TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-138-5p
miRNA Sequence: AGCUGGUGUUGUGAAUCAGGCCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr822022 1561 11592 12524 1969
NM_000038chr51385 11404 ----
NM_000052chrX----1172 --
NM_000081chr1--1349 2228 66 --
NM_000084chrX46691 6146 1785 143 ----26396 1063
NM_000090chr22777 78 ----2874 345
NM_000092chr233793 1165 580 --13003 13334
NM_000127chr8------186
NM_000141chr1021291 959 2275 141 ----
NM_000165chr631673 1479 72 11367 ----
NM_000168chr752907 2686 2228 2160 1194 12926 12950 --
NM_000176chr523689 1054 --1315 --
NM_000202chrX43516 2407 1175 215 12649 ----
NM_000210chr212259 12048 ----
NM_000212chr173367 355 32 2831 735 ----
NM_000216chrX33216 3156 542 --1206 --
NM_000217chr1285112 4650 3724 3508 1288 774 496 467 11870 ----
NM_000222chr421896 1298 1664 1168 --
NM_000259chr1596253 5100 4579 4558 4367 2007 1480 1127 965 14266 ----
NM_000264chr933052 951 799 --11350 --
NM_000284chrX52003 1883 1492 628 41 --11863 --
NM_000297chr431814 1269 489 ------
NM_000304chr1721129 904 --1249 --
NM_000315chr11----1137 --
NM_000328chrX1147 ------
NM_000330chrX11930 --11981 --
NM_000332chr676760 6736 4648 2810 2216 761 528 27164 4666 36938 6316 5978 --
NM_000337chr5115631 4647 4429 4349 3995 2049 1788 1345 1173 612 69 25034 752 11292 --
NM_000346chr1721623 1274 ------
NM_000368chr984730 4610 4461 1950 1874 1266 1233 1081 33465 2979 1622 ----
NM_000393chr21780 ----1121
NM_000408chr252397 1381 1093 161 120 1823 ----
NM_000448chr1143149 2819 2557 611 ------
NM_000461chr323646 575 23520 3286 1286 1271
NM_000484chr212964 182 ------
NM_000489chrX23274 2850 13200 ----
NM_000492chr731245 343 330 11391 11433 --
NM_000503chr83543 403 180 11285 21593 77 --
NM_000522chr71803 11137 1232 --
NM_000555chrX87780 7605 6885 6019 5983 5747 1860 600 --12290 --
NM_000599chr244407 3573 1270 60 1578 54091 4077 3804 3222 1393 --
NM_000602chr731423 1336 1165 ------
NM_000609chr1082509 2387 2155 1077 1046 845 421 54 ------
NM_000612chr1143522 2850 2504 74 23219 568 --11199
NM_000615chr1142225 2169 404 57 12674 ----
NM_000617chr122279 36 22013 649 ----
NM_000627chr2--1210 ----
NM_000633chr1841683 938 911 197 ----14217
NM_000660chr191282 ------
NM_000675chr223558 227 66 ----1248
NM_000725chr124336 230 98 87 ------
NM_000780chr841155 429 112 28 --1132 --
NM_000793chr1444848 4785 4303 1048 13817 34795 1955 1896 --
NM_000807chr41528 1135 ----
NM_000809chr498988 7307 6941 6671 6589 5865 5814 3262 1142 1838 ----
NM_000813chr595349 5110 4762 4590 4559 3686 2213 812 49 33613 3532 1037 21990 893 --
NM_000814chr1533654 1428 1382 --13814 13351
NM_000831chr1105430 5373 4971 4817 4752 3984 1613 1390 227 175 55213 4653 1798 1526 160 1882 --
NM_000844chr32128 101 ----1211
NM_000861chr332717 2301 607 1186 ----
NM_000866chr311753 21237 707 ----
NM_000868chrX11744 12182 ----
NM_000875chr15106582 5808 4976 4580 2477 2225 1942 1810 840 290 ------
NM_000891chr1712627 13278 21226 622 --
NM_000901chr411816 --12267 --
NM_000902chr362497 2242 1090 552 389 288 ------
NM_000924chr122351 65 --1899 154
NM_000926chr1167043 6278 6220 3782 3061 2437 16029 27816 3240 12287
NM_000933chr2041338 531 502 405 ------
NM_000944chr4--182 ----
NM_000950chrX33234 2897 1182 23418 2265 ----
NM_000959chr133016 2423 1001 11069 ----
NM_000964chr1721318 344 --184 21068 336
NM_000965chr321154 212 ------
NM_000977chr162394 353 ------
NM_000981chr17151 ------
NM_001001323chr1242676 2194 1980 544 --1313 --
NM_001001330chr101349 1937 1516 --
NM_001001349chr1751233 1198 1160 686 123 --31262 410 384 --
NM_001001395chr122654 435 ------
NM_001001396chr151500 1129 994 740 278 ------
NM_001001419chr541782 1379 1164 424 11259 ----
NM_001001420chr541782 1379 1164 424 11259 ----
NM_001001436chr16------148
NM_001001481chr813491 12994 --1909
NM_001001484chr102310 157 ----11497
NM_001001549chr772490 1991 1983 1771 884 847 134 ------
NM_001001550chr772490 1991 1983 1771 884 847 134 ------
NM_001001555chr772490 1991 1983 1771 884 847 134 ------
NM_001001557chr852136 1633 717 690 191 ----11536
NM_001001664chr221478 1193 1461 1306 --
NM_001001711chr1141115 909 275 98 ----1411
NM_001001790chr9--1412 ----
NM_001001928chr2276581 6216 5088 3301 2095 2024 1860 52275 1812 418 173 143 47498 3034 2358 1092 --
NM_001001994chrX1358 ------
NM_001001995chrX41679 1252 542 53 ------
NM_001001996chrX1358 ------
NM_001002837chr22--1181 ----
NM_001002860chr1473241 2915 909 775 506 92 78 14470 13504 --
NM_001002909chr171397 21969 83 --1255
NM_001003406chr2242883 1241 685 503 --23293 2212 --
NM_001003407chr1064038 2042 1461 629 546 167 15064 11747 --
NM_001003408chr1064038 2042 1461 629 546 167 15064 11747 --
NM_001003652chr1898208 7596 7466 7352 7228 6612 6176 2264 1774 27788 1203 28121 825 1796
NM_001003674chr18147090 6123 6108 5869 5788 5765 5557 5399 5354 5260 1508 1439 1352 431 14426 34418 2216 2092 --
NM_001003675chr18147090 6123 6108 5869 5788 5765 5557 5399 5354 5260 1508 1439 1352 431 14426 34418 2216 2092 --
NM_001003698chr631978 1897 1581 137 11760 --
NM_001003699chr631978 1897 1581 137 11760 --
NM_001003712chr1233544 3311 57 1964 ----
NM_001003796chr22133 --2869 346 --
NM_001003800chr942803 2728 1197 421 ----1150
NM_001003845chr2--1526 ----
NM_001003940chr1593544 2694 1098 784 606 537 523 305 32 ------
NM_001003942chr1593544 2694 1098 784 606 537 523 305 32 ------
NM_001003943chr1593548 2698 1102 788 610 541 527 309 36 ------
NM_001004051chrX128 ------
NM_001004065chr951225 1164 459 332 182 --1433 --
NM_001004127chr133711 259 168 1669 ----
NM_001004304chr1252864 2854 2126 2080 145 12715 1759 --
NM_001004317chr674071 3488 3367 3141 1498 1229 846 13101 13547 --
NM_001004360chr221918 1555 1147 ----
NM_001004419chr1242967 1119 705 457 14509 1874 --
NM_001004439chr1551285 1179 1057 1033 105 --2878 44 --
NM_001005158chr31114 ------
NM_001005159chr31114 ------
NM_001005354chr12----137 --
NM_001005386chr22987 337 ------
NM_001005404chr1743435 1712 1054 158 32823 2789 836 ----
NM_001005473chr566472 6461 5778 5649 4563 572 36100 4814 251 ----
NM_001005741chr11437 --1500 --
NM_001005742chr11437 --1500 --
NM_001005743chr142851 35 1502 ----
NM_001005744chr142851 35 1502 ----
NM_001005745chr142851 35 1502 ----
NM_001006600chr511631 ------
NM_001006618chr91195 ------
NM_001006636chr21863 ------
NM_001006665chr12502 127 ----1597
NM_001006684chrX1513 1134 ----
NM_001006932chr642659 2467 1075 700 136 32229 2102 199 --
NM_001007023chr1444848 4785 4303 1048 13817 34795 1955 1896 --
NM_001007024chr1794074 3770 3764 3454 3261 2795 1224 1208 1174 1108 ----
NM_001007025chr1794074 3770 3764 3454 3261 2795 1224 1208 1174 1108 ----
NM_001007067chr82332 93 --1696 --
NM_001007068chr82332 93 --1696 --
NM_001007069chr82332 93 --1696 --
NM_001007070chr82332 93 --1696 --
NM_001007097chr974111 3781 3771 3545 1986 1814 1415 2698 503 ----
NM_001007102chr6------2662 28
NM_001007156chr1531422 295 154 --2318 128 --
NM_001007226chr1731019 553 71 11277 ----
NM_001007227chr1731019 553 71 11277 ----
NM_001007228chr1731019 553 71 11277 ----
NM_001007229chr1731019 553 71 11277 ----
NM_001007230chr1731019 553 71 11277 ----
NM_001007257chr13571 451 111 ------
NM_001007466chr674008 3843 1908 1268 1020 875 692 --1495 14860
NM_001007553chr1----1131 --
NM_001008405chr711688 1189 ----
NM_001008539chr875293 3625 1705 1408 858 701 209 14324 13354 179
NM_001008564chr1331539 594 511 11401 ----
NM_001008701chr1962421 2297 2184 1107 1007 986 --31223 220 207 --
NM_001008707chr1421602 172 --11314 11341
NM_001008897chr6--1477 ----
NM_001008925chr443361 2913 774 29 23133 177 11399 --
NM_001009554chr471640 1247 1115 939 221 202 92 --13471 1575
NM_001009554chr471640 1247 1115 939 221 202 92 --13471 1575
NM_001009555chr44565 493 482 127 1331 ----
NM_001009899chr365313 5264 4028 1939 1858 541 14602 1848 --
NM_001009960chr75361 229 149 135 67 22734 2015 --22594 1081
NM_001009993chr244185 4152 3565 1004 ----11718
NM_001010854chr142198 58 1306 1486 --
NM_001010861chr122081 159 11740 ----
NM_001010888chrX41187 785 713 371 ------
NM_001010895chr911568 ----1442
NM_001010898chr173579 3318 3153 2971 2635 1265 87 --13065 --
NM_001010917chr1051747 1698 628 417 75 11507 ----
NM_001010986chrX2829 483 ----12262
NM_001011513chr422657 609 ----12893
NM_001011553chr7258 47 --193 --
NM_001011666chr795602 4834 2630 1168 934 919 463 250 207 15964 24889 1115 --
