TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-135a-5p
miRNA Sequence: UAUGGCUUUUUAUUCCUAUGUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr144813 782 701 100 ------
NM_000027chr43906 772 640 ------
NM_000038chr521899 222 ----1145
NM_000046chr582814 2252 2001 955 818 737 641 338 12949 22633 2262 --
NM_000053chr1321419 133 ------
NM_000084chrX226606 6571 6517 6434 6379 6221 6212 6144 6052 4621 4602 4385 2573 2377 1627 1393 1245 1119 862 472 388 106 25207 4472 36030 5580 4529 --
NM_000092chr263905 3435 1150 1081 372 307 --1807 --
NM_000104chr242572 883 813 640 --1372 --
NM_000108chr751528 1305 436 224 57 ------
NM_000109chrX41690 862 811 61 ------
NM_000125chr693716 3465 3311 3299 2929 460 410 333 138 13492 --13194
NM_000158chr3----3537 226 115 --
NM_000163chr532027 1787 71 --12300 --
NM_000165chr611209 ------
NM_000167chrX31741 1199 117 ------
NM_000176chr573901 3075 2792 2612 1428 708 507 --12703 --
NM_000201chr194529 226 194 165 --1924 --
NM_000212chr1792221 1673 1560 949 828 661 629 490 353 --1372 --
NM_000214chr2031241 206 195 ------
NM_000217chr1274036 3814 3521 1969 1861 1570 752 13440 21370 1349 --
NM_000232chr422723 2568 22154 470 31082 493 254 11258
NM_000245chr781852 1720 1700 1551 782 404 222 200 --175 --
NM_000252chrX21448 1166 ------
NM_000259chr15106377 5731 5098 5087 4707 4660 4575 3943 1791 1087 14614 2793 127 24698 2296
NM_000264chr983400 3048 2661 2407 1014 812 270 30 ------
NM_000267chr1742779 2625 743 568 --1353 --
NM_000282chr13243 23 ------
NM_000291chrX3965 679 42 ------
NM_000297chr431925 1760 321 ------
NM_000321chr1341152 1121 185 168 ------
NM_000325chr4------1122
NM_000330chrX22282 215 ------
NM_000332chr656718 6649 5832 5778 1734 12368 25504 1668 --
NM_000333chr34974 805 785 329 --1174 --
NM_000337chr5196399 6336 6194 6123 6044 5584 4984 4893 4538 4445 2133 2089 1533 1415 1135 793 571 546 72 26021 577 12207 16484
NM_000345chr42680 85 ------
NM_000346chr1741745 1467 247 161 ------
NM_000362chr2242852 1039 704 457 --12827 12394
NM_000368chr954665 3491 3132 1389 335 21616 1448 21044 881 --
NM_000390chrX42643 2311 581 360 ------
NM_000393chr232088 774 399 --11492 --
NM_000408chr253105 2866 2799 2584 1232 12549 12227 --
NM_000449chr121209 1109 --1936 --
NM_000461chr354424 4316 3573 1546 670 13478 11692 11508
NM_000462chr1511791 ----11405
NM_000493chr61132 ------
NM_000495chrX21099 1022 ------
NM_000533chrX41422 1415 268 199 ------
NM_000538chr132267 203 ----1311
NM_000539chr371562 1422 1370 1028 238 110 71 --11090 --
NM_000555chrX147218 7070 6748 6610 6418 5405 5204 3052 2921 2667 2450 2146 1578 1155 ------
NM_000575chr25958 869 364 90 70 11119 ----
NM_000599chr2104432 3959 1846 1817 1773 1656 1337 1268 1257 204 1975 ----
NM_000601chr71119 ------
NM_000609chr1073024 1921 953 843 580 388 282 --1242 13103
NM_000610chr1172467 2267 2000 1882 1140 1020 166 --22435 544 --
NM_000618chr12156623 6382 6306 6003 5967 5574 2429 2359 1892 1540 1251 987 704 372 304 --11507 14576
NM_000618chr12156623 6382 6306 6003 5967 5574 2429 2359 1892 1540 1251 987 704 372 304 --11507 14576
NM_000633chr1875207 3325 3258 3229 1202 726 200 15174 23798 2024 --
NM_000719chr12136580 5945 5679 5604 5189 4945 4627 2679 2327 2215 1840 940 415 --16086 --
NM_000721chr182368 2059 1940 1093 921 582 547 69 ----1647
NM_000726chr23924 520 487 ------
NM_000793chr14125163 4880 4556 4508 3942 3168 1249 812 703 543 518 368 11290 34239 1109 473 --
NM_000794chr53957 669 43 1224 ----
NM_000800chr521603 649 --11482 --
NM_000806chr521897 1684 --21268 229 --
NM_000807chr43560 531 209 ------
NM_000808chrX31019 906 218 ------
NM_000809chr478906 5812 2633 1264 638 274 133 --27321 5878 11766
NM_000813chr584868 3502 2008 1619 1448 1065 1005 339 ------
NM_000814chr1584001 3747 3670 3314 2845 1144 625 269 ----1308
NM_000828chrX3445 312 74 --21993 328 --
NM_000831chr1146079 5454 5000 4110 3941 2455 2403 1335 1055 413 271 244 173 157 15354 42321 2161 1904 1302 --
NM_000834chr1251279 1186 1090 868 231 ------
NM_000868chrX21783 37 ------
NM_000870chr551450 1243 1075 494 32 --21263 505 --
NM_000872chr1021409 466 --131 --
NM_000875chr15127006 6626 6441 6230 6050 5335 4591 4562 2759 895 740 545 --26246 5308 --
NM_000877chr253014 2922 2472 2049 58 --3905 630 158 --
NM_000891chr1773572 2786 2504 1363 1152 551 458 23050 1476 12449 --
NM_000899chr1241350 893 730 685 24185 3433 13264 --
NM_000901chr422110 1783 --1135 22341 266
NM_000917chr103925 353 118 ------
NM_000926chr11139267 8445 8032 7529 6994 6654 6460 6454 3788 2991 2950 2579 1015 37809 3244 1246 43607 3083 2742 372 29058 3208
NM_000937chr171370 ------
NM_000950chrX52815 2807 2454 595 542 --13658 --
NM_000953chr1421532 184 ------
NM_000956chr144891 811 800 432 11008 ----
NM_000962chr973051 2551 836 735 678 308 65 ----13151
NM_000963chr131533 800 114 1143 ----
NM_000991chr1982903 2698 2577 2399 952 814 173 28 --23017 114 --
NM_000994chr34862 329 318 226 11125 ----
NM_001001323chr1223080 372 ------
NM_001001330chr1011228 1842 ----
NM_001001331chr382403 2330 2203 2032 1949 1000 933 296 11967 ----
NM_001001389chr1172467 2267 2000 1882 1140 1020 166 --22435 544 --
NM_001001390chr1172467 2267 2000 1882 1140 1020 166 --22435 544 --
NM_001001391chr1172467 2267 2000 1882 1140 1020 166 --22435 544 --
NM_001001392chr1172513 2313 2046 1928 1186 1066 212 --22481 590 --
NM_001001395chr1232513 1930 439 --22458 1067 --
NM_001001396chr174437 3121 2728 1468 1430 1422 662 --23812 1353 --
NM_001001419chr555034 4731 3341 3309 1678 34711 1922 1198 --15187
NM_001001420chr555034 4731 3341 3309 1678 34711 1922 1198 --15187
NM_001001433chr2072897 2640 2574 2127 869 828 367 --1961 --
NM_001001438chr212408 52 ------
NM_001001481chr852494 1190 1003 904 494 21227 210 12734 12475
NM_001001484chr1052315 1809 775 719 160 --11977 12139
NM_001001664chr233458 2866 2628 13604 ----
NM_001001665chr263021 2608 2324 2225 802 642 1955 11336 --
NM_001001668chr1994311 4212 1642 1532 947 920 827 789 298 23201 3011 --24081 3825
NM_001001669chr562376 2103 2090 929 877 111 --1561 1633
NM_001001684chr1732162 1635 233 --12259 --
NM_001001787chr11336 ------
NM_001001870chr171785 --1593 --
NM_001001971chr102980 889 1205 11310 --
NM_001002009chr71231 ------
NM_001002010chr71231 ------
NM_001002258chr261599 1539 1462 1252 540 235 --1121 --
NM_001002759chr10----2468 454 --
NM_001002762chr1052874 1138 688 358 40 --42231 1960 1018 421 --
NM_001002843chr154953 880 814 360 ------
NM_001003652chr18138063 7858 7729 7231 7070 6852 5716 2971 2010 1998 1215 1029 642 13285 28712 1310 --
NM_001003674chr18106814 6299 5657 4889 4588 4326 2784 1816 1437 359 14754 36830 1329 769 --
NM_001003675chr18106814 6299 5657 4889 4588 4326 2784 1816 1437 359 14754 36830 1329 769 --
NM_001003694chr31516 ------
NM_001003712chr12103946 3812 3732 3580 1547 981 835 814 204 178 12907 --13225
NM_001003760chr622782 53 --21442 771 --
NM_001003792chr31432 ------
NM_001003793chr31432 ------
NM_001003794chr392993 2615 2374 2086 1991 1951 1189 967 283 ------
NM_001003800chr943713 2877 2801 921 13094 --13545
NM_001003927chr172414 54 ------
NM_001004065chr943022 2812 2693 1075 1497 13166 13523
NM_001004328chr1242323 2250 904 668 ----132
NM_001004346chr4----31118 87 33 --
NM_001004360chr231399 1358 785 ----1761
NM_001004419chr1222873 1166 --34284 775 395 14185
NM_001005266chr151502 1131 2524 84 --
NM_001005267chr151502 1131 2524 84 --
NM_001005268chr151502 1131 2524 84 --
NM_001005269chr151502 1131 2524 84 --
NM_001005375chrY41270 439 142 102 21441 675 11276 --
NM_001005386chr212450 ------
NM_001005404chr1723895 1457 --14188 --
NM_001005473chr526056 502 25507 653 ----
NM_001005609chrX133340 3046 2532 2406 1521 1347 1331 1283 1230 1211 477 346 51 --12749 --
NM_001005746chr23924 520 487 ------
NM_001005747chr23924 520 487 ------
NM_001005781chr22511 53 ----1191
NM_001005849chr171570 ------
NM_001006610chr163672 192 106 --3732 685 396 --
NM_001007023chr14125163 4880 4556 4508 3942 3168 1249 812 703 543 518 368 11290 34239 1109 473 --
NM_001007024chr1784058 3572 3335 2773 1659 1366 330 168 ------
NM_001007025chr1784058 3572 3335 2773 1659 1366 330 168 ------
NM_001007073chr34862 329 318 226 11125 ----
NM_001007074chr34862 329 318 226 11125 ----
NM_001007097chr965105 4541 2039 1984 1381 934 --14983 --
NM_001007102chr621557 209 --1537 --
NM_001007157chr7----1117 --
NM_001007237chr182471 2357 2072 1905 1793 1059 873 194 --11777 --
NM_001007246chr212681 211 --21502 1461 11421
NM_001007277chr111370 --1798 --
NM_001007466chr685199 4342 4165 4154 3989 3657 201 45 ------
NM_001007471chr91757 1621 1304 --
NM_001008239chr1833537 3065 173 --13492 --
NM_001008392chr393450 2501 2247 2196 1373 1089 424 132 114 ------
NM_001008405chr731318 1162 684 21692 329 ----
NM_001008529chr1771234 1170 1145 1126 1103 466 23 ------
NM_001008539chr853537 3287 1783 978 678 24350 3358 13918 11494
NM_001008723chr10----1407 --
NM_001008738chr562418 2261 2085 1788 728 257 ------
NM_001008783chr62328 223 --1599 --
NM_001008801chr1921742 1336 --1492 2604 54
NM_001008938chr111138 ------
NM_001009552chr81393 ------
NM_001009569chr1041506 1164 499 131 ------
NM_001009899chr385887 5587 5399 4469 4281 1610 722 510 35759 4558 708 24802 148 --
NM_001009959chr262226 2181 2166 2151 330 46 1929 1801 --
NM_001009960chr71122 2455 112 1358 --
NM_001009993chr2114438 4345 4183 4006 3407 3037 2986 2936 1278 916 624 ------
NM_001010846chr184433 3381 2908 2870 2846 600 427 126 ------
NM_001010853chr652845 2789 1000 791 499 ------
NM_001010861chr152348 2241 2029 1815 1100 12133 1456 --
NM_001010862chrX63060 2770 2290 2269 852 714 12973 12945 --
NM_001010867chr1186428 6374 5916 5886 5754 5287 5093 4592 4409 4268 2213 1876 1833 1233 1013 863 694 571 ------
NM_001010888chrX73630 2974 2818 1562 1113 695 244 34332 4283 3112 2952 846 --
NM_001010891chr5116928 6395 5849 5838 5365 2783 2402 2020 1753 1571 28 16785 26368 1418 --
NM_001010932chr71119 ------
NM_001011513chr474078 3410 2569 1183 950 752 569 ------
NM_001011537chr341915 1704 1682 1640 1947 11543 --
NM_001011551chrX1144 ------
NM_001011553chr72921 838 ------
NM_001011666chr775669 5532 5147 5077 4930 1606 290 15132 55696 5501 4541 1731 1430 15028
NM_001012270chr1711896 --31607 576 566 11675
NM_001012271chr1721999 1293 --31710 679 669 11778
NM_001012393chr1194429 3700 3147 1797 1554 1203 1190 1087 690 --24697 805 --
NM_001012420chr1532660 2253 910 ------
NM_001012423chr1532660 2253 910 ------
NM_001012661chr111152 ------
NM_001012751chr10--143 ----
NM_001012755chrX85085 4016 3888 3589 1468 893 238 97 21017 966 34511 4037 3663 --
NM_001012968chrX32115 1775 449 12836 ----
NM_001013031chr1053156 2889 1168 356 302 --12717 --
NM_001013251chr111152 ------
NM_001013406chr761277 1249 313 266 157 26 11342 1502 --
NM_001013438chr32834 70 ------
NM_001013439chr31680 ------
NM_001013620chr12127458 6551 6032 3385 3107 2622 2069 2026 1497 1357 821 539 28110 2317 38395 7006 2451 --
NM_001013699chr121523 1493 1111 --
NM_001014380chr1364577 4327 3700 1804 1266 966 13862 12347 --
NM_001014797chr10157501 6993 6720 6650 5558 5395 5223 2109 2053 1816 1673 1617 1398 1139 356 --25386 2936 1749
NM_001015045chr472035 1664 910 835 626 454 222 --11940 --
NM_001015877chrX1978 1208 1612 1295
NM_001017371chr21517 21236 983 1892 --
NM_001017395chr343686 3150 2359 2301 11277 ----
NM_001017415chr1198 ------
NM_001017416chr1198 ------
NM_001017424chr151945 1844 1822 1743 168 133 ----
NM_001017425chr151945 1844 1822 1743 168 133 ----
NM_001017440chr7158036 7927 7514 7025 6577 6506 6442 5690 5545 5190 1888 1534 993 983 330 21796 284 26287 553 --
NM_001017962chr103925 353 118 ------
NM_001017969chr91256 ------
NM_001018025chrX4784 754 325 209 ------
NM_001018037chr931336 365 186 11046 ----
NM_001018054chr111341 ----11368
NM_001018064chr971990 1847 1737 1689 1608 1308 86 ------
NM_001018065chr996046 5525 5194 4748 2314 1862 1510 986 870 --54648 1848 1760 1486 1049 --
NM_001018066chr996046 5525 5194 4748 2314 1862 1510 986 870 --54648 1848 1760 1486 1049 --
NM_001018074chr573901 3075 2792 2612 1428 708 507 --12703 --
NM_001018075chr573901 3075 2792 2612 1428 708 507 --12703 --
NM_001018076chr573901 3075 2792 2612 1428 708 507 --12703 --
NM_001018077chr573901 3075 2792 2612 1428 708 507 --12703 --
NM_001020825chr541376 550 267 87 --1178 --
NM_001023560chr64912 318 161 71 ------
NM_001024094chr573901 3075 2792 2612 1428 708 507 --12703 --
NM_001024372chr831424 413 35 1755 12298 --
NM_001024380chr84730 702 611 598 --12048 --
NM_001024381chr84730 702 611 598 --12048 --
NM_001024455chrX61996 1849 1061 621 483 474 12492 ----
NM_001024601chr1194 ------
NM_001024649chr51496 ------
NM_001024660chr331249 1054 175 11084 11127 --
NM_001024847chr351848 621 558 306 24 1364 ----
NM_001024948chr143242 2937 2143 405 ------
NM_001024956chr1165598 5481 4610 2297 1189 545 25180 2002 35294 3654 1086 13935
NM_001025076chr10145686 5456 4956 4823 4779 4706 4539 4356 3986 1931 1618 1454 240 224 --24514 561 --
NM_001025077chr10197044 6814 6314 6181 6137 6064 5897 5714 5344 4752 4657 2976 2812 1598 1582 822 717 517 61 --25872 1919 --
NM_001025079chr363779 2740 1042 1034 879 830 --23990 3639 --
NM_001025105chr52992 523 --1964 --
NM_001025108chr262994 1379 1055 911 572 182 --22667 996 --
NM_001025266chr364430 4357 1859 1236 1209 566 --34611 3313 1519 --
NM_001025580chrX54010 3448 1618 1555 79 --11105 --
NM_001025603chr121209 1109 --1936 --
NM_001025616chr411369 --1369 11805
NM_001029858chr653237 2276 1039 42 29 1437 2933 690 --
NM_001029859chr1182400 2383 2353 2154 2039 1787 1690 1590 ----1271
NM_001029863chr652464 1260 1140 766 591 13139 --1132
NM_001030007chr1644040 3179 1036 796 ------
NM_001030055chr1464255 4164 3580 3488 3057 1167 1226 1502 --
NM_001030272chr112147 134 130 2410 124 --
NM_001030273chr112147 134 130 2410 124 --
NM_001031679chr1272841 2465 2278 2201 719 243 158 ------
NM_001031684chr21926 11043 11291 --
NM_001031695chr22124802 4617 4356 4276 4029 3970 3496 2055 2028 1947 992 934 ----11204
NM_001031700chr452496 2280 2081 1901 603 1146 ----
NM_001031732chr473335 2948 2932 2832 2672 2363 528 12954 ----
NM_001031804chr1664381 4255 3612 3296 3258 85 ------
NM_001031812chr542281 2231 1856 1517 ----1545
NM_001032221chr931705 1267 655 --11320 --
NM_001032283chr1231029 793 356 1737 ----
NM_001032284chr1231029 793 356 1737 ----
NM_001032296chr1352062 1978 1895 118 70 ----1549
NM_001032380chr1072040 2022 1363 1299 593 429 411 21816 1540 ----
NM_001032394chr632802 2307 1931 12501 1376 --
NM_001032395chr632669 2174 1798 22368 1036 1243 --
NM_001033045chr234407 3005 256 --13924 13652
NM_001033059chr6--11428 ----
NM_001033087chr2072603 2550 2102 1239 1228 835 662 --11279 --
NM_001033112chr52774 635 ------
NM_001033117chr394895 4457 3673 3665 1625 1218 832 825 177 13766 --13197
NM_001033723chr8112714 2668 2393 2072 894 836 613 411 259 172 108 1228 32727 2243 1066 --
NM_001033925chr104742 566 470 243 1752 ----
NM_001034841chr16114812 4686 4300 3372 3361 1905 1583 820 746 620 79 23684 3564 24253 3623 --
NM_001034845chr41330 1903 ----
NM_001034954chr1072891 2620 2335 756 731 443 250 --12813 --
NM_001034955chr1072891 2620 2335 756 731 443 250 --12813 --
NM_001034956chr1072891 2620 2335 756 731 443 250 --12813 --
NM_001034957chr1072891 2620 2335 756 731 443 250 --12813 --
