TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-138-2-3p
miRNA Sequence: GCUAUUUCACGACACCAGGGUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX43157 2428 2416 2101 33443 3023 519 12396 12761
NM_000084chrX106740 6419 5714 5636 4721 4230 2793 956 833 301 35070 4763 2007 12569 16851
NM_000092chr2104443 4389 3847 3804 3671 3518 3456 1771 1624 757 33482 724 295 ----
NM_000097chr37866 859 389 298 291 283 256 1944 ----
NM_000104chr282802 2234 2011 1961 1067 900 891 32 ----1416
NM_000217chr1294046 3938 3925 3826 3245 1284 732 392 231 65012 3955 965 516 505 113 14867 --
NM_000254chr192597 2541 2518 2219 2150 1971 702 542 50 42192 2143 956 402 22174 442 --
NM_000259chr15126117 5752 5563 5177 5050 1509 775 588 561 508 177 47 15976 14109 35955 4104 1537
NM_000332chr6126573 6016 5808 5696 5170 2508 2290 2281 2270 2126 2041 1983 16965 --14794
NM_000337chr5186351 5499 5307 5298 5002 4884 4489 4369 4034 2221 1749 1620 1538 1397 1035 854 591 487 24575 2249 25845 1646 25514 1856
NM_000351chrX73165 3110 2988 2963 2902 696 525 32631 750 271 11229 1262
NM_000390chrX123429 3261 3077 2510 1127 1099 1067 975 659 501 118 85 43030 1110 1011 484 22427 840 --
NM_000408chr2113353 3234 2945 2532 2330 2210 1149 491 423 389 87 11177 --23367 1042
NM_000411chr2193341 3272 3182 3099 2936 1166 941 904 306 12506 12595 2592 205
NM_000441chr7132143 2115 2031 2003 1507 1486 1450 797 662 641 450 185 35 21756 1422 1598 --
NM_000461chr3133697 3511 2867 1861 1812 1489 1387 1333 1177 1044 1000 553 327 44564 4407 3592 1564 1125 --
NM_000555chrX127426 7386 7243 6466 5777 2855 2435 1727 1403 1254 1146 572 67316 6775 6379 2345 1631 640 22794 1384 22789 216
NM_000573chr192333 1777 1686 1642 691 653 589 299 278 ----21463 272
NM_000611chr1175429 5257 1896 1847 1539 1297 559 56264 2110 1429 145 96 1224 15840
NM_000618chr12146586 6478 5928 5758 4502 4289 4160 2597 1866 1292 1198 687 197 141 24548 4036 ----
NM_000618chr12146586 6478 5928 5758 4502 4289 4160 2597 1866 1292 1198 687 197 141 24548 4036 ----
NM_000633chr18145276 4802 4518 3898 3790 3654 3617 3319 1949 1703 1617 1551 219 57 ------
NM_000651chr192333 1777 1686 1642 691 653 589 299 278 ----21463 272
NM_000793chr14144693 4605 3927 3480 3466 3413 3154 1869 1358 1301 1280 966 689 172 43996 1757 1560 1338 ----
NM_000813chr5185629 5527 5252 4891 4697 4570 4546 4208 4093 3697 3578 3497 3399 1877 1676 967 950 295 11967 35500 4401 4389 --
NM_000899chr12134327 4238 3893 3857 3791 3479 3327 3291 3192 2772 2709 655 349 23874 429 ----
NM_000926chr11209398 8980 7498 6965 6769 6377 6337 6318 5848 3348 3019 2987 2946 2902 2673 1823 1562 851 668 438 53134 2508 1488 647 556 13175 33140 2694 2349
NM_001001481chr8193394 3316 3297 3135 3105 3002 2848 2599 2343 2296 1201 1117 802 792 736 456 432 237 33 23429 2283 13040 --
NM_001001664chr283159 3117 3065 2911 2862 2757 2596 725 23403 28 --13027
NM_001001890chr21124104 3890 3852 3759 3213 3157 3137 2888 2681 1063 953 617 23525 3092 ----
NM_001001995chrX91924 1706 1540 1363 1226 749 593 444 317 1451 11896 --
NM_001002257chr2153602 3358 3295 2970 2912 2772 2707 2200 967 882 803 706 700 232 47 1513 23241 2942 --
NM_001003652chr18148351 8003 7867 7458 6527 6508 5617 3223 2428 2042 2019 1886 897 199 15693 11138 11525
NM_001003674chr18165665 5546 4940 2700 2613 2494 2125 1967 1286 1105 1029 846 797 680 296 180 15157 15097 --
NM_001003675chr18165665 5546 4940 2700 2613 2494 2125 1967 1286 1105 1029 846 797 680 296 180 15157 15097 --
NM_001003712chr12134061 3936 3271 2616 2603 1634 1344 1294 590 470 462 344 122 1942 11425 --
NM_001004317chr6144023 3711 3589 3470 2757 1796 1593 1526 1298 1242 1077 795 443 408 ------
NM_001004419chr12124605 3898 3628 3338 3244 3138 2868 1725 1438 1140 863 382 13827 11696 12948
NM_001005473chr5176640 6025 5820 5740 4644 4023 2397 1957 1864 1707 1692 1645 1566 1275 792 712 234 26190 2207 1111 --
NM_001005502chr1274413 4360 4258 4154 3232 1128 792 34649 3960 747 43560 3305 636 261 1135
NM_001007023chr14144693 4605 3927 3480 3466 3413 3154 1869 1358 1301 1280 966 689 172 43996 1757 1560 1338 ----
NM_001007214chr1101685 1647 1562 1432 1315 1229 262 99 66 43 11391 --1567
NM_001008239chr18103810 3529 3451 2764 2711 1284 1154 524 334 228 33857 724 513 --12495
NM_001008738chr562582 2282 1927 675 341 37 11176 1376 1603
NM_001009554chr4114616 4468 4419 4144 3821 3513 3199 3072 1911 677 625 24596 4409 43776 1476 1332 744 14343
NM_001009554chr4114616 4468 4419 4144 3821 3513 3199 3072 1911 677 625 24596 4409 43776 1476 1332 744 14343
NM_001009909chr11133750 3268 3096 2506 1585 1430 1329 1010 968 736 213 131 78 12916 1776 --
NM_001010891chr5176924 6642 6541 6279 5526 5440 5426 5395 4733 4455 4273 4222 2624 1984 1809 1460 894 34919 4766 4723 36535 4951 1057 --
NM_001010922chr184295 4143 3737 3588 2973 2931 1720 1517 32890 2782 1223 --11296
NM_001010986chrX82393 861 726 492 469 443 249 152 1331 --42054 610 372 307
NM_001011513chr483902 2825 2555 462 455 329 158 124 43660 3314 1460 1133 13200 --
NM_001014380chr13165358 5088 4993 4120 4022 1771 1724 1417 1279 1027 886 606 469 317 300 164 34760 3625 1214 ----
NM_001014797chr10188133 7556 6904 6593 6384 6071 5928 5822 5787 5459 5186 5159 2720 2380 592 567 352 182 76858 6141 5684 2699 2561 718 262 16537 25702 2710
NM_001018067chr1165048 4395 4305 3931 3711 3554 2006 1443 1153 991 890 626 512 315 214 180 14730 35140 3645 841 --
NM_001018068chr1165048 4395 4305 3931 3711 3554 2006 1443 1153 991 890 626 512 315 214 180 14730 35140 3645 841 --
NM_001018069chr1165048 4395 4305 3931 3711 3554 2006 1443 1153 991 890 626 512 315 214 180 14730 35140 3645 841 --
NM_001024647chr12247680 7610 7563 7491 7378 7149 6942 6463 5870 5787 5484 3068 2194 1679 1555 1247 1231 1013 775 500 343 261 135 48 16975 ----
NM_001024855chr391757 1286 756 740 720 670 663 281 40 11244 --1268
NM_001024948chr183511 3480 3123 1099 764 472 392 374 52568 847 642 585 284 43305 3070 2788 1312 --
NM_001024956chr11185788 5741 5694 5072 4160 3869 3707 3699 2238 2169 1889 1514 1197 1029 907 414 110 43 25344 4637 11989 34451 4445 3595
NM_001025233chr1292808 2247 2073 1875 366 226 157 124 109 --12578 1675
NM_001025252chr8132888 2502 2446 2385 2294 2247 2174 2164 2116 570 516 253 135 --22412 1966 12513
NM_001025253chr8132888 2502 2446 2385 2294 2247 2174 2164 2116 570 516 253 135 --22412 1966 12513
NM_001025580chrX103887 2920 2768 2622 1716 1548 1244 1233 474 177 11330 34164 3399 3037 --
NM_001030055chr1494387 3779 3497 3259 1562 1287 1145 728 221 11408 ----
NM_001031695chr22115280 4768 4181 4009 3883 3749 3736 1021 974 553 25 31529 1111 1084 --11585
NM_001031804chr16104198 4032 4008 3677 3111 3071 3042 2888 1666 688 1753 --23704 1048
NM_001033087chr20103155 3124 2659 2628 2588 2382 2223 596 491 54 --12973 12477
NM_001037164chr782046 1931 1587 1397 1260 485 418 304 162 31516 766 701 --
NM_001039538chr2113272 3168 3123 2478 2270 1311 596 501 469 162 25 33279 3035 905 ----
NM_001039580chr4155113 4865 4805 4653 4389 4304 4180 3685 3619 3235 1942 1501 1029 139 93 11878 34994 4487 1451 --
NM_001039618chr11165896 5491 5443 5233 5206 4198 4064 2351 2304 2123 1910 1883 1862 1437 1061 813 55746 5137 3779 2391 1579 1493 --
NM_001039840chrX105601 5488 5271 4393 3962 3768 3733 2166 2149 251 14733 1433 --
NM_001039937chr13104156 4015 3912 3720 3242 2824 1329 940 547 114 53093 2879 1278 1057 784 23695 2529 23885 3590
NM_001040152chr784251 3883 3360 2036 1554 717 626 29 1182 23507 687 24453 3973
NM_001040284chr16135621 5512 5096 4830 4539 3641 3591 2306 1653 1464 1237 703 79 --1334 --
NM_001040441chr185506 5356 5350 4586 3339 2026 287 117 33825 1312 653 35337 4942 1301 --
NM_001040450chr15102620 2583 2277 2137 986 974 860 618 498 217 22410 1777 12879 --
NM_001040453chr15102620 2583 2277 2137 986 974 860 618 498 217 22410 1777 12879 --
NM_001040665chr7115009 4844 4243 3831 3722 3664 3593 1076 994 635 521 21691 425 ----
