146 ----
NM_023943chr3143 ------
NM_024007chr533007 1942 1065 1338 ----
NM_024017chr174355 243 191 29 1302 ----
NM_024037chr12858 227 --2811 277 --
NM_024090chr41372 --1588 --
NM_024094chr8--1577 1256 1237
NM_024103chr1981854 1583 1350 1332 1315 191 133 82 1253 1405 1508
NM_024345chr994470 1851 1653 1534 1402 1001 740 727 195 15716 44158 759 333 313 --
NM_024416chr931525 1321 506 --1308 1480
NM_024421chr182882 184 ------
NM_024422chr1841933 1740 1713 255 --1326 --
NM_024423chr1861387 1246 1148 918 747 450 --12852 13011
NM_024424chr111828 ------
NM_024425chr111828 ------
NM_024426chr111828 ------
NM_024429chr72957 360 ------
NM_024501chr2--1703 2536 62 --
NM_024511chr443555 3406 785 753 --13038 --
NM_024524chr333043 2697 148 1213 1543 --
NM_024525chr1195 ------
NM_024529chr161177 1149 1064 909 784 105 1361 ----
NM_024548chr341731 1262 483 89 ------
NM_024551chr1252560 2044 1683 1039 64 --1378 --
NM_024551chr1252560 2044 1683 1039 64 --1378 --
NM_024556chr11--1391 ----
NM_024557chr1151257 562 428 240 77 ------
NM_024567chr8171 ------
NM_024580chr15------132
NM_024594chr521640 212 1418 11412 --
NM_024613chr81494 1670 --11597
NM_024616chr311413 --11356 --
NM_024617chr91601 --146 --
NM_024631chr11146 ----1413
NM_024639chr662603 2491 2101 1970 1909 1056 --12903 12011
NM_024646chr183089 2840 2677 2528 1177 890 161 77 13806 1440 --
NM_024665chr343725 3174 3131 63 ------
NM_024666chr1551663 676 535 95 59 11364 11138 --
NM_024670chr1051623 1278 699 432 45 ------
NM_024674chr163223 2766 2542 1152 715 568 11286 ----
NM_024692chr221618 367 ------
NM_024713chr1531507 1264 46 ------
NM_024740chr1163322 1599 1592 1276 585 67 --22555 186 --
NM_024744chr252461 1759 884 449 173 --11876 --
NM_024762chr193669 594 141 --1870 --
NM_024769chr112873 32 ----1159
NM_024770chr242019 751 573 435 --26137 5119 --
NM_024784chr113124 72 40 ------
NM_024812chr872148 2139 1868 712 682 559 121 --21336 837 --
NM_024828chr931018 494 111 --1476 11146
NM_024830chr521398 261 ----11478
NM_024852chr1--1235 2618 142 --
NM_024857chr17146 --1294 --
NM_024887chr151761 1600 1347 864 561 1810 --11423
NM_024896chr942424 1887 1565 601 --31961 1870 63 --
NM_024913chr711347 11636 --1531
NM_024920chr42992 242 --1463 --
NM_024921chrX21453 1329 ------
NM_024947chr3139183 9138 7557 7184 6728 6591 3541 3098 2803 2380 2345 1290 400 49441 2268 2020 1059 16740 18715
NM_024953chr1242767 2720 2058 1957 ------
NM_024960chr201153 ------
NM_024969chr22707 693 ------
NM_024989chr257620 7589 3045 2893 1982 --11882 17310
NM_024991chr1083158 3040 3014 2017 1291 1190 742 496 --22654 2456 11030
NM_024993chr241586 1481 632 74 ------
NM_025054chr874033 3599 3151 1499 1467 1090 688 --22934 1632 --
NM_025073chr164668 4627 4565 4489 3130 913 11622 ----
NM_025079chr13719 554 229 1576 1561 --
NM_025126chr121557 --1671 --
NM_025133chr221144 758 1978 ----
NM_025134chr1632061 1608 819 2779 667 --11739
NM_025138chr132916 181 1255 1447 --
NM_025146chr362301 1998 1985 1945 465 397 --12098 1889
NM_025154chr711288 ----11374
NM_025160chr163792 3514 3366 3128 3080 487 23755 2613 ----
NM_025179chr184916 4220 4211 3633 1133 922 414 151 --24654 1001 --
NM_025191chr142792 2293 2222 1366 ------
NM_025208chr1152095 1841 1827 1774 77 ------
NM_025221chr42927 285 --11219 --
NM_025234chr15162 ------
NM_025235chr1021879 1702 ------
NM_025250chr732759 2230 817 ------
NM_025263chr661412 543 526 438 384 73 --11235 --
NM_030594chr1521290 856 11021 ----
NM_030621chr1474192 3369 2619 2607 2584 1398 389 --12750 --
NM_030625chr1052543 2486 1630 869 672 ------
NM_030627chr553800 3186 2554 1667 1508 1941 13989 11282
NM_030647chr7125234 4745 4596 4545 4433 4403 2283 1898 1868 1527 1074 933 1698 11641 --
NM_030648chr4105378 4866 4633 3421 1777 1711 1256 861 570 454 --23456 377 --
NM_030650chr264121 3152 2932 2884 744 367 ------
NM_030660chr142995 453 --11348 --
NM_030664chr1052125 1647 833 300 205 ------
NM_030674chr12105644 5064 5033 4309 4065 3907 2343 2187 379 286 25289 1594 129 --
NM_030762chr122762 262 ------
NM_030769chr12340 333 ------
NM_030774chr111328 --125 --
NM_030782chr5179 --1365 --
NM_030791chr1431837 1256 487 ------
NM_030797chr21298 ------
NM_030806chr1179095 8605 7919 7101 6342 6047 5947 5784 5712 3625 3011 2850 2065 1391 1014 948 878 18466 47673 7387 3471 1637 --
NM_030809chr1242368 2217 1606 49 --31733 1674 37 --
NM_030810chr621177 195 ------
NM_030816chr173218 2746 2736 1411 1089 884 750 ------
NM_030885chr331970 753 52 ----11754
NM_030915chr252256 2184 2060 1934 776 ------
NM_030918chr1104974 4678 4444 4361 4194 4125 3518 2126 1704 539 13856 24026 827 --
NM_030920chr182073 2012 1777 1357 229 146 88 24 --21766 346 --
NM_030938chr172394 335 ------
NM_030949chr62949 335 --193 --
NM_030952chr151332 1102 443 399 388 --1854 --
NM_030964chr573642 2481 2418 2312 804 534 126 1171 21065 574 --
NM_030979chr131148 ------
NM_031216chr1822188 1834 ------
NM_031243chr711726 11795 ----
NM_031268chr16124972 4824 4056 3675 3258 1563 1528 1521 1435 1420 730 344 --2592 550 --
NM_031296chr421723 1101 ------
NM_031314chr1442050 1927 1269 369 21483 223 1649 --
NM_031362chr251872 969 833 535 115 12698 12647 --
NM_031365chr252008 1105 969 671 251 12834 12783 --
NM_031366chr252008 1105 969 671 251 12834 12783 --
NM_031419chr331578 540 434 185 ----
NM_031426chr982794 2528 2363 2146 1910 1900 1782 943 --32701 2279 236 12109
NM_031427chr1465485 3853 1897 1636 830 203 24748 195 35066 2344 797 --