NM_001035003chr431203 898 290 --1955 --
NM_001035004chr431203 898 290 --1955 --
NM_001035260chr1041585 1352 1177 188 --11141 --
NM_001035521chr25772 731 680 649 323 169 ----
NM_001037132chr711634 ------
NM_001037133chr711634 ------
NM_001037165chr7168318 8208 7264 6967 6927 6463 6269 5955 5565 2997 2988 2933 2879 1300 479 464 18759 26802 3394 18829
NM_001037290chr113808 394 129 ------
NM_001037317chr152348 2241 2029 1815 1100 12133 1456 --
NM_001037331chr18--1330 ----
NM_001037535chrX41377 1313 1285 1120 1506 ----
NM_001037536chrX41377 1313 1285 1120 1506 ----
NM_001037540chrX41377 1313 1285 1120 1506 ----
NM_001037954chr1163363 1358 1220 1143 986 743 --12966 --
NM_001038493chr221028 417 --1156 --
NM_001039199chr20134989 4732 4446 4092 3928 3451 1931 1484 1303 1137 886 618 346 1784 ----
NM_001039538chr263400 3229 2888 2786 2344 803 11419 --21413 1000
NM_001039577chr174406 3700 3419 2847 1606 969 124 24461 3996 23567 2937 --
NM_001039590chrX33981 3462 2636 12901 23956 1059 1634
NM_001039591chrX33981 3462 2636 12901 23956 1059 1634
NM_001039614chr15--143 --197
NM_001039618chr1165168 4574 4494 4339 4175 497 15804 13638 15952
NM_001039762chr106950 811 757 714 593 57 1352 ----
NM_001039802chr11902 ------
NM_001039840chrX55025 4550 3882 1551 1046 ----1727
NM_001039937chr1333513 1051 725 --1803 --
NM_001039960chr1241181 1113 696 181 --1132 1351
NM_001040020chr72100 71 157 11315 --
NM_001040142chr232421 2193 664 --12112 --
NM_001040143chr232421 2193 664 --12112 --
NM_001040157chr422837 986 --1264 --
NM_001040172chr551450 1243 1075 494 32 --21263 505 --
NM_001040173chr551450 1243 1075 494 32 --21263 505 --
NM_001040202chr441806 732 444 355 1545 22490 972 1913
NM_001040280chr651264 1154 1010 251 206 1284 1294 --
NM_001040284chr1685832 5551 5306 5029 4549 4131 4062 1568 --25074 4146 1246
NM_001040429chr1351355 1055 958 515 465 11080 23562 1396 --
NM_001040441chr185235 5051 4522 3797 1354 1339 1317 717 --24336 153 --
NM_001040446chr532130 1878 383 ----11076
NM_001040450chr1542490 1101 1077 168 --2912 325 --
NM_001040453chr1542490 1101 1077 168 --2912 325 --
NM_001040624chr852235 2156 2139 1018 613 ----1902
NM_001040625chr852235 2156 2139 1018 613 ----1902
NM_001040626chr852235 2156 2139 1018 613 ----1902
NM_001040627chr852235 2156 2139 1018 613 ----1902
NM_001040628chr852235 2156 2139 1018 613 ----1902
NM_001040629chr852235 2156 2139 1018 613 ----1902
NM_001040630chr852235 2156 2139 1018 613 ----1902
NM_001040653chr382646 2285 2173 1828 1049 857 777 369 1887 ----
NM_001040665chr734527 1213 1119 11107 24611 3538 --
NM_001040712chr921427 1335 169 11021 --
NM_001040876chr43712 424 144 --21588 28 1248
NM_001042403chr12--1738 ----
NM_001042404chr111599 --1318 --
NM_001042413chr953270 3115 1340 987 451 21372 720 11314 --
NM_001042414chr13140 ------
NM_001042453chrX31704 1358 331 --31275 357 136 1468
NM_001042481chr141556 --11976 161
NM_001042492chr1742779 2625 743 568 --1353 --
NM_001042494chr15123358 3083 2798 2482 1402 1322 1066 483 343 286 242 185 1507 2791 382 11202
NM_001042495chr15123358 3083 2798 2482 1402 1322 1066 483 343 286 242 185 1507 2791 382 11202
NM_001042496chr15123358 3083 2798 2482 1402 1322 1066 483 343 286 242 185 1507 2791 382 11202
NM_001042497chr15123358 3083 2798 2482 1402 1322 1066 483 343 286 242 185 1507 2791 382 11202
NM_001042517chr134347 302 137 34 --147 --
NM_001042537chrX11633 ----1106
NM_001042543chr421499 159 --31154 1094 169 --
NM_001042550chr94819 506 483 299 --2464 401 --
NM_001042555chr1254492 4442 3014 1153 496 11649 24318 325 --
NM_001042599chr266459 5317 3130 2626 1278 95 --47116 6891 5721 1766 25573 2384
NM_001042601chr332738 2477 714 22815 2247 --12284
NM_001042603chr1284562 4497 2152 935 864 729 264 59 ----13927
NM_001042604chr374248 4211 4055 3184 2997 981 819 24155 3372 ----
NM_001042646chr331851 671 126 11400 1642 --
NM_001042669chr411369 --1369 11805
NM_001042681chr142675 2536 1953 604 1444 12216 --
NM_001042682chr142675 2536 1953 604 1444 12216 --
NM_001042682chr142675 2536 1953 604 1444 12216 --
NM_001042749chrX1208 --21555 34 --
NM_001042750chrX1208 --21555 34 --
NM_001042751chrX1208 --21555 34 --
NM_001044305chr611559 ------
NM_001044385chr263297 2990 2706 1393 1371 990 --23551 1357 1322
NM_001044722chr542281 2231 1856 1517 ----1545
NM_001044723chr542281 2231 1856 1517 ----1545
NM_001076778chr382410 2383 2365 2331 2064 1737 483 23 --22006 890 --
NM_001106chr388631 8077 6347 3606 3130 2953 2736 2055 29237 7972 48316 3539 3479 2328 --
NM_001113490chrX73679 3456 2381 2319 857 507 404 ------
NM_001117chr18177 --1127 11876
NM_001126chr11719 1909 ----
NM_001128chr1644040 3179 1036 796 ------
NM_001146chr831661 166 135 --11778 1631
NM_001148chr461821 1594 886 833 344 164 ------
NM_001153chr21171 ------
NM_001160chr1252404 2321 1755 1019 852 --12047 --
NM_001167chrX126238 5752 5404 5096 4845 4447 2389 2276 2137 1229 688 607 --15230 --
NM_001173chr1464255 4164 3580 3488 3057 1167 1226 1502 --
NM_001174chrX3851 604 255 ----21845 1623
NM_001178chr112147 134 130 2410 124 --
NM_001186chr2131279 585 142 12360 11318 13040
NM_001198chr641854 1573 863 471 1336 11579 1194
NM_001200chr201154 ------
NM_001204chr297623 7317 5696 3054 3044 886 527 437 151 --25619 1055 --
NM_001206chr942235 363 196 117 --12192 --
NM_001212chr17171 ----124
NM_001237chr431103 974 277 ------
NM_001237chr431103 974 277 ------
NM_001241chr242069 1640 753 439 ------
NM_001241chr242069 1640 753 439 ------
NM_001255chr1----148 --
NM_001256chr1721921 811 --12130 --
NM_001257chr162555 94 ----11430
NM_001268chr13297 51 ------
NM_001270chr52460 318 144 ----
NM_001284chr52120 47 ------
NM_001286chr192725 2056 1863 1850 970 348 289 134 126 ------
NM_001289chrX21236 301 1151 ----
NM_001304chr1763770 3521 918 757 294 263 --12602 --
NM_001310chr1262086 1093 1038 544 113 34 ------
NM_001319chr191117 ----11089
NM_001332chr561555 1448 1190 204 165 153 --11067 --
NM_001343chr541424 660 626 191 --11648 11718
NM_001349chr22549 81 ------
NM_001351chr3154 11415 ----
NM_001356chrX42388 1986 675 37 12021 1666 11970
NM_001361chr165719 582 559 112 98 --2295 278 --
NM_001364chr1164249 3914 3523 3056 1765 1269 --23722 156 --
NM_001387chr5102741 2696 1167 1161 1140 971 829 759 256 54 ------
NM_001389chr21158 ------
NM_001390chr1853285 3128 2442 1269 631 1778 12496 141
NM_001391chr1831220 799 382 ----194
NM_001399chrX133340 3046 2532 2406 1521 1347 1331 1283 1230 1211 477 346 51 --12749 --
NM_001400chr131176 271 115 --11046 --
NM_001401chr951401 644 333 105 29 11037 ----
NM_001412chrX52353 1037 973 859 385 ----1846
NM_001417chr1231713 1499 697 ----1619
NM_001418chr11----1707 --
NM_001418chr11----1707 --
NM_001419chr1974287 3953 3915 3733 3264 2980 1895 --13380 --
NM_001423chr1251699 1441 774 743 516 --31451 440 48 --
NM_001432chr473671 3248 3202 3010 2691 1338 549 1592 22652 1497 --
NM_001438chr162802 1436 1405 1081 821 577 23071 2437 ----
NM_001449chrX11276 ------
NM_001460chr1123586 3524 3483 3349 2418 2241 1435 964 955 878 78 37 ------
NM_001498chr621123 126 --2934 238 --
NM_001521chr25772 731 680 649 323 169 ----
NM_001526chr61155 ------
NM_001542chr182471 2357 2072 1905 1793 1059 873 194 --11777 --
NM_001543chr584796 4075 2944 1742 929 757 460 65 --23417 3074 --
NM_001546chr641423 1409 90 40 ------
NM_001553chr4142 ------
NM_001555chrX183 ------
NM_001560chrX92254 2206 2177 2024 905 846 227 205 133 12048 1962 --
NM_001616chr22735 58 --2709 529 --
NM_001627chr331488 326 221 --11813 --
NM_001634chr6--11428 ----
NM_001650chr1853673 3396 2672 1401 443 13120 11450 --
NM_001664chr33955 700 148 1761 1124 --
NM_001677chr12974 30 --1376 --
NM_001682chr1222794 86 ------
NM_001683chr382403 2330 2203 2032 1949 1000 933 296 11967 ----
NM_001684chr174154 2838 1573 1185 1147 1139 379 --23529 1070 --
NM_001689chr261599 1539 1462 1252 540 235 --1121 --
NM_001695chr863157 2764 2684 831 790 684 --44049 4040 1649 1085 --
NM_001701chr921524 176 ------
NM_001706chr311075 ------
NM_001729chr42429 344 ------
NM_001731chr121812 ------
NM_001746chr51496 ------
NM_001759chr12114874 4749 4456 4371 4275 4259 3915 3688 1707 770 571 24391 778 44654 1714 1511 1020 --
NM_001777chr363779 2740 1042 1034 879 830 --23990 3639 --
NM_001788chr72921 838 ------
NM_001791chr11902 ------
NM_001792chr18175 ------
NM_001830chrX43562 2933 2837 2463 22492 880 33444 2623 1289 --
NM_001833chr9169 ------
NM_001839chr1160 --1522 --
NM_001854chr1----11198 --
NM_001858chr654616 2000 967 856 125 24454 3688 ----
NM_001859chr993790 3604 2851 2708 2453 1329 738 285 245 13455 12636 --
NM_001884chr51129 --2172 34 --
NM_001891chr41349 ------
NM_001892chr52992 523 --1964 --
NM_001920chr123640 138 75 ------
NM_001939chrX113560 3343 3318 3196 3185 2892 1078 1071 812 565 295 --12901 --
NM_001942chr1852024 1861 1819 1754 31 --21948 523 --
NM_001949chr61257 --3571 496 419 --
NM_001957chr442280 2273 652 470 11905 11768 22145 2049
NM_001967chr3----1178 --
NM_001969chr1493300 2955 2830 2652 2387 1150 1131 729 89 ------
NM_001981chr13937 855 294 ----21608 198
NM_001999chr551193 596 559 489 68 ------
NM_002006chr455298 5203 1961 1764 1658 35158 4992 2142 ----
NM_002009chr1532245 569 459 --12130 --
NM_002015chr1333127 3102 2636 --13353 13262
NM_002025chrX68807 8583 2632 1656 1009 205 --21831 153 18222
NM_002033chr1173996 3672 3612 2817 1588 795 36 --24057 315 2950 356
NM_002035chr1853859 3740 3667 3361 662 12993 ----
NM_002048chr92280 139 ------
NM_002063chrX21300 894 1407 ----
NM_002069chr721810 1298 ------
NM_002074chr151688 1427 1228 452 239 --1663 --
NM_002076chr1263214 2951 2879 713 682 414 --1994 --
NM_002126chr1753882 3793 2988 2918 931 --23545 2856 --
NM_002128chr1322463 514 ------
NM_002137chr72173 120 --22345 398 --
NM_002156chr2186 ------
NM_002158chr253027 2594 2531 2467 2341 ----21394 62
NM_002184chr52154 51 ------
NM_002190chr61417 ------
NM_002196chr2011074 ------
NM_002196chr2011074 ------
NM_002203chr563802 3752 3395 2947 1299 1162 13486 34157 3079 1100 --
NM_002214chr784861 4768 2170 1880 1583 1445 904 76 ----11032
NM_002223chr1253703 3585 3475 1607 773 --53762 3454 1470 924 729 1437
NM_002227chr121080 117 --2839 68 --
NM_002228chr151049 955 798 211 117 ------
NM_002233chr111421 ------
NM_002267chr1351975 1636 651 505 167 --1136 --
NM_002270chr584987 4865 3476 2026 1843 1546 835 561 --13564 11900
NM_002271chr1341599 846 756 131 --22224 116 --
NM_002285chr262994 1379 1055 911 572 182 --22667 996 --
NM_002293chr172510 2352 2316 606 563 143 55 --11856 --
NM_002306chr14----1115 --
NM_002310chr5105470 5076 4657 2052 1788 1585 400 242 176 30 15837 ----
NM_002336chr1264854 3327 3274 3185 1600 85 13481 1765 --
NM_002349chr221612 468 ------
NM_002354chr21384 ------
NM_002356chr61894 ------
NM_002358chr4----164 --
NM_002359chr1753479 2998 2810 1049 264 --11055 12722
NM_002374chr263400 3229 2888 2786 2344 803 11419 --21413 1000
NM_002387chr5104638 4505 3721 3172 1958 1944 1551 1430 169 53 1548 ----
NM_002395chr621167 401 ------
NM_002397chr562130 1891 1761 763 455 119 --21459 863 --
NM_002398chr231335 934 480 --1302 --
NM_002399chr1531435 939 203 --1186 --
NM_002401chr1782485 2408 2316 2031 997 631 479 281 12441 ----
NM_002431chr14177 ----1320
NM_002444chrX81885 1691 709 558 360 139 117 92 ------
NM_002445chr8----172 11054
NM_002448chr41787 1760 ----
NM_002495chr5142 ------
NM_002500chr211161 --1965 --
NM_002522chr1763335 3264 2607 2440 1200 957 11120 33612 2771 1028 --
NM_002523chr751090 1018 845 426 409 162 ----
NM_002544chr171112 191 ----
NM_002545chr1194429 3700 3147 1797 1554 1203 1190 1087 690 --24697 805 --
NM_002547chrX102935 2876 1346 1102 890 447 431 368 272 90 12626 --1152
NM_002556chr1142179 2077 1868 277 --11720 --
NM_002564chr115918 868 823 336 195 --1940 --
NM_002581chr9125164 4634 4496 3876 1976 1362 1349 1165 1109 710 512 275 --11737 --
NM_002583chr121554 1507 ----
NM_002590chr13----1125 --
NM_002594chr2052372 2017 1509 913 356 ------
NM_002613chr1693613 1958 1574 1539 1338 1286 886 767 96 --13515 --
NM_002629chr101157 --3663 337 236 --
NM_002655chr884098 3567 3497 3474 3394 940 922 132 --1268 --
NM_002656chr61939 --1311 --
NM_002667chr611270 ------
NM_002709chr243505 2925 2660 87 12276 ----
NM_002710chr121801 ------
NM_002711chr71630 --137 --
NM_002713chr11313 ------
NM_002716chr1133668 496 421 11343 23674 217 --
NM_002719chr1441537 920 274 256 ----1638
NM_002731chr132517 2223 995 --12058 --
NM_002734chr1721664 611 1404 12128 --
NM_002737chr17145824 5310 4959 4541 4417 4391 4111 4085 2000 1945 774 714 442 87 --46532 6376 5159 4992 --
NM_002745chr2294436 3081 3001 2854 2792 1196 674 457 126 ----24248 3400
NM_002748chr151362 --177 --
NM_002750chr101182 ------
NM_002755chr151302 ------
NM_002816chr17----141 --
NM_002827chr2051814 1775 1548 1495 1183 --1229 --
NM_002834chr12113661 3282 3085 2900 2675 2479 1439 1403 1256 671 548 1599 ----
NM_002837chr12104439 4402 3764 3683 3326 1130 928 633 474 91 23615 766 1365 --
NM_002839chr921427 1335 169 11021 --
NM_002843chr1163081 2871 2308 1244 360 292 12976 ----
NM_002858chr121160 324 1875 ----
NM_002869chr1151563 1363 616 214 181 ------
NM_002886chr384395 1897 1695 1583 1164 453 284 42 ----13688
NM_002890chr51128 --1186 --
NM_002912chr61639 ------
NM_002940chr43712 424 144 --21588 28 1248
NM_002941chr341431 1149 365 285 11599 ----
NM_002942chr32956 528 ------
NM_002945chr171310 --1820 --
NM_002948chr32869 52 ----11285
NM_002956chr121982 ----11199
NM_002959chr164313 3304 3286 3242 1504 135 23019 1316 ----
NM_002970chrX1277 ------
NM_002971chr321115 1046 ------
NM_002976chr24466 436 369 63 ------
NM_002994chr421729 298 --11489 --
NM_003010chr1752269 1746 1622 963 264 21702 926 11901 --
NM_003017chr611115 1407 1451 1878
NM_003030chr331677 1649 165 ------
NM_003031chr163672 192 106 --3732 685 396 --
NM_003034chr12107816 6638 5003 2728 2328 1645 1481 1043 714 571 ----17216
NM_003037chr13624 616 582 ------
NM_003045chr13114703 4235 4110 4072 1683 1386 1140 937 505 454 417 ------
NM_003046chr853537 3287 1783 978 678 24350 3358 13918 11494
NM_003051chr12724 685 1574 ----
NM_003054chr10--188 ----
NM_003060chr521284 1087 ------
NM_003068chr82945 53 ------
NM_003070chr9------1801
NM_003071chr311931 --11288 --
NM_003081chr2011025 ------
NM_003099chr15116343 6272 5038 4934 4861 4745 4057 4024 2133 1455 1107 16364 26597 937 11168
NM_003108chr256949 6792 4926 2103 1623 11192 ----
NM_003111chr21517 21236 983 1892 --
NM_003137chr672037 1651 1503 1469 539 326 184 1561 ----
NM_003155chr842179 643 467 329 --12135 --
NM_003157chr3290 80 1333 ----
NM_003161chr1722681 616 ------
NM_003178chr341925 1619 883 42 --1701 --
NM_003185chr20------1257
NM_003199chr1875695 4939 4632 3602 954 582 478 --44879 4540 4503 1552 --
NM_003201chr101389 --172 --
NM_003221chr633532 3007 150 ------
NM_003234chr322355 655 --11746 --
NM_003236chr2113166 2918 2738 2722 1273 1109 1084 865 857 653 336 11070 1585 1723
NM_003242chr351848 621 558 306 24 1364 ----
NM_003244chr182183 158 ------
NM_003246chr1531617 1597 453 --31387 536 336 --
NM_003262chr375295 5172 4780 4692 3759 536 403 --1196 --
NM_003269chr62888 160 ------
NM_003274chr2162821 2296 2254 1152 612 473 --22923 348 12653
NM_003292chr132305 2278 1616 ------
NM_003298chr3154988 4899 4773 4508 4491 4378 4286 4279 3888 3787 2224 1976 1856 895 109 25467 711 --15792
NM_003304chr311514 --1118 --