NM_001042355chr16115382 5047 4266 3953 3430 3423 3377 1010 628 431 173 34916 1793 1051 21667 1056 --
NM_001042383chr3103382 3320 3095 656 643 378 318 299 93 30 --167 1847
NM_001042404chr161693 1684 802 345 208 49 11659 11372 21799 398
NM_001042412chr16115382 5047 4266 3953 3430 3423 3377 1010 628 431 173 34916 1793 1051 21667 1056 --
NM_001042413chr963549 3298 3205 1618 1306 318 --34039 3396 3215 23794 806
NM_001042533chr363101 2919 2774 2162 651 629 23327 739 12091 13117
NM_001042599chr2167848 7209 7167 7072 6658 6627 5537 5294 2864 2784 2747 2125 1220 1075 764 195 25464 2015 1783 11414
NM_001042601chr3113271 2733 2706 2635 2488 2192 2029 1280 477 215 168 32162 2020 970 ----
NM_001042604chr3134618 4216 3959 3667 1816 1739 1462 1335 1251 1224 811 676 404 11376 13851 23420 3312
NM_001046chr5142865 2659 2583 2448 2272 2196 2092 1185 1036 1005 876 567 308 268 11014 1581 --
NM_001099678chr3156346 5347 5249 5107 4559 4311 2224 1461 1444 1269 1012 728 609 48 26 52141 1833 1221 1126 65 --1976
NM_001100108chr1127610 7388 1640 1623 1409 1273 1136 885 631 570 255 122 33259 2592 1941 1488 --
NM_001106chr3159610 9486 9083 8521 7722 7612 7090 6719 6440 3283 1457 1063 1035 1001 945 16583 29265 2602 11575
NM_001167chrX136613 6143 6008 4507 4334 2609 1558 1491 1151 1027 435 346 113 46001 1296 463 360 ----
NM_001173chr1494387 3779 3497 3259 1562 1287 1145 728 221 11408 ----
NM_001186chr2192897 2822 2545 2255 608 496 359 299 183 21233 684 21071 793 --
NM_001204chr2177765 7029 6706 6692 5818 5726 2956 2475 2396 1664 1103 1050 1024 1010 998 948 759 37448 856 141 ----
NM_001259chr7125709 5419 5330 4912 4702 4656 4462 4437 2133 1142 813 571 2885 866 ----
NM_001304chr17123754 3482 3416 2992 2967 1335 956 668 559 550 480 365 ------
NM_001438chr1103592 3266 2918 2912 2847 2829 2795 2414 1293 936 11045 2897 404 --
NM_001527chr6114699 4622 3877 3319 1536 1388 992 843 598 276 128 44649 4633 4378 747 --1667
NM_001609chr10113287 3184 2864 1672 1595 1282 700 635 392 219 92 13208 1656 --
NM_001695chr8113937 3759 3615 3545 3000 1323 1043 953 410 256 57 2922 786 ----
NM_001717chr1571430 1096 1047 251 71 59 53 ------
NM_001754chr21124104 3890 3852 3759 3213 3157 3137 2888 2681 1063 953 617 23525 3092 ----
NM_001759chr12125290 5150 5114 4725 4473 4324 2100 1842 763 468 207 177 11304 --24156 1831
NM_001806chr19112617 2582 2251 2166 2136 1034 943 906 719 306 260 22660 671 ----
NM_001830chrX93921 3784 3302 3120 2715 2573 1065 928 57 11051 --13572
NM_001859chr962792 2752 1337 839 368 184 33561 3340 1040 11590 11046
NM_001874chr1274413 4360 4258 4154 3232 1128 792 34649 3960 747 43560 3305 636 261 1135
NM_001904chr321075 856 2850 842 ----
NM_001918chr1198855 8490 8455 8299 7591 7248 7027 6701 6447 6354 6322 5901 3499 3027 2347 1234 1115 778 750 69252 7287 6016 2999 1446 936 11284 1693
NM_001949chr673224 3038 2714 2280 2038 538 117 13173 12520 1514
NM_002006chr4195507 5105 5045 5005 4742 4480 4261 4147 3895 3688 3574 2041 1596 1278 1240 1198 1038 910 45 35659 5626 4439 14552 --
NM_002025chrX199035 8424 8143 7949 7497 7004 6765 6635 6626 6457 6346 5632 3236 2656 2605 2533 1270 1030 358 58701 7075 6039 3322 2797 ----
NM_002040chr2193196 3023 2529 2506 1249 1240 985 343 308 1440 22879 250 --
NM_002092chr4173731 3717 3513 3459 3306 1534 1441 1070 953 928 861 627 513 286 207 180 113 1898 1549 --
NM_002203chr593358 3243 3235 3227 3164 1655 1345 309 204 13121 13701 --
NM_002214chr7135417 5300 4829 4755 3936 3808 3776 2021 1780 1710 1146 936 836 41702 1130 1003 477 ----
NM_002270chr5204825 4536 4395 4356 4080 4071 4019 3737 3687 3589 1131 1106 924 725 672 632 438 325 235 125 35527 3540 1802 ----
NM_002310chr5136312 6261 6136 6088 5734 5209 4199 2553 2038 1950 1755 1699 99 15715 ----
NM_002336chr12174590 3712 3567 3323 3149 3064 1992 1867 1528 1446 490 448 350 325 151 142 131 44729 4399 814 579 ----
NM_002374chr2113272 3168 3123 2478 2270 1311 596 501 469 162 25 33279 3035 905 ----
NM_002481chr1147931 5859 5402 5372 3011 2894 2670 2379 1584 1307 1202 1178 1031 664 16013 37184 5547 1277 35319 5263 93
NM_002577chr364068 3926 3828 3400 1403 922 33584 3327 1368 196 33911 3761 748
NM_002581chr9155635 5421 4795 4490 4306 4166 4086 4061 3754 3576 3522 2234 2227 1290 414 13543 12056 1203
NM_002610chr242334 2278 2198 327 42884 807 720 131 --12755
NM_002655chr8115118 4321 3767 3404 2125 1882 1860 1361 1321 1095 31 54920 3587 1010 461 144 ----
NM_002709chr2123297 3291 3054 2938 2889 2814 2797 2745 2323 1321 1233 466 --13193 --
NM_002760chrY94599 4477 4460 4414 4385 4164 2313 1549 725 15312 35178 1891 1240 24366 330
NM_002834chr1284102 3957 3793 3730 3116 3029 1451 425 --11094 21295 33
NM_002837chr12124541 4491 4160 4098 3903 3860 3169 3065 1747 1693 1559 1027 23507 1802 ----
NM_002886chr375007 3770 1838 678 347 280 215 14560 1390 34446 3714 2020
NM_002959chr184428 4079 3834 3453 1676 1378 158 82 24342 3318 13705 1310
NM_002977chr293318 3145 3129 2737 2432 1294 1218 451 438 12596 11161 --
NM_003034chr12147503 7150 5960 5924 5910 5331 3120 2981 1882 1466 877 248 200 183 37670 5107 2862 12542 11858
NM_003071chr391521 832 656 567 355 222 188 78 53 2799 783 ----
NM_003099chr15166281 6232 6125 5657 5196 4878 4759 4537 3996 2493 2330 1803 956 456 324 202 25836 5663 25011 540 14769
NM_003108chr2147250 6402 6292 6011 5972 5814 5171 4922 4892 4464 1478 1238 537 229 16434 ----
NM_003112chr792845 2592 2524 1235 874 735 499 433 246 --23181 67 12466
NM_003161chr1763404 3210 3170 3052 647 197 63609 3190 2946 2436 541 452 11027 --
NM_003199chr18145335 4849 3612 2267 2108 1904 1877 1776 1664 1574 1347 1294 872 728 34790 3950 910 32052 1825 1188 --
NM_003246chr1551825 1681 1653 817 610 1623 11671 11777
NM_003262chr3115149 4993 4737 4534 3405 1918 1705 1018 962 235 117 --24869 1313 33187 2048 845
NM_003298chr3116056 5693 5600 5564 4667 2244 1586 507 344 193 68 25507 480 15578 --
NM_003387chr292663 2599 2525 1923 1030 644 532 166 135 22267 1051 12749 11133
NM_003392chr3124311 4044 3990 3841 3481 3252 1679 1383 1125 342 285 87 24144 3501 --13800
NM_003478chr11113294 3100 2843 2722 2674 2638 1227 983 810 603 295 12615 2779 451 --
NM_003566chr1293132 2666 2254 1183 720 611 289 264 119 23097 2798 1229 11286
NM_003574chr18195164 5090 4848 4664 4600 4345 4331 3776 3602 2205 2177 2095 1730 1475 1465 1420 1039 421 381 35616 1282 852 55554 5272 4924 4871 447 24462 2299
NM_003590chr293933 3642 3581 3421 3168 3158 1341 435 424 --23850 3307 --
NM_003607chr184290 3331 1521 1448 983 643 557 380 33230 1309 297 12765 11597
NM_003615chr3183914 3522 3417 3339 3269 2912 2678 2642 1469 1459 1356 1126 894 456 425 274 175 125 11105 ----
NM_003679chr1123486 3463 3426 3331 3299 2747 2566 1284 1182 1061 778 102 ----1474
NM_003759chr4114272 4079 3951 3913 3631 3454 3415 3086 2870 1279 455 181 23201 2673 14108
NM_003884chr371850 1445 1422 1405 1347 1337 476 ----21768 209
NM_003913chr6164061 3889 3803 3664 3591 3445 3375 3006 2880 2838 2821 2710 1353 362 356 293 12971 23867 3856 --
NM_003921chr191656 1636 1608 1420 1380 1112 289 137 70 1309 --11344
NM_003966chr5117845 7810 6257 5839 4946 2419 2365 2159 1319 379 182 47096 6441 5471 5373 57060 4929 2874 2148 1773 16188
NM_003994chr12134327 4238 3893 3857 3791 3479 3327 3291 3192 2772 2709 655 349 23874 429 ----
NM_004079chr152304 2123 1173 84 34 32953 2248 2002 22226 890 12555
NM_004094chr14112817 2781 2766 2505 2246 2195 1141 822 731 254 155 22775 1225 ----
NM_004161chr261534 1491 1305 1116 614 142 1478 21375 1255 11579
NM_004171chr11189610 9255 9243 9175 8266 7877 6458 3731 3612 3274 1675 1579 1550 1526 1342 736 469 314 33160 2904 2867 28804 8109 --
NM_004232chr18133289 3265 3227 2995 2976 2795 1259 829 726 698 415 55 36 21025 969 11537 --
NM_004293chr9103535 2943 2731 2624 2488 1047 763 734 152 89 1402 23261 2850 11386
NM_004330chr1581186 830 473 411 349 334 317 272 2249 113 ----
