TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-136-3p
miRNA Sequence: CAUCAUCGUCUCAAAUGAGUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001001419chr584811 4355 3976 3791 3695 2083 334 154 14462 11640 --
NM_001001420chr584811 4355 3976 3791 3695 2083 334 154 14462 11640 --
NM_001013620chr1297025 6330 6175 5726 2377 1398 1345 1087 638 27623 483 17148 --
NM_003108chr284728 2214 2035 573 202 116 94 74 31243 159 87 ----
NM_005359chr1886266 5884 2039 1912 1384 731 584 40 34153 1674 1563 ----
NM_005903chr584811 4355 3976 3791 3695 2083 334 154 14462 11640 --
NM_007038chr2174559 3736 3700 2252 1335 1325 256 35730 2398 1453 ----
NM_007249chr1399185 9124 8641 8401 7106 3572 3514 1909 572 37110 2632 1957 ----
NM_173808chr184061 3929 1582 1525 1394 1005 826 121 ------