NM_003320chr1173947 3826 3777 3483 3220 1763 462 --21037 958 13244
NM_003330chr122719 253 --1447 --
NM_003337chr531400 1213 1109 --21628 672 --
NM_003339chr541558 1527 577 236 --11540 --
NM_003340chr421428 1359 --11041 --
NM_003342chr1753306 2449 1254 770 668 ------
NM_003348chr12--11481 --11465
NM_003350chr81656 ------
NM_003363chr32723 532 --1177 --
NM_003366chr161158 ------
NM_003368chr1198 ------
NM_003373chr1031915 1447 771 ------
NM_003385chr2160 --1410 --
NM_003390chr1141139 1006 704 48 ------
NM_003392chr333667 3485 3469 --12638 13888
NM_003410chrX32792 2237 64 --21021 492 --
NM_003411chrY163 21757 264 ----
NM_003412chr373155 3069 2559 2126 2085 530 265 ----12135
NM_003413chrX31360 1305 170 ----1103
NM_003431chr1--1596 ----
NM_003439chr772985 2837 2685 2470 2242 2169 115 --124 --
NM_003453chr13149 ------
NM_003462chr141416 311 165 103 --11422 1126
NM_003463chr61142 ------
NM_003468chr253997 3866 3653 1686 1608 --12671 --
NM_003474chr1082193 2141 2069 1879 706 679 485 479 --11805 --
NM_003477chr11------1582
NM_003489chr211375 --22566 2123 --
NM_003498chr1672687 2618 2457 2317 727 707 603 ------
NM_003558chr9----1577 --
NM_003559chr17113690 3668 3508 3445 2945 2701 2684 2598 2586 1410 26 ------
NM_003566chr1233108 2749 1045 --12291 --
NM_003576chr1352062 1978 1895 118 70 ----1549
NM_003580chr81563 --1167 --
NM_003590chr253922 3783 3315 1160 1142 --13135 --
NM_003607chr173616 3570 1334 1111 860 805 100 12693 11681 --
NM_003615chr352766 2548 1451 1325 796 1538 13231 --
NM_003618chr2----11120 --
NM_003626chr1121152 1092 --1463 --
NM_003629chr163308 2930 1405 655 544 196 11134 11312 --
NM_003636chr1111626 1617 1530 1423 1277 730 631 359 353 321 78 ------
NM_003663chr353013 2208 1402 1124 672 ------
NM_003676chr13674 662 342 --2618 291 --
NM_003679chr153181 2393 909 836 230 11275 11070 --
NM_003690chr22572 538 ------
NM_003692chr9------1306
NM_003713chr12592 408 11480 11391 --
NM_003714chr562864 2622 2178 2132 631 431 22878 907 1887 --
NM_003716chr32944 140 ------
NM_003718chr71447 ------
NM_003725chr12----1303 --
NM_003741chr31364 ------
NM_003743chr251814 1402 297 264 101 11820 11595 11547
NM_003749chr1321935 476 12432 --11723
NM_003750chr102939 905 ------
NM_003758chr151587 ------
NM_003758chr151587 ------
NM_003759chr463969 3907 2973 1498 1052 252 --43886 3682 3066 1375 --
NM_003762chr131245 1024 517 ------
NM_003763chr2072897 2640 2574 2127 869 828 367 --1961 --
NM_003772chr11------11039
NM_003794chr32450 75 ------
NM_003800chr6----22144 1600 --
NM_003818chr202974 227 ------
NM_003822chr113072 ----11214
NM_003829chr921147 342 ------
NM_003842chr872349 2257 2245 1570 1543 516 23 12376 12263 --
NM_003860chr111364 ------
NM_003861chr1452294 845 789 187 27 --11936 1773
NM_003870chr1542019 1732 1422 586 --1391 --
NM_003877chr123704 124 54 ------
NM_003884chr321351 265 --11222 1184
NM_003885chr1772509 2275 896 440 223 214 95 --12618 --
NM_003887chr222317 576 11742 ----
NM_003891chr131275 ------
NM_003895chr2122161 1975 1245 192 --
NM_003913chr663542 2988 1337 1302 539 416 13790 11624 13903
NM_003932chr22----11701 --
NM_003934chr91261 --11088 --
NM_003941chr71195 ------
NM_003953chr141151 1123 195 178 ------
NM_003958chr663870 2411 1364 1180 626 78 12863 11000 --
NM_003966chr5127550 7154 6957 5116 2970 2795 2557 1304 1171 834 220 123 ------
NM_003980chr611401 ------
NM_003983chr16103855 3676 3670 3467 3370 3303 3152 3022 1184 39 24370 1653 11024 1158
NM_003994chr1241350 893 730 685 24185 3433 13264 --
NM_004004chr1321181 356 ------
NM_004006chrX41690 862 811 61 ------
NM_004007chrX41690 862 811 61 ------
NM_004009chrX41690 862 811 61 ------
NM_004010chrX41690 862 811 61 ------
NM_004011chrX41690 862 811 61 ------
NM_004012chrX41690 862 811 61 ------
NM_004013chrX41690 862 811 61 ------
NM_004014chrX41690 862 811 61 ------
NM_004015chrX41690 862 811 61 ------
NM_004016chrX31604 776 725 ------
NM_004017chrX41690 862 811 61 ------
NM_004018chrX31604 776 725 ------
NM_004020chrX41690 862 811 61 ------
NM_004021chrX31604 776 725 ------
NM_004022chrX31604 776 725 ------
NM_004023chrX31604 776 725 ------
NM_004028chr1853673 3396 2672 1401 443 13120 11450 --
NM_004056chr8------11124
NM_004060chr51216 --192 --
NM_004079chr152210 2033 1928 210 185 12516 ----
NM_004080chr751035 986 157 140 48 ------
NM_004081chrY41270 439 142 102 21441 675 11276 --
NM_004085chrX3738 727 80 ----1828
NM_004087chr341805 1747 242 205 --21964 736 --
NM_004093chr1353228 1215 1189 856 312 --22413 279 --
NM_004094chr1452478 2325 1941 1145 739 --22670 2291 --
NM_004117chr662150 1863 1835 588 573 250 --11898 --
NM_004124chr1443092 2328 1330 464 22766 1063 ----
NM_004134chr54545 526 463 23 ------
NM_004136chr1563168 2773 2096 1994 440 415 ------
NM_004156chr81393 ------
NM_004161chr231480 1469 367 ------
NM_004162chr311202 1441 ----
NM_004170chr931461 1179 54 1659 ----
NM_004171chr11149362 9060 6117 6039 3419 3035 2524 2407 2222 1622 1421 1159 963 604 18075 26527 3642 12686
NM_004183chr114764 665 573 205 183 ----
NM_004227chr792797 2598 2252 1902 979 793 488 455 337 1611 ----
NM_004231chr7------1253
NM_004232chr1833120 2807 130 13538 12815 11226
NM_004233chr651264 1154 1010 251 206 1284 1294 --
NM_004235chr92604 135 ------
NM_004241chr101654 --1568 --
NM_004242chr61156 --160 --
NM_004272chr531501 1306 741 1251 11291 --
NM_004274chr1443016 2389 500 281 ------
NM_004280chr62429 95 ------
NM_004290chr52514 211 --11044 --
NM_004293chr933544 2363 81 ------
NM_004311chr1062638 2454 2044 2013 1029 652 ------
NM_004323chr981955 1921 1812 1006 783 722 716 110 --1593 --
NM_004326chr1----11098 --
NM_004330chr151788 --1836 --
NM_004338chr18106814 6299 5657 4889 4588 4326 2784 1816 1437 359 14754 36830 1329 769 --
NM_004341chr21229 ------
NM_004342chr741826 1786 1753 308 --21769 400 --
NM_004349chr81410 ------
NM_004378chr15----1225 --
NM_004384chr542281 2231 1856 1517 ----1545
NM_004392chr1322023 665 --12165 --
NM_004397chr1124007 3648 1830 13527 --
NM_004411chr71762 ------
NM_004419chr102379 198 --1204 1756
NM_004430chr862268 2149 1827 857 642 75 ------
NM_004432chr9195 ------
NM_004437chr193442 2874 2721 2670 1107 496 409 403 73 --13325 12363
NM_004438chr252569 2276 1261 557 406 ----12290
NM_004451chr111658 ----2274 235
NM_004454chr351739 1707 1420 628 215 --11427 --
NM_004458chrX52369 2235 2183 1909 580 ------
NM_004464chr421735 122 2609 102 ----
NM_004481chr162302 1977 1659 1022 460 133 --1687 1611
NM_004482chr21851 ------
NM_004501chr183390 2593 1486 1438 907 829 522 382 --23580 1427 --
NM_004503chr121152 ------
NM_004505chr1751577 1442 660 605 92 ------
NM_004566chr1042112 2044 222 191 --12507 --
NM_004569chr144697 666 602 21 1139 --157
NM_004571chr2132197 2125 815 --22274 605 --
NM_004583chr172218 166 ------
NM_004586chrX94318 4131 3620 1891 1812 1710 1072 958 717 --11827 --
NM_004588chr11163390 3375 3052 2521 2478 1568 1441 1283 1173 1129 773 761 729 697 571 484 --2895 616 13561
NM_004598chr543112 2613 2427 46 --3987 950 242 --
NM_004612chr994393 3375 3158 2979 1753 1229 850 179 135 --11081 --
NM_004625chr3135 ------
NM_004631chr111341 ----11368
NM_004634chr31516 ------
NM_004641chr1041506 1164 499 131 ------
NM_004654chrY1308 ------
NM_004660chrY5671 457 145 38 21 --1662 --
NM_004663chr1531465 1443 370 ------
NM_004685chr13----21082 168 --
NM_004690chr63797 694 179 1101 ----
NM_004703chr1752457 2232 1006 773 100 --1500 --
NM_004705chr111122 --2689 270 154
NM_004723chr16865 708 205 177 163 152 ----1331
NM_004726chrX185663 5392 5373 5357 5248 4979 4577 4539 4505 3909 3822 3532 2112 1191 933 705 501 472 1598 ----
NM_004730chr511374 ------
NM_004734chr1353208 2597 2413 397 342 ------
NM_004736chr151677 1589 1434 806 534 ------
NM_004738chr2062563 1939 1733 1719 679 650 --1491 --
NM_004742chr321296 635 1547 ----
NM_004744chr453933 2648 1295 1191 528 ------
NM_004745chr8106193 5985 5510 5342 5244 5167 4582 4571 2143 736 14681 36458 5116 2657 --
NM_004748chr1573532 2761 779 688 507 369 336 13604 ----
NM_004755chr141303 11032 ----
NM_004760chr722148 159 12040 1993 --
NM_004772chr511576 ------
NM_004774chr1762931 2753 2428 919 583 487 32955 2763 1201 1361 --
NM_004775chr1862048 1547 944 600 227 117 ------
NM_004776chr2053102 2766 1283 1276 699 --1628 12234
NM_004779chr521090 982 ------
NM_004786chr181186 ------
NM_004798chr2052952 2914 2787 2750 2671 12730 --13311
NM_004799chr1--152 ----
NM_004801chr231128 428 379 ------
NM_004808chr1093404 3276 3074 2949 2364 1120 950 759 344 12066 ----
NM_004840chrX51916 1850 1513 375 319 --12258 --
NM_004842chr661720 1623 1213 625 404 384 ------
NM_004845chrX33863 3489 3246 13751 --13975
NM_004850chr231746 1553 23 ----2596 98
NM_004857chr14104669 4446 4280 1761 1326 1254 861 678 207 153 23096 1210 ----
NM_004863chr14164999 4974 4885 4725 4558 4469 4187 3947 3809 3503 1159 1098 802 476 94 66 --31808 1504 327 --
NM_004867chrX2570 38 ------
NM_004871chr1784058 3572 3335 2773 1659 1366 330 168 ------
NM_004874chr81172 ------
NM_004879chr111248 --1676 --
NM_004896chr1041500 1267 1092 103 --11056 --
NM_004898chr421933 297 --12776 --
NM_004904chr775669 5532 5147 5077 4930 1606 290 15132 55696 5501 4541 1731 1430 15028
NM_004912chr761277 1249 313 266 157 26 11342 1502 --
NM_004915chr212731 524 ----1754
NM_004926chr141194 ------
NM_004929chr841265 1167 385 223 11403 ----
NM_004932chr531551 222 113 ------
NM_004947chr392171 2148 1977 1956 1001 821 661 180 97 --21586 518 --
NM_004949chr1852157 2148 1833 1498 236 11428 12058 --
NM_004956chr743885 3845 1728 230 1702 24019 3594 --
NM_004962chr103753 606 26 ------
NM_004965chr211669 ------
NM_004985chr1243412 2806 1001 570 23975 3180 21602 659 --
NM_004990chr12124 ------
NM_004992chrX128139 8112 7670 7534 7411 7380 7372 7334 5243 3403 1650 1069 16407 38078 7922 783 --
NM_004992chrX128139 8112 7670 7534 7411 7380 7372 7334 5243 3403 1650 1069 16407 38078 7922 783 --
NM_005010chr711634 ------
NM_005026chr141693 1532 1461 1324 1184 31765 1628 1396 --
NM_005028chr1052191 1760 345 199 134 --11546 1279
NM_005045chr7----1378 1985
NM_005056chr1274806 4741 1179 1108 973 508 303 ----14171
NM_005063chr1073840 3404 3351 3329 2519 2348 158 ------
NM_005065chr1475246 3479 1176 1160 1085 812 305 11694 24819 491 --
NM_005077chr91179 ------
NM_005078chr1521628 1488 --11847 --
NM_005082chr1763223 3089 2726 1285 1114 815 --33408 458 303 --
NM_005087chr31680 ------
NM_005103chr11151 ------
NM_005112chr42824 135 ------
NM_005116chr2083618 1817 1081 657 582 350 299 238 --14560 --
NM_005121chr1743564 2821 1162 308 22729 296 22748 942 --
NM_005124chr6193 --1993 --
NM_005135chr15123358 3083 2798 2482 1402 1322 1066 483 343 286 242 185 1507 2791 382 11202
NM_005156chr935036 4514 3555 14399 --11114
NM_005160chr22116545 6456 6187 6032 5990 5442 4921 2673 2369 869 435 12688 34448 4341 1721 --
NM_005164chr1232494 197 83 --11629 12624
NM_005167chr11141 ------
NM_005168chr221698 1517 --197 --
NM_005180chr1041583 1506 515 478 1325 11243 --
NM_005181chr84840 708 539 318 ------
NM_005184chr1911247 ------
NM_005188chr11137177 7059 6839 6827 6675 6524 6109 5819 5337 5131 1851 692 661 --1854 1298
NM_005197chr1495900 4217 2365 2049 1991 1040 570 440 287 --25583 3868 2787 218
NM_005215chr182576 276 ------
NM_005220chr1731282 1121 262 11193 11427 --
NM_005230chr12------1632
NM_005233chr352337 2292 1020 368 289 1481 12458 --
NM_005235chr266459 5317 3130 2626 1278 95 --47116 6891 5721 1766 25573 2384
NM_005249chr141218 ------
NM_005254chr153371 281 82 1546 1135 --
NM_005259chr21128 ------
NM_005271chr103227 143 133 ------
NM_005295chr7------1264
NM_005296chrX2681 78 ------
NM_005329chr1641691 943 612 483 --11465 1716
NM_005339chr464133 3887 3244 370 255 173 --23301 1014 11408
NM_005342chrX72448 2200 2164 2137 2003 1017 181 ------
NM_005359chr18136569 6405 6394 6383 6072 5685 5604 5118 4249 2605 2471 2361 1805 34601 2508 1654 25225 4791 --
NM_005378chr21280 --1318 --
NM_005382chr8------2336 32
NM_005387chr111622 --142 --
NM_005388chr931286 507 210 ----11239
NM_005398chr1031441 543 400 ------
NM_005399chr183656 3537 2879 1746 1737 1464 1231 729 ----13972
NM_005409chr41268 --21067 429 --
NM_005433chr181328 ----1388
NM_005440chr1762391 2366 2342 2167 1282 413 --1780 1681
NM_005455chr11522 1363 --1291
NM_005475chr12113083 2976 2813 2650 2486 2138 2038 1253 1085 714 683 ------
NM_005477chr1592382 2080 2045 1931 1631 818 605 586 269 21839 168 ----
NM_005477chr1592382 2080 2045 1931 1631 818 605 586 269 21839 168 ----
NM_005491chrX72172 1587 1485 775 335 279 62 --3784 575 48 --
NM_005502chr972843 2350 2029 1179 848 743 87 --22784 430 12265
NM_005504chr12106494 6230 5644 4616 4504 4206 2595 1600 1033 387 24157 1826 35021 997 882 1250
NM_005509chr5--11876 ----
NM_005517chr12564 425 --1122 --
NM_005522chr7----1487 --
NM_005563chr12228 107 --1852 --
NM_005575chr54668 658 88 77 ------
NM_005578chr394737 4632 4326 4047 3658 3157 1819 1389 452 13989 23302 76 11337
NM_005585chr151417 ------
NM_005587chr151909 ----1917
NM_005593chr12----1173 --
NM_005596chr976453 5421 5406 4040 564 557 449 16061 ----
NM_005600chr11225 ------
NM_005611chr1611134 ------
NM_005613chr142179 1710 426 62 ------
NM_005614chr71982 ------
NM_005638chrX21352 332 ------
NM_005639chr1261811 1422 1414 1217 707 98 11191 11627 --
NM_005647chrX83088 2773 2705 2381 1111 1058 267 47 --11382 --
NM_005668chr554300 3701 1681 939 412 --21058 651 --
NM_005670chr631747 373 122 11832 ----
NM_005708chr13139 ------
NM_005715chr682581 2457 2155 2102 1860 1736 757 487 --11830 --
NM_005721chr21413 ------
NM_005722chr212450 ------
NM_005724chr151262 ------
NM_005725chr142345 1663 685 402 --1634 --
NM_005730chr12103339 3173 2643 2527 2445 2435 2391 583 364 27 1698 22673 1337 --
NM_005731chr2--1343 ----
NM_005746chr722252 240 --22371 2140 11693
NM_005748chr1233461 2095 422 1912 ----
NM_005754chr52478 318 21156 27 ----
NM_005756chrX31197 405 129 11144 ----
NM_005776chr14147 1288 1691 --
NM_005779chr583494 3191 1336 1028 875 567 147 105 ------
NM_005786chr18----1243 --
NM_005797chr113349 271 158 1188 1699 --
NM_005802chr9------1307
NM_005808chr393450 2501 2247 2196 1373 1089 424 132 114 ------
NM_005813chr231614 1041 374 11723 22173 1735 1191
NM_005815chr191150 --1307 --
NM_005822chr652237 1883 546 292 29 12026 ----
NM_005832chr32954 401 --11010 --
NM_005839chr12313 236 ----1938
NM_005840chrX147462 7417 6829 6795 6628 5764 5652 5594 5490 5283 4931 4859 1339 1088 17672 11382 11141
NM_005842chr131243 ------
NM_005843chr241531 1504 772 200 ----1153
NM_005859chr521251 1217 --21134 378 --
NM_005864chr141788 1619 1191 --
NM_005870chr1331399 1213 358 21362 1011 ----
NM_005899chr1721401 1326 11334 ----
NM_005901chr18138063 7858 7729 7231 7070 6852 5716 2971 2010 1998 1215 1029 642 13285 28712 1310 --
NM_005903chr555034 4731 3341 3309 1678 34711 1922 1198 --15187
NM_005909chr573939 2989 1115 741 586 150 82 14180 ----
NM_005925chr181157 ------
NM_005927chr521148 194 ------
NM_005935chr4124951 4831 3942 3884 3248 2113 1830 1797 1449 741 712 517 11852 24574 3380 --
NM_005941chr874161 1658 1542 1519 773 736 644 --1877 --
NM_005955chr1154954 4629 4547 4227 2125 1690 1636 1540 1438 1404 1114 992 502 464 220 11566 11329 --
NM_005964chr172257 87 ------
NM_005966chr231949 967 544 21829 617 2768 248 11488
NM_005986chr1332069 698 320 --11933 --