NM_031442chrX51011 855 667 598 331 ------
NM_031453chr1052058 1991 939 523 142 --1185 --
NM_031483chr2093556 3239 3019 2932 2727 2411 2362 847 576 12217 1394 --
NM_031844chr133850 3638 977 ----13306
NM_031845chr221333 1007 --21189 928 --
NM_031847chr221333 1007 --21189 928 --
NM_031850chr33820 685 301 ------
NM_031850chr33820 685 301 ------
NM_031854chr173409 122 44 --130 --
NM_031890chr2292908 2879 2693 2469 2392 2086 738 513 226 ------
NM_031911chr442274 2247 2145 320 ------
NM_032012chr985129 4687 4408 4222 3358 1814 1801 1533 11293 14710 --
NM_032021chr1131159 910 262 ------
NM_032025chr351928 1444 639 420 357 1196 1443 --
NM_032048chr181605 ------
NM_032049chr33820 685 301 ------
NM_032049chr33820 685 301 ------
NM_032050chr222702 394 1338 ----
NM_032052chr2211087 ------
NM_032102chr1142129 1149 421 83 ------
NM_032116chr13105817 5532 5319 4016 2146 1788 1679 1541 1519 324 --15520 --
NM_032121chrX42385 1058 608 363 ------
NM_032124chr1831168 1061 860 1810 ----
NM_032132chr12157 76 163 ----
NM_032139chr191254 ------
NM_032144chr211128 --1267 --
NM_032145chr651444 1391 1326 1314 513 21790 1365 11577 1486
NM_032153chr322550 661 ------
NM_032156chr123258 128 111 ------
NM_032186chr121471 1456 --11442 --
NM_032199chr1063631 2757 1411 1269 1002 55 ------
NM_032208chr241381 513 455 410 23437 1281 12800 12643
NM_032221chr2021974 1712 --21785 496 --
NM_032228chr1163477 2874 2800 2361 2253 656 ----12715
NM_032229chr13------1350
NM_032256chr121689 ------
NM_032268chr1692622 2587 1209 1099 807 631 538 508 161 --22202 2073 --
NM_032287chr22104188 3725 3372 2791 2579 1459 1154 950 825 95 --31438 997 422 --
NM_032291chr121633 541 ------
NM_032321chr272908 2798 2783 2109 512 488 276 --12671 --
NM_032352chr142197 33 ----1411
NM_032373chr1085767 4863 4603 4428 4003 1887 792 138 --15356 13832
NM_032413chr15--137 ----
NM_032439chr1051700 1624 1595 657 181 --1175 --
NM_032440chr1032380 797 229 --12059 --
NM_032445chr1562297 1933 1733 711 355 199 --12130 --
NM_032446chr543461 3071 2890 991 12780 13805 --
NM_032457chr443663 3496 545 376 11554 ----
NM_032458chrX52657 2487 1156 581 101 ------
NM_032491chr1241155 531 135 119 ----194
NM_032505chr32856 431 --12651 12474
NM_032510chr1822046 594 1214 11673 --
NM_032523chr22411 214 ------
NM_032547chr43963 917 386 --1429 --
NM_032557chr41269 1108 ----
NM_032582chr1721333 1235 ------
NM_032594chr1421010 185 1308 2325 107 1135
NM_032664chr821492 600 ----11307
NM_032682chr343305 3091 2579 809 --13457 --
NM_032689chr1921572 1101 ----1484
NM_032711chr17113981 3931 3850 3312 2915 2789 2761 1685 1603 126 67 --13759 11637
NM_032727chr1041590 1233 1087 152 --11608 --
NM_032784chr6------1324
NM_032818chr961955 1768 1590 739 660 290 --21961 296 --
NM_032819chr20183 ------
NM_032832chr66625 585 539 249 215 161 11548 ----
NM_032837chr1732029 604 591 --12134 --
NM_032846chr1451283 1087 535 526 468 1222 --1195
NM_032870chr6--1145 ----
NM_032873chr1174486 3948 1693 1352 653 622 245 13194 23485 3455 --
NM_032876chr1441746 1536 1408 617 1187 31375 854 801 --
NM_032900chr1093884 3780 3464 3352 3264 3245 1410 213 22 ------
NM_032905chr1031090 493 40 ------
NM_032968chrX64025 3510 2630 1569 689 595 ------
NM_032969chrX64025 3510 2630 1569 689 595 ------
NM_032973chrY74017 3506 2643 2629 1568 689 595 ------
NM_033012chr134679 312 273 234 ------
NM_033014chr931525 1321 506 --1308 1480
NM_033020chr114612 12941 11064 --
NM_033029chr31390 ------
NM_033030chr231407 1248 1105 --1564 --
NM_033044chr131232 355 133 1208 ----
NM_033055chr13946 347 325 ------
NM_033103chr1931161 487 386 ------
NM_033121chr1231860 1740 181 --1489 --
NM_033127chr13623 463 81 ------
NM_033132chr1331458 149 128 ----1873
NM_033133chr1773188 3116 2966 2837 1299 929 714 --12600 13737
NM_033135chr1152095 1841 1827 1774 77 ------
NM_033143chr454512 4105 1486 252 161 --1903 --
NM_033181chr611280 --1624 1965
NM_033211chr562090 2032 1923 1784 1451 788 --1634 --
NM_033221chr932168 2095 393 22433 765 ----
NM_033222chr9------11369
NM_033224chr7168025 6167 5797 5758 5445 5187 4905 2893 2228 2071 1985 1719 1561 920 427 313 17562 16567 --
NM_033225chr8123078 3054 2612 2505 2313 2301 2043 1993 811 591 578 153 --1940 --
NM_033261chr10----1183 --
NM_033272chr23307 136 79 ------
NM_033274chr583194 3183 2906 2876 2492 2430 1379 1049 --22914 149 23004 616
NM_033285chr831645 1419 1091 11677 23573 2966 13001
NM_033290chrX2915 774 21423 1209 ----
NM_033300chr121246 1095 ------
NM_033306chr11133 ------
NM_033326chr1131708 1645 157 ----22137 1632
NM_033331chr983496 3236 2766 2712 2585 2228 952 411 --1317 1927
NM_033360chr1243634 1443 1130 631 22885 617 2975 478 --
NM_033380chrX41094 1087 822 59 --2932 197 --
NM_033381chrX41094 1087 822 59 --2932 197 --
NM_033389chr1774754 4690 4312 3302 1654 1160 809 --33840 3439 3208 --
NM_033425chr1153006 2774 2640 2572 45 --23400 2420 --
NM_033428chr941698 1483 1438 605 ------
NM_033430chr453835 3361 1576 830 562 ------
NM_033437chr453835 3361 1576 830 562 ------
NM_033449chr5112120 1916 1880 1833 1441 1356 587 297 239 203 111 --143 --
NM_033502chr61150 ------
NM_033505chr265724 5618 5438 4490 797 251 22654 1992 24310 2097 --
NM_033515chr621255 380 ------
NM_033631chr173513 3365 2945 1478 1038 845 485 --21443 250 11197
NM_033655chr921072 116 --21064 93 --
NM_033656chr2175209 4274 4149 3966 2352 1273 386 --11601 --