NM_004338chr18165665 5546 4940 2700 2613 2494 2125 1967 1286 1105 1029 846 797 680 296 180 15157 15097 --
NM_004412chr10136029 5798 5657 5599 5298 4619 4404 1881 1866 1613 1457 1127 259 15685 11377 --
NM_004438chr2103324 3281 3030 2743 2686 2516 1298 232 183 113 22356 2326 12042 2771 282
NM_004464chr4104311 3711 3489 3369 2972 1639 1412 1113 1049 936 33655 2978 1179 11273 13310
NM_004504chr273084 2226 2146 1981 1159 794 359 12804 --32775 1015 375
NM_004586chrX95454 5081 3775 2058 1120 615 573 333 212 64793 4692 4552 2092 1032 220 1863 --
NM_004612chr9104763 4740 4260 3993 3542 3481 3414 861 677 627 11207 13797 14268
NM_004726chrX135407 4933 4780 4607 4187 3681 1330 1249 1214 1037 799 468 210 13664 24238 959 --
NM_004731chr1261874 1644 1396 1221 343 99 ----21334 422
NM_004745chr8247021 6976 6947 6792 6369 5651 5296 5288 5153 5145 5088 4777 4768 4246 2284 2169 2123 1917 1524 1264 1080 1067 1031 307 25896 4473 ----
NM_004748chr1594012 3561 3504 3229 3195 909 892 620 185 1144 12626 13245
NM_004815chr1124257 4180 4161 3830 3717 3674 3580 1145 898 809 293 246 24943 1173 14168 --
NM_004857chr14114746 4030 3516 3067 2943 1605 1117 558 452 258 180 23630 1344 ----
NM_004866chr5144605 4426 3905 3798 3605 3141 2009 1945 1458 1448 801 688 562 363 23992 3649 1430 --
NM_004936chr962953 2116 1942 1171 638 160 11196 22769 1903 12557
NM_004956chr7114359 3830 3455 1601 1580 1239 1189 1001 620 517 497 11208 --14059
NM_004999chr6104493 4345 3572 2747 1578 1452 1404 1327 1274 757 24122 3820 33627 2893 786 --
NM_005079chr8132888 2502 2446 2385 2294 2247 2174 2164 2116 570 516 253 135 --22412 1966 12513
NM_005126chr352275 1981 1844 1552 250 11467 31504 1414 612 191
NM_005156chr9104896 4510 4147 4120 3866 3660 3326 3277 1888 1279 64798 4290 2161 2143 2108 2031 ----
NM_005160chr22166287 5845 5711 5466 5334 5126 4993 4963 4898 4228 4213 4141 2178 1647 1001 198 22041 1186 36681 6298 5674 16388
NM_005188chr11108173 7244 6315 6288 5331 3047 1728 1194 940 163 42951 2935 1110 171 16341 1902
NM_005235chr2167848 7209 7167 7072 6658 6627 5537 5294 2864 2784 2747 2125 1220 1075 764 195 25464 2015 1783 11414
NM_005339chr4144174 4157 3958 3512 3496 3286 3173 2913 2777 2635 1315 824 682 208 33706 2837 793 --22880 1096
NM_005359chr1896511 4235 4081 2521 2457 2096 1597 1588 735 45770 1741 1569 1221 11997 24586 1541
NM_005399chr1104410 4205 3946 3908 3352 3179 1434 1414 312 258 1233 13288 --
NM_005431chr791837 1686 1630 1548 1525 1502 765 737 722 ----11735
NM_005436chr1093309 3222 3031 2928 2859 1100 1037 667 159 23078 897 --1955
NM_005497chr17145970 5455 5446 4821 4543 3744 3724 2379 2178 2072 1534 999 687 551 11176 11052 --
NM_005504chr12206541 6475 6398 6304 6096 5998 5700 4684 4519 4239 4182 4174 2137 1870 1794 1397 890 729 314 185 46135 2412 1357 31 26109 4939 15675
NM_005542chr7101844 1746 1725 1531 1463 1217 458 429 413 158 11344 ----
NM_005578chr3125013 4381 4014 3917 3704 3624 1987 1769 1694 682 523 60 ------
NM_005596chr995546 5250 5197 4697 4613 3924 2400 786 27 14250 --1381
NM_005604chr6122578 2419 2320 2257 2128 2101 2079 1923 1857 881 834 330 1811 12266 --
NM_005665chr1104910 4440 4375 3817 3554 1962 1869 1775 1768 72 33927 1686 215 --11756
NM_005668chr5154427 4364 4129 3412 3296 1851 1812 1457 1419 1365 1280 1101 604 158 65 33996 3347 1407 34456 3188 1801 13948
NM_005725chr192440 2057 1770 1742 973 760 449 233 88 22008 1972 11555 --
NM_005738chr782046 1931 1587 1397 1260 485 418 304 162 31516 766 701 --
NM_005739chr1572350 1899 1669 1624 951 907 877 2446 352 12039 12026
NM_005748chr1283061 2885 2670 2367 968 918 509 404 21323 132 2962 942 --
NM_005759chr2134557 4121 4034 3232 3180 3067 1361 1144 980 850 648 334 227 54269 2994 1486 180 90 135 --
NM_005828chr1775048 4668 4449 3258 1894 1626 1198 14649 13435 23945 1692
NM_005840chrX137239 6734 6538 6099 5943 4953 3040 2704 2464 2238 2062 1285 450 16376 17224 27509 777
NM_005868chr762286 2055 1622 1611 420 286 21954 779 2784 397 11822
NM_005901chr18148351 8003 7867 7458 6527 6508 5617 3223 2428 2042 2019 1886 897 199 15693 11138 11525
NM_005935chr494938 4433 4276 4049 3606 1340 491 340 270 34524 3450 957 --11477
NM_005941chr8144049 3741 3732 3557 3478 3404 3230 2653 1208 910 807 610 549 168 23363 2860 ----
NM_006007chr9144498 4126 3682 3387 3369 3194 2875 2754 1631 1405 1264 659 491 398 14271 ----
NM_006080chr7112892 2233 2148 2124 2100 2019 1974 1906 529 516 303 42452 908 579 34 ----
NM_006095chr4144523 4256 4069 3982 3634 3350 3191 3027 1510 1319 1163 1123 978 582 34108 3866 2991 ----
NM_006139chr2122651 2584 2182 2071 1825 785 750 572 525 417 179 74 22533 1879 42698 2497 2163 1051 --
NM_006203chr595595 5337 4686 3781 2235 1085 1060 522 158 23860 40 --12031
NM_006206chr4102793 2584 2184 956 908 868 753 570 260 177 ----1246
NM_006252chr1137241 6080 5709 5693 5368 4714 4658 4644 2790 1952 1875 1691 845 35802 2954 2367 11733 12532
NM_006255chr1441126 760 229 214 1316 1200 21042 47
NM_006282chr2064571 4395 4161 4108 4071 1794 23529 396 11742 24059 3830
NM_006306chrX115157 5044 4654 4328 2316 2042 1611 1492 922 654 609 15495 23824 1241 24766 4224
NM_006352chr192017 1757 1681 802 575 488 236 141 101 4474 379 202 50 ----
NM_006371chr3135265 5086 4985 4882 4396 4360 4227 4078 1802 1282 1183 1099 909 15125 21835 1167 --
NM_006379chr762183 1798 1637 869 556 146 32216 1480 920 --1471
NM_006407chr341136 1031 982 575 2995 397 --21188 256
NM_006457chr483902 2825 2555 462 455 329 158 124 43660 3314 1460 1133 13200 --
NM_006464chr284606 3438 3196 1317 1290 955 551 131 33879 3634 1007 33568 871 825 --
NM_006534chr2083377 2793 2535 2206 1338 653 635 238 33335 1326 959 1770 12312
NM_006538chr283996 3322 3151 2858 2600 1555 930 24 ----2598 348
NM_006544chr14165659 5035 5000 4579 4187 4011 3901 1788 1507 873 858 831 657 407 321 93 35771 5526 712 15023 --
NM_006572chr1793086 3063 2670 2636 2565 2406 1360 380 74 23055 2152 21296 499 1731
NM_006599chr16207871 7602 7311 7112 6934 6722 6674 6510 6386 6243 6009 5986 5539 5403 5092 2735 2686 2346 1503 1143 --36859 6294 1982 --
NM_006614chr373438 3274 3245 1171 1150 613 468 12406 --22304 89
NM_006620chr6114886 4282 3989 3313 3177 3119 3020 1210 313 283 151 23187 245 24031 42 --
NM_006626chr962720 2213 2162 2129 1055 821 12485 42110 640 559 246 --
NM_006682chr762883 2719 1822 1815 858 147 12059 --12352
NM_006729chrX125590 5539 4628 4490 4071 2068 1993 1927 1515 1487 1325 96 35236 4402 391 1137 1953
NM_006731chr9185753 5503 5480 4720 4267 4219 4178 3835 3626 3615 2137 2043 1939 1821 1750 1118 1052 343 34311 3539 1108 15583 --
NM_006750chr16167414 7321 6729 6431 5678 5281 3033 2904 2659 2527 2297 1950 1447 1392 477 43 36565 5644 5136 1954 --
NM_006777chrX62718 2674 2310 1867 735 559 1279 32517 1027 266 --
NM_006918chr11185788 5741 5694 5072 4160 3869 3707 3699 2238 2169 1889 1514 1197 1029 907 414 110 43 25344 4637 11989 34451 4445 3595
NM_006948chr21112255 2117 1939 1687 1660 943 917 858 677 478 336 11635 ----
NM_006955chr10102856 2826 2643 2304 2289 1036 808 474 360 285 22263 1119 11043 --
NM_006956chr762328 2158 1999 1865 1589 806 2827 445 --1404
NM_007006chr16132855 2728 2605 2525 2365 1348 1179 1019 899 751 171 145 22 33304 2510 249 12199 --
NM_007007chr1284360 3091 1845 1699 1648 1155 647 161 1751 --23618 133
NM_007011chr15146682 5690 5249 4385 4307 2636 2512 2193 2087 1601 1594 995 746 325 --25323 5279 --
NM_007038chr21155689 5604 5419 4444 4412 4322 2322 2245 2069 1978 1899 1397 1380 599 481 65593 5572 4719 4253 1747 664 44119 4101 3717 782 12429
NM_007050chr20117360 6534 5957 5519 5291 4942 3173 3013 2123 1227 258 37105 1598 1113 25678 2971 27011 1944
NM_007114chr393347 2961 2428 2241 1126 1058 1045 795 255 23075 947 ----
NM_007123chr181285 1168 1098 1091 1003 292 266 95 ----11045
NM_007137chrX165217 5197 4787 3388 2017 1656 1566 1531 1518 1467 1122 1005 767 741 492 216 24984 1406 25114 1720 --