NM_001011705chr13140 ------
NM_001011713chr14--1318 ----
NM_001012267chr92770 718 11475 ----
NM_001012329chr121893 926 --21864 180 1778
NM_001012393chr1153974 3802 1335 1273 80 --23849 1751 11042
NM_001012426chr613296 2219 135 52788 2412 2089 979 319 1292
NM_001012427chr613296 2219 135 52788 2412 2089 979 319 1292
NM_001012751chr1021565 260 ------
NM_001012761chr542244 756 370 140 11656 11911 --
NM_001012977chrX41239 1071 957 366 128 --21261 98
NM_001012989chrX1451 ------
NM_001012993chr9--1297 ----
NM_001013620chr1267657 7296 7244 6222 6042 5768 ------
NM_001014794chr111227 ------
NM_001014795chr111227 ------
NM_001014797chr1088166 7169 6794 5958 5623 1770 1401 873 26150 1342 21977 704 --
NM_001015045chr452400 2289 1963 974 807 --1887 1299
NM_001015877chrX22555 171 22722 581 --11990
NM_001015892chr5----1161 --
NM_001017371chr2--1909 ----
NM_001017395chr332567 1169 376 --23147 2289 --
NM_001017405chr41917 ------
NM_001017415chr1----1290 --
NM_001017416chr1----1290 --
NM_001017440chr7118177 7578 7207 6683 6485 6312 5969 3045 1538 279 250 --15051 1707
NM_001017969chr91608 ------
NM_001017999chr12730 710 --11459 11605
NM_001017999chr12730 710 --11459 11605
NM_001018000chr12730 710 --11459 11605
NM_001018000chr12730 710 --11459 11605
NM_001018001chr12730 710 --11459 11605
NM_001018050chr2253328 2643 2384 711 29 12986 2646 140 --
NM_001018052chr2253328 2643 2384 711 29 12986 2646 140 --
NM_001018064chr92851 711 1388 ----
NM_001018065chr975726 2380 2198 1893 1272 988 319 1513 ----
NM_001018066chr975726 2380 2198 1893 1272 988 319 1513 ----
NM_001018067chr143267 1007 877 338 ------
NM_001018068chr143267 1007 877 338 ------
NM_001018069chr143267 1007 877 338 ------
NM_001018074chr523689 1054 --1315 --
NM_001018075chr523689 1054 --1315 --
NM_001018076chr523689 1054 --1315 --
NM_001018077chr523689 1054 --1315 --
NM_001018108chr1511624 ------
NM_001018111chr752828 2597 2464 933 207 --33780 2647 1072 --
NM_001023587chr3165 1215 1786 1778
NM_001024094chr523689 1054 --1315 --
NM_001024372chr822020 573 1108 ----
NM_001024455chrX32074 1661 403 21964 217 ----
NM_001024463chr153224 178 34 3921 193 116 1234 1135
NM_001024649chr522185 141 12095 --1122
NM_001024808chr1272818 2501 2272 2248 2197 649 642 ----22286 49
NM_001024809chr1721318 344 --184 21068 336
NM_001024858chr1482934 2809 2494 2369 2267 2242 617 501 22126 934 11897 12488
NM_001024947chr52204 26 174 ----
NM_001025068chr321298 1156 ----11480
NM_001025069chr321298 1156 ----11480
NM_001025076chr1065827 2484 2320 1978 1928 1355 --25159 2101 --
NM_001025077chr1047185 4814 2713 63 --16517 --
NM_001025079chr373483 2734 1576 1044 1030 410 338 --1815 --
NM_001025105chr51525 11182 194 --
NM_001025266chr354955 3791 1461 1358 568 --14705 --
NM_001025356chr1222527 931 --1981 --
NM_001025580chrX33330 3122 2878 13708 --13959
NM_001025596chr11--1406 ----
NM_001029858chr612074 13198 --22807 983
NM_001029863chr623161 541 12303 ----
NM_001029875chr5------1852
NM_001030007chr1613408 --2972 449 --
NM_001030055chr1444696 4602 1310 1193 14266 ----
NM_001031679chr1223044 985 --12469 --
NM_001031680chr171813 1620 761 741 707 272 58 ------
NM_001031685chr13904 378 334 1611 ----
NM_001031696chr191206 ------
NM_001031716chr2----1297 --
NM_001031732chr433053 2950 1362 23318 1479 ----
NM_001031740chr111217 --1270 169
NM_001031804chr1654305 4259 3170 2681 1240 13299 ----
NM_001031812chr532111 349 240 ------
NM_001032296chr1372506 2404 2315 2150 898 605 130 --12657 12490
NM_001032999chr20104670 4625 4587 4143 3649 3452 2070 1204 1142 218 --23624 307 1103
NM_001033081chr121618 1492 11385 1290 --
NM_001033082chr121618 1492 11385 1290 --
NM_001033112chr5----1246 --
NM_001033117chr344092 3852 3669 1767 23791 3340 ----
NM_001033507chr121913 1851 11268 ----
NM_001033551chr1783475 3049 1507 1284 613 165 154 60 2955 535 63774 3754 3706 3185 2683 1463 --
NM_001033554chr171196 ------
NM_001033561chr171101 1850 ----
NM_001033566chr17----1954 --
NM_001033568chr17----1954 --
NM_001033578chr831833 927 680 12431 ----
NM_001033602chr1332496 2385 648 --1612 --
NM_001034841chr1664144 2201 1376 877 332 199 1790 13513 --
NM_001034845chr41421 2220 59 1195 --
NM_001034915chr8----21147 371 --
NM_001035003chr4----21348 1051 --
NM_001035004chr4----21348 1051 --
NM_001035260chr1021630 372 --135 --
NM_001037132chr721960 881 ------
NM_001037133chr721960 881 ------
NM_001037164chr761893 1708 1624 1557 1344 471 ------
NM_001037172chr321160 992 1345 ----
NM_001037174chr231956 1852 1510 21974 386 ----
NM_001037317chr122081 159 11740 ----
NM_001037954chr1163489 3467 3437 2745 1213 451 ------
NM_001038493chr211200 ------
NM_001038707chr13629 95 77 --1584 --
NM_001038707chr13629 95 77 --1584 --
NM_001039141chr2272597 2417 1812 1092 979 663 42 ----12719
NM_001039360chr1831685 551 362 11703 41846 1816 271 30 --
NM_001039538chr253150 3129 2318 731 708 12527 12990 --
NM_001039574chr11801 ------
NM_001039577chr153967 2953 1679 916 641 14451 44168 3705 1461 1399 --
NM_001039585chr133273 2680 1258 21326 248 2232 164 --
NM_001039618chr1155661 3641 1390 1234 88 24783 947 14844 --
NM_001039709chr20104670 4625 4587 4143 3649 3452 2070 1204 1142 218 --23624 307 1103
NM_001039802chr121125 497 ------
NM_001039840chrX45830 3884 1597 275 ------
NM_001039916chr1221134 430 --1187 --
NM_001039917chr1221134 430 --1187 --
NM_001039918chr1221134 430 --1187 --
NM_001039919chr1221134 430 --1187 --
NM_001039920chr1221134 430 --1187 --
NM_001040001chr61740 --12030 --
NM_001040142chr262434 2048 1971 1917 1853 228 --1355 --
NM_001040143chr262434 2048 1971 1917 1853 228 --1355 --
NM_001040152chr734389 4120 538 --11065 1485
NM_001040202chr41479 --1309 --
NM_001040284chr1665785 5714 5455 5109 4813 3834 15032 14701 --
NM_001040424chr2152971 2887 2551 1078 293 11935 --22069 152
NM_001040429chr1333270 2637 1351 12588 22743 2249 --
NM_001040441chr175091 3710 3523 1716 861 440 215 --25391 1329 --
NM_001040446chr552613 1979 672 645 305 ------
NM_001040450chr1532730 1167 1117 32388 2180 1127 ----
NM_001040453chr1532730 1167 1117 32388 2180 1127 ----
NM_001040661chr73919 439 356 3302 224 120 11093 1404
NM_001040665chr743859 1135 872 847 1341 11832 --
NM_001040712chr942499 2300 1332 1101 12810 ----
NM_001040875chr832038 1918 194 --12407 1791
NM_001040876chr431401 466 329 1513 ----
NM_001042355chr1655312 5090 3794 1742 1372 14706 ----
NM_001042371chr1672099 1706 1595 1347 804 445 52 ------
NM_001042403chr121763 ------
NM_001042404chr111337 11744 ----
NM_001042412chr1655312 5090 3794 1742 1372 14706 ----
NM_001042413chr964118 3111 2934 995 548 106 1599 33900 1368 1164 --
NM_001042424chr433118 836 108 12597 12516 --
NM_001042481chr141764 ------
NM_001042506chrX31081 957 366 128 --21272 98
NM_001042510chr811568 1101 1396 --
NM_001042511chr811568 1101 1396 --
NM_001042537chrX31927 857 339 ----12009
NM_001042543chr4----11602 --
NM_001042555chr1244326 3292 1607 1501 34037 3500 1358 23665 544 --
NM_001042599chr236951 6753 303 21281 1162 ----
NM_001042601chr3------12453
NM_001042603chr1253657 1729 1063 918 844 21253 949 ----
NM_001042604chr333735 984 363 23864 726 ----
NM_001042646chr32661 372 ------
NM_001042749chrX32021 1776 676 ------
NM_001042750chrX32021 1776 676 ------
NM_001042751chrX32021 1776 676 ------
NM_001044722chr532111 349 240 ------
NM_001044723chr532111 349 240 ------
NM_001077628chr1------1474
NM_001083621chr133345 1526 1223 31449 1161 885 21516 709 --
NM_001099678chr375824 4819 4755 2554 2081 1476 81 34164 2338 1601 ----
NM_001106chr3159187 8869 8421 7876 7355 7025 6662 6469 3862 3828 3609 2992 2873 848 280 27900 205 ----
NM_001113490chrX63393 3318 2601 2465 894 794 22723 32 1172 --
NM_001117chr1832202 1704 177 --12137 --
NM_001128chr1613408 --2972 449 --
NM_001135chr153796 604 292 1178 ----
NM_001148chr45830 626 193 89 80 22117 39 ----
NM_001149chr101341 11341 ----
NM_001156chr10----192 --
NM_001173chr1444696 4602 1310 1193 14266 ----
NM_001200chr2011071 ------
NM_001204chr266913 5520 2915 2798 2525 348 --12447 15530
NM_001206chr922979 1084 12497 ----
NM_001234chr31266 1212 ----
NM_001241chr232127 1518 778 133 --11497
NM_001241chr232127 1518 778 133 --11497
NM_001256chr17--22702 211 ----
NM_001268chr13----1905 1887
NM_001269chr1------1135
NM_001289chrX31362 1158 506 ----11189
NM_001292chr153995 279 242 --1899 1390
NM_001293chr112403 122 ----1168
NM_001304chr1733581 2910 323 --1830 --