NM_052818chr1351972 1845 634 233 33 22042 1377 ----
NM_052832chr822342 2105 12709 22634 892 --
NM_052834chr1862530 2180 858 564 250 39 --32461 1889 746 11826
NM_052840chr152483 334 --11189 --
NM_052851chr1352088 1857 911 689 206 ------
NM_052867chr13----11305 11085
NM_052872chr6149 ------
NM_052877chr13329 162 79 197 ----
NM_052879chr1263783 3540 3522 3276 3103 172 --1817 --
NM_052880chr222483 159 ----11401
NM_052885chr1263119 1732 1661 1114 456 312 --11687 --
NM_052886chr832165 1724 1590 1414 ----
NM_052900chr821481 470 ------
NM_052906chr2284535 4045 1384 1131 803 732 651 226 ----14983
NM_052913chr631065 313 185 ------
NM_052917chr2113385 3328 3173 2882 2700 2610 2460 2336 925 738 166 43018 1275 850 362 13010 --
NM_052918chr1073513 3184 1295 1107 898 407 182 --1126 --
NM_052932chr113618 258 46 ----1205
NM_052937chr82399 295 1754 ----
NM_052966chr173270 3237 2999 2854 2509 2457 1349 ------
NM_053002chr321171 852 ------
NM_053016chr977594 6703 5304 4879 3099 2359 1949 16172 27051 5388 12536
NM_053023chr1152587 1275 1264 421 173 1197 1851 12353
NM_053025chr341352 658 633 54 ------
NM_053026chr341352 658 633 54 ------
NM_053027chr341352 658 633 54 ------
NM_053028chr341352 658 633 54 ------
NM_053031chr341352 658 633 54 ------
NM_053032chr341352 658 633 54 ------
NM_053035chr72240 97 ------
NM_053056chr1132388 2189 645 --1883 --
NM_053064chr1432885 1100 672 12398 1786 12975
NM_054110chr36976 731 707 689 172 135 ------
NM_054111chr61108 ----1132
NM_054114chr62731 260 1737 1822 --
NM_057169chr12112989 2509 2116 1112 907 633 592 468 419 326 190 22603 779 13051 --
NM_057170chr12112989 2509 2116 1112 907 633 592 468 419 326 190 22603 779 13051 --
NM_057175chr462453 2363 2152 1894 1839 249 ------
NM_057178chr1772165 935 856 806 768 553 312 ------
NM_057749chr82851 429 --1185 --
NM_058170chr121391 1311 2299 56 11028 --
NM_058172chr42557 542 1505 ----
NM_058237chr143672 274 191 --1914 --
NM_058240chr1431726 1123 282 11133 1401 --
NM_078487chr952913 2466 2049 1202 991 12787 12060 --
NM_080390chrX143 ------
NM_080491chr1183406 3093 2691 2653 1498 1310 315 103 ----12492
NM_080552chr202681 126 ------
NM_080599chr102987 890 ------
NM_080628chr2071281 1235 1131 986 490 379 226 ------
NM_080645chr61491 12166 ----
NM_080654chr112372 333 --2192 77 --
NM_080667chr2165 ------
NM_080717chr1251036 548 475 365 32 11554 21492 390 --
NM_080737chrX31130 371 363 --11074 11336
NM_080738chr111976 ------
NM_080743chr642048 1581 1042 140 --12349 --
NM_080759chr1342400 1875 907 540 --22259 1740 11899
NM_080760chr1342400 1875 907 540 --22259 1740 11899
NM_080798chr101408 ------
NM_080799chr101408 ------
NM_080800chr101408 ------
NM_080801chr101408 ------
NM_080802chr101408 ------
NM_080803chr101408 ------
NM_080804chr101408 ------
NM_080805chr101408 ------
NM_080806chr101408 ------
NM_080807chr101408 ------
NM_080808chr101408 ------
NM_080809chr101408 ------
NM_080810chr101408 ------
NM_080811chr101408 ------
NM_080812chr101408 ------
NM_080813chr101408 ------
NM_080814chr101408 ------
NM_080815chr101408 ------
NM_080832chrX71742 1416 1198 720 324 220 46 11438 11853 --
NM_080867chr1485031 4987 3382 1916 1315 397 290 265 --55113 3542 1647 1554 1119 14423
NM_080868chr1126 ------
NM_080872chr8113165 2881 2789 1367 1263 1217 1199 1163 696 677 131 --2789 567 11234
NM_080927chr323007 876 11205 --33397 462 269
NM_080928chr73645 604 83 --2283 246 --
NM_130391chr953035 2661 2531 2289 1136 ------
NM_130392chr953035 2661 2531 2289 1136 ------
NM_130393chr953035 2661 2531 2289 1136 ------
NM_130434chr1521150 299 --1890 --
NM_130436chr213916 838 646 --22714 1039 --
NM_130466chr123711 478 319 ----1124
NM_130468chr153778 646 503 ------
NM_130798chr1521559 1145 ------
NM_130831chr332674 2036 208 ----1698
NM_130832chr332674 2036 208 ----1698
NM_130833chr332674 2036 208 ----1698
NM_130834chr332674 2036 208 ----1698
NM_130835chr332674 2036 208 ----1698
NM_130836chr332674 2036 208 ----1698
NM_130837chr332674 2036 208 ----1698
NM_130846chr123959 726 290 --1688 1935
NM_130850chr141182 ----1115
NM_130851chr141182 ----1115
NM_133170chr20268122 8049 6653 6488 6379 6162 5591 5469 5348 5233 3232 3155 3130 2254 1784 1529 1453 1370 1314 1162 1025 822 783 542 388 137 --47427 6620 5752 1732 16660
NM_133264chr1763739 3623 3336 3094 3057 1149 22696 196 ----
NM_133334chr475869 5663 3900 1708 1420 1213 327 11558 14783 25637 4372
NM_133338chr51390 ------
NM_133339chr51390 ------
NM_133340chr51390 ------
NM_133341chr51390 ------
NM_133342chr51390 ------
NM_133343chr51390 ------
NM_133344chr51390 ------
NM_133369chr53929 721 403 ------
NM_133370chr443586 3526 3345 2446 --1620 13507
NM_133372chr542428 2381 2255 2163 ----12317
NM_133445chr973267 3196 2622 2432 893 466 183 ------
NM_133631chr351588 1249 1240 1082 188 --1210 --
NM_133638chr551421 1300 925 577 313 ------
NM_133645chr6--1588 1623 --
NM_133646chr285392 4300 4279 4159 3894 3609 2178 508 1260 ----
NM_133647chr1553524 2701 2406 1111 1005 13440 --1825
NM_134325chr131754 1417 551 --1596 --
NM_134447chr191563 ------
NM_138270chrX31129 949 297 12723 13004 --
NM_138286chr1944230 3218 2976 129 --21304 841 --
NM_138297chr33374 162 46 ------
NM_138333chr952142 1862 1705 307 129 --32340 1973 99 --
NM_138335chr41683 --1132 1801
NM_138340chr182433 244 ------
NM_138357chr1021142 368 --1393 --
NM_138426chr74493 365 163 27 1314 1621 --
NM_138437chrX133 --1305 --
NM_138457chr693421 3078 2910 2500 1375 1334 798 599 443 --23235 2741 --