NM_007175chr8113404 3340 3126 3071 2675 2516 2308 1045 574 324 130 22908 2697 ----
NM_007195chr18123752 3542 3295 451 411 382 375 315 186 147 135 37 ------
NM_007231chrX112428 2041 1510 863 813 634 424 332 275 87 52 32018 833 503 ----
NM_007247chr171247 31036 331 73 --2998 414
NM_007249chr13189120 8561 8235 7781 7320 7261 7181 7121 6742 6248 6129 5977 5841 2347 2112 1844 982 777 48740 6000 2230 497 26563 3611 39317 7437 2860
NM_012081chr592778 1420 1162 1092 1041 465 402 316 233 22428 531 12693 --
NM_012120chr6113016 2824 2613 2606 2569 2149 2065 2036 1980 1100 764 22021 143 1594 --
NM_012141chr13104156 4015 3912 3720 3242 2824 1329 940 547 114 53093 2879 1278 1057 784 23695 2529 23885 3590
NM_012164chr9157571 7344 7254 5625 5602 5151 5094 2332 1590 1497 1094 1069 1015 953 875 35467 4620 2951 25684 4997 12118
NM_012193chr1195111 2117 1805 1701 1406 1385 972 434 381 1209 --25331 3794
NM_012214chr2196449 6398 5925 5859 5715 5692 5621 5160 4800 4468 4405 2118 2045 1557 1060 646 567 472 52 15111 34711 4462 1770 --
NM_012234chr383770 3213 2817 1400 841 778 758 643 23722 3363 --12711
NM_012252chr7175401 5163 5155 4604 4468 4095 4000 3878 3682 2086 1931 1897 1722 1605 1564 737 360 55295 3584 1924 1414 1011 23711 278 --
NM_012262chr1115208 4586 4386 3955 1579 1572 1297 1107 807 579 521 35112 4762 4030 21733 1643 1153
NM_012382chr5234453 4315 4085 4025 3823 3812 3173 3163 3141 1796 1658 1573 1299 1010 978 954 781 400 340 311 226 171 144 ----184
NM_012464chr442603 2581 2336 976 --32051 988 487 1287
NM_013231chr14103671 3346 3249 3094 1109 845 588 551 420 257 53740 3225 2954 1648 399 33358 1100 442 --
NM_013255chr7208814 7733 7636 7447 7055 6494 5795 5635 5576 5422 3120 3061 2697 2304 2249 2189 1526 1361 476 357 38522 7075 2656 35826 5809 1043 47488 2234 1192 28
NM_013269chr12124532 3825 3555 3265 3171 3065 2795 1652 1365 1067 790 309 13754 11623 12875
NM_013322chr781099 686 641 582 529 333 321 270 2597 352 133 --
NM_013943chr163110 2887 2460 499 428 370 32818 2305 608 11254 22954 2291
NM_013989chr14144693 4605 3927 3480 3466 3413 3154 1869 1358 1301 1280 966 689 172 43996 1757 1560 1338 ----
NM_014028chr682744 1091 1024 853 642 571 408 110 23120 344 21250 425 12455
NM_014048chr16105272 4902 4801 4416 3751 3739 1759 1469 982 126 13559 33536 3327 837 177
NM_014106chr15102703 2437 2305 2260 2000 1912 1085 1025 975 226 1543 22955 2855 --
NM_014112chr8194667 4650 4504 4488 4193 3984 3961 3801 3556 1774 1467 1159 1145 1135 564 506 293 279 185 24286 29 21246 34 --
NM_014141chr795365 5215 5061 4873 3948 3687 1364 147 137 31915 1610 1052 14813 --
NM_014155chr11147583 7026 5918 5164 5089 4622 2512 1925 1142 958 936 739 667 564 27517 2789 ----
NM_014331chr4147680 7623 7503 7418 6564 6446 5054 4913 3121 2578 1824 1277 1142 51 47828 7510 3136 1954 16689 --
NM_014388chr1165828 5566 5560 5227 4833 4717 2376 2040 1882 1857 1625 1012 654 513 420 381 --15970 --
NM_014423chr5135108 5016 4712 4478 4466 4367 4137 4116 2066 1644 1373 660 633 15650 31736 1059 107 12157
NM_014702chr6113457 3051 2645 2529 2401 2267 1232 1067 866 332 151 32383 2362 1264 1326 11163
NM_014721chr6177450 6520 6414 6172 5652 4744 2780 2221 2011 1469 1269 1034 864 815 735 636 417 26035 1494 24610 475 14871
NM_014733chr582128 1952 1945 1764 1655 1515 378 71 1647 31550 1469 876 11862
NM_014739chr6164142 3588 3475 3378 3296 3086 3052 2797 2752 1600 1584 1238 488 363 193 117 63976 3372 1286 984 808 200 1162 --
NM_014810chr1113667 3518 3139 2693 2270 930 848 684 590 468 385 33651 2503 420 22475 2388 12362
NM_014812chr161693 1684 802 345 208 49 11659 11372 21799 398
NM_014826chr184290 3331 1521 1448 983 643 557 380 33230 1309 297 12765 11597
NM_014864chr173374 1702 962 904 528 507 69 34240 543 43 --13510
NM_014898chr19102349 2258 2236 2155 1684 970 864 850 508 50 22488 580 ----
NM_014904chr10113843 3585 3462 3427 1368 979 412 396 312 300 215 23873 3688 --22551 336
NM_014906chr1793835 3698 3627 3490 2788 1032 822 446 182 21591 136 23792 2795 --
NM_014912chr1083532 3445 3334 2540 2208 1423 1153 705 42985 2585 1046 823 ----
NM_014936chr6132871 2583 2209 1932 1922 1905 1871 1127 579 521 279 269 67 ------
NM_014946chr2103127 3073 2518 2323 2083 2056 1953 914 661 408 32552 2497 698 ----
NM_014947chr173081 2760 2705 2684 2259 884 549 12851 --22856 503
NM_014950chr14111651 1595 1534 1479 1396 1373 1230 1116 513 456 75 11710 1693 --
NM_014953chr13144298 4277 4015 3748 3685 3260 3071 2909 2804 1713 1218 1078 917 586 42872 1188 387 288 ----
NM_014962chr20102821 2660 2645 1929 1775 1060 1031 719 570 368 2988 487 --12395
NM_014982chr14135429 5259 5186 5143 4498 4120 3412 3325 1732 1279 1202 443 206 25350 126 25010 3382 15133
NM_015025chr262260 684 574 499 175 161 1314 1660 1374
NM_015026chr1291909 1892 1538 791 758 532 512 350 33 24691 4010 24758 1152 --
NM_015040chr2103236 2840 2662 2332 1055 867 841 689 301 289 --11066 125
NM_015049chr283228 2919 2734 1082 845 534 322 145 12899 22115 1256 21327 1317
NM_015051chr9133389 3326 3219 3202 2773 2744 2554 2516 2200 1040 941 455 427 13089 22647 61 --
NM_015055chr1182787 2739 2627 2578 2568 2202 2169 1110 22950 2548 12235 --
NM_015071chr5146514 6240 5263 4793 4520 4252 2191 1786 1709 1418 930 606 284 95 36353 1696 347 1352 --
NM_015076chr674540 4484 3930 3691 1406 736 671 11032 23838 1518 13434
NM_015087chr1341952 350 200 61 32045 636 566 12080 31767 602 43
NM_015092chr1674672 4494 4248 3312 1452 1028 620 41485 1071 572 521 --1561
NM_015149chr172051 1835 1589 1497 1444 1395 175 1442 --2460 401
NM_015192chr2062866 2597 1205 835 798 392 22542 1138 1381 22424 2184
NM_015199chr383014 2829 2655 2625 1170 824 541 337 1888 12884 1200
NM_015206chr1563901 3819 3602 670 470 349 42678 2549 2418 1449 1404 23349 97
NM_015208chr18153794 3706 3682 3649 2994 2708 2650 1396 1301 1216 1195 1187 607 409 64 23598 3537 23565 3353 --
NM_015247chr16115382 5047 4266 3953 3430 3423 3377 1010 628 431 173 34916 1793 1051 21667 1056 --
NM_015271chr4103348 3272 2992 2830 2716 1593 1493 1367 1099 952 33789 2675 1144 33309 3218 1212 --
NM_015286chr1572493 2140 2101 1743 1695 763 413 12044 31766 489 482 --
NM_015310chr8168420 8362 8332 8128 7986 7868 7488 6917 5995 5536 5308 3198 2244 1284 1108 43 --37452 6904 1595 26843 893
NM_015313chr11154784 4523 4274 4190 3823 3773 3588 1942 1657 1498 1382 955 777 760 207 23917 967 ----
NM_015314chr752327 2230 2081 2062 1725 21909 836 32152 1799 1738 --
NM_015365chrX103887 2920 2768 2622 1716 1548 1244 1233 474 177 11330 34164 3399 3037 --
NM_015394chr12122450 2276 2252 2033 1799 1744 371 327 286 221 94 64 --12010 --
NM_015458chr893454 1704 1465 855 711 529 511 443 430 23526 825 13596 1259
NM_015553chr6105196 5146 4029 1764 1685 1526 1209 1005 555 292 44871 1669 1633 1131 21674 764 24602 3759
NM_015560chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_015569chr1164857 4653 4643 4425 4034 3930 3841 3734 3698 3575 3351 1818 1454 1437 1413 1068 11835 33037 1084 365 --
NM_015640chr1165048 4395 4305 3931 3711 3554 2006 1443 1153 991 890 626 512 315 214 180 14730 35140 3645 841 --
NM_015878chr841977 1810 1415 853 2872 269 11926 22240 626
NM_015879chr18218250 8133 8098 8022 7398 7384 7047 6501 6485 5902 3040 2936 2856 2508 2390 689 644 348 264 61 27 38091 423 74 21332 255 12402
NM_015886chr8165635 5328 5241 5184 4111 2029 1501 1355 1084 816 765 606 566 528 177 24 35145 1948 1941 ----
NM_015888chr183375 2894 2627 2381 1337 814 718 597 145 13157 --
NM_015906chr1163809 3400 3323 3303 3129 2973 1788 1206 1198 1190 983 686 480 243 162 97 23148 1541 1294 --
NM_016018chr872426 2094 2013 1927 1010 654 337 12551 --1251
NM_016083chr6143830 3421 3351 2974 2931 2549 2538 1541 1512 950 644 595 416 361 1982 33124 1039 256 --
NM_016132chr1582922 2566 2416 1295 1237 815 722 247 13344 12829 1499
NM_016206chr3238930 8710 8193 8088 6943 6745 6130 6062 6041 5961 5896 5847 3424 2403 2257 2197 2164 1638 1622 761 623 409 369 23188 902 16619 26578 3155
