TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-136-5p
miRNA Sequence: ACUCCAUUUGUUUUGAUGAUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000314chr1072947 2372 2249 2217 848 829 62 --22780 510 1311
NM_000555chrX106775 6405 6131 5953 5109 2345 1750 1631 466 284 --12227 1566
NM_000793chr1474064 3674 3118 1870 1757 1616 421 2670 248 14034 23867 3130
NM_000926chr11119193 8007 7486 6630 6141 3584 3140 2508 2190 1559 745 66775 6606 6315 6271 5776 3017 ----
NM_001003652chr18128280 7924 7843 7746 6867 5864 5693 3371 3113 1525 1139 589 28349 859 22603 2438 --
NM_001003674chr18106287 5654 5277 5157 5033 4462 2376 1733 835 244 11699 22150 1483 1526
NM_001003675chr18106287 5654 5277 5157 5033 4462 2376 1733 835 244 11699 22150 1483 1526
NM_001004419chr12114540 1614 1339 1178 920 877 599 587 484 383 44 21828 1772 23908 1417 13620
NM_001007023chr1474064 3674 3118 1870 1757 1616 421 2670 248 14034 23867 3130
NM_001017440chr7116632 6301 6083 5918 3197 3071 1804 1464 1125 120 107 57741 7501 2704 1135 998 --1525
NM_001025079chr343157 687 512 280 1589 13619 23173 1057
NM_001025252chr852454 2398 2136 1989 647 --11968 22033 256
NM_001025253chr852454 2398 2136 1989 647 --11968 22033 256
NM_001031804chr1643124 1246 1048 258 14386 --23706 2986
NM_001039618chr11105746 5398 3615 2391 2114 1713 1579 1357 647 346 --1834 --
NM_001040152chr7124947 4728 4216 3916 3508 3306 1862 1571 656 518 397 182 --1759 14455
NM_001106chr3119574 8966 8115 6819 3578 3312 1087 986 765 719 35 15980 23285 1961 28941 6585
NM_001777chr343157 687 512 280 1589 13619 23173 1057
NM_001918chr1199138 7640 7515 7287 7089 6918 6607 5744 3709 3688 3526 3406 3342 2898 1835 1446 936 693 508 27632 7550 --19254
NM_002025chrX128578 8144 7470 7211 6425 6120 3709 3322 2786 2751 2504 323 25628 2654 17253 --
NM_002270chr564028 3721 1455 503 426 262 35168 4534 334 1732 11804
NM_003583chr1273809 3294 2896 2744 655 649 641 ------
NM_003671chr973598 2473 2290 2261 1265 827 369 12411 11163 23173 135
NM_003953chr132803 589 453 2786 441 --21831 342
NM_004338chr18106287 5654 5277 5157 5033 4462 2376 1733 835 244 11699 22150 1483 1526
NM_004748chr1593219 2806 1658 1570 1517 1181 807 144 114 11076 --13015
NM_004956chr754343 621 287 243 235 24503 4045 23394 1847 11583
NM_005079chr852454 2398 2136 1989 647 --11968 22033 256
NM_005197chr1476021 5668 4329 4165 1950 1922 1096 2886 704 32249 1159 714 --
NM_005233chr392579 2265 1668 1627 944 766 341 239 148 ------
NM_005504chr12106394 6033 4950 4607 4515 4122 2472 1795 1357 24 --25290 4941 11489
NM_005828chr1763497 3168 1419 1191 1163 1155 24913 2034 14954 14651
NM_005840chrX117324 6655 6316 6094 5623 5290 1758 1491 1127 777 312 36400 5904 1982 27470 6009 --
NM_005901chr18128280 7924 7843 7746 6867 5864 5693 3371 3113 1525 1139 589 28349 859 22603 2438 --
NM_006482chr1273809 3294 2896 2744 655 649 641 ------
NM_006546chr17106594 6293 5531 4918 4899 4815 2543 1543 1362 983 34407 2607 1885 25378 2081 1644
NM_007050chr20167053 7011 6513 6323 5872 2913 2545 2453 2276 1966 1944 1752 1598 1552 1202 587 13221 22333 397 --
NM_007137chrX115426 5003 4749 4605 4130 4073 1413 1231 963 827 144 24142 3444 14760 11822
NM_007249chr13128038 7701 7598 7328 7126 6170 2860 2614 2573 1308 1279 978 26095 517 27083 5962 --
NM_007347chr1562832 2761 2613 1041 903 382 11147 --22666 104
NM_012164chr997399 7187 6175 5645 4620 3010 2951 2867 1586 16876 2292 211 --