NM_138459chr623516 1347 190 1335 --
NM_138468chr2126071 5446 4960 4855 4268 2293 1969 1893 1469 950 875 646 ------
NM_138473chr1295031 4765 4123 3565 1972 1394 708 531 343 13367 1539 --
NM_138479chr162071 2032 2018 1951 836 260 ------
NM_138492chr541351 575 416 394 ------
NM_138559chr231064 1058 492 ------
NM_138571chr62253 153 ------
NM_138576chr14114746 3945 3932 3817 3632 3427 3170 3121 3107 1093 162 --21621 1310 --
NM_138609chr51539 ------
NM_138610chr51539 ------
NM_138713chr16127293 6583 5868 5803 5651 5639 3154 2589 1156 295 280 213 1929 ----
NM_138714chr16127293 6583 5868 5803 5651 5639 3154 2589 1156 295 280 213 1929 ----
NM_138717chr62515 441 --1605 1697
NM_138727chr182389 2230 2211 1891 1708 1666 762 161 1630 ----
NM_138728chr182389 2230 2211 1891 1708 1666 762 161 1630 ----
NM_138731chr1474277 3731 2976 2708 2608 1608 1402 21553 1509 43190 2799 1632 1413 --
NM_138735chr231409 1165 222 --11430 --
NM_138736chr16144249 4172 4056 3921 3865 3595 2824 1586 1414 1173 1146 1111 628 548 12904 ----
NM_138766chr52466 181 --1520 --
NM_138771chr731526 223 50 11245 --11268
NM_138782chr511648 --1190 --
NM_138793chr173434 358 331 --31789 1299 305 --
NM_138799chr261942 415 401 395 277 203 11404 ----
NM_138811chr72985 822 ----11144
NM_138821chr52466 181 --1520 --
NM_138822chr52466 181 --1520 --
NM_138959chr175378 4943 4882 2653 2051 1869 630 25260 2548 11082 --
NM_138966chr181220 ------
NM_138970chr1441616 744 549 188 --12301 1767
NM_138971chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_138971chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_138972chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_138972chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_138973chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_138973chr1183084 2833 1431 1231 1222 1096 956 434 11139 51523 1383 1163 882 396 13166
NM_138992chr213460 387 59 ------
NM_139012chr622020 1434 ------
NM_139035chrX1669 --1764 --
NM_139045chr95859 748 717 553 49 ------
NM_139048chr321068 178 ----11115
NM_139071chr1261682 1606 1045 619 180 53 2523 427 31537 1376 681 --
NM_139076chr42488 428 11353 ----
NM_139132chr117724 429 397 362 318 123 58 --1805 --
NM_139182chr421751 1168 ------
NM_139207chr1252228 1860 1423 731 77 ------
NM_139242chr152575 57 ----11048
NM_139283chr1242402 2085 1722 520 --22392 1862 --
NM_139286chr9--1206 ----
NM_139312chr1031519 1181 601 ------
NM_139318chr14----1247 --
NM_139319chr1261837 1724 1433 1195 378 30 ------
NM_139323chr2031356 820 704 11546 --11448
NM_144567chr142755 2274 719 433 ------
NM_144571chr456600 6337 2246 701 92 27016 547 24821 831 16025
NM_144578chr1485439 5220 4578 3479 1962 1682 1390 984 --14235 22166 918
NM_144582chr292286 2220 2161 1768 1684 1652 813 266 60 --12137 --
NM_144590chr1062466 2261 1974 1910 1883 371 11868 13010 --
NM_144595chr1311001 ------
NM_144601chr1621049 779 ------
NM_144642chr33470 311 125 1454 ----
NM_144643chr41430 ------
NM_144709chr21274 ------
NM_144710chr23971 480 209 ------
NM_144721chr442343 1989 1117 1073 1808 --12615
NM_144767chr1574452 4428 3892 3697 3113 864 317 --12843 --
NM_144982chr123560 134 82 ----132
NM_145000chr52507 464 ------
NM_145011chr1031641 645 76 ------
NM_145036chr171116 --2405 284 --
NM_145055chr1822404 505 --23228 464 --
NM_145115chr71847 21541 907 32345 2151 2135 --
NM_145117chr1163196 2619 2507 2029 638 266 ------
NM_145175chr231271 1028 452 ------
NM_145239chr1681087 361 341 306 287 262 222 202 1980 ----
NM_145243chr1----149 --
NM_145259chr267126 4404 2857 1404 772 622 45692 5651 4947 290 45376 1041 802 195 --
NM_145268chr72461 107 ------
NM_145276chr192783 410 2703 81 ----
NM_145284chrX31801 1000 41 22428 1935 12356 --
NM_145307chr1063054 2971 1865 1315 1272 912 --24236 3385 --
NM_145320chr753584 3292 2292 773 682 31061 664 344 23171 863 21142 648
NM_145321chr753584 3292 2292 773 682 31061 664 344 23171 863 21142 648
NM_145322chr753584 3292 2292 773 682 31061 664 344 23171 863 21142 648
NM_145331chr61613 170 ----
NM_145332chr61761 1218 ----
NM_145333chr61761 1218 ----
NM_145686chr223419 3009 ------
NM_145687chr223419 3009 ------
NM_145690chr841758 1752 1653 1630 --11230 --
NM_145698chr102614 220 --21781 1679 --
NM_145725chr141332 ------
NM_145726chr141332 ------
NM_145733chr223387 351 329 ------
NM_145735chr133796 732 406 ----12656
NM_145739chr22411 214 ------
NM_145756chr18--1565 ----
NM_145808chr732055 2047 320 22190 263 180 --
NM_145858chr211407 ------
NM_145859chr31281 ------
NM_145860chr31281 ------
NM_145861chr111976 ------
NM_145913chr12126 ------
NM_147150chr942977 2921 1562 426 --22588 120 --
NM_147156chr10293 86 --1437 --
NM_147181chr42927 285 --11219 --
NM_147182chr42927 285 --11219 --
NM_147183chr42927 285 --11219 --
NM_147189chr852133 2020 1820 1644 745 ------
NM_148174chr831771 1543 1367 ------
NM_148894chr42393 120 ------
NM_152133chr62731 260 1737 1822 --
NM_152233chr1431284 1175 654 1282 1314 --
NM_152253chr2294107 3806 3241 2957 2924 2687 827 550 387 13780 1494 --
NM_152262chr194748 579 248 164 183 ----
NM_152263chr176072 4944 4120 1927 1750 1072 240 --1454 --
NM_152271chr821187 1001 --11100 --
NM_152275chr251955 1861 1824 493 208 ------
NM_152277chr5167 --41650 1586 633 109 --
NM_152280chr122397 1103 32472 581 147 12239 --
NM_152283chr521173 51 --1897 --
NM_152300chr1741610 1216 708 632 ------
NM_152305chr331601 703 477 11904 1130 --
