TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-138-1-3p
miRNA Sequence: GCUACUUCACAACACCAGGGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000611chr11107010 4966 4928 1813 1539 1307 591 584 549 392 56497 4676 2660 2652 2344 36674 542 224 15840
NM_001010891chr586857 5395 4594 2624 1984 1466 1391 789 14766 16575 14588
NM_001014797chr10107481 7381 6680 6100 5863 5459 5116 5051 3230 474 67365 6858 6141 5684 2699 262 16087 --
NM_001018067chr1135133 5124 4849 4399 4305 4272 4089 3545 3443 1629 1233 1079 180 --25140 841 --
NM_001018068chr1135133 5124 4849 4399 4305 4272 4089 3545 3443 1629 1233 1079 180 --25140 841 --
NM_001018069chr1135133 5124 4849 4399 4305 4272 4089 3545 3443 1629 1233 1079 180 --25140 841 --
NM_001039937chr1344015 1329 1294 921 23093 1459 --23590 2693
NM_001100108chr1137735 7388 6852 6009 5307 2917 1468 1170 631 318 209 199 122 31861 1356 1130 36680 1331 488 --
NM_001259chr7115709 5554 5419 5330 5084 4786 4736 4702 1661 1349 1018 24810 2430 --14816
NM_002006chr4105800 5514 5377 5093 4556 3856 3814 3688 910 45 15659 ----
NM_002025chrX97949 6693 3019 2870 1030 949 861 754 368 48701 7252 6039 2111 17742 12205
NM_002886chr395007 4463 3615 3167 1838 1769 1608 678 280 --25079 557 13714
NM_003199chr1895517 4688 4439 1776 1294 1136 1059 568 128 1910 11188 13727
NM_003463chr653204 935 469 398 111 23261 865 23092 2591 23008 31
NM_003574chr18115164 5073 4936 3776 3648 2255 1475 1465 1420 1039 431 11999 14924 14462
NM_004171chr11138873 8470 7877 7732 7502 3780 2324 2067 1985 1550 1498 736 469 23209 3160 17851 --
NM_005359chr18116306 5734 4594 4576 4491 4081 3956 2457 1388 1019 735 11221 14912 15280
NM_006544chr1494532 4427 4011 3861 1818 1507 846 831 571 12384 15023 --
NM_007137chrX114998 4644 3383 1983 1467 1249 1005 864 767 741 404 21820 434 34077 4006 3559 24552 1874
NM_007249chr13147781 7653 7574 7320 6718 6578 6533 6129 5841 3498 2839 2371 2347 1139 45961 2614 2458 497 ----
NM_012141chr1344015 1329 1294 921 23093 1459 --23590 2693
NM_012164chr9137344 7264 7088 6778 6721 6534 5908 4631 2989 2783 2332 1725 294 11619 --13010
NM_012214chr2126071 5671 5621 4800 4670 4491 2146 2118 1610 1557 646 472 25111 4141 ----
NM_014106chr1552305 1822 975 695 226 --22955 2855 1144
NM_014155chr11126602 6413 6373 6249 5945 5864 1296 958 739 564 272 185 46128 4827 2789 677 ----
NM_014906chr1793974 3287 3079 2635 1459 1032 1025 553 182 271 60 ----
NM_015092chr1643312 1301 1028 154 23868 521 --23838 1138
NM_015310chr8106691 6181 3076 2234 2059 1652 1470 1108 653 23 --15951 2693 468
NM_015375chr1104479 4112 3845 3551 3208 1841 1751 1597 1229 1164 11728 14301 11740
NM_015564chr543458 2335 145 137 1119 --1506
NM_015569chr1164653 3734 3698 3575 3457 3414 3175 2972 1454 1413 1375 759 520 332 235 85 --23798 574 --
NM_015640chr1135133 5124 4849 4399 4305 4272 4089 3545 3443 1629 1233 1079 180 --25140 841 --