NM_006007chr964405 4321 4200 3928 640 82 14492 33301 2738 1482 11526
NM_006011chr1583564 3557 1401 981 704 383 309 221 ------
NM_006016chr632097 833 57 11858 ----
NM_006036chr262486 2365 2116 1910 601 378 11784 1659 1530
NM_006054chr1141397 1134 373 247 --1402 --
NM_006055chr262703 2050 830 730 652 62 --12074 1952
NM_006079chr6------1577
NM_006080chr721930 699 12370 2556 360 --
NM_006089chrX41658 1528 1514 1194 1560 11630 --
NM_006095chr4123990 3738 3594 3541 3354 3268 3115 2962 2927 1813 1538 292 1570 --14115
NM_006106chr1152238 1139 461 366 75 ------
NM_006107chr17------1121
NM_006108chr1141876 1542 778 499 --11812 --
NM_006135chr12899 332 ------
NM_006139chr262000 1839 614 530 208 23 ------
NM_006148chr1752812 2500 2227 1839 1014 --1835 --
NM_006154chr1562067 1874 977 781 512 242 ------
NM_006158chr821163 109 --11733 --
NM_006159chr12----1553 1445
NM_006161chr52640 541 ------
NM_006180chr971990 1847 1737 1689 1608 1308 86 ------
NM_006187chr12113175 2976 2793 2780 2752 2124 1969 1257 1205 990 481 13097 ----
NM_006203chr575548 5313 4739 3881 2040 1028 469 --12153 --
NM_006212chr154899 1580 999 937 92 --24768 4045 --
NM_006237chr1321451 667 1527 ----
NM_006247chr191457 --1494 --
NM_006251chr542540 1055 774 52 ----1830
NM_006252chr1127622 7104 6571 6396 6084 5614 5088 4905 2709 2257 971 524 ------
NM_006256chr132033 1103 250 22308 816 ----
NM_006265chr8----1315 --
NM_006281chr831127 1116 1105 --1306 --
NM_006281chr831127 1116 1105 --1306 --
NM_006283chr8124613 4338 4235 3836 3596 1657 1650 1322 1277 1170 882 854 --23853 310 --
NM_006306chrX175830 5645 5428 5361 5206 4758 4559 4355 4332 4213 3816 2158 1342 1068 757 239 113 11316 65680 5614 5412 5379 4489 883 11916
NM_006313chr121227 --21733 684 --
NM_006320chr42271 22 ------
NM_006321chr321553 1514 --1199 11543
NM_006323chr41304 ------
NM_006327chr10142 ------
NM_006330chr8------11478
NM_006352chr12241 195 ------
NM_006359chrX11633 ----1106
NM_006366chr611026 ----1920
NM_006371chr3105170 4900 4436 4186 3242 2035 1721 1644 1014 493 14425 ----
NM_006393chr10104568 4016 1698 1692 1548 1452 1074 437 379 92 13707 13916 --
NM_006416chr6165 --1155 --
NM_006434chr1072891 2620 2335 756 731 443 250 --12813 --
NM_006439chr41106 ------
NM_006457chr474078 3410 2569 1183 950 752 569 ------
NM_006460chr17--2314 152 ----
NM_006496chr12771 187 ----11670
NM_006520chrX21548 1263 --2123 28 --
NM_006526chr202653 101 11615 ----
NM_006528chr71132 ------
NM_006538chr293432 2685 1616 1411 1395 1337 1320 1151 449 ------
NM_006540chr841583 1203 583 494 --11472 --
NM_006544chr14125565 5432 5044 4872 4569 4191 2294 2057 1716 1685 1585 722 2195 150 45292 4630 1615 1177 --
NM_006546chr1786488 6091 5856 5285 5096 2338 1857 1145 --24552 1392 --
NM_006547chr741840 1526 1472 1323 --1448 --
NM_006548chr341306 623 348 259 --21677 1174 --
NM_006561chr10145686 5456 4956 4823 4779 4706 4539 4356 3986 1931 1618 1454 240 224 --24514 561 --
NM_006599chr1688187 6978 5838 3316 2947 2366 2220 1473 1698 37761 7585 6960 11963
NM_006601chr121201 ------
NM_006602chr204751 637 569 38 --1226 --
NM_006603chrX1208 --21555 34 --
NM_006609chr242613 2128 754 335 ------
NM_006612chr17----1449 --
NM_006614chr363250 2893 2838 2510 1320 122 ------
NM_006618chr151374 1344 220 101 81 21500 1021 11088 --
NM_006620chr674321 1795 928 619 594 131 77 ------
NM_006624chr102787 72 ----12008
NM_006628chr1564403 4180 4086 1551 620 94 ------
NM_006629chr1841870 780 414 162 ------
NM_006644chr131522 ------
NM_006651chr421346 286 1377 --21165 111
NM_006654chr1254492 4442 3014 1153 496 11649 24318 325 --
NM_006667chrX21116 372 ------
NM_006699chr142384 2240 1013 333 ------
NM_006713chr53573 296 174 --194 --
NM_006717chr951315 922 558 273 260 ------
NM_006718chr61939 --1311 --
NM_006729chrX65526 4746 4229 3887 2226 355 --25197 510 14307
NM_006746chrX41377 1313 1285 1120 1506 ----
NM_006750chr16157110 6787 6128 5005 2751 2493 2459 1737 1639 1066 1031 958 782 719 597 --22424 831 --
NM_006763chr151412 409 248 103 57 --12046 --
NM_006766chr852719 2551 2473 2455 1871 1922 ----
NM_006769chr1185 ------
NM_006775chr632761 2047 423 --1848 --
NM_006791chr151611 --1469 --
NM_006805chr52238 126 ----11709
NM_006823chr821246 943 ------
NM_006827chr1442892 2767 289 176 --13306 --
NM_006828chr6157 1523 ----
NM_006832chr144930 434 289 224 135 2328 313 --
NM_006838chr1231827 1675 1412 11360 ----
NM_006851chr1262927 2600 2361 2349 1869 976 --11998 --
NM_006873chr243047 3014 2282 1092 --1660 --
NM_006874chr421169 83 --171 --
NM_006884chr331677 1649 165 ------
NM_006885chr1633716 3253 699 --13588 --
NM_006888chr1442879 1347 957 207 ------
NM_006910chr16----139 --
NM_006914chr921309 29 ------
NM_006915chrX42271 2007 1664 629 --2879 213 12099
NM_006918chr1165598 5481 4610 2297 1189 545 25180 2002 35294 3654 1086 13935
NM_006920chr231440 736 605 1782 11269 --
NM_006924chr1713981 ------
NM_006930chr51808 ------
NM_006931chr1241999 855 400 41 ----1836
NM_006937chr171570 ------
NM_006940chr1241845 1759 1353 1218 11498 21540 234 --
NM_006948chr2112128 --1806 --
NM_006951chr104752 680 87 31 ------
NM_006981chr982850 2542 2313 1912 963 826 689 174 --22675 786 --
NM_006982chr121261 ------
NM_007006chr1663255 3011 2747 1270 360 32 33162 631 56 1740 --
NM_007007chr1264775 4533 4508 3944 312 281 ----1985
NM_007008chr23662 626 139 ------
NM_007011chr15114461 4331 4298 4266 2393 2165 1638 546 497 443 286 12040 12687 15264
NM_007013chr82923 332 ----1657
NM_007017chr52827 210 1102 ----
NM_007036chr5----1817 --
NM_007038chr2165991 5671 5400 4105 1549 493 15180 196 --
NM_007050chr20187877 7326 7172 6833 6064 5574 5338 4994 3184 2923 2208 2160 1692 1566 1534 1231 547 338 17298 47675 5475 3076 1195 15968
NM_007064chr331249 1054 175 11084 11127 --
NM_007096chr9169 ------
NM_007106chr1332594 1025 546 --12757 --
NM_007109chr651378 1170 1003 513 502 --31340 324 267 1260
NM_007124chr621856 628 2514 499 31789 1685 1589 --
NM_007125chrY11290 --2487 101 --
NM_007145chr19----11306 --
NM_007146chr1752433 2246 1912 852 791 12157 ----
NM_007159chr331546 1193 519 --11435 --
NM_007167chr13802 663 30 1881 --1834
NM_007173chr1142294 1934 806 60 ----1732
NM_007174chr1242191 1494 493 231 ------
NM_007177chr382410 2383 2365 2331 2064 1737 483 23 --22006 890 --
NM_007187chr131741 ----1248
NM_007195chr1843745 2729 2396 1447 13570 1219 --
NM_007203chr943022 2812 2693 1075 1497 13166 13523
NM_007207chr11244 --1295 --
NM_007236chr1552009 1987 1757 759 328 --1530 11822
NM_007249chr13126722 6419 6324 6062 5966 3077 2874 2413 2306 1367 944 453 18536 ----
NM_007282chr31902 ------
NM_007283chr392993 2615 2374 2086 1991 1951 1189 967 283 ------
NM_007308chr42680 85 ------
NM_007315chr251376 551 508 347 113 ------
NM_007324chr1--152 ----
NM_007325chrX3445 312 74 --21993 328 --
NM_007345chr1831963 1545 864 ----1766
NM_007347chr1583059 2609 2511 1271 712 464 356 233 12569 11175 --
NM_007350chr1241743 1274 1192 619 21407 1085 34176 3755 3458 --
NM_007353chr752811 1135 1005 646 553 22736 2643 1920 --
NM_007358chr121663 109 ------
NM_007363chrX2970 180 ------
NM_007373chr1021376 150 --11274 --
NM_012069chrX52607 2473 2104 453 326 --12451 --
NM_012072chr2053459 3352 886 763 731 --21828 1282 --
NM_012082chr8----1269 --
NM_012083chr1071272 1159 1045 888 877 247 82 1916 ----
NM_012084chrX2215 133 ------
NM_012095chr1072909 2219 1257 985 543 413 176 11100 2919 356 11094
NM_012102chr142675 2536 1953 604 1444 12216 --
NM_012104chr1153634 3057 2781 636 447 --13158 --
NM_012104chr1153634 3057 2781 636 447 --13158 --
NM_012120chr6--2715 610 ----
NM_012129chr732402 2256 116 1821 12221 --
NM_012137chr132476 1078 868 12559 22644 1021 --
NM_012141chr1333513 1051 725 --1803 --
NM_012156chr2082802 2473 2129 2120 850 526 380 43 --12942 --
NM_012164chr996582 5448 2489 1920 1507 1277 680 628 476 --22709 1083 --
NM_012197chr92556 111 --11183 --
NM_012199chr184391 3925 3705 3568 3348 3216 1343 907 ------
NM_012210chr941449 972 292 38 --1550 --
NM_012214chr264355 4093 1929 1888 782 708 25169 1012 36417 5020 4577 --
NM_012219chr363155 3021 2785 2583 2469 211 12204 31137 655 371 --
NM_012223chr221029 256 --21240 902 --
NM_012234chr353695 3224 3138 2969 1050 13432 ----
NM_012249chr251303 1272 461 269 198 31120 507 68 12762 --
NM_012250chr112329 155 ------
NM_012259chr611046 186 1124 --
NM_012262chr141740 1258 474 118 --13255 14464
NM_012287chr344560 2896 1516 398 14318 2887 265 --
NM_012288chr681834 1342 975 898 731 518 236 206 14206 15202 --
NM_012290chr221106 659 --11511 --
NM_012294chr743966 2546 530 136 1685 1438 --
NM_012296chr1183464 3054 1513 819 531 390 352 236 12810 31547 1164 653 --
NM_012300chr542547 2356 865 629 12206 1497 --
NM_012301chr72765 236 ------
NM_012316chr1125377 5161 5069 4838 4081 4006 3786 3493 2031 1628 1532 613 12159 12081 --
NM_012322chr71100 ------
NM_012323chr2261605 1355 1220 1191 621 387 ------
NM_012328chr72461 125 11490 11118 --
NM_012330chr1011241 1615 2623 522 --
NM_012333chr141418 370 330 234 ------
NM_012334chr564580 4300 4031 3437 3305 3120 23998 713 23678 947 --
NM_012338chr721001 176 1345 ----
NM_012381chr6--163 1253 --
NM_012382chr574242 3259 2933 2897 1826 1807 739 11145 13196 14326
NM_012383chr91425 ------
NM_012388chr1552581 2316 1940 1208 871 ------
NM_012417chr17------1561
NM_012420chr1051669 828 480 271 244 --11746 --
NM_012428chr15----1711 --
NM_012464chr442648 2464 1143 585 --12073 12639
NM_012471chrX21211 436 ------
NM_012479chr722735 185 1613 21865 629 --
NM_013229chr1252404 2321 1755 1019 852 --12047 --
NM_013230chrY41664 1292 1133 554 ----1404
NM_013261chr443496 3131 2326 1152 ----185
NM_013262chr621221 201 ------
NM_013269chr1222800 1093 --34211 702 322 14112
NM_013286chr393630 3252 3072 3005 2649 1287 1278 1232 360 11031 --13769
NM_013302chr16104433 4295 4282 3798 3552 3461 3155 1739 787 572 ------
NM_013322chr731674 1332 194 152 11273 --
NM_013330chr1123 ------
NM_013354chr831194 401 264 ------
NM_013381chr1221641 246 21715 1607 ----
NM_013411chr152362 1954 1766 947 332 --1756 --
NM_013446chr7--1907 --11184
NM_013447chr1993556 3336 3031 2374 1264 1207 598 485 63 23476 3385 --23837 281
NM_013450chr21950 1820 ----
NM_013451chr102165 30 ------
NM_013943chr163298 2314 2176 1242 676 575 1924 --13173
NM_013989chr14125163 4880 4556 4508 3942 3168 1249 812 703 543 518 368 11290 34239 1109 473 --
NM_014000chr1031915 1447 771 ------
NM_014007chr951296 966 468 434 153 ------
NM_014011chr242414 1615 868 643 11651 ----
NM_014016chr331411 1102 477 --1218 --
NM_014021chr153195 3101 2890 2284 80 ------
NM_014023chr1062548 2084 1936 901 745 82 ----12396
NM_014028chr663094 2340 2301 578 524 95 23306 3290 12934 --
NM_014034chr61533 11206 134 --
NM_014048chr1683901 3755 3516 3199 1730 1318 892 475 13496 11268 13315
NM_014057chr931481 518 425 ------
NM_014106chr151850 11129 21097 878 --
NM_014109chr81492 --2505 50 --
NM_014110chr11313 ------
NM_014112chr884986 4135 4086 3391 1412 540 397 246 ------
NM_014141chr7155189 5065 4657 4412 4365 4128 4115 4018 3676 3287 1789 1070 883 731 397 --13370 --
NM_014155chr1146403 5352 2703 367 16980 26229 1348 11312
NM_014157chr16103113 2823 2817 2760 2701 2515 1572 1377 888 310 1569 12773 13880
NM_014160chr341348 985 162 56 ------
NM_014161chr63260 229 58 ------
NM_014191chr121966 --1679 --
NM_014210chr172414 54 ------
NM_014217chr151945 1844 1822 1743 168 133 ----
NM_014233chr1762152 1543 1413 1367 249 177 ------
NM_014240chr394015 3999 3646 3538 2836 2580 1482 1468 995 ------
NM_014243chr422082 1463 ----1732
NM_014271chrX1691 ------
NM_014278chr41424 ------
NM_014283chr111388 ------
NM_014286chr9123370 3290 3053 2801 2711 2650 2570 2209 1452 818 189 58 --13518 --
NM_014293chr2293646 3585 3338 1502 1372 1206 867 758 702 --13242 --
NM_014299chr1951751 743 619 362 159 11740 12234 163
NM_014309chr22124792 4607 4346 4266 4019 3960 3486 2045 2018 1937 982 924 ----11194
NM_014332chrX1321 ------
NM_014345chr62848 146 ------
NM_014350chr511165 --1361 --
NM_014379chr821083 1068 --130 --
NM_014380chrX1225 ------
NM_014388chr1135868 5571 5545 5326 5199 5183 4406 4400 3805 3734 2424 1745 720 1733 15176 --
NM_014398chr351738 1677 1147 260 141 ------
NM_014415chr31566 --11170 --
NM_014421chr422082 1450 ------
NM_014423chr565346 5332 4482 4155 1281 251 --11589 --
NM_014445chr33755 736 162 ------
NM_014456chr1031341 496 249 ------
NM_014547chr152748 525 --1642 --
NM_014547chr152748 525 --1642 --
NM_014552chr231316 386 89 ------
NM_014573chr1711777 --21536 278 11368
NM_014575chr33390 106 30 ------
NM_014584chr14194 --11425 11481
NM_014585chr221081 153 ------
NM_014602chr3----1325 --
NM_014607chr221868 730 11512 ----
NM_014608chr15----1431 --
NM_014613chr5103023 2828 2769 2424 2105 1896 1134 1048 604 74 ------
NM_014615chr1673169 2497 1384 1286 1242 1173 763 --11116 --
NM_014616chr362993 2968 2796 2568 1075 27 1662 1303 --
NM_014620chr122634 589 --3520 500 277 --
NM_014621chr21267 ------
NM_014630chr1543178 1596 1145 836 ------
NM_014637chr8--11097 ----
NM_014647chr1651779 1466 1431 784 361 --1111 --
NM_014660chr711010 1121 ----
NM_014670chr231398 1246 1152 1210 1649 --
NM_014671chr711547 --1572 --
NM_014677chr821255 403 1396 1263 --
NM_014679chr1121373 952 ------
NM_014682chr8----1435 1830
NM_014701chr154773 611 537 50 ------
NM_014702chr673223 3137 3029 2749 2170 1394 298 22869 956 23039 976 --
NM_014706chr123878 477 161 1483 ----
NM_014717chr192234 91 ----1288
NM_014721chr6125781 5408 5156 4935 4904 4889 1707 981 905 821 745 325 11912 24733 1948 --
NM_014729chr831677 1546 165 1400 11483 --
NM_014730chr1295071 4470 3662 1780 1625 1548 1496 1409 942 21261 55 ----
NM_014730chr1295071 4470 3662 1780 1625 1548 1496 1409 942 21261 55 ----
NM_014732chr16185485 4625 4505 4496 4331 4292 3576 3563 2258 2007 1944 1161 1001 372 314 236 115 99 --138 --
NM_014733chr531982 880 293 ------
NM_014737chr2063576 1192 391 344 158 67 14175 1126 --
NM_014746chr254125 3478 3395 1311 1055 11383 34389 3584 1655 --
NM_014749chr14----2188 50 --
NM_014752chr1151986 1966 1450 576 325 1708 ----
NM_014755chr273963 3559 3195 1020 916 910 627 ----14021
NM_014756chr111138 ------
NM_014757chr582228 2053 1690 1614 1586 1448 601 177 ------
NM_014762chr162223 2001 1677 626 614 457 12050 ----
NM_014774chr163262 2815 2181 1095 959 346 12460 13162 2898 146
NM_014790chr52494 79 --1125 --
NM_014797chr672615 2449 1316 1076 468 388 46 1326 ----
NM_014810chr12898 341 --33535 2245 1168 1414
NM_014812chr111599 --1318 --
NM_014819chr542080 1837 1738 251 ------
NM_014826chr173616 3570 1334 1111 860 805 100 12693 11681 --
NM_014828chr1441602 737 153 21 --11563 --
NM_014836chr1072040 2022 1363 1299 593 429 411 21816 1540 ----
NM_014838chr2282818 2650 2449 1876 1748 983 176 25 --1476 --
NM_014839chr132020 1005 96 --22517 399 --
NM_014840chr1252899 2278 665 434 152 --22576 338 12393
NM_014844chr1494171 3857 3814 3682 3186 3088 2700 574 420 ------
NM_014848chr1562504 852 551 437 315 201 1772 ----
NM_014850chr394895 4457 3673 3665 1625 1218 832 825 177 13766 --13197
NM_014872chr961897 1759 1513 844 801 32 1556 ----
NM_014873chr184165 4053 3499 3211 3037 1688 1525 1484 --13913 --
NM_014877chr17117576 7433 7107 6185 5150 2154 2103 1960 1203 713 273 --36676 5775 2342 16476
NM_014883chr472035 1664 910 835 626 454 222 --11940 --
NM_014888chr72100 71 157 11315 --