NM_152344chr172610 329 195 ----
NM_152350chr171157 --1440 --
NM_152375chr132461 2223 437 --22539 669 --
NM_152387chr23906 707 302 ----1424
NM_152388chr253351 3041 1615 1488 1207 --23610 259 23720 3085
NM_152390chr21528 ------
NM_152409chr533194 1009 820 --22803 2433 --
NM_152414chr821447 313 ------
NM_152417chr82902 241 190 ----
NM_152418chr81631 ------
NM_152424chrX114612 4287 4098 3653 3306 3229 3222 1360 1224 681 607 14303 ----
NM_152437chr125877 861 562 511 103 163 1921 --
NM_152451chr153632 276 52 ------
NM_152470chr1853945 3637 3589 2731 398 13813 11086 --
NM_152487chr141178 1019 511 263 --11121 --
NM_152493chr111432 ----11347
NM_152519chr252108 1690 539 476 61 ------
NM_152520chr23998 867 227 1192 1328 --
NM_152529chr253169 1489 1005 623 460 1330 12714 11019
NM_152551chr612028 --31954 1187 658 2239 213
NM_152556chr71661 ----1582
NM_152574chr9--166 1177 --
NM_152588chr122351 51 1722 21665 486 --
NM_152594chr1541970 1943 749 565 --1687 --
NM_152608chr141969 1740 901 430 --123 --
NM_152609chr121069 436 --11161 --
NM_152622chr543344 3229 3079 479 --11104 --
NM_152624chr547278 5578 5294 520 36859 6249 2567 ----
NM_152636chr1183067 2422 2199 1924 1112 923 543 519 12092 1352 12293
NM_152647chr15123 ------
NM_152660chr12698 22 --2266 107 --
NM_152665chr121248 883 ------
NM_152671chr22517 320 ------
NM_152678chr362623 2187 2008 888 521 435 ------
NM_152699chr363413 2682 2502 766 434 149 --1878 --
NM_152716chr1171564 1513 1201 513 375 181 153 ------
NM_152724chr1032300 718 69 --12108 12065
NM_152754chr733423 2725 33 173 1419 --
NM_152756chr5104039 3670 3111 2865 1494 971 462 448 166 60 ----12806
NM_152758chr832618 988 550 1175 1838 12569
NM_152765chr872244 1677 879 863 840 738 25 --31820 565 260 --
NM_152772chr121404 ------
NM_152774chr71131 12467 --12089
NM_152780chrX21293 148 --2461 283 --
NM_152787chrX93760 3144 3049 1260 815 710 465 331 76 --11294 --
NM_152835chr142563 2005 563 556 1734 ----
NM_152838chr2042983 1318 635 70 ------
NM_152896chr92839 707 ------
NM_152903chr1362664 2213 1933 1920 637 96 ------
NM_152924chr15205850 5494 5361 4922 4704 4670 4648 2559 2316 2251 2110 1909 1874 1805 1165 580 560 408 359 64 --1306 --
NM_152999chr784580 3494 3092 1317 1162 803 765 257 14958 44324 3713 1682 1370 1504
NM_153013chr542382 2235 1989 938 12528 ----
NM_153029chr1673822 3459 3143 3134 3059 1077 316 11052 11066 --
NM_153035chr173101 1970 1130 767 556 476 458 --12158 --
NM_153050chr2274272 3822 1766 1598 1517 1200 189 21968 1488 33553 3459 44 --
NM_153051chr2274272 3822 1766 1598 1517 1200 189 21968 1488 33553 3459 44 --
NM_153181chr181220 ------
NM_153183chrX3509 293 121 --21242 144 --
NM_153184chr33777 376 101 ------
NM_153188chr564553 3907 2003 1611 1473 666 14045 --14956
NM_153207chr1232677 1421 1308 --14010 --
NM_153215chr32581 79 ------
NM_153223chr521421 390 --11249 11226
NM_153228chr17------124
NM_153255chr62211 192 ------
NM_153262chr173098 2552 2270 2093 1018 471 424 --11119 --
NM_153321chr171941 --1703 --
NM_153322chr171941 --1703 --
NM_153343chr472174 2110 1509 911 473 410 164 11807 1832 --
NM_153354chr5------1895
NM_153362chr62988 323 ------
NM_153365chr432568 2357 747 --22681 2626 --
NM_153371chr1331972 1522 166 ------
NM_153374chr15----2454 342 199
NM_153442chr10125911 5679 5165 4753 4590 1945 1072 1010 855 280 129 103 --1192 --
NM_153456chr13104437 4380 4169 2405 2327 2264 2014 1196 592 523 --34865 4849 4610 --
NM_153605chr331135 495 29 ----1204
NM_153607chr523065 2922 ------
NM_153616chr1532095 1515 970 --12199 12311
NM_153617chr1532095 1515 970 --12199 12311
NM_153618chr1532095 1515 970 --12199 12311
NM_153619chr1583333 2753 2537 1160 1131 786 333 190 1938 13437 13549
NM_153634chr1231319 241 157 11082 ----
NM_153640chr201153 ------
NM_153649chr141898 882 749 707 --1144 11876
NM_153686chr462298 2061 1873 1659 777 275 ------
NM_153689chr231673 761 133 ------
NM_153694chr122245 189 ------
NM_153695chr9185 ------
NM_153702chr42200 107 ------
NM_153756chr161961 1946 1915 1545 1449 109 ------
NM_153757chr41133 ------
NM_153809chr9------1608
NM_153810chr1075008 4907 4483 4243 4015 3393 1299 1706 1832 11969
NM_153836chr252071 1629 700 156 121 --1634 --
NM_170606chr74750 549 462 39 --1405 --
NM_170607chr1731207 982 51 --11409 --
NM_170665chr1284123 3919 3845 3647 3277 2787 1450 1441 14285 ----
NM_170679chr511311 ----1253
NM_170692chr131157 1084 50 --21031 204 --
NM_170696chr1521360 103 ------
NM_170697chr1521360 103 ------
NM_170706chr1114072 3551 3330 1680 1507 1430 1299 1010 903 107 55 --22834 166 1515
NM_170711chr192362 70 ------
NM_170719chr132916 181 1255 1447 --
NM_170731chr1132056 1897 631 11152 12708 --
NM_170732chr1132056 1897 631 11152 12708 --
NM_170733chr1132056 1897 631 11152 12708 --
NM_170734chr1132056 1897 631 11152 12708 --
NM_170735chr1132056 1897 631 11152 12708 --
NM_170783chr6----1181 --
NM_172069chr272345 1984 1745 857 802 552 61 --11683 --
NM_172070chr232285 1730 720 ------
NM_172071chr1137051 7012 6973 6799 6156 6134 6059 5899 5522 5511 5356 2940 1313 11261 26771 436 --
NM_172103chr642663 2638 466 194 ------
NM_172105chr642663 2638 466 194 ------
NM_172110chr201475 ------
NM_172111chr201475 ------
NM_172112chr201475 ------
NM_172113chr201475 ------
NM_172196chr2------180
NM_172216chr1262546 2503 1894 1171 871 815 ------
NM_172375chr141190 --11181 --
NM_172387chr1821381 360 ------
NM_172388chr1821428 407 ------