NM_001316chr20--1485 ----
NM_001332chr531605 1524 1129 1134 ----
NM_001333chr9197 ------
NM_001343chr541655 1534 1373 494 ------
NM_001356chrX2938 108 22307 182 ----
NM_001364chr1134422 3525 1769 21731 370 1386 21576 818
NM_001391chr182332 271 1802 --1937
NM_001397chr142223 1014 291 263 1638 --12345
NM_001401chr9126 1441 ----
NM_001402chr6--11856 11669 --
NM_001406chr1731604 1558 1463 --11580 --
NM_001412chrX32308 1334 667 --11256 --
NM_001419chr1954014 3960 3391 3272 273 11527 14399 --
NM_001421chrX51203 505 210 187 32 ------
NM_001427chr721335 508 192 --1654
NM_001430chr211361 --149 197
NM_001432chr463804 3293 2553 1518 1424 671 ------
NM_001448chrX11235 --150 --
NM_001453chr621232 551 --1130 2173 167
NM_001463chr22553 294 3748 674 67 ----
NM_001543chr564793 4412 1744 1277 856 480 13504 --1222
NM_001555chrX169 ------
NM_001614chr17--1152 ----
NM_001614chr17--1152 ----
NM_001616chr232692 2593 323 13272 ----
NM_001620chr11----149 --
NM_001660chr31691 --1540 --
NM_001663chr14--21019 605 ----
NM_001664chr331021 245 189 1137 1960 --
NM_001665chr11----146 1560
NM_001668chr112246 ----12154
NM_001677chr1----2130 27 --
NM_001682chr1232390 1908 258 --127 --
NM_001701chr91252 --11275 --
NM_001709chr1112819 12050 --12155
NM_001717chr152547 416 --1316 --
NM_001746chr522185 141 12095 --1122
NM_001755chr1612247 1680 --11975
NM_001759chr1243878 3528 1318 1136 ----14659
NM_001760chr61178 1232 --1300
NM_001777chr373483 2734 1576 1044 1030 410 338 --1815 --
NM_001788chr7258 47 --193 --
NM_001791chr121125 497 ------
NM_001806chr1952911 2386 2079 2026 1855 1138 ----
NM_001821chr154023 3606 1708 1633 48 13199 ----
NM_001830chrX42465 859 632 614 11154 ----
NM_001856chr11336 ------
NM_001861chr161118 ------
NM_001862chr2161 ------
NM_001879chr341616 749 655 424 --130 --
NM_001880chr2171 ------
NM_001885chr11----151 --
NM_001892chr51525 11182 194 --
NM_001896chr161356 ------
NM_001901chr63852 307 241 1288 ----
NM_001918chr1129168 8940 7391 6350 6272 5693 2490 2441 1565 1479 909 379 167 ----
NM_001931chr112210 100 ------
NM_001933chr1421221 50 1148 1289 --
NM_001935chr21398 1653 2802 253 --
NM_001939chrX52991 2978 1409 1191 247 ------
NM_001946chr12----2115 67 --
NM_001955chr64904 748 197 129 ------
NM_001969chr1453138 2973 2827 190 59 32879 2862 861 ----
NM_001977chr411577 21636 408 ----
NM_001999chr531368 1278 1213 1278 ----
NM_002006chr445084 2286 796 623 --14111 --
NM_002010chr13--1420 196 --
NM_002024chrX1710 ----1332
NM_002025chrX118717 8489 6430 6417 3091 2687 2106 1658 1476 727 51 --1718 --
NM_002033chr1153669 3588 2876 917 281 11249 ----
NM_002035chr1853631 3209 3147 989 123 --13299 --
NM_002045chr3----1137 --
NM_002048chr941359 1099 959 368 ------
NM_002063chrX21135 491 ------
NM_002077chr911741 2644 270 170 1330
NM_002092chr464947 1512 1499 1299 1187 852 --14431 --
NM_002126chr1723124 102 12820 --21650 93
NM_002129chr4194 ------
NM_002141chr7122 ------
NM_002154chr5176 ------
NM_002158chr223676 397 23091 2889 1775 --
NM_002166chr21674 ------
NM_002192chr7--1511 ----
NM_002193chr231365 529 177 1289 1374 --
NM_002198chr51244 ------
NM_002199chr41343 2900 298 1387 --
NM_002214chr734298 1761 1737 21011 267 ----
NM_002221chr15979 802 679 437 299 12382 21979 338 --
NM_002223chr1263472 3001 1289 239 36 26 --13143 13913
NM_002228chr11795 ------
NM_002246chr221074 897 --1162 --
NM_002247chr101613 11879 ----
NM_002253chr411033 ----183
NM_002264chr374441 4188 3981 3973 3779 1817 1485 13568 --14486
NM_002267chr1342253 1558 1542 50 1619 ----
NM_002268chr331860 1817 1674 ------
NM_002271chr1362441 1834 1623 936 187 23 1457 ----
NM_002296chr121705 1574 ------
NM_002310chr565860 4373 4079 3998 1863 667 14085 12291 168
NM_002313chr1064038 2042 1461 629 546 167 15064 11747 --
NM_002334chr1151702 1632 498 426 144 1394 1292 11387
NM_002336chr1244760 4501 3800 627 13475 ----
NM_002345chr12--1595 ----
NM_002355chr122274 151 1885 ----
NM_002356chr642884 698 477 295 1789 ----
NM_002359chr1733140 258 41 --21370 533 --
NM_002374chr253150 3129 2318 731 708 12527 12990 --
NM_002375chr341822 1771 246 240 ------
NM_002376chr141441 ------
NM_002380chr82906 225 --1651 --
NM_002387chr564533 1734 1617 1325 645 325 11554 11505 --
NM_002390chr1751885 1644 1373 1327 177 --21658 339 --
NM_002398chr21952 ------
NM_002430chr2252316 1864 584 246 29 ------
NM_002480chr12--1344 ----
NM_002481chr1127701 7438 7317 6755 6621 5920 5541 2049 1714 1513 488 277 57390 6114 6107 5017 3086 --13112
NM_002499chr1551979 1930 1724 591 131 1120 11740 --
NM_002501chr1984040 3710 3700 3393 3303 3273 981 512 23753 415 --33759 3160 273
NM_002508chr12313 103 ------
NM_002515chr141168 1280 ----
NM_002522chr1732458 1145 1138 --13189 23862 1566
NM_002527chr12------1253
NM_002537chr152924 910 --1716 --
NM_002544chr17178 ------
NM_002545chr1153974 3802 1335 1273 80 --23849 1751 11042
NM_002547chrX23736 1553 12654 --11248
NM_002556chr1131682 806 144 --1158 --
NM_002577chr321033 558 23168 1098 1232 --
NM_002581chr974586 4286 1352 1069 755 103 38 13936 --14820
NM_002585chr1--1113 ----
NM_002594chr2062290 2186 1719 1526 880 527 11512 1712 --
NM_002609chr54734 410 203 108 148 11491 --
NM_002612chr731905 1692 210 1402 149 --
NM_002613chr1685364 4216 1138 1048 888 467 351 93 1191 21955 336 11011
NM_002616chr17193 --1146 --
NM_002627chr10--175 ----
NM_002629chr104687 651 344 133 ------
NM_002645chr1122615 1057 22985 1184 12065 --
NM_002648chr6182 1401 ----
NM_002655chr865201 4660 3938 640 450 151 24218 876 ----
NM_002657chr2043666 3623 685 302 22889 540 1706 --
NM_002709chr242683 2663 412 29 12631 ----
NM_002710chr121880 --11035 --
NM_002713chr11791 --1372 --
NM_002715chr52239 198 ------
NM_002718chr342007 1664 912 126 ------
NM_002719chr1432299 366 35 ----1462
NM_002731chr11702 1788 ----
NM_002737chr1744602 4509 835 612 --21040 858 11963
NM_002742chr141700 ------
NM_002745chr2233495 1702 373 12987 13017 --
NM_002747chr184786 636 364 174 11625 11572 11279
NM_002753chr41136 ------
NM_002755chr15----1602 --
NM_002760chrY75124 5026 4561 3940 2244 1317 1007 --24850 4422 --
NM_002763chr11127 ------
NM_002825chr7--1183 --137
NM_002827chr2021790 1165 31461 582 69 --1443
NM_002829chr9--193 ----
NM_002834chr1263739 1344 1321 910 791 381 11519 ----
NM_002837chr1264031 3687 3484 886 762 88 --11791 --
NM_002839chr942499 2300 1332 1101 12810 ----
NM_002849chr121339 --11028 --
NM_002852chr31611 ------
NM_002855chr1173071 2749 2507 2388 1388 345 124 --1487 --
NM_002857chr142522 1859 1652 146 12369 ----
NM_002868chr1241694 1511 657 176 11609 ----
NM_002869chr1112117 11874 ----
NM_002874chr932203 1653 238 1915 135 --
NM_002886chr365059 4257 3841 974 836 591 ------
NM_002890chr5--1172 2883 623 --
NM_002899chr3--136 ----
NM_002906chr1122080 951 --1112 --
NM_002940chr431401 466 329 1513 ----
NM_002953chr12502 127 ----1597
NM_002955chr631978 1897 1581 137 11760 --
NM_002956chr1241322 1146 900 256 ----166
NM_002957chr953612 3194 468 269 240 --33164 2581 57 1532
NM_002959chr173217 3015 2804 1754 1103 692 395 --1542 13803
NM_002971chr31290 ------
NM_003016chr1721598 365 ------
NM_003020chr15------1410
NM_003026chr93920 902 235 ----1474
NM_003027chr15----155 --
NM_003028chr973818 3612 3340 2568 980 306 72 43502 3441 2557 123 12901 11163
NM_003042chr341620 1413 495 300 11407 --1248
NM_003045chr1374334 3409 3189 1491 1102 287 227 11352 184 --
NM_003046chr875293 3625 1705 1408 858 701 209 14324 13354 179
NM_003051chr141601 542 126 80 ------
NM_003070chr91125 ------
NM_003099chr1556289 4576 4527 4134 1396 35226 2369 1033 12533 15478
NM_003107chr662643 2559 2402 1849 736 723 --11923 --
NM_003108chr297196 6992 6909 6720 5163 2809 1957 1577 878 14432 12649 --
NM_003111chr2--1909 ----
NM_003128chr222323 365 12114 11855 --
NM_003144chr632003 1868 261 1464 ----
NM_003155chr832513 1960 1734 11851 164 --
NM_003161chr1732807 2678 2614 12282 --23273 925
NM_003185chr201133 ------
NM_003187chr5----1161 --
NM_003189chr1124 1188 ----
NM_003199chr1811570 21794 545 24965 4908 --
NM_003202chr541479 745 497 80 ------
NM_003211chr1251591 1442 1091 542 199 ------
NM_003215chr451549 1377 465 266 143 11076 11300 --
NM_003217chr1241456 1225 330 105 21420 294 ----
NM_003236chr263177 1195 1106 538 333 211 12161 12946 1914
NM_003247chr631236 227 216 21317 147 ----
NM_003257chr152469 313 ----11321
NM_003262chr354640 3741 3349 2089 476 ----11658