NM_016217chr6133663 3586 2738 2648 2543 2482 2360 1439 1343 1260 689 677 141 32979 1228 1095 ----
NM_016260chr2267532 7293 7222 7091 7066 7016 6602 5835 5485 5315 5043 4825 4732 4640 3052 2855 2720 2058 1956 1900 1767 1464 413 210 56 34 14620 1767 --
NM_016287chr181844 1774 1759 1661 1537 1504 551 403 1410 --11956
NM_016298chr363363 3287 2895 2638 871 423 31253 1119 263 32209 637 59 12576
NM_016929chr664228 3743 3459 3187 1624 209 13525 13253 24095 3476
NM_016953chr2145976 5683 5417 5327 4686 4600 4172 3822 3745 2415 2067 1959 986 255 31999 1151 1061 25837 1900 --
NM_017420chr1493814 3748 2490 2405 468 445 383 364 251 31154 306 226 13371 --
NM_017447chr21124310 4105 3552 3219 3018 2934 2778 1571 1272 1081 780 343 --13313 1363
NM_017563chr3146174 6076 5250 4634 4376 4356 2420 2055 1855 943 590 398 300 125 36341 4432 1978 22205 676 12361
NM_017628chr4105173 5134 5062 5037 4583 3679 1373 1100 556 408 14471 24807 3423 --
NM_017633chr6113801 3632 3409 3281 2852 2639 1338 1128 1122 765 300 13852 13180 --
NM_017634chr8111941 1722 1604 1589 1545 1336 715 482 331 315 91 ------
NM_017637chr9178988 7740 7621 7131 6999 5848 3692 2990 2863 2638 1984 1886 1875 1597 934 638 167 29398 7637 18591 27647 3009
NM_017645chr9153104 3034 2811 2803 2716 2576 2202 2144 902 598 488 379 302 220 213 12056 --11192
NM_017650chr7156093 5451 5136 4650 4411 4219 4096 3949 3707 2267 2195 1943 1796 1528 243 33844 2178 1061 24398 397 12127
NM_017655chr171547 1432 1215 454 205 138 124 1332 11254 11104
NM_017658chr14154218 4077 3727 3592 3416 3384 3317 3066 3013 1359 1209 1131 988 924 574 --3161 115 23 13096
NM_017694chr291839 1818 1672 1565 1378 824 714 638 511 --11681 31552 428 227
NM_017709chr1134302 4174 3794 3479 3382 2895 1465 1083 840 793 709 671 485 24117 262 23992 3347 --
NM_017754chr6104025 3891 3735 3488 3421 3363 3283 3055 1730 1270 13211 34328 3520 501 11619
NM_017801chr372524 2462 2349 2267 2164 1779 170 42425 1048 749 229 11838 11054
NM_017813chr8145402 5373 5224 4818 4812 4627 4558 4115 4030 3946 2066 1684 1444 179 41870 1138 607 543 21849 42 15143
NM_017831chr18144783 4708 4225 3951 3917 3901 1787 1267 1172 1115 977 424 275 67 ------
NM_017919chr9134521 4514 4192 2293 2237 1725 1380 1151 1008 899 444 271 102 34503 4219 144 14508 --
NM_018036chr14114417 3815 3780 3662 3170 2945 2864 1415 1277 439 201 33733 3635 3514 14139 --
NM_018046chr581892 1845 1554 1479 1235 768 178 129 41698 1671 207 44 2682 503 --
NM_018078chr431033 811 43 --136 156
NM_018084chr2133332 3234 2941 2728 2688 2543 1325 1245 1040 780 337 175 86 21092 161 1644 --
NM_018167chr147994 835 376 362 236 228 222 ------
NM_018227chr4112999 2933 2545 2309 2187 2107 1224 1152 870 491 426 12651 12396 1863
NM_018299chr8193394 3316 3297 3135 3105 3002 2848 2599 2343 2296 1201 1117 802 792 736 456 432 237 33 23429 2283 13040 --
NM_018351chr1254650 4609 3243 1191 797 1926 14447 1649
NM_018361chr8143806 3783 3216 3112 3038 3030 2790 2738 1541 1482 1216 1084 663 471 33772 2782 230 ----
NM_018362chr11113863 3703 3543 3043 2871 2839 2581 1171 1097 1061 1012 33578 2591 1420 23605 918 --
NM_018364chr1164075 3977 3888 3750 3553 3090 2834 2586 1424 1332 751 667 523 444 296 123 23546 2778 11460 --
NM_018374chr7144556 4542 4328 4321 4246 3767 3544 3401 3326 3319 1138 908 828 32 15167 2864 534 --
NM_018439chr18132637 2587 2406 2257 2120 2053 1840 855 793 751 351 337 68 1169 32492 1648 436 --
NM_018440chr8178655 8301 8292 8234 7789 7667 6922 6122 5924 3481 3043 2508 2496 2353 1327 1281 452 32618 1404 1333 48513 3199 1591 1394 --
NM_018452chr6_random83411 2603 2400 1176 1005 270 236 222 23185 1487 --12547
NM_018566chr1105155 5003 4900 4760 4704 4687 3520 3386 1822 242 34254 3376 1234 1773 --
NM_018590chr10111727 1699 1481 1360 1193 1116 1096 1075 628 611 214 ----1494
NM_018638chr12145241 5003 2138 1609 1313 1187 924 867 704 555 535 487 215 179 32035 1588 1306 14883 24238 159
NM_018698chrX51912 1343 752 584 470 31601 1337 1278 --1767
NM_018841chr1103821 3196 3103 2788 2755 1545 1103 335 303 126 33310 3284 1414 ----
NM_018958chr1574041 4034 3589 3445 3109 1557 1120 53547 2596 2588 2488 1583 23268 529 22954 2477
NM_018976chr1282726 2679 2409 1984 1014 896 868 812 --1584 21818 201
NM_018999chr10144721 4267 4116 4064 4026 3593 3291 3232 3112 1687 1496 902 654 408 ----13441
NM_019001chr3134618 4216 3959 3667 1816 1739 1462 1335 1251 1224 811 676 404 11376 13851 23420 3312
NM_019035chr452080 1568 1524 586 95 21819 835 144 1817
NM_019044chr2114758 4117 4058 3798 3642 1382 1195 1086 893 528 376 11539 34421 1130 75 1865
NM_019072chr5173695 3432 3306 3258 2996 2986 2775 1451 1317 926 601 481 403 223 69 55 34 12825 ----
NM_019117chrX103224 2562 1290 1170 1113 1101 739 452 423 76 22451 24 ----
NM_020123chr1031034 386 318 1354 --21296 288
NM_020205chr193003 2830 2796 2282 2119 1283 1217 1029 312 1948 23138 2938 13067
NM_020336chr2083841 3229 2344 1508 1479 1127 848 367 1131 31068 963 185 1688
NM_020337chr4123182 2916 2780 2756 2623 2404 1014 871 637 571 236 158 ----12298
NM_020342chr282393 2067 2035 2021 1975 924 879 858 31704 502 381 --1333
NM_020390chr3114929 4797 3665 3429 3011 1910 1661 1044 876 370 266 33498 3445 1239 33575 1940 1796 --
NM_020466chr6154986 4638 4527 4320 3868 3217 3103 1991 1717 1186 935 925 714 643 239 14466 11425 --
NM_020640chr362298 2081 1944 1532 1411 824 ----21614 1457
NM_020673chr20177646 7300 7098 7051 7008 6669 6617 6089 5510 5014 4800 2853 1891 1515 730 520 495 26681 5638 26689 36 1136
NM_020718chr16135955 5841 5241 5215 4292 4017 2640 2624 2471 2395 1426 693 248 35938 674 616 25414 4921 --
NM_020727chr21143946 3912 3442 3357 3217 3037 1514 1214 692 426 355 344 180 61 23269 1037 ----
NM_020728chr752562 633 578 533 412 53136 3102 2906 2593 352 --1401
NM_020734chr1292599 2424 2309 2210 2145 2094 373 350 211 31236 1176 199 --2647 147
NM_020739chr1594012 3561 3504 3229 3195 909 892 620 185 1144 12626 13245
NM_020748chr1791772 1597 1566 1533 838 683 608 581 462 21883 486 ----
NM_020755chr6101590 1452 1187 1178 1165 1082 666 649 376 277 ----1185
NM_020768chr5103155 3134 2740 2651 2551 2232 2171 2138 296 206 12226 --12413
NM_020772chr17158262 8159 7785 7115 6846 6548 5949 5890 3305 3167 1867 1649 1575 634 262 67920 7488 7171 5424 1516 113 46698 6503 6118 708 17494
NM_020774chr18155832 5812 5803 5032 4608 4195 2256 2109 1421 1219 890 598 503 492 166 35158 2186 579 14381 --
NM_020782chr12134864 4800 4677 4482 3671 3549 3407 3368 3361 1603 828 335 108 34516 787 670 11793 11130
NM_020783chr1872264 1992 1762 1725 826 655 495 11978 2876 262 1130
NM_020810chr1493606 3460 2916 2682 2338 2214 1417 1398 287 11173 --151
NM_020841chr12134061 3936 3271 2616 2603 1634 1344 1294 590 470 462 344 122 1942 11425 --
NM_020844chr8167415 7138 7119 7069 6662 6368 4959 2668 2387 2130 1786 1587 1558 1320 753 293 11442 17355 --
NM_020870chr472018 1830 1573 841 793 396 48 2531 285 --11631
NM_020917chr19143435 3268 3225 3211 2760 2659 2530 2451 1231 1048 918 780 750 313 13233 21225 896 --
NM_020918chr10163602 3567 3525 3479 3289 3024 2989 2566 2389 2259 1211 900 677 663 608 346 23078 2646 12786 --
NM_020935chr2104264 3485 3403 1818 1145 949 719 436 403 252 74171 3771 3695 2938 1255 909 831 --1700
NM_021072chr5132549 2505 2239 2170 1976 1909 1033 1002 741 405 142 111 31 11765 ----
NM_021083chrX83453 3253 3156 2871 2848 2360 1247 651 2776 516 11353 1938
NM_021101chr362316 2048 1944 388 107 57 2329 47 22192 1899 11773
NM_021163chr7123829 3767 3681 3651 3572 3451 3226 2900 1283 708 668 646 11295 22943 1505 --
NM_021191chr1272562 2153 1823 993 617 480 423 32210 474 243 11898 --
NM_021205chr192908 2778 2411 2264 2108 1930 1912 217 193 32707 2143 1941 ----
NM_021255chr14114082 3939 3146 2707 2676 2663 1334 1182 1133 443 120 24126 2969 ----