NM_172389chr1821428 407 ------
NM_173082chr63986 457 283 ------
NM_173198chr96982 906 808 717 161 100 --1743 --
NM_173199chr92118 108 ------
NM_173200chr96982 906 808 717 161 100 --1743 --
NM_173214chr16127293 6583 5868 5803 5651 5639 3154 2589 1156 295 280 213 1929 ----
NM_173216chr342615 1834 1094 582 1373 1555 1183
NM_173217chr342615 1834 1094 582 1373 1555 1183
NM_173359chr321609 1593 --2506 307 --
NM_173454chr151962 ----1993
NM_173468chr475407 4790 4466 4059 2242 1838 826 12061 --35556 5225 198
NM_173469chr1521401 85 --1256 1342
NM_173470chrX62924 2744 2220 728 445 78 11852 ----
NM_173495chrX31592 516 340 ------
NM_173496chr1052653 2592 2498 261 158 ------
NM_173500chr1551333 1307 918 562 550 ----169
NM_173511chr253601 2846 2675 2528 370 --12409 13923
NM_173515chr61106 ------
NM_173552chr31710 11997 12459 --
NM_173560chr62421 46 ------
NM_173582chr11116211 5957 5203 4138 4094 4078 2065 1952 1724 1343 675 1823 195 --
NM_173595chr12155327 5146 4984 4955 4881 4151 3361 3252 1886 1849 1339 1222 587 422 337 12025 21821 1034 --
NM_173602chr1253226 3214 3023 2767 912 13319 ----
NM_173631chr1921223 1103 ------
NM_173642chr1118574 7748 7026 6878 6570 2688 2322 2024 1168 1055 47 17066 13185 --
NM_173681chr721845 1556 --11812 --
NM_173683chr831790 1435 468 --2634 225 --
NM_173694chrX22158 2136 ----11655
NM_173698chrX42011 1645 556 43 ------
NM_173797chr521320 167 ------
NM_173798chrX1203 1350 --1390
NM_173808chr194179 3916 3740 3038 2752 1345 1255 1031 731 11656 23057 402 --
NM_173809chr1031491 1115 220 11137 11228 --
NM_173814chr152508 94 ------
NM_173822chr241792 1684 1421 184 --1360 --
NM_173825chr342877 2783 1146 200 --43064 819 215 185 --
NM_173834chrX3412 165 86 ------
NM_173854chr182324 1755 1491 850 802 778 537 68 --22046 732 --
NM_174909chr51291 1786 1138 --
NM_174911chr842952 750 605 243 --1385 --
NM_174938chr92407 107 ------
NM_175038chr12--1241 ----
NM_175061chr731702 1360 825 11581 ----
NM_175607chr311060 11103 --1264
NM_175610chr1531245 1215 68 ------
NM_175612chr311060 11103 --1264
NM_175624chr12126883 6850 6504 6477 6071 5946 5875 5685 5338 5166 4773 2429 11930 37508 1275 1183 --
NM_175625chr12126883 6850 6504 6477 6071 5946 5875 5685 5338 5166 4773 2429 11930 37508 1275 1183 --
NM_175634chr841267 1201 1046 118 --1292 --
NM_175635chr841267 1201 1046 118 --1292 --
NM_175636chr841267 1201 1046 118 --1292 --
NM_175736chr12137850 6598 6406 6098 5652 5601 5151 3030 2954 2145 1332 544 180 --57799 6007 5972 4883 1875 --
NM_175848chr2011427 ------
NM_175848chr2011427 ------
NM_175849chr2011427 ------
NM_175849chr2011427 ------
NM_175850chr2011427 ------
NM_175850chr2011427 ------
NM_175852chr192285 1943 1930 1205 708 688 518 497 378 --12957 12943
NM_175876chr142591 2354 816 647 189 ----
NM_176792chr1021124 154 21398 206 11192 --
NM_176824chr41393 ------
NM_177398chr131974 1777 448 --21963 1741 --
NM_177399chr131974 1777 448 --21963 1741 --
NM_177422chr1--1235 2618 142 --
NM_177424chr122123 733 1429 31851 575 492 --
NM_177438chr1474192 3369 2619 2607 2584 1398 389 --12750 --
NM_177553chr112946 825 ------
NM_177952chr143818 756 721 ------
NM_177972chr1194241 4133 3992 3978 3584 3576 794 604 133 13726 34380 3605 1406 --
NM_177985chr221417 336 ----11790
NM_177989chr31238 ------
NM_177999chr953511 2603 528 349 170 13742 --11474
NM_178006chr1352088 1857 911 689 206 ------
NM_178007chr1352088 1857 911 689 206 ------
NM_178011chr1042987 2072 1272 114 --23206 2785 --
NM_178013chr14112792 2695 2536 2238 2184 2113 2010 1936 1178 581 404 --21210 264 --
NM_178031chr111203 ------
NM_178042chr31238 ------
NM_178123chr2----1335 --
NM_178126chr173554 390 149 11837 ----
NM_178140chr512070 12658 ----
NM_178151chrX87293 7004 6622 2779 2758 2582 2014 316 26800 1745 45666 2946 2271 1530 36182 5871 2693
NM_178152chrX87293 7004 6622 2779 2758 2582 2014 316 26800 1745 45666 2946 2271 1530 36182 5871 2693
NM_178153chrX87293 7004 6622 2779 2758 2582 2014 316 26800 1745 45666 2946 2271 1530 36182 5871 2693
NM_178313chr212158 --31414 1408 746 --
NM_178423chr731287 944 194 ------
NM_178425chr731287 944 194 ------
NM_178426chr12266 68 --31628 699 361 --
NM_178427chr12873 166 --31528 599 261 --
NM_178439chr22375 146 ------
NM_178445chr331023 945 806 ------
NM_178544chr1951433 1279 575 438 262 --21326 172 --
NM_178548chr13613 498 23 ------
NM_178566chr9--11897 ----
NM_178584chr23971 480 209 ------
NM_178585chr452085 915 800 257 225 --1344 --
NM_178586chr1432436 2122 868 ------
NM_178812chr841511 1493 310 289 ------
NM_178815chr1031926 57 28 1462 ----
NM_178832chr1091643 1580 1173 469 286 233 225 133 51 ------
NM_181093chr12456 385 ------
NM_181310chr631858 419 180 ----11508
NM_181332chrX72120 2021 1925 448 272 221 178 --123 --
NM_181339chr13782 698 241 --3829 75 48 --
NM_181351chr1162870 2776 2504 1096 290 136 ------
NM_181358chr153913 3216 3203 1620 211 11634 13718 --
NM_181359chr172409 1800 1683 1009 791 248 179 --21866 1724 --
NM_181361chr331440 470 108 1445 1993 --
NM_181427chr15--199 ----
NM_181443chr2032366 2089 1127 12040 ----
NM_181481chr1865729 4808 2561 2516 2508 1049 --15195 --
NM_181482chr1865729 4808 2561 2516 2508 1049 --15195 --
NM_181483chr1865729 4808 2561 2516 2508 1049 --15195 --
NM_181486chr1251036 548 475 365 32 11554 21492 390 --
NM_181504chr532565 1460 202 ------
NM_181521chr1696320 6040 5631 4708 4612 2899 1506 920 597 12471 --12235
NM_181523chr532565 1460 202 ------