NM_014897chr1762882 2743 2237 1197 996 477 12915 1747 --
NM_014900chr22966 911 ------
NM_014903chr1251923 1710 1625 1583 514 --11775 --
NM_014906chr1724050 1082 11582 12864 1524
NM_014912chr1023400 2506 1163 --1964
NM_014920chr642651 2428 1193 1065 --23495 3254 --
NM_014927chrX------198
NM_014934chr1373620 3600 3402 1340 860 727 32 23387 2997 --1258
NM_014935chr1112998 2716 815 604 451 301 224 157 145 53 29 --2637 67 --
NM_014946chr272910 2740 2488 2330 1990 1983 868 ------
NM_014951chr1041736 341 113 61 ----12650
NM_014962chr2032063 1154 863 --1643 1921
NM_014969chr11279 ------
NM_014982chr1464799 4532 4311 3664 1434 813 11553 ----
NM_014988chr442514 2130 1739 769 22416 511 1784 --
NM_014996chr31353 ------
NM_015000chr1243011 2783 2329 2195 --2964 455 --
NM_015002chr1271944 1723 1680 1587 1396 550 112 ------
NM_015008chr343686 3150 2359 2301 11277 ----
NM_015020chr16103873 3336 3322 3252 3176 2987 1341 925 468 452 --33450 3079 206 12644
NM_015024chr821228 560 ------
NM_015025chr222446 978 --1720 --
NM_015027chr1621970 1724 --41793 1628 1614 625 --
NM_015035chr20116086 6045 5310 4733 4330 4297 2610 2369 1499 516 64 1289 12168 --
NM_015039chr164344 3489 1479 933 660 177 11600 11046 --
NM_015040chr253340 2397 1070 242 70 --13021 --
NM_015042chr1593070 3000 2723 2666 1225 1093 1068 327 29 1446 11272 --
NM_015045chr1072191 1606 904 370 137 63 43 1710 169 --
NM_015051chr973183 3131 2634 2252 2076 1148 419 1586 ----
NM_015055chr1152367 1953 1100 842 525 --1834 --
NM_015059chr1563738 3157 2835 773 463 293 --13206 --
NM_015062chr101264 ------
NM_015071chr5125248 4949 4611 4228 4023 3984 2567 2202 2123 585 341 211 14406 46053 1303 261 73 15224
NM_015076chr644300 3019 1635 23 ----13994
NM_015077chr17134460 4353 4175 3956 3943 3907 1791 1641 1166 993 834 447 198 14523 --11427
NM_015082chr592613 2547 2443 2377 2277 2015 805 543 352 --12591 11024
NM_015090chr1126190 6133 5300 4795 4657 4572 3967 1934 1828 228 159 88 ------
NM_015091chr141111 ------
NM_015092chr1663828 3408 1415 704 579 80 --1851 --
NM_015094chr22103863 3769 3211 3203 2848 1852 1413 1263 494 195 13556 ----
NM_015097chr332275 2111 1681 ------
NM_015101chr152525 1929 952 395 115 --12457 --
NM_015110chr951716 1617 787 489 244 ------
NM_015130chr441300 1111 424 369 ------
NM_015137chr831681 851 53 1166 ----
NM_015138chr1542690 2384 2197 132 ------
NM_015141chr352096 915 871 485 251 --11018 1982
NM_015144chr16103800 3622 3574 3081 2752 2622 2559 2466 1174 544 --33457 3336 35 --
NM_015149chr171593 1525 853 716 675 596 107 ----11386
NM_015156chr1483931 3334 3274 1607 1396 412 111 80 --14042 --
NM_015172chr131207 234 60 11537 ----
NM_015178chr862535 2397 1923 1846 573 504 1419 --12257
NM_015185chrX72818 2647 2164 2012 1994 923 645 11849 11964 --
NM_015190chr102410 84 ------
NM_015192chr2092758 2648 2612 2285 2259 1218 1029 557 477 --1665 1374
NM_015206chr1552520 2423 707 654 292 --13864 --
NM_015216chr521529 294 21381 1308 ----
NM_015225chr942886 2480 1053 575 ----22831 742
NM_015226chr16123243 2808 2619 2573 2520 2464 2456 2441 1264 1067 983 115 ------
NM_015250chr912015 11396 --11847
NM_015251chr1652259 2153 1765 774 302 ----12354
NM_015252chr2165 1947 ----
NM_015263chr152232 54 ------
NM_015265chr261915 1662 1003 782 390 287 ------
NM_015270chr1252212 1979 1960 1741 573 22043 585 ----
NM_015271chr433690 1737 825 1947 33772 3479 1286 --
NM_015272chr1612119 11406 ----
NM_015275chr1211340 --1369 1712
NM_015278chr653080 1199 800 428 35 --21068 824 --
NM_015291chr192985 2957 2627 2321 1232 1101 903 788 392 1855 22369 1081 --
NM_015294chr17132 ------
NM_015299chr1483765 3583 3027 2477 2464 1469 542 133 --11032 --
NM_015310chr8128197 6383 6035 5920 5487 5107 2874 2539 2425 2045 1305 698 --26019 1636 --
NM_015313chr1164570 4336 3411 3066 1873 1115 11819 13375 --
NM_015314chr72943 468 22509 474 133 --
NM_015317chr242214 1809 776 325 ------
NM_015321chr19124806 4583 4539 4450 4054 3780 3710 3434 1033 973 306 32 --11051 --
NM_015328chr761143 1098 893 556 214 206 --11033 --
NM_015336chr1232264 1985 1725 --22534 703 --
NM_015346chr1421892 1394 11577 ----
NM_015347chr1282610 2482 2375 2049 543 304 275 66 ------
NM_015349chr651237 848 616 556 422 --1375 --
NM_015355chr1711453 ------
NM_015359chr852663 2445 546 367 149 ----12969
NM_015365chrX54010 3448 1618 1555 79 --11105 --
NM_015385chr1072891 2620 2335 756 731 443 250 --12813 --
NM_015396chr341290 1015 906 95 ------
NM_015397chr9------11459
NM_015415chr1187 ------
NM_015419chrX21037 63 --1454 1356
NM_015429chr321042 812 --2185 81 --
NM_015436chr473141 2348 2178 1240 757 256 203 ------
NM_015448chr101148 --1173 --
NM_015455chr573922 3246 2893 1540 574 360 154 --11396 --
NM_015458chr874578 3949 2086 2019 848 515 238 12121 13661 --
NM_015460chr361375 1352 643 617 119 72 --22142 168 --
NM_015475chr2------1676
NM_015493chr1962275 2203 2006 1621 1591 419 ------
NM_015523chr111286 ------
NM_015548chr61194 --1741 --
NM_015550chr743277 2739 2624 430 12680 ----
NM_015557chr1123559 3541 2931 2924 2670 2557 2546 2519 2369 875 112 49 ------
NM_015564chr573608 3416 3165 2971 2759 2490 1075 --1346 13433
NM_015565chr21189 --1518 --
NM_015568chr20134017 3560 3268 2796 1410 1207 1021 977 707 683 621 569 56 --13101 13868
NM_015569chr153677 3658 3446 1318 1074 13018 34369 3949 3780 1386
NM_015571chr652526 1909 1841 438 189 ------
NM_015576chr352874 2105 1925 1184 819 --12369 --
NM_015578chr1932077 703 394 11539 11304 --
NM_015601chr103833 381 145 ------
NM_015602chr131600 1474 1271 --11795 --
NM_015642chr3----170 --
NM_015652chr101525 ------
NM_015660chr71242 ----187
NM_015678chr1331321 1087 24 --21653 695 --
NM_015859chr141132 ------
NM_015878chr821722 134 ------
NM_015879chr18188421 8316 7941 7744 7075 5887 5850 5819 5201 3372 3318 3248 2849 1340 1231 1101 724 192 37498 1365 324 57391 6761 5327 1275 879 --
NM_015885chr111129 ------
NM_015886chr864279 3537 3486 1684 1468 1339 13611 24396 905 --
NM_015906chr154817 3079 1573 1315 1038 --11908 --
NM_015981chr552869 2666 2112 1130 473 --1170 --
NM_015994chr142654 496 --2585 555 --
NM_015995chr1575365 4895 4653 4207 1740 1302 372 23418 3366 45227 4841 4696 1423 --
NM_016009chr173884 3582 2976 1271 1031 1010 120 --11437 14626
NM_016023chr82549 127 11926 11513 11686
NM_016040chr112760 ----1242
NM_016048chr51108 ------
NM_016061chr22287 275 ------
NM_016070chr17162 ------
NM_016072chr123581 305 206 --153 --
NM_016076chr152939 2872 2250 2133 2007 12945 11263 --
NM_016083chr643809 3436 2893 872 --13517 --
NM_016084chr17152 ------
NM_016120chrX4801 191 120 23 ----1428
NM_016131chr231480 456 126 ------
NM_016132chr1553290 2883 2786 2197 684 1869 2253 61 12209
NM_016162chr12------1597
NM_016169chr1073071 2847 2566 2407 1256 234 161 --1560 --
NM_016195chr10--140 ----
NM_016201chr352222 609 441 67 29 1447 12353 11906
NM_016206chr368908 8670 8504 7764 6828 1137 1628 17668 27858 1020
NM_016224chr631636 1566 624 22210 314 ----
NM_016227chr111388 ------
NM_016235chr1641481 1247 265 179 --11211 --
NM_016252chr23952 831 50 --1762 --
NM_016255chr653373 3177 2674 2620 2379 --156 1687
NM_016258chr11630 ------
NM_016260chr277255 6901 6450 5227 4887 2622 1819 14696 45843 3045 2979 1618 16345
NM_016261chr172785 642 ------
NM_016271chr184881 416 116 69 --12288 11613
NM_016277chr6----11485 --
NM_016289chr22484 52 ------
NM_016315chr211671 ----21586 365
NM_016338chr51407 ------
NM_016374chr12488 459 --11190 11528
NM_016374chr12488 459 --11190 11528
NM_016376chr1784057 3367 3190 2924 2732 972 700 25 --1237 --
NM_016377chr661720 1623 1213 625 404 384 ------
NM_016396chr1552429 2391 2312 1123 1089 ------
NM_016424chr174667 568 214 125 ----11626
NM_016441chr24698 609 559 543 12154 1750 --
NM_016448chr131799 1634 1272 --1600 11463
NM_016480chr52774 635 ------
NM_016489chr71231 ------
NM_016507chr1722254 1944 ------
NM_016513chr642651 2428 1193 1065 --23495 3254 --
NM_016530chr1554037 2963 1302 1288 569 12754 23566 527 --
NM_016531chr453519 2820 2608 723 502 12928 23956 3297 1867
NM_016542chrX31704 1358 331 --31275 357 136 1468
NM_016577chr384336 3780 3659 3350 1428 1273 504 321 --1790 --
NM_016578chr11----1536 --
NM_016591chr551136 1022 952 253 222 ------
NM_016603chr531954 843 34 --22270 54 --
NM_016604chr52219 107 1871 21230 496 --
NM_016605chr522514 2147 ----21891 958
NM_016626chr1811494 ----11625
NM_016641chr1681632 1615 1539 1316 591 529 408 153 1445 ----
NM_016653chr231209 1018 1011 ------
NM_016654chr153371 281 82 1546 1135 --
NM_016818chr212731 524 ----1754
NM_016929chr6104220 3687 3323 3091 1338 1165 879 791 586 405 13134 ----
NM_016936chr1661986 1715 1682 853 496 490 ------
NM_016952chr1193974 2656 2644 1418 1230 974 710 39 22 43268 2694 904 295 ----
NM_017415chr584120 3999 3685 2946 2867 1743 1614 427 --1748 12987
NM_017420chr1422772 261 13148 11435 --
NM_017423chr41503 ------
NM_017455chr15----1711 --
NM_017491chr42824 135 ------
NM_017522chr111341 ----11368
NM_017548chr341785 1395 471 63 ------
NM_017563chr3115737 5068 4665 4457 4256 4187 4074 2327 1785 1620 552 --14743 --
NM_017577chr331506 1305 1285 ------
NM_017580chr1042131 1871 1837 590 12186 --12282
NM_017594chr973380 2957 2296 1245 1233 405 172 --32812 952 635 12935
NM_017599chr1231961 411 106 12082 ----
NM_017612chr122137 26 ------
NM_017628chr444115 3968 3793 1483 ------
NM_017637chr9128809 6540 6380 6105 5881 3478 3400 2956 2236 1519 1053 548 ------
NM_017641chr122911 899 --1936 --
NM_017643chr1762787 2780 2555 938 443 151 12388 ----
NM_017644chr374275 4229 4113 3933 1659 957 27 ------
NM_017645chr922905 395 --32513 254 47 --
NM_017658chr1432944 1523 551 --23047 1663 --
NM_017661chr154953 880 814 360 ------
NM_017671chr2071942 1580 1538 664 524 361 41 ------
NM_017694chr231982 1748 680 --1661 --
NM_017709chr163889 1040 939 595 363 181 13441 13522 --
NM_017719chr331624 905 471 --11664 21691 592
NM_017737chr141951 1646 852 237 ------
NM_017742chr1841924 1765 683 47 1368 ----
NM_017744chr142199 716 395 288 1859 21789 520 --
NM_017745chrX2654 186 ------
NM_017753chr91120 ------
NM_017754chr694371 4234 3254 1133 707 476 408 313 95 --14694 --
NM_017769chr1452857 2802 1290 973 436 1471 22956 2767 --
NM_017770chr642157 1098 1081 553 --22958 2658 --
NM_017779chr13919 598 237 ----155
NM_017780chr81777 --1138 --
NM_017798chr203388 315 196 ------
NM_017799chr1431347 515 351 1486 1109 --
NM_017812chr72559 207 ------
NM_017813chr854988 4834 4230 3558 477 --35275 433 102 --
NM_017824chr10--1227 ----
NM_017848chrX63597 3376 3271 2888 1205 72 12842 23926 3048 --
NM_017851chr1521244 464 31156 875 175 ----
NM_017866chr83857 836 817 21042 394 1163 --
NM_017895chr201151 --162 --
NM_017902chr1064790 3906 3689 1477 1307 1096 ----21183 685
NM_017915chr1231217 914 795 ----1166
NM_017944chr1152882 2838 2802 2257 262 1535 22440 396 --
NM_017948chr91465 ------
NM_017969chr2--1194 ----
NM_018008chr33343 329 147 ------
NM_018011chr131185 ------
NM_018013chr692878 2866 2507 2088 962 632 544 313 127 --13001 --
NM_018027chr1092876 2342 2278 811 529 389 330 109 85 ------
NM_018076chr101229 --125 --
NM_018078chr4187 1669 1301 --
NM_018084chr252384 2363 2320 581 431 ------
NM_018085chr1107973 6859 6327 5847 2764 2263 1819 1642 669 368 ------
NM_018086chr22541 243 ------
NM_018121chr1052900 2843 2310 1026 319 22583 274 ----
NM_018126chr411452 ------
NM_018133chr33402 305 61 ----11597
NM_018155chr322735 72 23315 375 1321 --
NM_018169chr121178 ----1378
NM_018176chr451524 1299 491 417 85 ------
NM_018178chr151818 1310 809 619 231 1336 ----
NM_018184chr31200 ------
NM_018200chr1531849 1046 164 --2149 64 12022
NM_018206chr161611 --1505 1587
NM_018211chr141960 748 537 384 187 ----
NM_018222chr1151508 1274 765 724 644 --21260 404 --
NM_018243chr482952 2799 2756 2572 2487 1068 482 393 ------
NM_018246chr832635 2229 704 12276 ----
NM_018257chr20------12241
NM_018287chr10--1293 ----
NM_018293chr332917 2202 321 22667 2572 --11061
NM_018299chr852494 1190 1003 904 494 21227 210 12734 12475
NM_018302chr432462 612 426 --12047 1772
NM_018312chr1122070 1803 12131 --1691
NM_018313chr352456 2192 1965 527 57 --2163 133 --
NM_018325chr911468 ------
NM_018339chr941719 663 402 290 ------
NM_018340chr16105045 4667 3620 1756 1085 904 670 648 540 514 --14321 --
NM_018351chr1273604 1804 1441 1081 965 863 109 --11210 --
NM_018364chr133537 3274 3202 --14060 --
NM_018367chr1192420 2160 2138 2051 1995 1921 969 445 409 --21961 1557 --
NM_018374chr734610 3445 596 --24851 1646 1306
NM_018375chr1421767 1638 1205 1374 --
NM_018383chr241857 1626 1505 810 11661 ----
NM_018403chr383884 3599 3356 3055 2975 2793 508 440 --2942 897 --
NM_018409chr452016 592 482 459 70 ----12524
NM_018416chr1262364 2198 706 474 459 141 --1346 --
NM_018420chr142890 2097 2028 655 --1398 --
NM_018424chr92625 423 ------
NM_018429chr552479 1074 572 491 466 ------
NM_018439chr1852496 2207 1741 105 59 ------
NM_018440chr8218722 8415 7485 7409 7353 6938 6744 6629 5868 5759 5525 3385 2685 2238 1975 1651 1198 1134 920 722 311 17831 46785 6486 5518 2634 18628
NM_018444chr831667 320 229 ----1517
NM_018448chr1221023 805 ------
NM_018452chr6_random93497 3260 3010 2739 2651 1432 811 624 548 --12630 --
NM_018464chr101315 ------
NM_018471chr2131 ------
NM_018490chr1141660 1471 662 155 ------
NM_018557chr211678 ------
NM_018566chr154269 3948 3337 3165 1307 24363 1628 172 --
NM_018584chr11302 ------
NM_018638chr1295051 3671 2049 1574 1355 1191 970 495 73 --11600 --
NM_018640chr1232513 1930 439 --22458 1067 --
NM_018650chr11165 ------
NM_018685chr71941 ------
NM_018703chr16----139 --
NM_018710chr8156 ------
NM_018718chr752039 1827 674 586 170 --11597 --
NM_018844chr721560 1404 21934 571 ----
NM_018898chr551691 823 699 460 23 1932 ----
NM_018899chr551691 823 699 460 23 1932 ----
NM_018900chr551691 823 699 460 23 1932 ----
NM_018901chr551691 823 699 460 23 1932 ----
NM_018902chr551691 823 699 460 23 1932 ----
NM_018903chr551691 823 699 460 23 1932 ----
NM_018904chr551691 823 699 460 23 1932 ----
NM_018905chr551691 823 699 460 23 1932 ----
NM_018906chr551691 823 699 460 23 1932 ----
NM_018907chr551691 823 699 460 23 1932 ----
NM_018908chr551691 823 699 460 23 1932 ----
NM_018909chr551691 823 699 460 23 1932 ----
NM_018910chr551691 823 699 460 23 1932 ----
NM_018911chr551691 823 699 460 23 1932 ----
NM_018945chr643682 3079 2819 1244 --1181 --
NM_018951chr7------1229
NM_018959chr191213 ------
NM_018970chr752916 2447 2388 2276 1074 172 11984 --
NM_018976chr1272821 2342 2180 1807 1035 612 294 ------
NM_018979chr1242532 2295 1810 760 --11058 --
NM_018999chr1064855 1607 736 616 596 430 --24796 356 --
NM_019001chr374248 4211 4055 3184 2997 981 819 24155 3372 ----
NM_019004chr712196 ------
NM_019006chr15175 ------
NM_019030chr5152 ------
NM_019041chr652061 936 801 728 406 --11637 1136
NM_019046chr104983 194 103 82 ------
NM_019049chr13793 624 292 ------
NM_019058chr101532 ------
NM_019063chr222260 2117 ----1638
NM_019072chr563806 3415 2713 2611 891 235 14076 33606 3554 2799 --
NM_019084chr1022167 362 --151 --
NM_019094chr1243777 3462 1515 194 --1201 --
NM_019106chr2283250 2362 1337 1100 711 652 568 373 --22218 546 --
NM_019114chr982330 2321 2072 1978 1911 933 403 136 ------
NM_019116chr1693194 2859 2680 2367 1504 948 503 237 147 1973 13404 --
NM_019556chrX----11316 --
NM_019557chr12189 123 ------