NM_003281chr1114961 4380 3830 3796 3491 1776 1729 1147 864 671 619 23352 1809 ----
NM_003290chr191807 --2210 169 --
NM_003298chr3115843 5738 5054 4691 2077 2010 1749 1325 1227 534 401 23790 1289 34496 3966 2302 --
NM_003300chr141187 ------
NM_003320chr1173767 3165 3003 1353 647 144 103 22860 1121 1896 --
NM_003326chr132299 576 187 --12126 136
NM_003330chr1221315 716 11329 21617 258 --
NM_003340chr4------1531
NM_003342chr1732947 2675 674 --12665 --
NM_003368chr1----1290 --
NM_003369chr1142703 878 672 619 ------
NM_003389chr94547 466 458 114 ------
NM_003390chr111193 --1236 --
NM_003392chr363759 3730 3671 3332 976 809 ------
NM_003405chr22----1493 --
NM_003410chrX11075 13058 ----
NM_003412chr312730 ----11048
NM_003418chr3--1294 ----
NM_003445chr19--1272 ----
NM_003458chr343726 1212 823 145 23568 3115 11173 --
NM_003463chr673390 3318 3252 2902 2712 423 131 --11220 --
NM_003472chr641425 1027 1002 373 168 ----
NM_003473chr10----1693 --
NM_003474chr104703 671 651 416 ----1810
NM_003489chr2122599 237 22262 206 11192 --
NM_003558chr92524 74 1171 ----
NM_003559chr1753738 3504 864 675 664 11153 1402 --
NM_003563chr1731019 553 71 11277 ----
NM_003566chr1221007 892 ------
NM_003574chr1832163 986 211 11628 --1224
NM_003576chr1372506 2404 2315 2150 898 605 130 --12657 12490
NM_003583chr1263353 3326 3109 3070 3002 274 --12705 --
NM_003590chr243278 2791 2757 168 --13792 --
NM_003591chr10----1139 --
NM_003597chr211582 31741 1439 769 --1267
NM_003601chr4--139 ----
NM_003603chr441828 1620 1381 37 1817 --1145
NM_003607chr132688 840 104 1450 11495 --
NM_003615chr353157 3121 859 439 310 ------
NM_003622chr1252219 617 454 360 284 ------
NM_003624chr1971369 1270 1124 897 890 422 26 --1332 179
NM_003629chr143380 2972 2433 2381 --22201 620 --
NM_003630chr61195 ------
NM_003632chr171661 ------
NM_003633chr51295 --1440 --
NM_003654chr111650 ------
NM_003663chr321121 374 ------
NM_003664chr5--1565 ----
NM_003670chr351108 975 506 459 259 --1335 --
NM_003677chr1222135 1435 11936 --1868
NM_003684chr12968 376 1822 ----
NM_003714chr552860 1981 1155 835 805 --12231 --
NM_003716chr31270 1290 ----
NM_003743chr221816 512 1468 11514 --
NM_003744chr142851 35 1502 ----
NM_003758chr151541 1340 ----
NM_003758chr151541 1340 ----
NM_003795chr6----153 --
NM_003796chr191190 ------
NM_003799chr1833274 1283 1023 ------
NM_003861chr1442177 1091 810 383 1848 ----
NM_003870chr1522016 502 11657 ----
NM_003872chr233070 2212 575 --11031 --
NM_003884chr3--11325 ----
NM_003887chr252063 1887 1738 462 77 ------
NM_003888chr1521477 166 --11278 --
NM_003895chr2121972 1812 11883 1352 --
NM_003910chr71139 ------
NM_003913chr653440 2952 2816 1439 1264 1368 11666 --
NM_003927chr18--11092 1879 --
NM_003930chr72637 208 --12126 --
NM_003932chr2221475 81 ------
NM_003939chr1053919 1200 756 126 74 23722 2815 ----
NM_003941chr71226 12359 ----
NM_003949chr1721536 413 --31298 724 714 21578 489
NM_003958chr653770 2859 2418 203 171 ----1553
NM_003966chr567374 2409 1989 1967 1065 127 ----1590
NM_003971chr172578 179 --1196 --
NM_003983chr1663950 2822 1228 1203 1162 1133 146 1526 --
NM_004034chr10----192 --
NM_004056chr81761 ----1936
NM_004077chr122187 30 2914 397 ----
NM_004087chr341895 1431 1309 239 ------
NM_004094chr1442382 1108 865 234 --1449 --
NM_004095chr8--1307 169 --
NM_004096chr102767 745 2516 104 ----
NM_004100chr612674 12490 --1807
NM_004102chr11384 ------
NM_004109chr111110 11895 ----
NM_004124chr1421159 567 11343 ----
NM_004130chr3----1569 --
NM_004162chr33316 273 78 --11299 --
NM_004170chr921832 1775 1535 ----
NM_004171chr11139126 9057 8790 7353 6808 6114 3537 3341 2721 2409 1600 1132 286 16769 16388 --
NM_004200chr1172963 2523 2145 949 904 324 172 13220 1987 --
NM_004227chr772437 2428 2231 2184 2064 1053 492 ----1699
NM_004232chr1823012 133 13367 --13455
NM_004272chr531936 1881 1346 ------
NM_004282chr6--1175 ----
NM_004286chr2242362 2286 926 62 12741 12835 12341
NM_004293chr933356 2993 2430 ------
NM_004296chr1473885 3842 3386 3188 2856 2802 643 33670 3142 539 33523 1529 665 --
NM_004308chr1171693 1578 1370 223 174 112 67 --122 11646
NM_004321chr273251 2935 2380 2317 937 553 167 13001 13102 --
NM_004327chr2222021 1636 ----11538
NM_004331chr842135 1917 582 331 ----2692 283
NM_004338chr18147090 6123 6108 5869 5788 5765 5557 5399 5354 5260 1508 1439 1352 431 14426 34418 2216 2092 --
NM_004342chr71784 12169 ----
NM_004349chr8----1882 --
NM_004350chr171813 1620 761 741 707 272 58 ------
NM_004380chr1622108 173 --11625 --
NM_004384chr532111 349 240 ------
NM_004392chr1352169 2020 1691 1011 198 1436 ----
NM_004395chr5----152 --
NM_004397chr1154098 3450 1507 1282 647 ------
NM_004423chr331785 963 440 22540 733 12492 --
NM_004426chr1251893 1541 1511 1267 24 21326 71 ----
NM_004432chr921773 777 --1903 --
NM_004434chr1421602 172 --11314 11341
NM_004437chr163415 2809 764 481 411 122 23277 56 21173 535 --
NM_004438chr211232 --42133 1100 943 252 --
NM_004451chr11----2543 130 --
NM_004480chr143782 612 573 ------
NM_004491chr1963888 3282 3216 1449 687 537 13184 2305 148 11198
NM_004499chr51342 ------
NM_004501chr1------12860
NM_004504chr242519 2129 380 145 --12411 --
NM_004505chr1731778 723 602 --1251 --
NM_004517chr111227 ------
NM_004528chr1----1103 --
NM_004580chr1511495 --1502 --
NM_004586chrX45237 4352 1566 1406 24529 3623 ----
NM_004593chr3--1732 ----
NM_004600chr151134 1119 428 192 40 ------
NM_004612chr944827 3464 1541 434 1645 ----
NM_004622chr232275 663 125 --12054 --
NM_004626chr112615 160 ------
NM_004663chr15----1210 --
NM_004690chr61707 ------
NM_004711chr2272554 2381 2342 2298 1349 1303 382 --23666 100 --
NM_004725chr101568 ------
NM_004726chrX65101 5041 4281 4097 1294 516 45033 2198 2130 1825 ----
NM_004734chr1362881 2543 2084 850 389 25 --1866 --
NM_004736chr111875 11598 2897 770 11737
NM_004745chr876615 6347 5851 5369 5103 936 729 ------
NM_004747chr1051300 1254 602 276 51 ------
NM_004756chr1911117 --1409 --
NM_004759chr13761 498 344 --21860 1730 --
NM_004762chr1742000 1322 198 129 11330 1560 --
NM_004772chr521431 169 ------
NM_004776chr2042777 2385 1171 180 ----11060
NM_004779chr5------1266
NM_004796chr1431863 643 564 ------
NM_004798chr2053271 3069 2823 2639 275 161 --1556
NM_004805chr21407 ------
NM_004808chr1063039 2990 2903 2606 2214 644 12781 ----
NM_004815chr144749 4457 3684 1457 ------
NM_004822chr1773674 3618 3092 3041 1175 944 37 1640 11029 --
NM_004834chr241186 710 254 170 11093 ----
NM_004845chrX74097 3866 3853 1608 1581 890 154 22556 1514 23453 544 --
NM_004850chr221593 373 ----1363
NM_004853chr17------123
NM_004859chr1732238 2135 1933 22860 501 ----
NM_004871chr1794074 3770 3764 3454 3261 2795 1224 1208 1174 1108 ----
NM_004883chr51179 ------
NM_004887chr5136 ------
NM_004896chr1021545 287 ------
NM_004904chr795602 4834 2630 1168 934 919 463 250 207 15964 24889 1115 --
NM_004922chr102656 336 ------
NM_004947chr332442 1731 658 --21707 964 --
NM_004949chr1821735 1715 ----1187
NM_004961chrX31004 360 299 11572 11323 --
NM_004964chr1----1400 --
NM_004966chr10--1812 ----
NM_004973chr61396 --1100 1637
NM_004978chr131464 325 170 --21185 53 --
NM_004992chrX138094 7325 6886 6490 6338 6092 6080 2865 1680 1393 1073 528 409 27375 1778 33253 2496 583 17859
NM_004992chrX138094 7325 6886 6490 6338 6092 6080 2865 1680 1393 1073 528 409 27375 1778 33253 2496 583 17859
NM_004993chr141318 ------
NM_005008chr22133 --2869 346 --
NM_005010chr721960 881 ------
NM_005023chr511128 ------
NM_005036chr2276581 6216 5088 3301 2095 2024 1860 52275 1812 418 173 143 47498 3034 2358 1092 --
NM_005045chr7------1909
NM_005054chr251556 1466 1080 290 232 ------
NM_005056chr1263901 1973 1307 1162 1088 241 21497 1193 ----
NM_005057chr141861 1834 1380 246 11718 ----
NM_005063chr1043674 2631 87 37 ------
NM_005077chr9------1171
NM_005093chr20104670 4625 4587 4143 3649 3452 2070 1204 1142 218 --23624 307 1103
NM_005109chr352415 1676 1601 701 190 1199 ----
NM_005116chr2054015 3205 1050 745 461 33559 1025 714 23765 821 --
NM_005126chr321739 213 22313 1478 ----
NM_005156chr985134 4758 4615 3599 1387 502 336 180 14433 ----
NM_005168chr231294 1164 106 1651 ----
NM_005171chr12----11225 --
NM_005188chr1187673 7248 6176 5508 2341 679 134 36 46563 6294 2427 803 --12606
NM_005189chr1772467 2334 1909 1898 1760 1576 740 --12109 11652
NM_005197chr1466036 5612 4203 4131 1993 545 21229 86 34963 2407 612 --
NM_005215chr183185 115 97 1718 ----