NM_021629chr3145083 4310 3963 3748 3105 1454 1047 924 784 723 705 423 369 340 24300 3814 14414 --
NM_021647chr4114616 4468 4419 4144 3821 3513 3199 3072 1911 677 625 24596 4409 43776 1476 1332 744 14343
NM_021911chr5185629 5527 5252 4891 4697 4570 4546 4208 4093 3697 3578 3497 3399 1877 1676 967 950 295 11967 35500 4401 4389 --
NM_021914chr1492269 2218 2186 1771 1705 1549 822 306 140 1781 2632 67 --
NM_021961chr11116892 6764 6256 6140 2180 1653 1605 1434 1000 827 622 21061 847 16391 --
NM_021964chr3146605 5384 5353 4454 2627 2584 2278 2064 1941 1815 1752 1389 715 132 35577 2044 77 21874 1149 25190 4239
NM_022133chr861571 1544 1445 622 535 168 1366 1162 11308
NM_022166chr16116108 6024 5980 5966 5902 5122 4948 4063 1198 904 837 --44429 2221 1127 846 14333
NM_022351chr8123382 3352 3218 2954 2823 2753 2395 1398 1012 922 884 304 ----12513
NM_022456chr12247680 7610 7563 7491 7378 7149 6942 6463 5870 5787 5484 3068 2194 1679 1555 1247 1231 1013 775 500 343 261 135 48 16975 ----
NM_022459chr13146351 5988 5748 5086 4908 4808 4730 3906 3848 1773 1344 1116 1039 298 35264 3978 2174 25788 4919 1376
NM_022473chr1594383 4269 3791 3325 3211 2964 1585 499 94 2558 202 --14008
NM_023929chr8132742 2610 2495 2398 2289 2234 1759 1027 953 808 776 366 301 ------
NM_024345chr9135815 5767 5694 5546 5298 5079 4535 3866 3836 2247 2104 582 70 25409 3726 14181 --
NM_024594chr5131890 1750 1740 1729 1528 1231 769 694 633 586 475 176 161 --21709 437 --
NM_024613chr8131830 1820 1762 1604 1581 1396 1271 696 617 519 460 156 62 ----11210
NM_024646chr163187 2829 1534 749 489 63 33830 3478 1362 11237 23415 920
NM_024665chr394281 3584 3281 3001 1598 1259 511 245 130 63578 2957 2919 1734 1370 434 13779 --
NM_024692chr291858 1556 1534 1497 1456 1385 1316 532 67 1679 --1626
NM_024740chr1193711 3462 2665 2657 2544 1629 1493 1212 1001 33907 3899 253 --13518
NM_024761chr9125209 4974 4833 4115 3825 3683 3563 1735 1280 833 630 87 14652 --11401
NM_024770chr2186715 6610 6218 5918 5903 5884 5491 5278 4655 4311 2571 2485 2353 2273 1349 1336 1010 587 35987 4751 2407 11090 1548
NM_024817chr15106007 5964 5900 5141 5095 3613 1541 1510 545 288 --15482 14339
NM_024818chr3101484 1441 1160 1056 575 563 533 518 372 269 ------
NM_024920chr491610 1528 1394 1181 1099 617 431 165 114 21017 185 --11083
NM_024947chr3229381 9328 9147 8983 8759 8453 8176 8028 7426 6977 6098 3525 3336 3083 2767 2541 1558 1210 970 928 441 272 16690 29153 3207 13047
NM_024949chr4145001 4811 4769 4678 4588 3670 3482 3178 2012 1194 1139 1089 922 748 21394 294 --2516 299
NM_024989chr2247679 6881 6786 6519 6507 6445 6407 6366 6268 6257 5807 5794 5211 5018 1866 1768 1702 996 592 492 436 397 280 133 46986 6091 2789 571 21757 165 17755
NM_025054chr894225 4197 4143 3772 3622 2904 2601 797 366 32677 565 357 ----
NM_025073chr1124755 4392 3341 3061 3007 1681 1575 1428 1204 801 741 609 33305 3233 2989 13238 --
NM_025146chr3122746 2679 2657 2548 2429 2408 2292 1920 1853 1058 777 543 11903 --12349
NM_025180chr3103381 3319 3095 656 643 378 318 299 93 30 --167 1847
NM_025191chr173279 2780 2744 2671 2569 2390 2312 2748 208 1358 1829
NM_030579chr1663335 2847 2484 1410 1161 619 --11311 33257 2774 2536
NM_030625chr10122655 2640 2403 2202 1970 1797 1715 838 652 525 512 244 11770 12218 --
NM_030627chr5104085 2757 1551 1468 1441 1021 709 701 317 303 13581 11200 --
NM_030647chr7176123 5661 5514 5117 4985 4927 4123 2295 2077 1729 1621 1578 1489 1281 1112 863 415 44996 4110 2426 1550 45888 5498 1788 1776 11204
NM_030648chr495234 4992 4095 2071 1861 1501 1240 781 532 34080 2224 614 --25270 36
NM_030674chr12225837 5264 5251 5239 5178 4982 4946 4718 4508 4438 4364 4227 4143 4044 2251 1543 1454 753 516 469 370 107 45795 2266 1660 127 35190 2056 1200 15025
NM_030780chr871703 1528 1474 1460 1271 1144 396 31176 1120 315 2683 216 --
NM_030806chr1148940 8303 8268 6668 6103 6022 5777 3679 2716 2401 1855 1296 175 45 11789 12374 35929 2362 553
NM_030816chr193449 2797 2648 2534 1066 655 586 408 323 23038 71 22358 148 23007 2505
NM_030962chr1171472 1432 1195 1121 1024 302 167 154 11255 11341
NM_031418chr11122736 2429 2309 2126 900 887 666 451 264 158 129 48 12807 12667 --
NM_031427chr14175981 5940 5547 5048 4993 4873 4527 4265 3887 2395 2372 2151 2118 1403 1060 556 489 35566 4699 4615 14366 --
NM_031431chr1371561 1493 1434 448 337 257 245 1324 1293 1152
NM_031435chr12103267 3235 3144 2506 1256 988 610 573 108 50 13304 33384 2598 881 23124 1048
NM_031438chr561974 1935 1754 392 324 129 21910 1763 --11657
NM_031442chrX52401 2138 2060 1961 838 32585 2325 1168 31999 1225 1072 --
NM_031483chr2073200 2697 2428 2236 2170 1182 584 43404 2820 2478 1081 12251 12545
NM_031845chr2113272 3168 3123 2478 2270 1311 596 501 469 162 25 33279 3035 905 ----
NM_031847chr2113272 3168 3123 2478 2270 1311 596 501 469 162 25 33279 3035 905 ----
NM_031911chr462482 1898 1867 925 467 196 22442 915 21792 936 12553
NM_032102chr1162803 2707 2382 1052 713 310 22812 2692 22751 908 12682
NM_032105chr1168064 5992 5535 5505 3144 3027 2803 2512 1717 1440 1335 1311 1164 797 133 96 16146 37317 5680 1410 35452 5396 226
NM_032116chr13165358 5088 4993 4120 4022 1771 1724 1417 1279 1027 886 606 469 317 300 164 34760 3625 1214 ----
NM_032160chr18133736 3034 2970 2891 2773 2743 1078 961 667 658 586 574 157 13553 23082 532 13513
NM_032321chr2123146 2990 2889 2589 2435 2267 2174 849 721 641 311 153 21289 905 12941 --
NM_032373chr10215742 5524 5153 4620 4571 4255 3617 3587 2227 2217 2162 2132 1942 1812 1550 1421 1193 1149 459 405 346 45456 4416 1957 1066 15208 --
NM_032446chr5103798 3315 3236 2836 2598 2427 1324 1006 834 670 21556 1389 1661 11363
NM_032457chr4133949 3854 3822 3480 2941 2566 2532 2376 1336 1130 1042 581 483 33368 2426 1003 12729 --
NM_032458chrX133113 3087 3071 3030 2903 2890 2562 2330 1331 860 798 618 69 32925 2618 2182 ----
NM_032778chr363101 2919 2774 2162 651 629 23327 739 12091 13117
NM_032826chr7145059 4989 4965 4281 4000 3928 3846 3825 3637 2096 2061 1833 1474 1282 33667 201 179 25223 4747 --
NM_032859chr13203633 3580 3511 3447 3397 3240 3123 2869 2629 2584 1567 1553 1495 1238 663 500 445 335 316 150 12852 33056 1542 1255 21103 735
NM_032968chrX134156 4053 3736 3326 3243 2941 2853 1304 1255 1219 1164 803 378 43338 2750 365 111 ----
NM_032969chrX134156 4053 3736 3326 3243 2941 2853 1304 1255 1219 1164 803 378 43338 2750 365 111 ----
NM_032973chrY134148 4045 3728 3321 3238 2936 2848 1304 1255 1219 1164 803 378 43333 2745 365 111 ----
NM_033020chr1163809 3400 3323 3303 3129 2973 1788 1206 1198 1190 983 686 480 243 162 97 23148 1541 1294 --
NM_033143chr4114642 4042 3820 3700 3303 1743 1444 1380 1267 306 33 33986 3309 1510 11604 13641
NM_033181chr6143830 3421 3351 2974 2931 2549 2538 1541 1512 950 644 595 416 361 1982 33124 1039 256 --
NM_033224chr7237933 7616 7308 7048 6719 6130 5889 5773 5484 3211 2550 2233 1865 1813 1567 1515 1131 946 769 736 658 563 150 48046 2606 1903 1500 66372 5767 5392 4976 3230 3074 1324
NM_033360chr12104660 4091 4030 3618 3467 2962 2827 1655 1221 1038 2742 507 23296 857 --
NM_033430chr484199 3794 3267 2972 2943 982 495 406 21661 553 12709 21298 776
NM_033437chr484199 3794 3267 2972 2943 982 495 406 21661 553 12709 21298 776
NM_033505chr2206493 6146 6128 5933 5878 5736 5561 5457 5004 4269 2333 2301 2157 1654 1520 1336 982 639 530 27 12522 --21635 1624
NM_033656chr21165984 5154 4800 4486 3983 3887 3806 2303 2290 2162 2015 1310 1209 1024 271 99 23916 1789 21700 577 2862 37
NM_052879chr12103863 3823 3248 3115 3003 2963 2734 1648 1151 1013 21384 793 ----
NM_052885chr1294046 1907 1570 1544 1355 1123 1041 838 748 14489 34022 3940 262 23726 3407
NM_052907chr12144246 4235 4105 3781 3385 2881 2755 1618 1570 1548 1485 1199 317 185 21105 1008 ----
NM_053016chr9177262 6495 6260 6012 5467 2575 2498 1984 1943 1801 1775 1611 1428 1334 926 648 606 46947 6314 5339 1593 36377 6065 2290 16031