NM_019558chr21108 1244 ----
NM_019590chr1011102 ------
NM_019593chr2012355 ------
NM_019859chr1021440 497 --162 --
NM_019860chr1021488 545 --1110 --
NM_020062chr206937 843 803 737 234 27 ------
NM_020122chr2135703 5471 5337 4745 4559 4156 4138 1804 1704 1556 709 645 566 12141 15712 --
NM_020139chr442051 1908 1853 773 --1626 --
NM_020141chr132353 2337 199 --21647 21 --
NM_020148chr1832517 954 267 ----1403
NM_020150chr1062233 2217 1951 668 489 122 ------
NM_020154chr151100 ------
NM_020177chr532822 1076 687 --12057 --
NM_020178chr171285 ------
NM_020184chr23666 620 418 32087 1819 1658 ----
NM_020205chr132571 787 495 1678 --11156
NM_020243chr222600 226 1747 ----
NM_020245chr675105 4248 4071 4060 3895 3563 107 ------
NM_020336chr201474 1240 13360 --
NM_020338chr10112874 2785 2711 2524 1494 950 910 742 621 109 21 12676 21224 943 --
NM_020341chr2051390 1347 754 499 29 --21428 231 --
NM_020342chr222446 94 ------
NM_020346chr1131422 349 343 11236 1205 --
NM_020348chr1082614 2600 2416 1737 895 801 687 556 1203 ----
NM_020354chr101394 ----1184
NM_020357chr3----1526 --
NM_020381chr652015 1952 1573 813 316 ----11795
NM_020390chr354055 3586 3323 1203 750 11547 --182
NM_020403chr132509 184 --1546 --
NM_020416chr452459 1991 485 180 94 11771 146 --
NM_020420chrY41270 439 142 102 21441 675 11276 --
NM_020443chr1156936 6901 6336 6106 6017 5508 5125 4449 4304 4291 4277 2752 1739 715 52 ----14409
NM_020455chr632802 2307 1931 12501 1376 --
NM_020463chr24969 952 418 277 --1935 --
NM_020466chr674770 4728 4109 3430 1659 885 805 13393 ----
NM_020474chr1831266 664 133 ------
NM_020532chr23662 626 139 ------
NM_020630chr101624 ----1299
NM_020640chr3------12009
NM_020651chr221762 43 --11522 --
NM_020654chr311267 --1120 --
NM_020666chr51653 ------
NM_020673chr20167230 7193 6968 5791 5730 5621 5609 5319 4699 3011 2765 2588 1870 1557 907 489 --37236 1854 1226 15008
NM_020699chr1115361 4715 4666 4295 4233 3594 1976 1652 1262 900 805 13293 35422 4204 3513 --
NM_020711chr262226 2181 2166 2151 330 46 1929 1801 --
NM_020715chr1492287 1881 1790 1723 1575 919 619 600 350 ------
NM_020717chrX94350 3829 1946 1355 1220 775 429 187 39 --43911 3659 3248 1242 11990
NM_020718chr1675422 4689 2570 1065 797 363 239 1216 25973 2502 --
NM_020724chr472573 2009 1008 705 685 592 295 --1780 --
NM_020731chr5113195 3018 2868 2610 2237 1209 1189 1062 703 539 472 ------
NM_020739chr1573532 2761 779 688 507 369 336 13604 ----
NM_020742chrX32174 2007 157 1794 12185 --
NM_020747chr51116 ------
NM_020748chr1722146 1462 ----1669
NM_020752chr1082550 2426 1052 963 622 320 188 128 1916 --1716
NM_020760chr241687 1291 560 364 --21795 112 --
NM_020762chr12167 --1696 122
NM_020766chrX34144 2807 1733 --1864 --
NM_020771chr641395 1349 1130 473 ------
NM_020772chr1796884 6383 5227 3345 3266 2555 2011 1856 45 --47184 6346 6242 2502 --
NM_020773chr472708 2245 1798 867 727 600 301 ------
NM_020774chr1835058 3834 43 14060 25022 416 14854
NM_020781chr772584 2149 2053 1071 909 801 487 --12473 --
NM_020782chr1264644 3730 3101 2942 628 318 --21723 1632 --
NM_020784chr1471663 1633 1109 638 530 437 127 1342 ----
NM_020792chr362273 1879 1853 1799 1770 1010 ------
NM_020801chr532062 722 636 ------
NM_020803chr462418 2180 1889 1557 1539 1522 132 21697 1664 --
NM_020804chr641025 896 775 130 --1645 --
NM_020809chr1151781 1675 1427 526 518 11574 1628 --
NM_020810chr1463413 2753 2688 1239 1075 438 --22971 1265 --
NM_020813chr1972474 1978 693 644 610 602 495 12436 2786 350 --
NM_020815chr4------1403
NM_020824chr101494 ------
NM_020830chr223189 775 11046 11116 --
NM_020841chr12103946 3812 3732 3580 1547 981 835 814 204 178 12907 --13225
NM_020844chr867292 6430 2541 2286 828 714 16203 12878 --
NM_020854chr1861364 1152 1109 1065 479 47 --31414 383 346 --
NM_020856chr19----11193 --
NM_020858chr1532414 1927 243 ------
NM_020860chr46851 409 348 312 250 207 ------
NM_020861chr641244 1208 987 332 11288 ----
NM_020868chr231399 1358 785 ----1761
NM_020871chrX2692 242 11029 11919 --
NM_020873chr31638 ------
NM_020918chr102622 457 --12633 --
NM_020948chr1----12356 1871
NM_020951chr1932097 1910 1608 1159 12072 --
NM_020952chr91757 1621 1304 --
NM_020956chr19134426 4184 3891 3622 3137 2981 1358 1331 1068 857 722 223 60 --14766 --
NM_020958chr14149 ------
NM_020959chr19144 ------
NM_020964chr18144025 3653 3570 3496 3351 1505 1120 968 633 617 450 396 305 278 --13471 --
NM_020977chr461821 1594 886 833 344 164 ------
NM_020980chr1531732 1394 639 1120 ----
NM_020983chr1252212 1979 1960 1741 573 22043 585 ----
NM_021007chr232421 2193 664 --12112 --
NM_021025chr51531 ------
NM_021033chr1312841 --2891 276 --
NM_021061chr854444 4004 3851 3353 1815 1266 13260 13589
NM_021072chr521048 745 --1772 12619
NM_021097chr242617 1020 631 215 --12151 12237
NM_021111chr92470 450 1910 11146 --
NM_021116chr7258424 7641 7582 6958 6099 5896 5709 3619 3486 3107 2963 2928 2915 2647 2483 1986 1702 1661 1418 685 519 506 375 110 64 23371 1688 38278 7593 3213 --
NM_021144chr91385 ------
NM_021145chr721007 127 ------
NM_021159chr411183 11505 --21743 1071
NM_021163chr763859 3324 3063 1338 127 66 ----1365
NM_021204chr41340 ------
NM_021205chr152772 2634 2537 1998 930 --12240 157
NM_021222chr121371 446 ------
NM_021238chr1262006 1818 1742 1653 400 66 ------
NM_021255chr1443582 3035 989 966 --34090 3446 3093 --
NM_021627chr3----1942 --
NM_021629chr354437 3536 1759 1198 638 11244 --14611
NM_021638chr494727 4503 3595 3504 3100 1757 1335 436 138 --21726 306 24735 4344
NM_021643chr241679 1225 723 446 --2714 677 --
NM_021648chr642563 1953 783 501 --1454 --
NM_021785chrX----1284 --
NM_021813chr655266 5232 4768 4478 3812 --23563 1631 15357
NM_021814chr611511 ------
NM_021815chr232401 1107 155 1518 21209 419 --
NM_021826chr20178 ----135
NM_021911chr584868 3502 2008 1619 1448 1065 1005 339 ------
NM_021912chr1584001 3747 3670 3314 2845 1144 625 269 ----1308
NM_021914chr1452206 1905 927 746 332 ------
NM_021940chr611559 ------
NM_021943chr661919 1794 1768 212 137 70 --11617 --
NM_021949chrX2349 229 --32290 1804 1796 --
NM_021951chr91324 --2867 301 --
NM_021956chr611365 ------
NM_021960chr142191 2154 1967 1750 12132 1253 1349
NM_021961chr1195749 4970 4847 4677 2857 2826 2597 2190 1698 --36233 6159 167 16288
NM_021964chr366666 5728 4522 4424 2436 388 ------
NM_021998chrX1450 --127 --
NM_021999chr13----1810 1224
NM_022048chr15115307 5237 5128 4401 2447 1207 1105 1096 938 443 186 --1865 --
NM_022049chr141311 1281 751 260 11414 1200 --
NM_022051chr11228 ------
NM_022058chr221862 38 --21890 644 1394
NM_022079chr103833 381 145 ------
NM_022096chr202671 83 ------
NM_022103chr1941253 924 201 124 --2878 139 --
NM_022114chr184699 3404 3027 2944 1828 1148 681 240 13648 24013 3795 --
NM_022117chrX1155 ------
NM_022123chr141441 ------
NM_022130chr51394 ------
NM_022166chr16105657 4509 4177 3981 2382 2225 2076 1424 1402 920 2365 126 24243 631 --
NM_022336chr272117 2062 1801 1492 141 45 37 11654 ----
NM_022340chr353503 2891 2470 1294 48 12229 ----
NM_022351chr833377 2830 1130 ----1916
NM_022451chr101844 ------
NM_022459chr13116196 4748 4283 2540 2314 1764 1351 1222 883 797 101 25515 1666 35948 5207 5166 --
NM_022473chr1563274 3220 3113 1409 939 69 --23506 30 13915
NM_022482chr2082475 2350 2261 2241 2051 1686 842 488 ------
NM_022491chr1263154 2848 2720 2400 964 337 12711 13532 --
NM_022497chr383274 3225 3048 2618 1130 607 569 310 --23836 699 --
NM_022648chr274041 2999 2990 1650 1526 1419 478 --1752 --
NM_022650chr51128 --1186 --
NM_022658chr1211291 11361 ----
NM_022716chr142888 1143 710 494 ----1692
NM_022719chr22123493 3434 3147 3037 2978 2647 2591 1367 1297 1241 1057 644 ------
NM_022726chr621739 1603 ----11548
NM_022728chr7----1524 --
NM_022748chr762862 2726 2140 2092 539 57 --12230 12710
NM_022753chr152407 1794 425 302 291 ------
NM_022756chr141247 1012 387 96 11361 1170 --
NM_022763chr362761 2393 1126 1085 764 249 ------
NM_022768chr11154 ------
NM_022776chr341381 1290 489 72 ------
NM_022780chr231177 574 112 ------
NM_022826chr2--1336 ----
NM_022832chr452281 1961 966 681 639 --1271 12024
NM_022838chrX------1255
NM_022843chr13--21257 214 11189 --
NM_022845chr1632197 899 341 12226 11674 --
NM_022893chr232610 955 153 ----12493
NM_022898chr1443657 1723 485 456 14029 34078 3738 3116 --
NM_022912chr22121 74 12704 12777 --
NM_022977chrX52369 2235 2183 1909 580 ------
NM_023039chr51316 --1338 --
NM_023072chr1951152 976 916 369 101 ----1207
NM_024007chr552690 2164 927 814 798 --13002 12586
NM_024052chr1773114 2901 2747 2120 966 627 248 --11909 --
NM_024090chr441493 1368 455 289 11433 --125
NM_024295chr821801 35 --31952 1667 1300 --
NM_024332chrX5689 645 566 420 56 ----1126
NM_024408chr133733 997 102 13487 --13587
NM_024416chr931481 518 425 ------
NM_024524chr342594 2175 1983 1210 12795 13215 --
NM_024539chrX21061 270 ------
NM_024541chr1061746 1725 1351 505 370 178 ------
NM_024546chr131127 ------
NM_024607chr873850 2784 1625 1275 720 372 80 23869 2879 14232 --
NM_024613chr831302 1248 100 ------
NM_024626chr161596 1331 1198 1147 1116 163 --134 --
NM_024631chr111242 ------
NM_024636chr732529 2168 831 --21968 248 --
NM_024646chr164008 3685 2959 1244 510 313 1109 1901 --
NM_024665chr343430 3331 2888 1602 24318 935 11527 --
NM_024666chr1541765 608 499 448 174 21698 324 --
NM_024674chr192871 2840 2598 2367 2062 2023 1124 1112 395 ------
NM_024686chr11461 ----1574
NM_024692chr211485 186 1160 --
NM_024713chr1541578 568 455 134 11446 ----
NM_024721chr81276 --11754 1680
NM_024740chr1133210 596 172 --31513 866 75 1426
NM_024744chr232502 1824 236 ------
NM_024770chr2146429 6337 6045 4884 4430 4176 2653 1705 1393 1155 1097 643 450 29 --14686 --
NM_024795chr231557 579 457 --31478 269 71 --
NM_024798chr15132700 2605 2588 2568 2327 2302 933 885 780 742 320 296 248 --22574 39 --
NM_024812chr81307 1649 12192 --
NM_024887chr152096 2033 1539 630 138 21668 153 ----
NM_024900chr441755 1576 767 461 166 1633 --
NM_024900chr441755 1576 767 461 166 1633 --
NM_024920chr4----11117 --
NM_024921chrX61781 1730 1690 1319 565 97 11444 2360 36 --
NM_024930chr552343 2294 1941 596 510 22451 1956 ----
NM_024941chr531012 977 530 --11238 11381
NM_024947chr3118728 8620 8334 7583 6189 3013 2356 2009 1642 785 253 23737 2617 27723 3252 --
NM_024948chr102700 83 ------
NM_024949chr494278 4190 3909 3158 3080 1975 1372 1146 534 --24489 1320 --
NM_024960chr20----1138 --
NM_024969chr21230 ------
NM_024971chr91757 1621 1304 --
NM_024991chr1072891 2620 2335 756 731 443 250 --12813 --
NM_025073chr174306 4142 3207 3193 1562 614 327 13253 --1999
NM_025133chr21152 ------
NM_025134chr1612222 --12515 1743
NM_025160chr142648 1700 1377 1163 --13734 --
NM_025179chr193644 3335 1803 1608 1555 1544 656 408 265 --23024 729 --
NM_025191chr173098 2151 1010 949 908 639 265 43333 2595 1236 975 ----
NM_025195chr821833 1462 1677 ----
NM_025211chr9121 ------
NM_025221chr431203 898 290 --1955 --
NM_025235chr1011665 --11727 --
NM_025238chr15--11555 --1649
NM_030594chr151910 ------
NM_030623chr21159 ----11414
NM_030625chr101325 --173 --
NM_030627chr553628 3072 2676 1461 848 --13970 --
NM_030629chr161358 ------
NM_030640chr122839 118 ------
NM_030647chr765046 4579 4218 2053 1939 21 44990 2513 2095 1586 33888 639 389 45578 5477 5430 1148
NM_030648chr4125275 5120 4493 4482 3491 3482 2116 1794 1217 1205 990 339 --1552 14023
NM_030651chr6--163 ----
NM_030664chr1052315 1809 775 719 160 --11977 12139
NM_030665chr1721444 1413 ------
NM_030670chr1241933 1566 692 105 ----11675
NM_030671chr1241933 1566 692 105 ----11675
NM_030674chr12115762 3935 3856 3788 3688 2173 2005 1943 1704 1499 724 11932 --12112
NM_030758chr2241023 519 405 302 ------
NM_030761chr182376 2216 2029 1994 1970 920 777 418 --1496 --
NM_030791chr1451875 693 480 191 75 ------
NM_030799chr532100 765 264 --12065 --
NM_030806chr1129148 9129 8310 8275 8254 7287 6954 6160 5872 2235 1755 1163 37824 6645 3634 27201 561 --
NM_030809chr1242290 1801 463 313 ------
NM_030816chr143024 2348 2335 275 13292 12782 --
NM_030820chr64859 844 415 184 ------
NM_030877chr20196 ------
NM_030918chr1125215 4588 4383 3578 3392 3336 2111 1032 676 419 236 28 --15246 --
NM_030920chr12280 83 --12123 --
NM_030939chr6--2735 724 ----
NM_030945chr531946 991 571 32186 925 587 1311 --
NM_030962chr1121519 275 ----1339
NM_031217chr112523 112 ------
NM_031243chr72173 120 --22345 398 --
NM_031267chr71447 ------
NM_031268chr1693613 1958 1574 1539 1338 1286 886 767 96 --13515 --
NM_031271chr841487 1463 605 357 ------
NM_031296chr432478 1747 610 ----172
NM_031305chr411369 --1369 11805
NM_031371chr12488 459 --11190 11528
NM_031371chr12488 459 --11190 11528
NM_031372chr421488 1136 --31116 1096 659 --
NM_031411chr551691 823 699 460 23 1932 ----
NM_031427chr14155779 5734 4922 4692 4214 3950 3824 3649 1523 1430 1264 847 677 664 304 --35186 2062 1229 --
NM_031442chrX----23199 3103 --
NM_031453chr1032314 865 387 ----12414
NM_031468chr7158036 7927 7514 7025 6577 6506 6442 5690 5545 5190 1888 1534 993 983 330 21796 284 26287 553 --
NM_031475chr11530 ------
NM_031844chr183390 2593 1486 1438 907 829 522 382 --23580 1427 --
NM_031845chr263400 3229 2888 2786 2344 803 11419 --21413 1000
NM_031847chr263400 3229 2888 2786 2344 803 11419 --21413 1000
NM_031849chr551691 823 699 460 23 1932 ----
NM_031857chr551691 823 699 460 23 1932 ----
NM_031858chr1721401 1326 11334 ----
NM_031860chr551691 823 699 460 23 1932 ----
NM_031862chr1721401 1326 11334 ----
NM_031938chr113808 394 129 ------
NM_031940chr84730 702 611 598 --12048 --
NM_031954chr1252810 2356 429 257 129 --42605 1852 954 854 12933
NM_032012chr974986 4792 3481 1977 1822 1656 1111 14507 ----
NM_032017chr132044 1300 173 --11938 --
NM_032021chr1111003 --1121 --
NM_032041chr852235 2156 2139 1018 613 ----1902
NM_032042chr552712 2675 2562 2240 542 ------
NM_032102chr1152943 2060 1165 618 368 ------
NM_032105chr1167637 7051 6111 5031 5011 4989 1826 1465 1277 1263 1170 914 879 778 381 114 --31996 1783 927 --
NM_032116chr1364577 4327 3700 1804 1266 966 13862 12347 --
NM_032124chr1821252 295 --1929 --
NM_032135chr14133 ------
NM_032136chr4124 --1140 --
NM_032144chr241420 1224 64 31 ------
NM_032147chr12--1738 ----
NM_032160chr1844376 3891 3109 1204 ----13045
NM_032192chr171224 ------
NM_032199chr1073754 3620 3339 1353 1299 1150 88 12858 11406 --
NM_032208chr283571 3124 2846 2747 2303 2287 1417 230 12374 21024 760 --
NM_032228chr1112179 --175 --
NM_032233chr142888 872 ------
NM_032268chr1652898 2760 1253 1185 841 1392 ----
NM_032288chr341915 1704 1682 1640 1947 11543 --
NM_032373chr1064469 3935 1367 1259 980 485 14234 2246 126 --
NM_032435chr152283 949 474 171 109 ------
NM_032438chr621557 209 --1537 --
NM_032440chr1042906 2753 1178 65 12194 2639 444 --
NM_032445chr1512226 1858 ----
NM_032457chr453428 3414 3034 2380 844 --1873 --
NM_032458chrX11308 1538 2942 204 1625
NM_032499chr153637 527 512 1272 ----
NM_032517chr10------1132
NM_032521chr2053051 3021 2003 1145 759 ------
NM_032523chr2179 ------
NM_032539chrX3833 794 671 1663 1149 --
NM_032547chr411143 --11441 --
NM_032569chr1641999 1413 519 463 --21761 753 --
NM_032582chr1751600 1465 1195 620 92 ------
NM_032599chr71126 ----1495
NM_032623chr42329 291 ------
NM_032632chr1422003 181 ----1266
NM_032663chr1231837 296 147 ----11272
NM_032682chr31815 ------
NM_032711chr1753479 2998 2810 1049 264 --11055 12722