NM_005230chr12----1506 --
NM_005233chr321621 929 21914 280 ----
NM_005235chr236951 6753 303 21281 1162 ----
NM_005241chr3--11298 ----
NM_005276chr1231754 1556 77 21471 52 --21206 386
NM_005276chr1231754 1556 77 21471 52 --21206 386
NM_005278chrX1358 ------
NM_005311chr772490 1991 1983 1771 884 847 134 ------
NM_005312chr941720 653 163 126 3996 893 220 --1355
NM_005313chr154341 193 186 43 ------
NM_005324chr1731887 1719 1450 11518 --1793
NM_005328chr8176 --1295 --
NM_005329chr1631814 1590 542 21610 620 12036 --
NM_005339chr414169 1309 13460 --
NM_005358chr131588 1172 ----
NM_005359chr1866109 6074 4952 4707 2602 679 15878 --14745
NM_005370chr1961116 474 420 370 134 119 11234 11131 --
NM_005392chr921347 95 11403 1381 --
NM_005397chr752828 2597 2464 933 207 --33780 2647 1072 --
NM_005398chr1021075 98 --1285 --
NM_005399chr153484 2842 684 534 67 ------
NM_005400chr222067 554 ----1214
NM_005406chr1821220 392 ------
NM_005426chr13904 378 334 1611 ----
NM_005436chr1043353 1585 778 209 12938 ----
NM_005440chr1763068 3026 2549 2171 934 484 --1493 --
NM_005450chr17176 ------
NM_005458chr951710 911 517 496 345 11930 ----
NM_005460chr5------1183
NM_005465chr131514 506 119 --171 --
NM_005475chr1242517 2423 2311 402 22842 717 --22797 2722
NM_005477chr1532403 216 122 --1381 --
NM_005477chr1532403 216 122 --1381 --
NM_005493chr62841 62 ------
NM_005497chr17105552 5188 4306 4119 3940 2413 2209 1396 1255 555 15980 --1732
NM_005499chr191232 ------
NM_005523chr71586 --1222 --
NM_005537chr13--2997 209 --1913
NM_005542chr711870 --21354 615 --
NM_005562chr1----11379 --
NM_005578chr385057 4935 3696 3324 1684 1013 634 610 14063 13173 --
NM_005587chr152687 305 --1350 --
NM_005595chr1146 ------
NM_005596chr986014 5364 5325 5233 4764 1258 566 45 35646 1744 244 25310 5054 --
NM_005603chr1831596 584 291 --1724 --
NM_005604chr641816 910 661 464 11681 ----
NM_005607chr81739 11062 --298 63
NM_005610chr11841 ----1882
NM_005625chr82332 93 --1696 --
NM_005639chr121483 1285 ----
NM_005647chrX52469 2383 1061 484 44 22421 1306 1272 --
NM_005650chr221198 1164 1554 --
NM_005652chr162937 794 ------
NM_005662chr8122 --1303 --
NM_005665chr174575 4549 4304 4050 3228 1910 1480 11222 ----
NM_005686chr141085 437 382 71 11538 ----
NM_005721chr2--1691 ----
NM_005722chr22987 337 ------
NM_005724chr151801 1735 ----
NM_005730chr1293353 2816 2437 2326 1219 935 586 514 68 1571 12603 --
NM_005737chr252638 745 635 267 211 --11099 --
NM_005738chr761893 1708 1624 1557 1344 471 ------
NM_005739chr1531589 678 94 ------
NM_005746chr732294 1735 711 1509 ----
NM_005748chr1243414 2747 2461 672 ------
NM_005759chr224074 1421 ----11691
NM_005778chr3----1310 --
NM_005779chr533089 2531 344 13234 1753 --
NM_005786chr18158 1904 1909 --
NM_005807chr12487 101 ------
NM_005819chr152957 2385 902 802 270 ------
NM_005822chr632129 1497 302 1254 --1489
NM_005840chrX87438 7308 6542 5479 5262 2503 224 97 1304 --2959 803
NM_005845chr1321567 45 --1238 11362
NM_005859chr511072 ----11100
NM_005868chr732225 1704 1635 22179 71 ----
NM_005882chr41917 ------
NM_005898chr1143224 562 374 67 ----11044
NM_005901chr1898208 7596 7466 7352 7228 6612 6176 2264 1774 27788 1203 28121 825 1796
NM_005902chr1544449 3638 1317 1169 23537 1131 23758 293 --
NM_005903chr541782 1379 1164 424 11259 ----
NM_005909chr522787 1573 --1275 --
NM_005911chr241364 1026 349 117 ------
NM_005935chr434948 2044 85 34314 3316 317 ----
NM_005937chr1783764 3584 3499 3031 2993 1208 974 885 1363 11283 --
NM_005938chrX21450 520 11229 1341 --
NM_005941chr833784 1033 993 13926 13293 --
NM_005955chr133796 1651 481 11365 ----
NM_005990chr582289 2274 2263 2225 1100 831 353 109 ------
NM_006007chr964222 4070 3044 744 692 406 1532 ----
NM_006011chr1564285 3908 2643 1504 973 44 13308 42980 2862 2714 1230 43709 3393 2923 557
NM_006037chr221888 788 13689 1846 23482 3287
NM_006076chr752866 2856 2215 2170 623 23006 471 1328 --
NM_006080chr732477 2312 459 ----1353
NM_006085chr11104 --11136 --
NM_006094chr821514 557 1779 12199 --
NM_006095chr431371 1029 52 31686 1504 448 ----
NM_006141chr1621734 369 --12701 --
NM_006145chr194765 201 168 70 1317 ----
NM_006154chr1532728 2511 1842 22235 1824 22472 1871 --
NM_006166chr1242410 2119 946 70 ------
NM_006180chr92851 711 1388 ----
NM_006203chr5105443 4151 1845 1745 1433 1363 1147 1031 304 169 24654 453 33914 2157 935 15493
NM_006238chr631495 189 82 143 --1375
NM_006246chr141913 --11096 1335
NM_006258chr1021293 1160 164 1531 1251
NM_006264chr4--1390 ----
NM_006270chr19144 ------
NM_006281chr821102 51 1248 ----
NM_006281chr821102 51 1248 ----
NM_006282chr2084437 3836 3539 3372 1431 825 502 138 183 ----
NM_006298chr652719 2564 2319 1263 901 ------
NM_006300chr1942422 2353 756 204 ------
NM_006310chr1731259 932 110 1190 ----
NM_006315chr434336 1355 761 23757 168 14202 --
NM_006323chr41753 ------
NM_006330chr81294 11578 --136
NM_006359chrX31927 857 339 ----12009
NM_006366chr61491 ------
NM_006369chr1----286 41 --
NM_006373chr1751014 502 479 71 31 ------
NM_006375chrX21685 500 1483 11633 11606
NM_006379chr7--1179 ----
NM_006380chr1744064 2802 728 601 24355 640 ----
NM_006387chr195909 233 214 146 33 --2854 444 --
NM_006393chr1053148 1454 1297 888 143 --24565 881 --
NM_006401chr91308 ------
NM_006420chr2022423 2394 33054 2213 1077 12612 --
NM_006431chr12133 ------
NM_006454chr452953 2632 2219 1172 607 32923 2199 2083 42558 2136 81 39 12346
NM_006457chr422657 609 ----12893
NM_006475chr13------1103
NM_006482chr1263353 3326 3109 3070 3002 274 --12705 --
NM_006489chr141168 1280 ----
NM_006493chr1321422 603 ----2125 42
NM_006496chr121813 1626 --1349 --
NM_006497chr172621 242 --1544 --
NM_006516chr161541 1152 1140 1020 574 270 1135 ----
NM_006517chrX21996 703 ----2737 83
NM_006521chrX21002 52 11010 1433 --
NM_006529chr4----11593 --
NM_006534chr2052074 1289 1110 110 55 ------
NM_006537chr153423 182 36 1589 ----
NM_006538chr283978 3956 3186 1045 648 631 451 101 23260 1619 11195 11247
NM_006544chr1434262 1587 328 --1191 --
NM_006546chr1796485 5971 4364 2178 2125 1395 1340 506 371 44468 4258 1293 1252 24622 2191 --
NM_006547chr722021 689 ------
NM_006558chr8----141 --
NM_006559chr1------11040
NM_006560chr11--1406 ----
NM_006561chr1065827 2484 2320 1978 1928 1355 --25159 2101 --
NM_006565chr1641132 954 333 24 ----1474
NM_006570chr9--2356 301 ----
NM_006587chr42397 30 ----11372
NM_006595chr1131717 1690 409 ----169
NM_006599chr1688132 7203 6176 6099 5338 5275 2634 2228 37302 6780 3319 16208 15687
NM_006603chrX32021 1776 676 ------
NM_006608chr1179 ------
NM_006609chr232343 1153 358 32420 1821 628 12113 --
NM_006614chr3--1536 ----
NM_006620chr643412 1701 1646 621 ------
NM_006621chr131934 613 24 ------
NM_006624chr101202 12109 2501 108 --
NM_006628chr1521878 90 ----14501
NM_006629chr18----11945 --
NM_006646chr1322896 1194 1410 1804 --
NM_006654chr1244326 3292 1607 1501 34037 3500 1358 23665 544 --
NM_006675chr1213130 13048 22329 1236 11334
NM_006690chr2072340 2092 2064 217 91 57 39 3773 386 99 2422 391 --
NM_006708chr641070 909 427 70 ------
NM_006720chr1064038 2042 1461 629 546 167 15064 11747 --
NM_006731chr9115797 5719 5093 4885 4593 4472 3940 3672 1791 1489 372 25040 4849 ----
NM_006738chr1584616 4390 3798 1390 774 667 484 46 21714 547 ----
NM_006749chr82896 118 ----1835
NM_006751chr21785 ------
NM_006756chr82486 56 ------
NM_006764chr3------186
NM_006775chr621933 1204 12309 ----
NM_006777chrX11007 --11915 --
NM_006788chr181607 32075 1372 728 1659 --
NM_006802chr11756 --2882 435 --
NM_006803chr82174 77 --22121 211 1742
NM_006805chr521358 1162 1293 ----
NM_006814chr2021821 127 --2256 235 22233 71
NM_006823chr8--11392 ----
NM_006826chr21307 ------
NM_006832chr142137 131 21031 780 ----
NM_006839chr2--151 ----
NM_006852chr172536 111 11096 11776 --
NM_006854chr722044 127 ----122
NM_006861chr1261808 1361 560 455 355 190 11643 11906 --
NM_006885chr16--13270 23471 2728 --
NM_006888chr1432472 1376 215 ------
NM_006898chr21209 --1311 --
NM_006902chr123114 2097 --1741 --
NM_006910chr161152 1340 ----
NM_006912chr152380 2278 983 820 649 ------
NM_006914chr9--21019 559 ----
NM_006915chrX31020 590 202 ----1774
NM_006920chr231915 280 226 ------
NM_006924chr1743867 3308 1529 1501 ------
NM_006927chr1661846 1756 1360 276 145 45 21417 73 1793 --
NM_006931chr1251780 371 317 282 73 ------
NM_006940chr1221702 65 11224 1139 --
NM_006943chr2053239 3079 942 259 38 --11048 1253