NM_053042chr4143033 2732 2591 2562 2532 2517 2354 2181 1960 1133 161 132 98 83 11152 1513 12101
NM_080550chr171247 31036 331 73 --2998 414
NM_080676chr20103155 3124 2659 2628 2588 2382 2223 596 491 54 --12973 12477
NM_080867chr14114301 4202 4034 3687 3373 1944 1729 1581 1049 1004 735 84281 4262 3974 3356 1357 1303 667 195 14637 15003
NM_080927chr3103297 3192 3185 3172 2518 2259 2122 974 913 391 22661 1340 ----
NM_130831chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_130832chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_130833chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_130834chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_130835chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_130836chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_130837chr3102765 2711 2466 2283 2068 1077 544 395 373 238 32208 1824 910 ----
NM_133170chr20117360 6534 5957 5519 5291 4942 3173 3013 2123 1227 258 37105 1598 1113 25678 2971 27011 1944
NM_133334chr4116395 6256 5984 5694 5374 4608 4193 1595 1380 1125 460 ----15911
NM_133372chr562582 2282 1927 675 341 37 11176 1376 1603
NM_133474chr491686 1462 1397 1272 1261 1246 1092 519 321 --11532 --
NM_133477chr473248 3089 2874 2100 911 441 403 33202 2236 983 --11016
NM_133493chr6124535 3959 3291 3178 3161 3028 2971 1534 1236 639 329 301 34125 3921 1588 11287 --
NM_133646chr2125197 4848 4548 4306 4286 3515 3472 1858 1811 1641 769 207 15311 54412 3727 3390 1148 474 11266
NM_138348chr5146485 6229 6122 4932 4832 4732 4559 4259 2179 1845 1736 1427 1136 312 ----24513 2195
NM_138444chr13114925 4892 4750 4662 4068 3931 3621 1723 1678 1605 1538 21550 638 14111 --
NM_138459chr6173340 3003 2928 2887 2872 2469 1430 1157 1132 772 557 397 299 274 247 225 212 21303 883 11049 --
NM_138468chr2106235 6188 6061 5419 4431 4304 4196 4067 903 306 36276 5885 401 36214 677 454 --
NM_138621chr283996 3322 3151 2858 2600 1555 930 24 ----2598 348
NM_138638chr1492269 2218 2186 1771 1705 1549 822 306 140 1781 2632 67 --
NM_138713chr16207871 7602 7311 7112 6934 6722 6674 6510 6386 6243 6009 5986 5539 5403 5092 2735 2686 2346 1503 1143 --36859 6294 1982 --
NM_138714chr16207871 7602 7311 7112 6934 6722 6674 6510 6386 6243 6009 5986 5539 5403 5092 2735 2686 2346 1503 1143 --36859 6294 1982 --
NM_138731chr14124031 3645 2849 2746 1707 1564 1182 1115 999 993 923 141 21150 1034 13404 11142
NM_138782chr572187 1825 1516 1480 392 181 166 1436 12030 --
NM_138959chr1136837 6222 6045 5327 5222 4463 4329 4157 4132 2707 1890 495 54 11196 46705 5583 4138 1903 --
NM_139169chr10102087 2035 1802 1643 898 721 568 525 217 178 21637 636 ----
NM_139207chr1272210 1960 1555 431 379 311 255 11987 22045 2013 1888
NM_139279chr293462 3108 2844 2415 2337 834 469 162 153 13151 1179 --
NM_139321chr20124252 3941 3758 3739 3687 3292 3055 2885 1669 994 883 215 64260 3530 1450 1423 809 378 185 13813
NM_144571chr4147028 5947 5890 5863 5126 5016 4991 4280 4257 2739 2397 1121 709 80 32292 2069 788 24850 2568 --
NM_144578chr14175546 5257 5034 4802 4742 4137 3914 3590 1953 1843 1717 1641 1538 798 269 203 42 11727 24819 2060 25536 3516
NM_144599chr15103332 2147 1813 1668 1335 1229 1148 838 792 363 35284 1783 580 21893 34 21797 76
NM_144721chr4112753 2702 2332 2317 2225 1909 1029 844 715 672 287 --1925 12640
NM_144775chr1764931 4849 4548 4527 3995 1106 13087 --23467 1438
NM_144973chr12115038 4855 4650 4379 4336 4167 3275 2043 1948 693 306 31910 1200 195 23905 1935 1978
NM_145055chr18103810 3529 3451 2764 2711 1284 1154 524 334 228 33857 724 513 --12495
NM_145207chr4144955 4812 4256 4122 3936 3757 3677 3610 3579 1666 1108 606 469 111 25204 3830 33717 3572 1738 --
NM_145259chr2216858 6771 6671 6643 5899 5342 5241 4618 2714 2136 1943 1812 1774 1564 1509 1102 923 787 687 660 261 21953 1193 25216 2002 12621
NM_145284chrX92511 2491 2257 2249 2057 2048 854 759 579 12211 --12119
NM_145307chr10114364 4298 4012 3438 3134 2915 1407 1243 1057 706 639 33113 3007 1385 1695 13967
NM_145728chr1572493 2140 2101 1743 1695 763 413 12044 31766 489 482 --
NM_148174chr841977 1810 1415 853 2872 269 11926 22240 626
NM_148955chr15166281 6232 6125 5657 5196 4878 4759 4537 3996 2493 2330 1803 956 456 324 202 25836 5663 25011 540 14769
NM_152352chr1893130 2969 2929 1213 1048 369 193 132 104 4881 610 550 507 ----
NM_152409chr573267 3093 2679 2666 766 619 357 33531 2696 305 22960 2593 --
NM_152622chr593508 3356 3334 3185 2453 2169 1048 447 187 43247 3175 1337 574 --11114
NM_152624chr5156806 6692 6048 5846 4703 4674 2773 2522 1988 1698 1486 716 571 321 100 16758 46445 5527 4692 2745 --
NM_152629chr963549 3298 3205 1618 1306 318 --34039 3396 3215 23794 806
NM_152636chr1193082 3034 2679 2304 2230 2208 633 257 21 32604 2124 29 --22698 1893
NM_152641chr1262935 2313 936 668 335 324 2631 608 --1366
NM_152754chr7103812 3792 3094 2973 2862 1210 964 449 296 235 23348 2797 13365 23671 2966
NM_152756chr594240 3976 3310 3297 3030 2986 2945 1522 1254 11320 --11326
NM_152774chr7102713 2568 2247 1802 995 790 500 378 277 263 11012 1853 --
NM_152787chrX93452 2974 2867 2454 1533 1330 367 343 165 13627 13059 21306 215
NM_152793chr784814 4565 3246 1859 1661 1168 408 137 14586 44918 3674 3595 100 22064 1951
NM_152826chr15166281 6232 6125 5657 5196 4878 4759 4537 3996 2493 2330 1803 956 456 324 202 25836 5663 25011 540 14769
NM_152836chr861571 1544 1445 622 535 168 1366 1162 11308
NM_152837chr861571 1544 1445 622 535 168 1366 1162 11308
NM_152924chr15146682 5690 5249 4385 4307 2636 2512 2193 2087 1601 1594 995 746 325 --25323 5279 --
NM_152999chr7115009 4844 4243 3831 3722 3664 3593 1076 994 635 521 21691 425 ----
NM_153182chr363101 2919 2774 2162 651 629 23327 739 12091 13117
NM_153188chr5204825 4536 4395 4356 4080 4071 4019 3737 3687 3589 1131 1106 924 725 672 632 438 325 235 125 35527 3540 1802 ----
NM_153207chr12143968 3911 3217 2976 2879 2505 1597 1555 1188 1131 1071 498 470 195 1525 13390 21021 180
NM_153332chr872909 2613 2383 2165 962 652 408 11252 --32493 789 138
NM_153456chr13236183 6160 6145 6042 5107 4794 4473 4350 4160 3947 2371 1938 1856 1833 1799 1355 1273 1106 1023 909 723 318 217 25017 1665 ----
NM_153689chr292312 1896 1776 1707 1678 463 403 329 258 ----11961
NM_153810chr1095123 4992 4434 3970 3864 2044 1863 1538 1036 34141 1232 735 34167 1096 218 --
NM_172070chr262224 1592 905 885 496 289 31844 1403 658 21515 642 --
NM_172071chr196917 6169 5324 5070 4569 4540 2727 1525 1101 47405 6941 996 702 47146 2645 1112 368 17061
NM_172193chr1461283 1229 1168 988 503 487 ----1959
NM_173214chr16207871 7602 7311 7112 6934 6722 6674 6510 6386 6243 6009 5986 5539 5403 5092 2735 2686 2346 1503 1143 --36859 6294 1982 --
NM_173468chr4206094 6023 5689 5443 5425 5344 5096 4985 4434 3919 2192 2121 2028 1893 1750 1564 1511 1276 716 525 55658 4178 1860 1647 990 34288 4183 1579 --
NM_173511chr263397 3004 2893 2870 1527 731 33958 3769 2986 23061 1022 12693
NM_173536chr4234902 4879 4803 4564 4240 4167 4107 3816 3257 2080 2037 1879 1708 1589 1400 1328 840 791 466 317 162 152 121 34959 4349 3665 24964 4742 --
NM_173582chr11155653 5646 4740 4540 4271 1843 1768 1576 1097 1046 859 782 445 199 179 11022 55866 2274 1882 523 185 13889
NM_173642chr1148545 8374 7971 7941 7487 3580 3533 3092 2608 1660 1240 747 330 155 66388 6346 3405 2569 1800 1552 13517 --
NM_173644chr2061924 1784 1332 1289 720 622 --21835 1258 2583 308
NM_173694chrX82459 927 792 558 535 509 315 218 1397 --42120 676 438 373
NM_173808chr1104478 4409 3767 3559 3515 3475 2787 1705 1620 1261 13234 11516 --
NM_173829chr5176033 5783 5509 5454 5003 4861 4587 3890 2262 2182 1980 1695 1680 852 640 481 317 24773 768 26077 2010 --
NM_173851chr8103694 3623 3380 3223 822 667 533 443 385 262 --22751 1489 --
NM_174911chr8143628 3290 3015 2958 2727 2654 2643 2566 2426 1454 1050 946 621 145 23493 2465 1879 12662
NM_175623chr12247680 7610 7563 7491 7378 7149 6942 6463 5870 5787 5484 3068 2194 1679 1555 1247 1231 1013 775 500 343 261 135 48 16975 ----