NM_032782chr51201 ----11036
NM_032784chr63999 174 75 --1886 --
NM_032801chr113880 346 167 ------
NM_032804chr1032354 2237 2086 --1475 1287
NM_032810chr1021079 552 1249 --1292
NM_032826chr7125152 4959 3322 2135 2047 1985 1799 1132 1088 653 386 108 14214 24013 1870 --
NM_032832chr631448 549 342 11600 --1170
NM_032858chr1--165 ----
NM_032859chr1323547 3213 53334 2427 1457 1352 865 13230 13086
NM_032864chr141186 1117 995 554 191 ----
NM_032866chr15122801 2548 2105 1991 1057 1026 1007 907 897 812 798 226 --1842 --
NM_032873chr1174498 3080 1726 1199 1107 1079 455 13966 ----
NM_032895chr171785 --1593 --
NM_032906chr42672 621 ------
NM_032927chr42217 197 ------
NM_032949chr13----1125 --
NM_032961chr45865 329 136 102 90 21089 335 21081 432 --
NM_032975chr1853285 3128 2442 1269 631 1778 12496 141
NM_032978chr1831220 799 382 ----194
NM_032979chr1831220 799 382 ----194
NM_032980chr1853285 3128 2442 1269 631 1778 12496 141
NM_032981chr1831220 799 382 ----194
NM_032995chr281674 1595 1165 314 303 273 238 143 --21082 604 11485
NM_033014chr931481 518 425 ------
NM_033020chr154817 3079 1573 1315 1038 --11908 --
NM_033036chr1141455 1333 1224 582 21186 575 ----
NM_033055chr1----1242 --
NM_033056chr101573 ------
NM_033082chr12187 ------
NM_033132chr131409 ------
NM_033136chr511784 --11663 --
NM_033137chr511784 --11663 --
NM_033138chr741826 1786 1753 308 --21769 400 --
NM_033139chr741826 1786 1753 308 --21769 400 --
NM_033140chr741826 1786 1753 308 --21769 400 --
NM_033143chr44453 259 241 119 3940 433 38 ----
NM_033157chr741826 1786 1753 308 --21769 400 --
NM_033181chr643809 3436 2893 872 --13517 --
NM_033211chr511689 11676 ----
NM_033222chr911350 ----11408
NM_033224chr7166952 6913 6877 6298 5958 5871 5807 5301 2703 2435 2327 2258 1951 987 967 849 13216 36279 2794 613 12592
NM_033225chr832410 2238 763 136 12784 --
NM_033260chr61136 ------
NM_033274chr5153584 3404 3263 2870 2340 1096 1059 984 902 707 576 502 345 328 64 12971 23317 367 --
NM_033281chr52908 613 ------
NM_033285chr864283 3545 2869 1472 1391 1361 2841 585 ----
NM_033290chrX83728 3294 2307 1471 1069 762 320 50 ------
NM_033300chr111341 ----11368
NM_033305chr931336 365 186 11046 ----
NM_033312chr1178 ------
NM_033360chr1253533 2927 1122 691 97 24096 3301 21723 780 --
NM_033380chrX21099 1022 ------
NM_033381chrX21099 1022 ------
NM_033389chr1794645 4174 3757 3696 3581 1888 1570 886 477 1976 23618 250 --
NM_033393chr482953 2559 2508 2462 2117 1017 347 327 ------
NM_033411chr6141 --1221 --
NM_033425chr1163363 1358 1220 1143 986 743 --12966 --
NM_033426chr1492954 2850 2463 2270 2115 1152 637 393 134 12196 12612 12077
NM_033429chr1563296 2869 2291 896 492 168 12358 12707 --
NM_033430chr454031 2688 2567 1114 669 --24100 3136 --
NM_033437chr454031 2688 2567 1114 669 --24100 3136 --
NM_033512chr872468 2169 2013 480 460 412 331 --1745 --
NM_033515chr6--11292 --1148
NM_033624chr1271944 1723 1680 1587 1396 550 112 ------
NM_033644chr542547 2356 865 629 12206 1497 --
NM_033645chr542547 2356 865 629 12206 1497 --
NM_033656chr2175545 5408 5267 4875 2129 1738 1268 --13737 --
NM_052851chr1341736 862 732 42 --1715 --
NM_052879chr1233942 3556 556 --11291 11459
NM_052885chr1223926 1737 13104 14811 --
NM_052886chr821390 726 2633 544 --11778
NM_052900chr81726 1384 ----
NM_052906chr22125112 4385 4165 4141 3745 3195 1848 933 740 460 330 33 --14331 --
NM_052907chr12103740 2674 1714 1529 1329 1298 801 443 321 303 1159 23486 2908 --
NM_052918chr1053355 3088 1367 555 501 --12916 --
NM_052966chr172559 2415 1550 1129 1058 570 40 --13282 --
NM_053016chr9117530 7417 6381 6183 6131 5949 5787 5243 2601 1366 612 --12244 --
NM_053024chr31240 158 ----
NM_053025chr32491 354 ----2316 34
NM_053026chr32491 354 ----2316 34
NM_053027chr32491 354 ----2316 34
NM_053028chr32491 354 ----2316 34
NM_053031chr32491 354 ----2316 34
NM_053032chr32491 354 ----2316 34
NM_053056chr1162991 2699 2474 2236 801 660 --22822 597 --
NM_053279chr862697 2314 2123 1760 1038 74 ------
NM_053281chrX1123 ------
NM_057159chr951401 644 333 105 29 11037 ----
NM_057749chr821086 258 --1540 --
NM_058170chr121326 534 ----1268
NM_058172chr42510 377 --11822 --
NM_058237chr142341 68 --3899 785 771 --
NM_058241chr241969 1540 653 339 ------
NM_058241chr241969 1540 653 339 ------
NM_078473chr84730 702 611 598 --12048 --
NM_080422chr18--132 ----
NM_080423chr18--132 ----
NM_080491chr1183464 3054 1513 819 531 390 352 236 12810 31547 1164 653 --
NM_080546chr942213 2203 1799 1533 --1532 --
NM_080591chr973051 2551 836 735 678 308 65 ----13151
NM_080629chr1----11198 --
NM_080630chr1----11198 --
NM_080669chr17144593 3688 3514 3339 3251 3221 1479 1359 1174 1144 430 423 303 245 --24728 3699 --
NM_080676chr2072603 2550 2102 1239 1228 835 662 --11279 --
NM_080759chr1322023 665 --12165 --
NM_080760chr1322023 665 --12165 --
NM_080832chrX1401 ------
NM_080867chr1484904 4831 4520 4124 3910 3843 3449 583 11445 24950 3456 --
NM_080872chr883681 3622 3395 3147 3005 1479 803 306 ------
NM_080874chr42592 268 ------
NM_080927chr333056 2545 2470 1522 ----
NM_080928chr7----1232 --
NM_130385chr1172622 2458 2310 771 708 233 157 12780 --13070
NM_130387chr34297 244 186 76 1950 --11095
NM_130391chr921427 1335 169 11021 --
NM_130392chr921427 1335 169 11021 --
NM_130393chr921427 1335 169 11021 --
NM_130438chr2153183 1289 765 378 175 --12152 --
NM_130446chr383943 3290 3157 2659 1390 988 442 153 --13132 1107
NM_130783chr1152010 1780 1714 792 152 --31328 415 113 --
NM_130811chr2011025 ------
NM_130830chr3113856 3761 3702 3527 3021 2751 2595 1128 669 590 220 13637 23727 3278 --
NM_130838chr1511791 ----11405
NM_130839chr1511791 ----11405
NM_133170chr20187877 7326 7172 6833 6064 5574 5338 4994 3184 2923 2208 2160 1692 1566 1534 1231 547 338 17298 47675 5475 3076 1195 15968
NM_133171chr2051235 952 917 192 131 ----11119
NM_133264chr1783811 3772 3744 3372 3261 2487 830 731 11318 ----
NM_133265chrX73679 3456 2381 2319 857 507 404 ------
NM_133367chr673441 3166 2949 2573 1276 766 144 1669 ----
NM_133370chr473335 2948 2932 2832 2672 2363 528 12954 ----
NM_133372chr562418 2261 2085 1788 728 257 ------
NM_133446chr101237 ------
NM_133478chr252530 2263 2090 895 400 12151 ----
NM_133503chr123640 138 75 ------
NM_133504chr123640 138 75 ------
NM_133505chr123640 138 75 ------
NM_133506chr123640 138 75 ------
NM_133507chr124818 316 253 122 ------
NM_133631chr341431 1149 365 285 11599 ----
NM_133646chr2125070 4193 3830 3614 2076 1113 916 625 573 199 119 99 --11981 --
NM_133647chr15123358 3083 2798 2482 1402 1322 1066 483 343 286 242 185 1507 2791 382 11202
NM_138288chr1441625 1507 555 236 11725 ----
NM_138316chr10192 --2967 98 --
NM_138335chr43727 236 73 --1287 --
NM_138348chr595699 5146 5019 2003 1772 1221 961 555 126 --25199 1492 --
NM_138394chr2154 ------
NM_138409chr661377 1140 939 854 438 370 ------
NM_138423chr1562048 1477 869 840 717 226 1802 ----
NM_138426chr732412 1011 588 ------
NM_138444chr1324347 1057 13577 13723 --
NM_138468chr286117 5367 5112 4548 4211 2492 1992 1815 --34473 3958 2230 14164
NM_138494chr71122 2455 112 1358 --
NM_138558chr11313 ------
NM_138576chr1443657 1723 485 456 14029 34078 3738 3116 --
NM_138621chr293432 2685 1616 1411 1395 1337 1320 1151 449 ------
NM_138633chr661720 1623 1213 625 404 384 ------
NM_138638chr1452206 1905 927 746 332 ------
NM_138693chr7192 ------
NM_138694chr6103684 3271 3078 2839 2645 2623 2524 2406 820 204 22439 157 ----
NM_138713chr1688187 6978 5838 3316 2947 2366 2220 1473 1698 37761 7585 6960 11963
NM_138714chr1688187 6978 5838 3316 2947 2366 2220 1473 1698 37761 7585 6960 11963
NM_138727chr142199 716 395 288 1859 21789 520 --
NM_138728chr142199 716 395 288 1859 21789 520 --
NM_138730chr61181 --185 --
NM_138735chr231128 428 379 ------
NM_138782chr52494 159 1945 --12106
NM_138931chr311075 ------
NM_138971chr1153634 3057 2781 636 447 --13158 --
NM_138971chr1153634 3057 2781 636 447 --13158 --
NM_138972chr1153634 3057 2781 636 447 --13158 --
NM_138972chr1153634 3057 2781 636 447 --13158 --
NM_138973chr1153634 3057 2781 636 447 --13158 --
NM_138973chr1153634 3057 2781 636 447 --13158 --
NM_139014chr622069 1799 --134 --
NM_139045chr9------1801
NM_139046chr101182 ------
NM_139048chr341094 301 201 185 --1451 --
NM_139072chr22907 691 ------
NM_139076chr441031 474 330 51 ------
NM_139131chr111622 --142 --
NM_139207chr1252049 1603 1536 284 190 ------
NM_139241chr121178 ------
NM_139244chr62150 129 ------
NM_139321chr2073720 3618 3497 577 278 267 55 ------
NM_144567chr172437 2429 2004 1028 627 578 494 --12813 --
NM_144571chr4117032 6429 6233 5480 4421 2803 2031 1179 1125 359 87 14367 25431 483 --
NM_144574chr143602 430 223 1127 ----
NM_144583chr221749 1296 --21364 639 --
NM_144599chr1584914 4496 3359 1595 1514 1500 1323 922 15446 ----
NM_144664chr1121924 332 ------
NM_144665chr11----167 --
NM_144710chr221478 177 11240 2962 601 --
NM_144721chr452578 2537 2518 1788 484 --12452 1314
NM_144728chr11244 --1295 --
NM_144729chr11244 --1295 --
NM_144775chr1793943 3294 1678 1583 1535 970 769 340 301 --24625 838 14879
NM_144778chr1321745 158 22613 2236 ----
NM_144949chr242414 1615 868 643 11651 ----
NM_144967chrX1809 ------
NM_144973chr1294870 4500 3329 1984 1174 1167 874 452 359 13870 34587 2143 1430 --
NM_144979chr4--1144 ----
NM_145000chr51415 ------
NM_145011chr1031746 1679 296 11501 1231 1271
NM_145055chr1833537 3065 173 --13492 --
NM_145117chr1173103 2714 2658 2078 1138 482 89 ----12755
NM_145176chr683553 3152 2880 2750 2590 1318 843 358 --32169 793 342 --
NM_145185chr1951867 1648 1552 1403 767 ----11515
NM_145234chrX3727 602 80 --1948 --
NM_145244chr421512 1332 --170 --
NM_145247chr10----2468 454 --
NM_145251chr1411296 ------
NM_145259chr276568 6231 5851 4940 1837 698 306 --15322 16936
NM_145274chr171688 ------
NM_145305chrX2137 97 --21000 868 --
NM_145307chr1054176 3481 1302 1046 857 --44053 3868 3698 125 --
NM_145320chr743277 2739 2624 430 12680 ----
NM_145321chr743277 2739 2624 430 12680 ----
NM_145322chr743277 2739 2624 430 12680 ----
NM_145332chr61120 ------
NM_145333chr61120 ------
NM_145341chr1031341 496 249 ------
NM_145735chr1342395 2366 961 892 --22690 2502 12577
NM_145739chr2179 ------
NM_145753chr31674 ----164
NM_145800chrX1946 ------
NM_145808chr732489 2359 365 1834 11006 --
NM_145891chr164577 397 365 348 1297 ----
NM_145892chr164577 397 365 348 1297 ----
NM_145893chr165699 519 487 470 40 1419 ----
NM_147150chr943022 2812 2693 1075 1497 13166 13523
NM_147156chr1011040 --21100 417 --
NM_147175chrX41954 1801 1595 244 ------
NM_147181chr431203 898 290 --1955 --
NM_147182chr431203 898 290 --1955 --
NM_147183chr431203 898 290 --1955 --
NM_147189chr862323 2177 940 569 397 222 ------
NM_147223chr251997 1585 480 447 284 12003 11778 11730
NM_147233chr251814 1402 297 264 101 11820 11595 11547
NM_148170chr1144503 1096 786 37 13973 1944 --
NM_148174chr821722 134 ------
NM_148955chr15116343 6272 5038 4934 4861 4745 4057 4024 2133 1455 1107 16364 26597 937 11168
NM_148977chr10192 --2967 98 --
NM_148978chr10192 --2967 98 --
NM_152261chr1242349 2115 463 81 --11743 1401
NM_152263chr1125940 5850 5836 5279 5125 4877 4519 4009 2418 1976 317 278 --25238 541 11770
NM_152265chr121445 50 ----11043
NM_152271chr811179 ----1398
NM_152283chr541126 961 948 940 ------
NM_152305chr362210 1992 709 625 537 111 ------
NM_152330chr141556 --11976 161
NM_152332chr1431991 1922 589 --12080 --
NM_152388chr263297 2990 2706 1393 1371 990 --23551 1357 1322
NM_152407chr552840 2539 2107 1248 513 1121 --12501
NM_152409chr552716 2646 2304 1123 1063 1838 ----
NM_152414chr821629 519 --11385 --
NM_152422chr941451 1267 447 184 ----11229
NM_152424chrX63459 3170 3133 3043 1760 1690 --1659 --
NM_152437chr1242392 1977 1891 295 --2635 351 --
NM_152446chr14--1718 ----
NM_152470chr1862779 2563 623 467 403 89 2928 57 ----
NM_152510chr222359 292 ------
NM_152529chr234407 3005 256 --13924 13652
NM_152542chr462159 623 396 307 203 108 ------
NM_152556chr722256 1619 --1499 --
NM_152588chr1251483 371 327 300 195 11413 ----
NM_152608chr131603 761 99 12310 --1959
NM_152613chr222414 61 ----11257
NM_152622chr562457 1234 863 644 357 57 --11215 --
NM_152624chr514931 34582 1730 1175 12345 --
NM_152629chr953270 3115 1340 987 451 21372 720 11314 --
NM_152636chr1173089 2837 2442 2352 1073 799 463 --12078 --
NM_152638chr1231283 227 131 1827 1463 --
NM_152641chr1262906 2830 823 559 507 38 ------
NM_152666chr1----1849 --
NM_152678chr341794 1774 819 283 --11911 12049
NM_152692chrX1144 ------
NM_152704chr134699 388 366 312 ------
NM_152721chr181741 ------
NM_152723chr112343 129 --1166 --
NM_152729chr621188 1165 --11657 --
NM_152733chr6136268 6126 6065 5775 5359 5038 5002 4180 2539 1921 1876 1563 1385 24415 1886 25797 372 1311
NM_152736chr64912 318 161 71 ------
NM_152744chr7103471 3302 2967 2881 2701 2242 1289 1154 746 635 --12749 --
NM_152756chr533423 1263 267 21416 963 ----
NM_152758chr82431 68 --22757 2479 --
NM_152787chrX33946 2881 275 --33691 1339 790 --
NM_152793chr7104890 4596 4076 3254 2077 1833 1405 974 687 491 --21544 765 21619 874
NM_152826chr15116343 6272 5038 4934 4861 4745 4057 4024 2133 1455 1107 16364 26597 937 11168
NM_152835chr141995 757 530 91 21874 766 12817 --
NM_152862chr2--1343 ----
NM_152878chr2261605 1355 1220 1191 621 387 ------
NM_152903chr1352416 1897 1791 1756 1005 21770 909 ----
NM_152919chr1993556 3336 3031 2374 1264 1207 598 485 63 23476 3385 --23837 281
NM_152924chr15114461 4331 4298 4266 2393 2165 1638 546 497 443 286 12040 12687 15264
NM_152989chr1241845 1759 1353 1218 11498 21540 234 --
NM_152996chr141839 1738 359 267 11467 1574 --
NM_152999chr734527 1213 1119 11107 24611 3538 --
NM_153000chr181155 ------
NM_153013chr521935 720 ----12075
NM_153029chr16103127 1591 1556 1462 1005 913 844 728 591 322 13797 ----
NM_153040chr154679 547 148 46 ------
NM_153042chr621391 369 --31704 406 281 --
NM_153184chr31635 11670 176 1368
NM_153188chr584987 4865 3476 2026 1843 1546 835 561 --13564 11900
NM_153207chr1213140 ----2993 460
NM_153208chr161736 ------
NM_153223chr551369 1031 598 523 351 ------
NM_153261chr1611068 ----170
NM_153262chr13807 702 304 ----22035 482
NM_153267chr93668 597 284 ------
NM_153332chr842896 1997 1305 857 12012 ----
NM_153367chr1063523 1284 1140 453 201 27 --13540 23216 3062
NM_153426chr4------1122
NM_153427chr4------1122
NM_153437chr9169 ------
NM_153456chr13135447 5095 2112 1984 1878 1556 1541 1247 1092 359 266 256 84 25666 2071 2652 244 12166
NM_153605chr351568 1524 1012 630 87 ----1436
NM_153607chr511163 1481 11228 21973 1958
NM_153616chr1532414 1927 243 ------
NM_153617chr1532414 1927 243 ------
NM_153618chr1532414 1927 243 ------
NM_153619chr1553652 3165 410 388 135 --52468 703 606 479 379 --
NM_153633chr122634 589 --3520 500 277 --
NM_153634chr12--1480 ----
NM_153640chr20----1138 --
NM_153686chr442159 1961 956 331 ----11941
NM_153693chr121152 ------
NM_153695chr92264 75 ------
NM_153706chr52176 40 ------
NM_153715chr7------1229
NM_153756chr181936 1717 1709 1331 1255 751 304 279 --11725 --
NM_153810chr1085028 3918 3910 3818 3665 3288 3220 1490 --24795 4785 24933 1139
NM_153828chr23662 626 139 ------
NM_153836chr271956 1777 1610 856 655 646 72 ------
NM_170606chr71713 --1687 --
NM_170665chr12134391 3625 3414 3264 2918 1781 1712 1678 1585 1574 1411 463 313 1996 24142 1265 --