NM_006947chr431701 1615 51 11760 ----
NM_006965chr1821216 801 128 ----
NM_006981chr942516 1032 897 412 11004 12855 12750
NM_006988chr212164 106 1487 ----
NM_006999chr522101 1459 184 --166
NM_007005chr9------11533
NM_007007chr1214797 21262 170 ----
NM_007011chr1545465 2212 1489 1033 16725 11868 1117
NM_007014chr1631730 1628 1308 31795 1176 440 31230 1114 553 --
NM_007015chr13140 ------
NM_007023chr23706 154 90 1331 ----
NM_007030chr5164260 4000 3952 3898 3863 3828 3758 3688 3653 2095 2002 1971 1909 1031 629 448 31571 1078 417 21755 910 --
NM_007032chr2272597 2417 1812 1092 979 663 42 ----12719
NM_007038chr2135149 4765 2355 24465 1018 13743 --
NM_007050chr20137610 7522 7346 5645 5117 2619 2355 2162 1757 660 521 500 232 17880 25095 1121 15393
NM_007106chr1332207 1913 326 1857 --1394
NM_007107chr342058 1965 1918 1898 ------
NM_007118chr53712 93 45 ------
NM_007124chr62510 495 ------
NM_007125chrY1416 ------
NM_007146chr172991 578 22857 48 --1367
NM_007153chr19134314 4165 3772 3241 3086 1487 1205 1037 866 818 698 366 28 33888 3652 3252 1736 14111
NM_007158chr1----1131 --
NM_007174chr1232046 516 298 12238 1704 --
NM_007178chr12----165 --
NM_007189chr731352 1079 64 ------
NM_007200chr1584616 4390 3798 1390 774 667 484 46 21714 547 ----
NM_007203chr951225 1164 459 332 182 --1433 --
NM_007236chr1541945 914 346 227 2393 331 ----
NM_007249chr1398253 7254 6853 6254 5903 2323 2149 1813 582 38345 2331 480 11516 --
NM_007286chr582049 1991 1890 1572 1519 671 393 297 21977 1953 ----
NM_007287chr362497 2242 1090 552 389 288 ------
NM_007288chr362497 2242 1090 552 389 288 ------
NM_007289chr362497 2242 1090 552 389 288 ------
NM_007294chr1721113 304 --1136 --
NM_007295chr1721113 304 --1136 --
NM_007296chr1721113 304 --1136 --
NM_007297chr1721113 304 --1136 --
NM_007298chr1721113 304 --1136 --
NM_007299chr1721113 304 --1136 --
NM_007300chr1721113 304 --1136 --
NM_007302chr1721113 304 --1136 --
NM_007303chr1721113 304 --1136 --
NM_007304chr1721113 304 --1136 --
NM_007305chr1721113 304 --1136 --
NM_007308chr4------1133
NM_007331chr4----12574 --
NM_007358chr11139 ----11851
NM_007359chr172567 94 21727 132 ----
NM_007363chrX158 ------
NM_012081chr5--33477 2470 736 --12375
NM_012082chr8157 1213 ----
NM_012084chrX2207 145 1462 ----
NM_012086chr2150 ------
NM_012090chr11965 ----1950
NM_012095chr1033081 988 28 1425 22600 911 --
NM_012097chr231956 1852 1510 21974 386 ----
NM_012098chr951586 1259 1109 1101 207 --2976 90 1472
NM_012104chr1113054 --1666 11279
NM_012104chr1113054 --1666 11279
NM_012120chr6----1870 --
NM_012137chr121821 1797 12002 ----
NM_012154chr84741 290 77 51 2580 96 ----
NM_012164chr966145 4776 2959 2935 527 502 --36291 4653 2094 --
NM_012175chr11127 1107 ----
NM_012193chr1155275 4592 3811 1357 954 3371 110 50 14710 --
NM_012199chr163860 3835 1652 1347 909 774 23708 168 1183 14630
NM_012214chr276174 4966 4610 2113 1567 1260 523 16025 12074 --
NM_012215chr1051687 1640 782 679 104 --11351 --
NM_012218chr1973026 2378 2176 745 632 441 48 11052 12113 1571
NM_012219chr332177 572 42 --1985 --
NM_012229chr1011074 ----11371
NM_012233chr23333 276 70 2394 133 ----
NM_012238chr1021731 243 ----139
NM_012248chr161142 ------
NM_012249chr263050 1427 1411 1129 1092 463 ----13571
NM_012256chr721175 930 ------
NM_012259chr621032 300 ----1220
NM_012262chr144998 4416 3387 1052 ------
NM_012264chr2282068 1845 1681 1598 586 335 300 76 ------
NM_012264chr2282068 1845 1681 1598 586 335 300 76 ------
NM_012268chr191206 ------
NM_012282chrX2563 556 ------
NM_012287chr333784 1700 1473 --13709 --
NM_012290chr211695 11253 ----
NM_012294chr793862 3773 3218 2817 2718 2639 1132 172 138 23294 313 ----
NM_012296chr1183964 3521 2805 2668 1550 1379 319 140 1469 1874 --
NM_012297chr432002 1602 607 21772 1051 ----
NM_012304chr522443 418 1845 --11026
NM_012306chr1283464 2701 2216 1267 945 849 564 95 11377 13337 --
NM_012309chr1153781 3540 1559 1452 817 11890 34034 1201 360 --
NM_012325chr2011513 ------
NM_012327chr1861513 1385 1327 595 441 417 ------
NM_012329chr171401 129 ----
NM_012333chr111441 11381 ----
NM_012334chr554159 3961 3013 1823 1387 11206 --13238
NM_012381chr6159 ------
NM_012382chr543511 3406 1804 1473 12921 ----
NM_012384chr2042251 2003 1969 949 --11719 --
NM_012395chr733354 1159 488 --1355 --
NM_012399chr2221336 436 1107 ----
NM_012405chr142509 2440 802 416 --12450 --
NM_012448chr172921 41 --22220 161 11857
NM_012455chr241379 1232 548 373 ------
NM_012471chrX31601 1263 263 --1433 --
NM_012474chr11258 ------
NM_012478chr173395 197 129 1138 1813 --
NM_012479chr721807 175 --12493 --
NM_012481chr173673 561 222 ------
NM_013227chr153796 604 292 1178 ----
NM_013247chr2198 ----1125
NM_013257chr831833 927 680 12431 ----
NM_013261chr42993 829 --23761 622 12367
NM_013262chr611208 ------
NM_013269chr1242894 1046 632 384 14436 1801 --
NM_013277chr12--1197 ----
NM_013279chr1161975 658 565 264 101 29 2749 429 ----
NM_013291chr8------126
NM_013308chr31385 ----1399
NM_013309chr1552244 2215 2168 1849 120 ------
NM_013330chr1----1196 --
NM_013353chr1126 ------
NM_013372chr1542097 735 265 194 22308 2125 12338 --
NM_013374chr333033 330 211 ------
NM_013381chr121243 ------
NM_013386chr111558 ------
NM_013450chr23954 323 215 156 ----
NM_013943chr122160 550 ----23282 3276
NM_013981chr51179 ------
NM_013982chr51179 ------
NM_013983chr51179 ------
NM_013989chr1444848 4785 4303 1048 13817 34795 1955 1896 --
NM_014007chr921177 140 --1321 --
NM_014011chr221831 51 ----12515
NM_014016chr31617 --184 1639
NM_014028chr642643 2466 2158 913 --12076 12823
NM_014034chr611399 1143 ----
NM_014038chr71402 ------
NM_014039chr1141066 889 417 188 ------
NM_014048chr1695229 5019 4721 3980 3492 3397 2100 1863 1173 13771 ----
NM_014071chr201454 ------
NM_014079chr32870 109 --1745 --
NM_014089chr1331539 594 511 11401 ----
NM_014110chr11791 --1372 --
NM_014112chr854635 4028 2130 1095 300 34259 1370 833 15521 15256
NM_014141chr784130 3733 3678 1771 1682 800 779 580 3665 615 109 --11738
NM_014155chr1156620 6123 5929 4974 539 44967 2915 2904 2298 26923 1529 --
NM_014157chr1673007 2762 2726 2707 1406 312 54 1243 ----
NM_014160chr321401 1345 11028 11033 --
NM_014243chr43749 310 197 11675 ----
NM_014252chr13181 ------
NM_014264chr4--1584 1471 --
NM_014271chrX1171 --1569 --
NM_014299chr1961963 1753 1674 1393 456 213 --11982 --
NM_014319chr1211636 ------
NM_014323chr222739 271 ------
NM_014325chr122777 138 1840 ----
NM_014335chr1511323 21356 1137 --11034
NM_014368chr92191 136 11319 1728 --
NM_014372chr121447 590 12013 ----
NM_014415chr3----1383 --
NM_014418chr1451828 800 790 729 667 21963 101 --21794 1393
NM_014454chr6--140 ----
NM_014462chr8------1242
NM_014488chr112728 235 2167 33 ----
NM_014494chr161952 --1593 --
NM_014517chr321804 1665 1455 --21919 1280
NM_014585chr21399 ------
NM_014587chr162977 190 --11155 1289
NM_014603chr1731634 1346 463 --2536 209 11711
NM_014607chr21413 --2459 266 --
NM_014612chr91183 ------
NM_014620chr121807 ------
NM_014634chr2263241 2625 658 618 428 244 42997 2917 2892 2507 1518 --
NM_014636chr944228 3223 1652 948 --1167 33346 1537 1129
NM_014640chr2280 63 --145 --
NM_014646chr1873180 2140 1220 694 580 156 88 1982 ----
NM_014647chr1611668 1334 ----
NM_014659chr153224 178 34 3921 193 116 1234 1135
NM_014661chr1053461 893 564 233 64 --1210 22700 1159
NM_014665chr853600 3193 3016 1024 750 --43522 3095 3002 958 32967 2264 1301
NM_014670chr231571 1350 1332 ------
NM_014671chr72280 37 1592 ----
NM_014677chr82447 34 --21403 492 --
NM_014682chr831422 886 627 1714 ----
NM_014686chr196889 766 367 215 198 110 --194 12495
NM_014701chr15--23451 2225 1476 --
NM_014702chr652905 2201 1156 691 124 ------
NM_014705chr752153 1760 712 472 181 ------
NM_014707chr732121 2049 868 ------
NM_014711chr1632089 1866 91 ------
NM_014721chr646558 787 318 264 35617 2664 1740 22643 2551 --
NM_014730chr1244882 4398 4260 51 65090 4253 3583 1783 945 401 ----
NM_014730chr1244882 4398 4260 51 65090 4253 3583 1783 945 401 ----
NM_014731chr2031550 1436 437 ----11291
NM_014732chr16125476 4436 3972 1930 1163 1148 1053 880 706 655 247 137 1102 --15700
NM_014733chr532034 1456 456 ------
NM_014742chr2051504 1485 641 541 444 --11384 --
NM_014743chr442965 2606 2338 2274 1353 ----
NM_014747chr165311 4836 4517 3619 3519 1383 12310 11191 --
NM_014757chr521471 224 1180 1305 11531
NM_014758chr1131905 63 55 1928 1607 1374