NM_175624chr12237775 7705 7658 7586 7473 7244 7037 6558 5965 5882 5579 2289 1774 1650 1342 1326 1108 870 595 438 356 230 143 17070 ----
NM_175625chr12237775 7705 7658 7586 7473 7244 7037 6558 5965 5882 5579 2289 1774 1650 1342 1326 1108 870 595 438 356 230 143 17070 ----
NM_175736chr12117332 7190 6914 6848 6514 6475 5744 5075 5054 2720 2031 26159 5964 --12135
NM_175861chr12155793 5517 4868 4808 4702 4229 2128 2072 1608 1340 871 828 406 367 352 --22138 1167 --
NM_175907chr1862224 1911 1026 720 134 40 32200 2017 525 2607 482 1659
NM_176081chr10136029 5798 5657 5599 5298 4619 4404 1881 1866 1613 1457 1127 259 15685 11377 --
NM_176083chr10136029 5798 5657 5599 5298 4619 4404 1881 1866 1613 1457 1127 259 15685 11377 --
NM_177538chr2108782 6642 6520 6491 3211 3183 2665 2308 2292 1845 48649 8167 1104 372 18094 28623 8114
NM_178151chrX127426 7386 7243 6466 5777 2855 2435 1727 1403 1254 1146 572 67316 6775 6379 2345 1631 640 22794 1384 22789 216
NM_178152chrX127426 7386 7243 6466 5777 2855 2435 1727 1403 1254 1146 572 67316 6775 6379 2345 1631 640 22794 1384 22789 216
NM_178153chrX127426 7386 7243 6466 5777 2855 2435 1727 1403 1254 1146 572 67316 6775 6379 2345 1631 640 22794 1384 22789 216
NM_178509chr1774093 3734 3442 3212 1389 916 86 --34062 2794 630 22617 124
NM_178566chr9101855 1734 1673 1661 1576 1484 669 634 288 246 11727 ----
NM_180989chr1382174 1934 1883 522 510 259 191 181 12226 ----
NM_181358chr1124275 4206 4027 3674 3489 3474 2999 2930 2736 1099 931 691 ----14110
NM_181443chr20102821 2660 2645 1929 1775 1060 1031 719 570 368 2988 487 --12395
NM_181481chr18165665 5546 4940 2700 2613 2494 2125 1967 1286 1105 1029 846 797 680 296 180 15157 15097 --
NM_181482chr18165665 5546 4940 2700 2613 2494 2125 1967 1286 1105 1029 846 797 680 296 180 15157 15097 --
NM_181483chr18165665 5546 4940 2700 2613 2494 2125 1967 1286 1105 1029 846 797 680 296 180 15157 15097 --
NM_181504chr562620 1147 1009 985 766 290 32794 742 664 23719 157 13662
NM_181521chr16147228 6805 6289 6133 6102 5779 5203 4640 2888 1879 1848 670 350 328 17298 22417 2114 --
NM_181523chr562620 1147 1009 985 766 290 32794 742 664 23719 157 13662
NM_181524chr562620 1147 1009 985 766 290 32794 742 664 23719 157 13662
NM_181659chr2083377 2793 2535 2206 1338 653 635 238 33335 1326 959 1770 12312
NM_181659chr2083377 2793 2535 2206 1338 653 635 238 33335 1326 959 1770 12312
NM_181705chr5205237 4838 4473 4351 4325 4286 3764 3746 3543 2153 1772 1401 955 793 745 638 368 270 125 74 34101 3686 598 45001 4445 4235 666 33708 3643 545
NM_181706chr1162013 2006 1740 1505 749 21 21800 217 --2609 84
NM_181714chr62173 43 --21217 803 2244 150
NM_181787chr873846 3475 3381 1566 845 102 39 53357 2964 2658 762 517 --23306 160
NM_181869chr12102649 2613 2300 2208 1928 1905 1805 1082 383 90 ----12104
NM_182485chr493448 3290 3239 2443 2377 1308 530 426 87 11296 13688 --
NM_182508chr1382659 2610 2508 2445 1813 1042 995 691 11718 --12241
NM_182551chr2153602 3358 3295 2970 2912 2772 2707 2200 967 882 803 706 700 232 47 1513 23241 2942 --
NM_182646chr493448 3290 3239 2443 2377 1308 530 426 87 11296 13688 --
NM_182762chr7165715 4534 4459 4414 4304 4177 2266 1813 1688 1678 1579 1506 1459 934 696 633 26270 1453 --26185 5476
NM_194071chr7105494 4771 4637 4016 2111 1490 1449 1263 914 731 --14362 24028 3564
NM_194247chr294463 4420 3933 1821 1803 1572 1245 661 358 23258 623 24179 2927 --
NM_194283chr5154239 3946 3904 3788 3550 3328 3186 2997 2839 1627 1458 1393 947 570 286 ------
NM_194285chr1193342 3108 3052 2938 2475 1349 1274 848 557 1566 --13267
NM_194286chr1285422 5272 4632 4403 3898 1587 1363 90 24980 654 35311 809 630 25234 4948
NM_194314chr1174524 4503 4489 3838 3554 3503 2252 2230 2023 1794 1662 1633 1579 1384 824 644 294 35388 4798 1044 34783 3630 1179 --
NM_194434chr18195164 5090 4848 4664 4600 4345 4331 3776 3602 2205 2177 2095 1730 1475 1465 1420 1039 421 381 35616 1282 852 55554 5272 4924 4871 447 24462 2299
NM_198066chr1452990 2120 569 233 67 1834 --21904 562
NM_198268chr1124275 4206 4027 3674 3489 3474 2999 2930 2736 1099 931 691 ----14110
NM_198269chr1124275 4206 4027 3674 3489 3474 2999 2930 2736 1099 931 691 ----14110
NM_198270chrX83427 2799 1391 1238 1209 965 704 202 53061 2476 2187 485 269 ----
NM_198273chr5113002 2898 2829 2601 2239 2208 2062 1995 1053 819 247 --1639 1573
NM_198281chr4123487 2940 2927 2607 2581 2230 1200 931 808 581 482 399 --1301 12962
NM_198320chr1274413 4360 4258 4154 3232 1128 792 34649 3960 747 43560 3305 636 261 1135
NM_198329chr3101484 1441 1160 1056 575 563 533 518 372 269 ------
NM_198465chrX92892 2835 2670 2626 2556 2155 2017 159 144 ----1846
NM_198484chr3126007 5818 5607 4189 4077 1594 1178 1108 834 688 634 181 1487 35840 4119 1297 15040
NM_198503chr192278 1989 1815 1613 1543 841 211 137 89 ----11727
NM_198549chr1122988 2943 2720 2693 2398 2386 787 759 596 258 241 40 22916 2137 ----
NM_198581chr2137450 7284 6136 4965 2802 2453 2444 2313 2004 1827 1634 1504 941 56776 6738 1959 1747 642 36020 1328 715 25937 2587
NM_198715chr1196215 6175 6111 6102 5399 5358 4936 4903 4545 4154 3883 2506 2274 2218 1925 1761 639 169 131 45113 1683 1518 1087 ----
NM_198859chr394643 4530 4160 2039 1594 1446 1240 839 542 15120 34367 4286 3350 14281
NM_198900chr12117332 7190 6914 6848 6514 6475 5744 5075 5054 2720 2031 26159 5964 --12135
NM_199188chr12103863 3823 3248 3115 3003 2963 2734 1648 1151 1013 21384 793 ----
NM_199190chr12103863 3823 3248 3115 3003 2963 2734 1648 1151 1013 21384 793 ----
NM_199320chr442515 2317 1161 276 12325 11062 22661 759
NM_199320chr442515 2317 1161 276 12325 11062 22661 759
NM_199421chr14114301 4202 4034 3687 3373 1944 1729 1581 1049 1004 735 84281 4262 3974 3356 1357 1303 667 195 14637 15003
NM_199436chr2103127 3073 2518 2323 2083 2056 1953 914 661 408 32552 2497 698 ----
NM_201263chr151545 1316 743 732 611 --21556 108 21867 764
NM_203329chr1175429 5257 1896 1847 1539 1297 559 56264 2110 1429 145 96 1224 15840
NM_203330chr1175429 5257 1896 1847 1539 1297 559 56264 2110 1429 145 96 1224 15840
NM_203331chr1175429 5257 1896 1847 1539 1297 559 56264 2110 1429 145 96 1224 15840
NM_203390chr861852 1454 1231 507 141 103 2518 127 1398 1310
NM_203458chr1113303 3177 2641 2610 2581 2538 1514 1489 1077 920 886 33499 999 394 12395 11142
NM_203459chr1102119 1821 1750 1694 1012 496 482 476 323 212 1230 ----
NM_203463chr2154758 4519 3968 3696 3592 3543 3248 3221 1751 1512 1218 858 458 135 52 ----1642
NM_205768chr192017 1757 1681 802 575 488 236 141 101 4474 379 202 50 ----
NM_206594chr1103592 3266 2918 2912 2847 2829 2795 2414 1293 936 11045 2897 404 --
NM_206595chr1103592 3266 2918 2912 2847 2829 2795 2414 1293 936 11045 2897 404 --
NM_206853chr6143993 3932 3784 3725 3521 3142 2978 2525 1235 1227 861 557 495 413 24134 1458 13154 --
NM_206854chr6135254 5193 5045 4986 4782 4403 4239 3786 3535 2122 1818 1756 1674 25395 3344 34415 3650 776 --
NM_206855chr6176219 6158 6010 5951 5747 5368 5204 4751 4500 4192 3960 935 798 755 395 148 46 26360 4309 45380 4615 1741 786 --
NM_206866chr2192897 2822 2545 2255 608 496 359 299 183 21233 684 21071 793 --
NM_206876chr2123297 3291 3054 2938 2889 2814 2797 2745 2323 1321 1233 466 --13193 --
NM_206909chr8168420 8362 8332 8128 7986 7868 7488 6917 5995 5536 5308 3198 2244 1284 1108 43 --37452 6904 1595 26843 893
NM_207015chr362244 1875 1801 1541 930 521 --1229 21630 404
NM_207306chr123993 3115 241388 1352 1316 1280 1244 1208 1172 1136 1100 1028 992 956 920 852 816 780 744 708 672 636 600 564 528 456 13109 --
NM_207406chr4126323 5679 5605 5067 4340 4208 2524 2494 1737 1728 271 197 34439 1303 140 35741 1675 328 --
NM_207429chr1162638 2279 1039 913 306 82 1104 --22012 2007
NM_212460chr782046 1931 1587 1397 1260 485 418 304 162 31516 766 701 --
NM_213589chr2135409 5161 4529 4381 4014 3972 3823 1537 1495 1453 1018 646 269 15386 --1446