NM_015879chr1888133 7485 7398 7231 5380 5299 2005 264 48091 7381 1373 1081 11332 --
NM_016206chr3118088 8062 7512 6844 6745 5896 2257 2197 1030 623 167 --27849 1952 13155
NM_017447chr2194310 4105 3512 3405 3285 3219 1664 1571 1049 ----11322
NM_017637chr968970 8150 8046 7621 7045 2990 38304 6388 1858 13064 27647 3009
NM_017645chr983034 2479 840 583 488 302 220 94 42800 2612 672 567 --11192
NM_018440chr8148092 7840 7119 6122 5498 3481 3043 2892 2353 1984 1865 1702 175 73 26599 6032 ----
NM_020718chr1655841 4017 2640 2624 2471 36594 5938 2151 1774 24480 689
NM_020772chr17108513 8262 7575 6810 6631 5506 2678 2109 1649 437 68335 7920 7171 1686 1516 113 ----
NM_020844chr8127069 5707 5339 4787 3039 2130 1587 1574 1289 1030 1002 993 21961 1385 27355 5754 --
NM_024665chr384281 4044 3984 3914 3113 1842 1068 511 33578 3483 1734 --1603
NM_024947chr3149381 9328 8759 8453 8176 7426 6257 5997 3309 3083 3027 970 568 429 ----13180
NM_024989chr2107648 6642 6445 6268 5807 5211 2303 2155 1188 397 46986 6091 3162 542 21757 165 --
NM_030579chr1683335 3132 2484 827 775 737 619 76 12600 11311 12536
NM_030806chr1109248 8527 6668 2934 2681 1855 1263 923 696 601 17551 22242 354 22700 553
NM_030816chr143016 2797 2534 1066 23445 2875 --22505 61
NM_032105chr187101 7047 5285 2626 1572 1440 404 133 11000 27317 5680 25864 1230
NM_033083chr393185 2834 2652 1351 1277 629 484 449 377 23160 221 1952 13354
NM_033505chr2115933 5919 5561 4599 4386 4347 4118 2592 2157 1098 27 --24736 410 --
NM_053042chr472760 2732 2532 2354 1960 886 161 22436 2044 12620 12101
NM_139207chr1232210 1748 277 21551 882 12013 21438 888
NM_144571chr4106610 6513 6161 5947 5126 5103 4991 2176 709 80 24401 2069 25366 2568 --
NM_144578chr1464802 2047 1868 1843 203 42 45523 3383 1727 1220 --11421
NM_144599chr1594794 4689 3458 1971 1685 1366 1238 1229 1089 24043 1783 1612 21797 76
NM_145307chr1064012 3149 2835 1501 998 772 ----34638 3967 161
NM_153346chrX51721 1590 823 530 102 41903 1651 679 312 --1161
NM_172071chr176906 6585 5392 4540 2320 1605 1101 17405 37036 2645 368 --
NM_173468chr445443 5096 2192 1750 34982 4160 1647 14183 13947
NM_182762chr754177 3852 1600 633 40 21328 1025 11543 36185 4581 597
NM_194314chr1105607 5601 4524 4503 4228 1839 1662 1619 294 201 15388 24783 3560 --
NM_194434chr18115164 5073 4936 3776 3648 2255 1475 1465 1420 1039 431 11999 14924 14462
NM_198859chr394254 4002 3926 3174 2066 1749 757 532 165 14078 24367 3350 14281
NM_199462chr1104479 4112 3845 3551 3208 1841 1751 1597 1229 1164 11728 14301 11740
NM_203329chr11107010 4966 4928 1813 1539 1307 591 584 549 392 56497 4676 2660 2652 2344 36674 542 224 15840
NM_203330chr11107010 4966 4928 1813 1539 1307 591 584 549 392 56497 4676 2660 2652 2344 36674 542 224 15840
NM_203331chr11107010 4966 4928 1813 1539 1307 591 584 549 392 56497 4676 2660 2652 2344 36674 542 224 15840
NM_206909chr8106691 6181 3076 2234 2059 1652 1470 1108 653 23 --15951 2693 468