NM_170674chr1531435 939 203 --1186 --
NM_170675chr1511111 ------
NM_170676chr1511111 ------
NM_170677chr1531435 939 203 --1186 --
NM_170686chr772584 2149 2053 1071 909 801 487 --12473 --
NM_170695chr182183 158 ------
NM_170706chr164344 3489 1479 933 660 177 11600 11046 --
NM_170721chr1721240 321 1533 1351 --
NM_170768chr1151699 1666 1399 1374 547 ----1299
NM_170774chr2063576 1192 391 344 158 67 14175 1126 --
NM_171825chr552869 2666 2112 1130 473 --1170 --
NM_171998chrX31002 301 213 --22354 369 11598
NM_172037chr821469 594 ------
NM_172070chr232181 1474 316 ------
NM_172071chr177236 6438 5794 5139 5012 2703 1000 25287 1793 11123 --
NM_172130chr1111626 1617 1530 1423 1277 730 631 359 353 321 78 ------
NM_172193chr1411357 --1425 --
NM_172201chr212282 23 ------
NM_172315chr1531435 939 203 --1186 --
NM_172316chr1531435 939 203 --1186 --
NM_172375chr141359 ------
NM_173054chr7----1378 1985
NM_173198chr982850 2542 2313 1912 963 826 689 174 --22675 786 --
NM_173200chr982850 2542 2313 1912 963 826 689 174 --22675 786 --
NM_173207chr182183 158 ------
NM_173208chr182183 158 ------
NM_173209chr182183 158 ------
NM_173210chr182183 158 ------
NM_173211chr182183 158 ------
NM_173214chr1688187 6978 5838 3316 2947 2366 2220 1473 1698 37761 7585 6960 11963
NM_173355chr22698 312 ----168
NM_173463chr494261 4189 3949 2994 1158 870 733 562 187 1211 34423 3755 2947 --
NM_173468chr446108 4660 3750 182 1847 14706 1510
NM_173511chr253666 3471 3092 864 856 --1876 --
NM_173545chr231674 1660 458 ----1305
NM_173546chr32550 51 ------
NM_173552chr331700 614 402 --1288 --
NM_173557chr182559 545 --1756 --
NM_173560chr62435 129 ------
NM_173576chr1021921 638 --1304 --
NM_173582chr1176009 5321 4463 2372 1656 1529 1226 14197 22484 2410 14527
NM_173595chr1285292 4702 4498 3601 3226 1968 1301 1098 ------
NM_173609chr151502 1131 2524 84 --
NM_173642chr1126257 5722 3415 2982 2911 2701 2486 2294 1262 993 881 857 --21771 1385 --
NM_173644chr2031839 1407 195 --12031 --
NM_173645chr22471 149 ------
NM_173653chr361386 985 957 451 223 62 ----11096
NM_173794chrX------179
NM_173797chr541073 946 505 445 ------
NM_173808chr194274 4106 3349 3317 3160 1295 989 748 308 --34400 1566 1551 13221
NM_173812chr1211147 11252 1969 --
NM_173822chr241933 1572 1343 727 12128 ----
NM_173825chr31841 1866 --12855
NM_173829chr5145940 4757 4648 4544 4415 4098 2435 2113 1730 1658 1613 1132 230 213 15476 122 --
NM_173833chr841490 1038 583 553 11296 11044 --
NM_173848chr81370 --1327 --
NM_173851chr853856 2810 995 432 38 11090 --13346
NM_174886chr182183 158 ------
NM_174890chr102727 534 ------
NM_174921chr431100 921 745 ----1840
NM_174938chr9------1348
NM_175061chr731900 1811 665 11890 ----
NM_175607chr3------11462
NM_175612chr3------11462
NM_175624chr1242861 2743 2719 2447 --37566 6602 5038 --
NM_175625chr1242861 2743 2719 2447 --37566 6602 5038 --
NM_175634chr81410 ------
NM_175635chr81410 ------
NM_175636chr81410 ------
NM_175736chr12137610 7570 7485 7091 5885 5208 5011 4925 4764 3067 1582 1152 931 --27316 2121 --
NM_175767chr541838 1735 1144 197 ------
NM_175854chr1322062 186 ------
NM_175856chr51221 ------
NM_175907chr1862781 2240 2191 943 445 249 1451 1996 --
NM_175920chr54668 658 88 77 ------
NM_176071chr115918 868 823 336 195 --1940 --
NM_176072chr115918 868 823 336 195 --1940 --
NM_176812chr20--1688 ----
NM_177402chr13837 789 56 ------
NM_177414chr12592 408 11480 11391 --
NM_177452chr1442199 2173 1853 810 1288 12228 11700
NM_177972chr1173947 3826 3777 3483 3220 1763 462 --21037 958 13244
NM_177974chr1562048 1477 869 840 717 226 1802 ----
NM_177990chr2051390 1347 754 499 29 --21428 231 --
NM_177995chr941451 1267 447 184 ----11229
NM_177996chr2082802 2473 2129 2120 850 526 380 43 --12942 --
NM_177999chr9123559 3366 3056 1309 1150 1104 692 465 445 410 253 24 12776 --12909
NM_178006chr1341736 862 732 42 --1715 --
NM_178007chr1341736 862 732 42 --1715 --
NM_178010chr1241845 1759 1353 1218 11498 21540 234 --
NM_178011chr1053310 2499 1229 967 302 --12126 --
NM_178013chr1462630 2204 860 834 768 326 12772 23018 471 --
NM_178135chr441336 1178 389 305 ------
NM_178140chr562452 2280 1991 1882 909 776 --32466 2315 2201 1727
NM_178151chrX147218 7070 6748 6610 6418 5405 5204 3052 2921 2667 2450 2146 1578 1155 ------
NM_178152chrX147218 7070 6748 6610 6418 5405 5204 3052 2921 2667 2450 2146 1578 1155 ------
NM_178153chrX147218 7070 6748 6610 6418 5405 5204 3052 2921 2667 2450 2146 1578 1155 ------
NM_178423chr72475 392 --21115 350 --
NM_178424chr51564 ------
NM_178425chr72475 392 --21115 350 --
NM_178450chr5----1739 1567
NM_178454chr12627 242 1741 1157 1822
NM_178498chr1163690 2615 2605 1178 590 581 11220 13299 --
NM_178527chr12434 129 ------
NM_178539chr1241598 1326 256 175 ------
NM_178565chr851706 1567 1212 1122 58 ----1616
NM_178566chr921809 89 ------
NM_178584chr221478 177 11240 2962 601 --
NM_178586chr1441537 920 274 256 ----1638
NM_178812chr821451 1211 --21300 529 --
NM_178815chr1032225 944 587 --22554 1698 --
NM_178826chr124701 586 540 26 1553 1715 --
NM_178831chr7102698 2658 2435 2420 2362 2122 1095 929 738 194 12510 ----
NM_178832chr1071633 1287 483 477 255 204 41 ------
NM_180989chr1321649 900 --12002 1848
NM_181302chr143602 430 223 1127 ----
NM_181308chr143602 430 223 1127 ----
NM_181332chrX32174 2007 157 1794 12185 --
NM_181354chr831368 1243 1141 ------
NM_181358chr134049 3518 1040 --1863 --
NM_181361chr32954 401 --11010 --
NM_181443chr2032063 1154 863 --1643 1921
NM_181457chr22444 26 ------
NM_181459chr21343 ------
NM_181460chr21390 ------
NM_181481chr18106814 6299 5657 4889 4588 4326 2784 1816 1437 359 14754 36830 1329 769 --
NM_181482chr18106814 6299 5657 4889 4588 4326 2784 1816 1437 359 14754 36830 1329 769 --
NM_181483chr18106814 6299 5657 4889 4588 4326 2784 1816 1437 359 14754 36830 1329 769 --
NM_181489chr3186706 6183 6050 5852 5593 5411 5231 5000 4738 4441 2706 2136 2076 1090 1057 953 415 119 35192 2057 1104 15155 --
NM_181504chr564149 3966 3621 2884 2877 257 --1111 --
NM_181505chr171224 ------
NM_181523chr564149 3966 3621 2884 2877 257 --1111 --
NM_181524chr564149 3966 3621 2884 2877 257 --1111 --
NM_181537chr172191 54 ------
NM_181571chr101767 1166 ----
NM_181671chr174678 252 45 33 --1291 1872
NM_181672chrX41822 1351 598 461 ------
NM_181673chrX41822 1351 598 461 ------
NM_181705chr585541 5391 4614 4181 3815 3579 1354 316 15753 --35525 3726 3527
NM_181706chr1182164 2124 2082 1850 1606 1482 906 446 --157 --
NM_181712chr172043 806 659 474 190 96 88 --11709 --
NM_181723chr82660 548 --1736 --
NM_181784chr242607 2218 605 295 --12412 --
NM_181832chr2293694 3350 3126 2573 2377 847 567 464 154 --1429 --
NM_181837chr6--163 1253 --
NM_181838chr541558 1527 577 236 --11540 --
NM_181839chr821246 943 ------
NM_181861chr1252404 2321 1755 1019 852 --12047 --
NM_181868chr1252404 2321 1755 1019 852 --12047 --
NM_181869chr1252489 2406 1840 1104 937 --12132 --
NM_181876chr452459 1991 485 180 94 11771 146 --
NM_181886chr421428 1359 --11041 --
NM_181887chr421428 1359 --11041 --
NM_181888chr421428 1359 --11041 --
NM_181889chr421428 1359 --11041 --
NM_181890chr421428 1359 --11041 --
NM_181891chr421428 1359 --11041 --
NM_181892chr431475 1406 63 --11088 --
NM_181893chr421428 1359 --11041 --
NM_182485chr441289 963 561 118 --13517 --
NM_182487chr974272 4232 3835 3297 3259 2824 2751 13282 ----
NM_182511chr1841230 1219 1127 283 ----11460
NM_182557chr1162099 2059 1625 1373 644 326 ----11482
NM_182646chr441289 963 561 118 --13517 --
NM_182663chr151856 1776 868 807 561 12017 11986 --
NM_182664chr141986 1906 937 691 12147 12116 --
NM_182665chr151856 1776 868 807 561 12017 11986 --
NM_182691chr731380 1265 543 ------
NM_182692chr731380 1265 543 ------
NM_182701chr6--1877 ----
NM_182718chr101767 1166 ----
NM_182719chr101767 1166 ----
NM_182724chr101767 1166 ----
NM_182725chr101767 1166 ----
NM_182729chr122719 253 --1447 --
NM_182734chr2083005 2895 2859 2532 2506 1276 804 724 --2912 102 1621
NM_182742chr122719 253 --1447 --
NM_182743chr122719 253 --1447 --
NM_182756chr22496 237 ----1155
NM_182763chr142180 2143 1956 1739 12121 1242 1338
NM_182764chr2051235 952 917 192 131 ----11119
NM_182765chr1032115 1919 1482 22268 434 ----
NM_182769chr101767 1166 ----
NM_182770chr101767 1166 ----
NM_182771chr101767 1166 ----
NM_182772chr101767 1166 ----
NM_182830chr1421809 640 1331 1358 --
NM_182850chr101767 1166 ----
NM_182898chr775669 5532 5147 5077 4930 1606 290 15132 55696 5501 4541 1731 1430 15028
NM_182899chr775669 5532 5147 5077 4930 1606 290 15132 55696 5501 4541 1731 1430 15028
NM_182907chr641854 1573 863 471 1336 11579 1194
NM_182944chr14192 ------
NM_182948chr132517 2223 995 --12058 --
NM_182964chr1173103 2714 2658 2078 1138 482 89 ----12755
NM_182970chr20103729 2857 2780 2675 1497 969 723 489 384 362 13310 ----
NM_182972chr152407 2027 1759 447 368 ------
NM_182975chr11808 ----11127
NM_183004chr1493300 2955 2830 2652 2387 1150 1131 729 89 ------
NM_183060chr101767 1166 ----
NM_183075chr432532 1838 190 12210 --11968
NM_183227chr6----11485 --
NM_183238chr1263422 1284 1134 953 831 290 --1194 1632
NM_183353chrX4801 191 120 23 ----1428
NM_183380chr61194 --1741 --
NM_183381chr31902 ------
NM_183383chr31902 ------
NM_183384chr31902 ------
NM_183393chr32944 140 ------
NM_183394chr32944 140 ------
NM_183398chr52514 211 --11044 --
NM_183399chr52514 211 --11044 --
NM_183400chr52514 211 --11044 --
NM_183401chr52514 211 --11044 --
NM_194071chr774328 3797 3699 3675 3508 2172 800 15210 13769 --
NM_194247chr233302 2950 224 12932 ----
NM_194282chr442942 2300 1224 359 ------
NM_194285chr1143090 2622 1239 270 ----11158
NM_194286chr12146165 6135 5876 5166 5077 4614 4477 4284 2298 1960 1824 1072 772 739 15476 35955 5582 5145 --
NM_194314chr164167 1987 1272 1223 625 596 ------
NM_194317chr272639 2537 2525 685 537 176 71 1859 12659 --
NM_194454chr761277 1249 313 266 157 26 11342 1502 --
NM_194455chr761277 1249 313 266 157 26 11342 1502 --
NM_194456chr761277 1249 313 266 157 26 11342 1502 --
NM_194463chrX21061 270 ------
NM_197941chr552408 2268 1997 1920 66 1639 12230 1450
NM_197968chr13149 ------
NM_197972chr1123 ------
NM_198098chr721424 108 11306 ----
NM_198123chr81726 1384 ----
NM_198124chr81726 1384 ----
NM_198128chr184881 416 116 69 --12288 11613
NM_198182chr231316 386 89 ------
NM_198215chr101980 1205 11310 --
NM_198225chr1072040 2022 1363 1299 593 429 411 21816 1540 ----
NM_198240chr121982 ----11199
NM_198268chr134049 3518 1040 --1863 --
NM_198269chr134049 3518 1040 --1863 --
NM_198390chr161358 ------
NM_198395chr52478 318 21156 27 ----
NM_198400chr1562067 1874 977 781 512 242 ------
NM_198401chr831221 431 305 1585 11280 --
NM_198465chrX21976 549 --11163 1433
NM_198503chr142329 2083 1583 225 --1546 --
NM_198507chr52464 78 1377 ----
NM_198513chr821584 108 2684 439 ----
NM_198569chr632669 2174 1798 22368 1036 1243 --
NM_198571chr7----11210 --
NM_198595chr494727 4503 3595 3504 3100 1757 1335 436 138 --21726 306 24735 4344
NM_198793chr363775 2736 1038 1030 875 826 --23986 3635 --
NM_198798chr202671 83 ------
NM_198859chr394996 4672 4548 3871 3453 1663 708 237 52 14477 15028 --
NM_198896chr1151563 1363 616 214 181 ------
NM_198900chr12137610 7570 7485 7091 5885 5208 5011 4925 4764 3067 1582 1152 931 --27316 2121 --
NM_198902chr151262 ------
NM_198904chr521998 1498 --21768 1757 --
NM_198968chr1373620 3600 3402 1340 860 727 32 23387 2997 --1258
NM_198990chr762610 2465 2055 1095 632 531 ------
NM_198995chr18150 ------
NM_199040chr1243777 3462 1515 194 --1201 --
NM_199050chr2153148 1432 1261 847 26 2856 617 1596 --
NM_199132chr1921742 1336 --1492 2604 54
NM_199138chr134699 388 366 312 ------
NM_199181chr20148 ------
NM_199188chr1233942 3556 556 --11291 11459
NM_199190chr1233942 3556 556 --11291 11459
NM_199246chr51216 --192 --
NM_199320chr45931 851 834 813 149 12410 --12040
NM_199320chr45931 851 834 813 149 12410 --12040
NM_199324chr423271 3001 1484 ----
NM_199328chr211142 --2161 35 --
NM_199334chr171519 ------
NM_199355chr1661760 1550 1176 1167 500 481 --11474 --
NM_199421chr1484904 4831 4520 4124 3910 3843 3449 583 11445 24950 3456 --
NM_199436chr272910 2740 2488 2330 1990 1983 868 ------
NM_199440chr2186 ------
NM_199454chr184699 3404 3027 2944 1828 1148 681 240 13648 24013 3795 --
NM_199461chr1043379 3169 1058 541 ----1763
NM_199478chrX41422 1415 268 199 ------
NM_201428chr1141397 1134 373 247 --1402 --
NM_201429chr1141397 1134 373 247 --1402 --
NM_201430chr1141323 1060 299 173 --1328 --
NM_201434chr172218 166 ------
NM_201595chr141132 ------
NM_201613chr12----1822 --
NM_201999chr421169 83 --171 --
NM_203327chr2083618 1817 1081 657 582 350 299 238 --14560 --
NM_203342chr193442 2874 2721 2670 1107 496 409 403 73 --13325 12363
NM_203343chr193442 2874 2721 2670 1107 496 409 403 73 --13325 12363
NM_203349chr154749 735 597 282 ----1263
NM_203350chr11417 1258 --1186
NM_203351chr1782485 2408 2316 2031 997 631 479 281 12441 ----
NM_203364chr1111146 --11025 1427
NM_203391chrX31741 1199 117 ------
NM_203399chr12228 107 --1852 --
NM_203401chr12228 107 --1852 --
NM_203406chr592954 2445 1824 991 922 834 652 191 140 --12051 11091
NM_203446chr2162971 2785 582 576 346 109 11055 1902 --
NM_203453chr951717 1566 741 172 77 1189 ----
NM_203458chr153452 2594 1355 943 237 1894 1957 --
NM_203459chr132457 2446 837 ------
NM_203487chr132509 184 --1546 --
NM_203488chr14----1171 --
NM_205768chr12241 195 ------
NM_205860chr113072 ----11214
NM_205861chr152096 2033 1539 630 138 21668 153 ----
NM_205864chr6156 ------
NM_206594chr162802 1436 1405 1081 821 577 23071 2437 ----
NM_206595chr162802 1436 1405 1081 821 577 23071 2437 ----
NM_206839chr151611 --1469 --
NM_206854chr655368 5299 4282 4192 3438 --1294 --
NM_206855chr686333 6264 5247 5157 4403 943 616 478 1739 11259 --
NM_206866chr2131279 585 142 12360 11318 13040
NM_206876chr243505 2925 2660 87 12276 ----
NM_206907chr542540 1055 774 52 ----1830
NM_206909chr8128197 6383 6035 5920 5487 5107 2874 2539 2425 2045 1305 698 --26019 1636 --
NM_206915chrX1225 ------
NM_206917chrX1225 ------
NM_206944chr91757 1621 1304 --
NM_206945chr91757 1621 1304 --
NM_206946chr91757 1621 1304 --
NM_206947chr91757 1621 1304 --
NM_207009chr103893 675 359 ------
NM_207012chr1072909 2219 1257 985 543 413 176 11100 2919 356 11094
NM_207015chr332124 1906 374 1608 21992 123 --
NM_207043chr142234 1963 1733 1447 --1767 --
NM_207044chr142234 1963 1733 1447 --1767 --
NM_207047chr142234 1963 1733 1447 --1767 --
NM_207174chr212731 524 ----1754
NM_207299chr91120 ------
NM_207303chr1034142 3212 206 --13963 --
NM_207304chr1321632 45 22500 2123 ----
NM_207317chr51359 ------
NM_207325chr1932030 1612 382 ------
NM_207337chr1241166 881 353 228 ------
NM_207362chr2145 2513 179 ----
NM_207404chr392268 2260 2210 2147 1947 1860 1628 1512 374 --11846 --
NM_207405chr4112207 2056 1553 881 733 605 513 420 385 320 25 ------
NM_207411chr883485 2724 2588 2399 1092 1052 894 187 ------
NM_207481chr2153 ------
NM_207520chr23662 626 139 ------
NM_207521chr23662 626 139 ------
NM_207627chr212731 524 ----1754
NM_207628chr212731 524 ----1754
NM_207629chr212731 524 ----1754
NM_207645chr111375 ------
NM_212467chr1522273 97 1140 42214 2167 460 376 --
NM_212471chr1721664 611 1404 12128 --
NM_212472chr1721664 611 1404 12128 --
NM_212558chr973120 2705 2670 1534 651 236 149 ------
NM_213589chr224176 1542 1124 --15360