NM_013255chr798522 8196 8156 6961 5887 3228 1518 1155 28 48854 8426 7916 1819 12191 --
NM_013269chr12104467 1541 1266 1105 847 804 526 514 411 310 31788 1755 1699 23835 1344 13547
NM_013989chr1474064 3674 3118 1870 1757 1616 421 2670 248 14034 23867 3130
NM_014141chr7114274 4165 3464 2132 1915 1698 1610 1052 457 144 134 11252 --34816 1367 873
NM_014982chr1445411 5350 5187 5133 14839 45012 4796 4475 4167 14118
NM_015035chr20156683 6481 6441 5479 5239 4559 4433 4213 4202 919 903 889 682 262 207 12269 --14663
NM_015886chr875145 3659 3554 1222 1151 1096 890 21138 68 --11943
NM_016009chr134762 4404 3011 23455 1242 34113 3028 1903 23193 3017
NM_016206chr3108979 8278 7408 6603 6324 5919 3461 2826 2033 902 18025 16621 --
NM_017637chr999398 8838 6502 6388 5852 3404 3241 3219 2287 16909 21859 1496 28594 7639
NM_017813chr8105374 5279 4380 3938 3593 1910 1870 1850 462 180 182 15144 --
NM_020673chr20117052 5491 5224 5059 1922 1639 903 789 516 496 136 32689 2160 385 ----
NM_020714chr1994472 3846 3679 3191 3126 2870 552 248 215 12890 34320 2900 171 21649 1403
NM_020739chr1593219 2806 1658 1570 1517 1181 807 144 114 11076 --13015
NM_021116chr7139004 8441 7758 7183 7129 6882 6201 6153 1295 1232 989 125 35 27090 1185 13057 28736 7499
NM_021964chr395354 5190 4906 4890 4659 4068 2616 2044 1150 12150 178 36324 2574 2178
NM_022166chr16146257 5652 5401 4833 4282 4000 3956 2518 2006 1199 905 655 136 111 23855 1420 21554 372 14227
NM_024569chr132880 666 530 2863 518 --21908 419
NM_031468chr7116632 6301 6083 5918 3197 3071 1804 1464 1125 120 107 57741 7501 2704 1135 998 --1525
NM_031911chr442071 788 671 74 12033 --32780 2555 917
NM_032291chr12464 308 ----21870 42
NM_033224chr7116187 4943 1944 1599 1500 1346 1293 1102 929 882 727 --18047 193
NM_033331chr973598 2473 2290 2261 1265 827 369 12411 11163 23173 135
NM_053016chr9126803 6099 6031 5927 5794 2777 2567 2493 1981 1802 499 277 27363 3085 --27413 2684
NM_133170chr20167053 7011 6513 6323 5872 2913 2545 2453 2276 1966 1944 1752 1598 1552 1202 587 13221 22333 397 --
NM_145259chr286710 6049 4650 1997 1841 1300 871 533 --34771 2791 521 --
NM_152622chr573175 2785 2121 814 574 444 435 --13248 --
NM_153188chr564028 3721 1455 503 426 262 35168 4534 334 1732 11804
NM_173468chr495710 4722 4160 4143 4037 3968 3947 315 48 35784 949 917 11171 --
NM_173642chr1127853 7412 6745 6648 6499 6346 3345 2897 2476 1213 830 369 28627 3476 --38368 2335 1889
NM_178151chrX106775 6405 6131 5953 5109 2345 1750 1631 466 284 --12227 1566
NM_178152chrX106775 6405 6131 5953 5109 2345 1750 1631 466 284 --12227 1566
NM_178153chrX106775 6405 6131 5953 5109 2345 1750 1631 466 284 --12227 1566
NM_181481chr18106287 5654 5277 5157 5033 4462 2376 1733 835 244 11699 22150 1483 1526
NM_181482chr18106287 5654 5277 5157 5033 4462 2376 1733 835 244 11699 22150 1483 1526
NM_181483chr18106287 5654 5277 5157 5033 4462 2376 1733 835 244 11699 22150 1483 1526
NM_194286chr12136071 5234 5033 5023 4980 4740 1797 1732 1651 1108 813 444 303 41941 1530 598 346 45313 5274 4949 3884 --
NM_194291chr842913 2712 1017 537 ----22175 796
NM_198484chr3135967 5865 5811 5781 5040 2393 2074 1849 1369 1226 704 487 243 45496 5245 4870 4541 --1723
NM_198793chr343153 683 508 276 1585 13615 23169 1053
NM_203458chr132356 745 106 1446 13500 23563 2584
NM_203459chr1--1464 --31962 1697 232
NM_207406chr475416 4715 1671 1573 1303 944 385 36172 4053 378 14440 14928