NM_014766chr753270 2392 2339 1185 1080 21512 59 11446 --
NM_014771chr164837 664 411 172 ------
NM_014772chr1863291 3221 3019 1266 1255 299 --23299 536 --
NM_014774chr132089 1151 79 1221 23010 2456 1918
NM_014776chr122823 404 ----12564
NM_014779chr321186 205 --1724 --
NM_014781chr81181 1377 1342 --
NM_014788chr952442 2197 857 221 72 32836 1025 798 12056 --
NM_014790chr51395 --159 --
NM_014810chr143530 2551 1404 784 22255 130 --12674
NM_014812chr111337 11744 ----
NM_014819chr52650 448 11882 ----
NM_014826chr132688 840 104 1450 11495 --
NM_014828chr1472536 2407 2384 2122 2013 866 449 ------
NM_014830chr1263623 2907 692 664 532 292 1438 ----
NM_014835chr2061865 1690 654 522 416 284 ------
NM_014839chr112147 11724 1113 --
NM_014840chr1232911 2622 257 1285 11131 --
NM_014841chr61456 ----198
NM_014847chr11354 ------
NM_014850chr344092 3852 3669 1767 23791 3340 ----
NM_014864chr143760 3157 2852 430 44012 3721 3595 96 13979 --
NM_014870chr133345 1526 1223 31449 1161 885 21516 709 --
NM_014873chr123380 1631 23040 1162 1323 --
NM_014877chr1797421 5778 5691 2877 2055 1595 1105 517 416 26330 4987 ----
NM_014883chr452400 2289 1963 974 807 --1887 1299
NM_014891chr721536 1320 ----11049
NM_014897chr1743158 457 300 123 12946 --12613
NM_014900chr21161 1306 ----
NM_014903chr1222410 552 --1920 --
NM_014906chr1731389 315 277 11574 --13668
NM_014912chr10----1316 --
NM_014913chr1851229 1216 1209 293 160 ------
NM_014918chr1521558 1411 ------
NM_014920chr621298 495 32914 2510 2406 ----
NM_014921chr1962421 2297 2184 1107 1007 986 --31223 220 207 --
NM_014924chr1433166 326 242 1500 ----
NM_014932chr311905 21537 1354 2401 376 --
NM_014934chr1333667 3203 601 135 ----
NM_014935chr153144 3000 2891 1187 453 --33196 2603 946 --
NM_014953chr1343980 3247 3110 491 34262 3062 1064 ----
NM_014964chr1772195 2085 1909 1741 724 539 277 --22290 427 11779
NM_014982chr1464526 3826 3546 902 851 434 15239 11549 --
NM_014988chr462199 1953 870 838 705 537 11080 12564 12208
NM_014989chr631784 1515 508 --1670 --
NM_014991chr41893 ------
NM_014994chr1542123 1666 698 577 --32047 1916 479 12234
NM_014997chr762775 2498 2369 2189 1891 130 32524 2394 671 ----
NM_015000chr1242745 2137 181 53 ------
NM_015002chr1241708 867 205 104 ----1123
NM_015008chr332567 1169 376 --23147 2289 --
NM_015025chr232449 1985 71 ------
NM_015026chr1233346 3187 466 23740 731 ----
NM_015027chr1641701 1486 1416 521 1290 ----
NM_015032chr1322053 594 ----11862
NM_015033chr922944 426 --3869 774 210 1658
NM_015039chr193683 3532 3049 1715 1550 1149 1014 636 612 ----13245
NM_015042chr1574140 2645 475 389 373 166 89 --11551 1728
NM_015044chr1663091 2765 2450 883 873 350 12245 ----
NM_015051chr922973 1329 1824 ----
NM_015053chr152264 2228 1790 780 352 --22211 2189 --
NM_015071chr595328 4802 4511 2450 2246 1919 1134 599 191 1218 ----
NM_015073chr1971704 1593 1383 753 739 316 151 11425 ----
NM_015074chr174308 4217 3925 3269 1781 1156 412 --24571 3183 --
NM_015076chr643297 1674 864 25 11474 11482 --
NM_015077chr17134355 3980 3748 3411 3011 1780 1716 1634 1169 677 644 449 77 ----14603
NM_015079chr1593166 2750 2528 2491 798 732 678 522 364 --2661 50 --
NM_015082chr532024 1973 1916 ------
NM_015092chr1633755 148 50 33927 3795 515 14579 --
NM_015094chr2294492 4141 3990 3655 3083 3042 1742 1659 925 11266 14316 --
NM_015101chr131865 664 29 21924 955 11873 22697 369
NM_015113chr1762351 2087 1931 647 272 93 --1508 --
NM_015132chr7--1294 198 11848
NM_015138chr1541002 911 531 378 --1192 --
NM_015155chr1083058 2898 2379 2293 770 663 504 496 12513 22984 2259 23196 922
NM_015158chr9------1107
NM_015161chr1621257 565 ------
NM_015163chr1451810 792 615 372 74 --123 --
NM_015173chr441715 653 607 120 1129 11553 --
NM_015191chr1122214 467 --42703 2334 1705 800 --
NM_015194chr1761862 1711 1643 664 553 440 11635 1514 --
NM_015199chr352852 2642 2429 724 347 ------
NM_015205chr13105091 4339 4228 4210 4142 1858 1729 1017 875 24 --44041 865 774 340 --
NM_015206chr1533133 1405 858 23082 1350 ----
NM_015209chr12730 710 --11459 11605
NM_015215chr152890 2641 2392 2181 160 32656 422 232 ----
NM_015233chr1332496 2385 648 --1612 --
NM_015236chr411115 --11124 --
NM_015247chr1655312 5090 3794 1742 1372 14706 ----
NM_015252chr2----1692 --
NM_015263chr152494 60 11049 ----
NM_015265chr23943 355 344 ------
NM_015270chr1232209 1963 575 --21890 1752 --
NM_015271chr4--2684 317 13394 23231 927
NM_015272chr16--11549 ----
NM_015278chr63910 583 506 13298 1765 --
NM_015282chr232817 2762 2673 --12630 --
NM_015284chr181918 1832 1826 1805 1590 769 83 54 ------
NM_015308chr113557 271 67 ------
NM_015310chr847974 7101 6245 1579 25568 1675 27611 3056 26820 2261
NM_015315chr542720 2586 1208 699 12811 1508 12729
NM_015317chr222733 2288 ----12151
NM_015326chr152475 598 556 224 76 42738 2650 2614 2505 ----
NM_015328chr72750 588 13099 --12921
NM_015332chr783504 3259 3072 2758 2626 2279 300 192 11329 22296 862 22533 1244
NM_015336chr1222266 596 22185 769 ----
NM_015344chr812064 --11564 --
NM_015345chr642679 769 605 544 --22712 1025 --
NM_015347chr1222377 1102 ----22461 1889
NM_015349chr663016 1996 1183 809 782 63 ------
NM_015359chr82320 194 --22507 58 12601
NM_015365chrX33330 3122 2878 13708 --13959
NM_015375chr155020 4627 4200 3105 1304 ----11891
NM_015378chr142398 2160 1867 48 12485 12937 --
NM_015381chr2231907 1455 796 --11554 1238
NM_015387chr22765 305 --21543 186 --
NM_015396chr321012 64 ------
NM_015397chr9----11397 --
NM_015409chr1212641 ----12707
NM_015435chr821373 1347 192 ----
NM_015436chr433180 2732 593 12952 11218 --
NM_015441chr11356 ----143
NM_015446chr12366 45 ------
NM_015455chr531474 1148 576 13837 ----
NM_015463chr22127 62 ------
NM_015481chr12----1887 1695
NM_015483chr721006 149 11100 1982 11040
NM_015493chr1972008 842 794 707 310 261 23 --1469 --
NM_015508chr331480 565 548 1530 ----
NM_015526chr1931107 477 127 ----142
NM_015535chr243287 3219 1174 154 ------
NM_015553chr643471 2023 349 166 11308 1116 --
NM_015557chr163490 2319 780 685 594 114 22261 728 23397 3168 --
NM_015564chr533350 2492 29 33133 2731 797 12313 --
NM_015568chr2094216 4006 3592 3406 2685 1203 1167 709 58 24091 3007 1574 12781
NM_015569chr184481 4050 3984 1689 1222 328 120 104 24511 3052 --14523
NM_015576chr332852 444 149 1672 ----
NM_015577chr531149 475 248 1200 ----
NM_015578chr1911649 ----1115
NM_015609chr141968 899 702 616 1342 12643 22152 1005
NM_015635chr922055 117 --170 --
NM_015640chr143267 1007 877 338 ------
NM_015678chr1351530 1504 1377 641 437 --1190 --
NM_015686chrX32328 2128 543 11570 142 --
NM_015691chrX62739 2725 2654 1128 717 66 ------
NM_015696chr12395 223 --1234 --
NM_015725chr191414 ----2486 461
NM_015850chr86747 700 549 280 231 125 ------
NM_015866chr13571 451 111 ------
NM_015872chr121544 1174 --1123 1118
NM_015878chr83417 221 155 11569 ----
NM_015879chr18117284 7261 6660 6394 6152 5852 5788 5203 2696 964 925 28424 3261 1712 --
NM_015902chr8--139 --1180
NM_015906chr11643 23430 1010 ----
NM_015908chr7185 ------
NM_015980chr521288 370 11421 ----
NM_015982chr171283 --1125 --
NM_015995chr1584437 4339 3832 3726 990 737 412 374 25343 4128 23362 1342 --
NM_016009chr143439 359 123 116 13698 ----
NM_016018chr812606 22263 388 1794 --
NM_016022chr11175 ----1866
NM_016025chr1631940 1841 1298 ------
NM_016026chr1461482 923 504 482 386 348 ------
NM_016037chr1----1329 --
NM_016045chr2021347 513 ------
NM_016072chr1212191 1146 ----
NM_016076chr153151 2637 2308 509 53 22298 2159 12555 12683
NM_016078chr171210 11007 ----
NM_016083chr633137 2776 1334 ------
NM_016089chr381601 1451 798 546 462 455 378 42 --21588 127 --
NM_016096chr811568 1101 1396 --
NM_016098chr6146 ----1334
NM_016107chr52967 413 ------
NM_016120chrX3956 382 226 11146 ----
NM_016121chr13848 765 466 1342 ----
NM_016128chr3--1336 ----
NM_016131chr212335 ------
NM_016152chr321154 212 ------
NM_016173chr3113802 3773 3732 3101 3078 1809 1238 983 936 853 171 --138 11610
NM_016201chr332092 1769 416 --1879 1194
NM_016205chr411324 --2304 269 --
NM_016206chr312564 16906 --18457
NM_016248chr1353734 3253 2650 529 432 ----13381
NM_016255chr622991 59 22677 1128 --12546
NM_016260chr236420 1058 975 27028 955 11911 --
NM_016261chr172529 126 ------
NM_016275chr332533 1878 613 12327 ----
NM_016279chr51206 ------
NM_016281chr122456 171 ------
NM_016284chr161146 ------
NM_016287chr121766 146 ------
NM_016289chr231740 185 62 --11645 --