NM_181524chr532565 1460 202 ------
NM_181527chr20181 ------
NM_181528chr201136 ------
NM_181537chr17162 --1153 --
NM_181553chr1621049 779 ------
NM_181554chr1621049 779 ------
NM_181571chr103940 294 130 ------
NM_181581chr72679 321 ------
NM_181643chr131572 1156 290 --1542 --
NM_181674chr51312 ----1107
NM_181675chr51312 ----1107
NM_181676chr51312 ----1107
NM_181677chr51312 ----1107
NM_181678chr51312 ----1107
NM_181705chr5104928 4336 3928 3759 3656 2213 1946 1548 462 89 --11299 --
NM_181706chr1112281 --12258 --
NM_181714chr611666 --41921 491 320 100 --
NM_181741chr211320 --31278 1238 1099 --
NM_181742chr211320 --31278 1238 1099 --
NM_181762chrX4186 164 144 67 ------
NM_181777chrX4186 164 144 67 ------
NM_181782chr641906 1834 1557 1422 --12227 --
NM_181784chr292646 2481 2245 2084 2031 2008 1978 1964 128 ------
NM_181807chr111330 ----1127
NM_181809chr143991 3733 967 281 --22821 1408 --
NM_181836chr552576 2177 2166 449 104 1855 21799 1073 --
NM_181861chr1232512 2227 224 ------
NM_181868chr1232512 2227 224 ------
NM_181869chr1232597 2312 309 ------
NM_181876chr472283 2192 2184 798 527 175 161 ------
NM_181897chr372571 2036 1867 651 369 349 307 --22213 819 --
NM_182481chr2111225 ------
NM_182482chr2111225 ------
NM_182493chr1683938 3417 2107 1669 1228 1080 399 180 --11059 --
NM_182503chr694934 4778 3803 3515 2127 1634 634 527 479 25146 4169 ----
NM_182557chr1181918 1661 1584 1431 772 537 503 301 --31455 277 264 --
NM_182648chr142650 605 ------
NM_182691chr721171 247 1491 ----
NM_182692chr721171 247 1491 ----
NM_182697chr741762 1678 531 41 ------
NM_182715chr731213 1129 162 ------
NM_182718chr103940 294 130 ------
NM_182719chr103940 294 130 ------
NM_182724chr103940 294 130 ------
NM_182725chr103940 294 130 ------
NM_182763chr162761 2203 1875 951 482 80 ------
NM_182769chr103940 294 130 ------
NM_182770chr103940 294 130 ------
NM_182771chr103940 294 130 ------
NM_182772chr103940 294 130 ------
NM_182789chr5------1178
NM_182797chr2031673 1465 539 --11725 --
NM_182830chr1441987 1544 593 472 12002 ----
NM_182850chr103940 294 130 ------
NM_182896chr321719 668 ----1710
NM_182898chr7106096 5235 5182 5168 4467 2446 2358 1793 1699 1082 --26362 639 15475
NM_182899chr7106096 5235 5182 5168 4467 2446 2358 1793 1699 1082 --26362 639 15475
NM_182907chr662096 1905 1811 629 556 268 ------
NM_182936chr1431726 1123 282 11133 1401 --
NM_182943chr331135 1072 774 --21157 980 --
NM_182948chr142190 908 843 302 1264 23102 2240 --
NM_182964chr1163196 2619 2507 2029 638 266 ------
NM_182972chr111037 --2576 418 --
NM_182975chr11842 ------
NM_182978chr182638 85 --1698 1651
NM_183002chr1431726 1123 282 11133 1401 --
NM_183004chr1473525 3149 2940 2528 2416 1160 353 1622 12818 --
NM_183060chr103940 294 130 ------
NM_183228chr17127 --1574 --
NM_183229chr17127 --1574 --
NM_183230chr17127 --1574 --
NM_183231chr17127 --1574 --
NM_183232chr17127 --1574 --
NM_183323chr5------1178
NM_183376chr1532613 2200 500 --22135 211 --
NM_183381chr31675 ------
NM_183383chr31675 ------
NM_183384chr31675 ------
NM_183393chr32659 56 1989 1282 --
NM_183394chr32659 56 1989 1282 --
NM_183397chr20135062 5001 4983 4823 4544 3896 3598 3179 1822 1010 493 155 33 --23641 642 11866
NM_183398chr561255 1035 490 437 412 42 --11162 --
NM_183399chr561255 1035 490 437 412 42 --11162 --
NM_183400chr561255 1035 490 437 412 42 --11162 --
NM_183401chr561255 1035 490 437 412 42 --11162 --
NM_183415chr123711 478 319 ----1124
NM_194071chr785328 4937 4317 1849 1698 1070 1019 155 14194 11732 --
NM_194247chr253793 3738 2831 2791 1281 1333 1833 --
NM_194271chr121557 --1671 --
NM_194283chr5113666 3591 3129 2968 2715 2690 2666 1504 1173 703 34 13693 23210 3193 33168 3008 1690
NM_194285chr1142818 2451 2323 81 --11104 --
NM_194286chr12126109 5561 5245 4828 4091 3855 2328 1900 1639 1619 1372 165 25285 104 25195 4132 --
NM_194301chr141265 --11187 --
NM_194313chr951753 1444 785 191 88 1632 11292 --
NM_194314chr175555 4646 4312 3806 1304 360 99 --35261 4703 3472 34745 4621 4187
NM_194328chr963031 2834 2313 1314 1183 261 2503 373 13295 --
NM_194329chr963031 2834 2313 1314 1183 261 2503 373 13295 --
NM_194330chr963031 2834 2313 1314 1183 261 2503 373 13295 --
NM_194332chr963031 2834 2313 1314 1183 261 2503 373 13295 --
NM_194429chr6----2178 101 --
NM_194434chr1875691 5220 4864 3974 1592 1233 551 --15600 13926
NM_197941chr542954 2548 600 110 ------
NM_197955chr15--137 ----
NM_197968chr131658 ------
NM_197970chr231407 1248 1105 --1564 --
NM_197977chr91749 --1918 --
NM_198057chrX11209 --1411 --
NM_198077chr12587 488 ------
NM_198086chr1441746 1536 1408 617 1187 31375 854 801 --
NM_198123chr821481 470 ------
NM_198124chr821481 470 ------
NM_198158chr342889 2398 2214 2058 12623 ----
NM_198159chr342889 2398 2214 2058 12623 ----
NM_198177chr342889 2398 2214 2058 12623 ----
NM_198178chr342889 2398 2214 2058 12623 ----
NM_198181chr1562404 2387 2109 2017 1003 361 --2944 497 --
NM_198204chr1731207 982 51 --11409 --
NM_198205chr1731207 982 51 --11409 --
NM_198212chr741886 900 546 51 --22186 935 --
NM_198243chr152687 81 ------
NM_198256chr221976 555 ------
NM_198261chr12--1797 1683 --
NM_198262chr12--1797 1683 --
NM_198268chr153913 3216 3203 1620 211 11634 13718 --
NM_198269chr153913 3216 3203 1620 211 11634 13718 --
NM_198270chrX22786 1049 12626 12680 --
NM_198273chr533135 1919 552 ----32074 1179 829
NM_198279chrX31289 940 421 ------
NM_198381chr112267 214 --11297 --
NM_198391chr2041377 1199 622 72 ------
NM_198395chr521063 948 ------
NM_198399chr331671 391 379 ------
NM_198400chr1542559 762 537 321 ------
NM_198404chr133639 279 189 ------
NM_198468chr683943 3300 3252 3009 1837 1263 349 70 1442 1965 13549
NM_198485chr382539 2530 2430 824 617 592 408 317 1641 --1659
NM_198503chr13861 285 29 11699 2889 184 12105
NM_198513chr841942 1671 1553 631 ------
NM_198560chr3143510 3423 3239 2666 1431 1390 1110 1094 1083 899 458 402 303 283 ------
NM_198581chr266950 5691 4570 2738 2701 678 180 12090 26884 4763
NM_198584chr8------1785
NM_198715chr176023 5972 5136 3877 1029 998 453 --34882 1538 156 15097
NM_198793chr343203 2951 1136 723 23951 1489 11169 12598
NM_198794chr14--11263 21350 473 --
NM_198829chr731104 439 267 ------
NM_198830chr171614 ------
NM_198859chr373512 3150 1988 1516 848 714 229 15113 ----
NM_198896chr1122069 426 --1418 --
NM_198900chr12137850 6598 6406 6098 5652 5601 5151 3030 2954 2145 1332 544 180 --57799 6007 5972 4883 1875 --
NM_198903chr52626 87 ------
NM_198904chr551579 626 375 326 87 --22078 1606 --
NM_198935chr2032720 2430 723 13284 23189 2711 --
NM_198965chr121135 --1347 --
NM_198966chr121135 --1347 --
NM_198968chr1333083 2941 473 --13255 23845 1332
NM_198990chr7112730 2693 2305 1245 1196 965 794 771 453 214 95 22972 1325 33078 2044 308 --
NM_199000chr741929 1802 888 549 --42009 1585 766 444 --
NM_199050chr2153248 1401 1150 643 431 13335 1738 --
NM_199053chr42722 212 ------
NM_199136chr71136 ------
NM_199188chr1263783 3540 3522 3276 3103 172 --1817 --
NM_199190chr1263783 3540 3522 3276 3103 172 --1817 --
NM_199262chr1761900 1814 1644 1626 405 22 --22075 615 --
NM_199324chr423170 2389 ----1331
NM_199327chr43863 459 122 --21060 100 --
NM_199415chr20112364 2277 2154 2061 1816 924 908 781 329 227 219 --1979 --
NM_199421chr1485031 4987 3382 1916 1315 397 290 265 --55113 3542 1647 1554 1119 14423
NM_199423chr1641194 614 274 258 --2405 135 --
NM_199454chr184677 3856 1628 1464 1388 987 175 85 --1669 --
NM_199461chr10103322 2940 2550 2351 1271 1046 989 877 861 560 --1687 --
NM_199462chr1124553 4048 3533 3455 3265 2008 1803 1548 1522 803 618 29 --24229 1046 --
NM_199482chr242084 1746 730 701 ----11929
NM_201263chr131304 521 26 ------
NM_201267chr21627 ------
NM_201269chr121471 1456 --11442 --
NM_201437chr831402 1173 149 ------
NM_201567chr351597 1406 1384 1280 302 --1201 --
NM_201599chrX7897 886 441 424 382 145 136 --11087 --
NM_201613chr121839 ------
NM_203282chr1931483 274 58 11661 11541 --
NM_203301chr1421387 51 ------
NM_203327chr2054149 3539 3458 2920 566 --3978 906 191 1345
NM_203329chr11106015 5832 5795 5268 4743 2530 1498 1413 907 508 14884 25038 1103 --
NM_203330chr11106015 5832 5795 5268 4743 2530 1498 1413 907 508 14884 25038 1103 --
NM_203331chr11106015 5832 5795 5268 4743 2530 1498 1413 907 508 14884 25038 1103 --
NM_203349chr1521846 489 1148 ----
NM_203351chr1742376 1837 1710 596 11721 21897 1693 --
NM_203379chr103739 624 95 --1396 --
NM_203380chr103739 624 95 --1396 --
NM_203394chr1232630 470 432 11945 11781 --
NM_203406chr542902 2771 2093 816 --11941 --
NM_203446chr21----32656 2199 1088 12879
NM_203458chr153665 3199 2702 2547 601 ----23857 489
NM_203459chr11616 --1648 --
NM_203464chr121239 1079 ------
NM_203487chr1321254 85 ------
NM_203499chr172898 36 1352 ----
NM_203504chr4----12439 --
NM_203505chr4----12439 --
NM_203506chr1731809 744 125 --21522 378 11427
NM_205548chr51390 ----1161
NM_205768chr111269 ----158
NM_205836chr52485 191 1467 ----
NM_205842chr22734 650 ----1222
NM_205846chr541351 575 416 394 ------
NM_205860chr162997 2975 2896 2843 823 522 ------
NM_205861chr151761 1600 1347 864 561 1810 --11423
NM_206594chr161328 832 683 556 294 272 ------
NM_206595chr161328 832 683 556 294 272 ------
NM_206853chr633862 1066 798 --12646 --
NM_206854chr645123 2059 730 689 --23907 3564 --
NM_206855chr646088 4026 1695 1654 --24872 4529 --
NM_206860chr10----1453 --
NM_206861chr10----1453 --
NM_206862chr10----1453 --
NM_206866chr2193297 3220 2669 2163 986 850 727 708 365 --1757 --
NM_206876chr263623 3237 3209 3084 749 445 11039 11288 --
NM_206907chr522245 428 ----11287
NM_206909chr8148150 7560 5813 3299 3207 3043 2493 2113 1764 1534 1448 1425 1031 989 15776 1865 --
NM_206914chr12102150 1921 1779 1717 1556 1452 1425 1418 482 113 --11706 --
NM_206937chr131770 ------
NM_207012chr1063110 2949 2939 2501 2197 497 --12290 --
NM_207015chr31672 11918 1328 --
NM_207043chr162282 2197 1898 1816 1807 497 --12088 1209
NM_207044chr162282 2197 1898 1816 1807 497 --12088 1209
NM_207047chr162282 2197 1898 1816 1807 497 --12088 1209
NM_207303chr1054066 3900 3311 2613 1537 --12719 --
NM_207337chr1221002 336 --1432 --
NM_207343chr111387 178 ----
NM_207361chr1385995 4559 4190 2317 2284 2012 869 773 --24584 288 --
NM_207371chr1021364 558 11345 ----
NM_207372chr1062292 2229 1873 659 451 83 1465 2804 629 --
NM_207406chr486147 5658 5573 5254 3988 2500 2106 1962 --26232 2341 14958
NM_207429chr1122452 122 ------
NM_207435chr124911 778 151 68 --1380 --
NM_207481chr22506 46 --11022 --
NM_207645chr1121336 120 ------
NM_207647chr912364 1766 --11782
NM_212467chr1552202 1964 1707 896 340 ------
NM_212551chr121131 298 --2901 280 1695
NM_212558chr964225 1637 907 778 623 529 --23690 3639 --
NM_213589chr235593 5344 2120 44771 3966 1138 1099 13683 14198
NM_213594chr1241155 531 135 119 ----194
NM_213654chr31508 --21087 338 --