NM_016300chr3----1530 --
NM_016308chr131777 632 238 11583 ----
NM_016322chr952772 2473 2173 906 754 12331 --1922
NM_016329chr31114 ------
NM_016376chr1764311 3988 890 873 227 211 13774 21148 66 --
NM_016396chr1522862 2294 ----1297
NM_016441chr251526 826 708 526 513 --12048 --
NM_016480chr5----1246 --
NM_016485chr61174 --11853 1162
NM_016488chr1211806 ----11702
NM_016507chr1723037 1971 33011 2249 157 1190 --
NM_016513chr621298 495 32914 2510 2406 ----
NM_016522chr1111179 ------
NM_016526chr1142000 1844 728 27 --11815 12395
NM_016530chr1542965 2800 1643 300 ------
NM_016577chr3114338 4267 4023 3891 3516 3386 3212 3091 884 793 166 11383 1563 --
NM_016578chr111162 --153 --
NM_016603chr511388 ----12197
NM_016605chr551969 1778 1770 1664 805 --2729 328 --
NM_016613chr41517 ----1570
NM_016621chr1194447 4426 3782 3324 3269 3199 1762 230 156 1249 21832 296 11721
NM_016623chr81658 ------
NM_016653chr221120 1071 ------
NM_016929chr644365 3837 787 240 13508 23208 308 --
NM_016952chr1142765 2561 2493 899 13977 1387 --
NM_016953chr245034 4934 2341 1251 1902 25370 4013 12451
NM_017410chr1221156 929 --1938 --
NM_017413chrX11795 --2589 125 --
NM_017415chr531153 813 534 24002 1496 14117 --
NM_017420chr1432937 2587 840 --135 --
NM_017426chr4153 --1447 --
NM_017451chr173849 759 242 --11050 1270
NM_017456chr1742000 1322 198 129 11330 1560 --
NM_017515chr1131500 324 32 --21253 284 --
NM_017519chr6--11129 ----
NM_017520chr131603 ------
NM_017551chr1011816 42694 2384 1695 47 --12094
NM_017582chr1--21345 664 21739 1574 --
NM_017592chr1932486 1027 863 2543 126 --22710 2014
NM_017594chr91955 2944 257 --12359
NM_017595chr1751233 1198 1160 686 123 --31262 410 384 --
NM_017596chr13880 664 463 24562 490 11534 13896
NM_017599chr121456 --11640 --
NM_017628chr464957 4269 4257 4154 1960 1421 13706 --12010
NM_017629chr141757 1564 1419 266 1114 11509 --
NM_017635chr1131347 1163 1086 1118 1347 21434 436
NM_017637chr9149095 7906 7527 7500 7463 7313 3389 2916 1967 1069 337 184 37 28 18859 18671 22906 2059
NM_017644chr334260 4222 1609 --14056 --
NM_017650chr754459 4369 3782 1523 1069 21234 453 ----
NM_017651chr631574 614 280 --1565 --
NM_017658chr1434535 1233 1094 14379 ----
NM_017660chr1973351 3243 2594 2496 2252 394 176 --1128 1286
NM_017697chr8----1371 --
NM_017706chr531096 236 36 11178 ----
NM_017724chr31218 ------
NM_017728chr1772481 2404 2246 711 609 529 213 22436 1912 13091 1444
NM_017752chrX52096 809 740 362 322 ------
NM_017754chr623325 939 --31578 1236 158 148
NM_017769chr1432600 2313 694 12701 ----
NM_017770chr62269 32 2907 186 ----
NM_017780chr81806 ------
NM_017784chr321200 757 ------
NM_017789chr21187 --2196 67 --
NM_017799chr1431316 400 268 ------
NM_017801chr321917 533 1672 1994 --
NM_017811chr932630 2227 595 12978 ----
NM_017813chr824416 135 14975 25323 593 --
NM_017824chr101758 21030 388 ----
NM_017845chr42107 21 ------
NM_017848chrX54284 3207 3172 1549 718 ------
NM_017902chr1065591 4269 3862 1309 980 890 13754 1773 --
NM_017911chr22136 ------
NM_017926chr141114 1337 --1618
NM_017944chr1142684 617 531 347 11177 --1115
NM_017945chr31892 11017 ----
NM_017972chr141114 1337 --1618
NM_017974chr22345 268 ------
NM_017998chr9--1923 ----
NM_018011chr131476 1615 ----
NM_018014chr231042 984 298 ------
NM_018017chr1021081 843 2861 570 ----
NM_018018chr122316 140 1130 1546 --
NM_018024chr8--1492 ----
NM_018027chr1073003 2860 658 410 400 111 53 11124 1202 --
NM_018061chr1--11079 ----
NM_018085chr1107114 5184 2827 2079 1971 1676 1654 1644 165 39 28016 6192 ----
NM_018086chr211574 ----11544
NM_018113chr12------1496
NM_018121chr1011107 --13093 --
NM_018126chr431449 1293 248 ------
NM_018128chr1751269 1220 1196 1050 979 --2530 490 --
NM_018133chr3--1554 ----
NM_018144chr101250 ------
NM_018156chr142398 2160 1867 48 12485 12937 --
NM_018157chr1272991 2857 2146 1120 1099 733 701 140 ----
NM_018159chrX11392 11254 11170 --
NM_018167chr141384 --1879 --
NM_018177chr42961 252 ------
NM_018181chr1831661 1630 486 ------
NM_018191chr1321616 105 ------
NM_018202chr12595 176 ------
NM_018206chr16----1770 --
NM_018211chr131698 202 83 --1534 --
NM_018214chr62175 98 --1187 --
NM_018222chr1131370 1231 289 --11599 --
NM_018227chr453096 2111 623 573 135 13025 ----
NM_018243chr434057 3122 1233 ----23391 126
NM_018254chr12172 51 2487 137 --11946
NM_018263chr252570 2424 2209 1005 54 12011 ----
NM_018275chr7------1205
NM_018286chr172344 223 ------
NM_018287chr102289 45 ------
NM_018293chr34995 318 213 73 ----1623
NM_018299chr813491 12994 --1909
NM_018307chr17----1954 --
NM_018312chr1131800 747 565 21363 126 ----
NM_018330chr10151 ------
NM_018337chr19------1655
NM_018351chr1263456 2969 1739 1357 529 51 11086 ----
NM_018364chr143181 3094 2656 1050 --13470 11569
NM_018374chr734714 1941 1614 ------
NM_018383chr241735 515 179 173 ------
NM_018387chr91195 ------
NM_018398chr31250 ----1120
NM_018403chr353912 3614 3353 1336 876 --2361 280 1195
NM_018425chr1052163 1951 1922 595 346 ----1666
NM_018440chr8117459 6952 6607 6065 6050 5698 2531 2016 1888 1579 571 38489 1654 696 --1598
NM_018452chr6_random32953 2598 124 11261 ----
NM_018457chr12----137 --
NM_018475chr41722 ------
NM_018482chr862507 2464 2140 1785 1697 466 --11843 1180
NM_018486chrX--1455 1369 --
NM_018488chr17--1747 ----
NM_018557chr2------193
NM_018566chr123621 1998 34991 410 303 13595 --
NM_018584chr12397 101 11208 11052 --
NM_018590chr1031663 1552 1237 ------
NM_018640chr122654 435 ------
NM_018650chr132223 2195 531 --12210 --
NM_018660chr832938 1018 263 --172 --
NM_018667chr1652072 583 493 225 30 --1525 --
NM_018682chr71470 --1117 --
NM_018695chr511631 ------
NM_018697chr732072 2062 49 31809 525 133 ----
NM_018698chrX11486 21816 1543 ----
NM_018703chr161152 1340 ----
NM_018710chr811105 ------
NM_018834chr5--1688 ----
NM_018837chr20--2908 167 1234 --
NM_018844chr711930 1431 ----
NM_018945chr642580 1358 1246 545 ----1410
NM_018947chr774476 4263 4214 3404 3268 991 88 ------
NM_018959chr192729 640 ----1197
NM_018970chr743121 3102 2428 770 2197 104 --12242
NM_018972chr832038 1918 194 --12407 1791
NM_019001chr333735 984 363 23864 726 ----
NM_019005chr7--1137 ----
NM_019006chr15----1724 --
NM_019024chr2140 ------
NM_019035chr42518 293 ----12030
NM_019042chr7----11088 --
NM_019063chr262016 1880 1828 1456 784 581 21993 1887 ----
NM_019087chr511709 ------
NM_019106chr2293331 3118 2647 2347 2186 2103 1128 666 595 12954 ----
NM_019114chr9--12556 11933 --
NM_019555chr331142 718 684 --21711 1691 11287
NM_019592chr91595 1574 ----
NM_019593chr2021952 582 --12030 --
NM_019594chr93531 315 287 --21580 1240 --
NM_019600chr151123 ------
NM_019605chr1----1177 --
NM_019610chr11866 22034 855 ----
NM_019843chr221173 ------
NM_019848chrX----126 --
NM_019857chrX21568 1285 1600 --11103
NM_019859chr1011424 --21025 501 --
NM_019860chr1011472 --21073 549 --
NM_019885chr222192 2013 --2558 232 --
NM_020066chr12382 200 ------
NM_020119chr773343 3330 1585 1518 1367 1187 233 ------
NM_020122chr2105780 5722 5473 5170 4780 3796 2188 1698 1681 568 ----1703
NM_020123chr102293 269 ------
NM_020134chr22993 302 --146 1762
NM_020141chr142082 2008 338 201 ----1722
NM_020144chr71149 21459 437 ----
NM_020150chr10--12126 ----
NM_020177chr523322 2419 ----22302 84
NM_020178chr172785 339 ------
NM_020205chr1----12394 --
NM_020239chr13629 95 77 --1584 --
NM_020245chr673914 3749 1814 1174 926 781 598 --1401 14766
NM_020248chr121893 926 --21864 180 1778
NM_020310chr1761865 1840 1076 259 187 102 11028 172 --
NM_020337chr422499 710 13067 ----
NM_020342chr252365 2238 955 291 240 ------
NM_020346chr1121429 503 ------
NM_020348chr1032604 1044 700 1730 ----
NM_020357chr3------11409
NM_020390chr344910 4202 3809 2986 23790 1468 1955 --
NM_020401chr121166 ------
NM_020429chr773053 2664 2572 825 809 405 41 --12526 --
NM_020431chr1462435 2015 1953 862 642 569 22625 2247 1392 --
NM_020432chr721526 125 ------
NM_020440chr12414 102 22535 180 ----
NM_020443chr186903 4540 4485 1890 1741 1161 761 633 14865 21962 49 14874
NM_020457chr16------1209
NM_020463chr22604 135 ------
NM_020466chr664115 1362 1180 617 381 140 21677 391 ----
NM_020474chr183351 176 130 --1165 --
NM_020475chr821959 988 11529 12461 1906
NM_020476chr821959 988 11529 12461 1906
NM_020477chr821959 988 11529 12461 1906
NM_020478chr822022 1561 11592 12524 1969
NM_020480chr821959 988 11529 12461 1906
NM_020526chr151542 1393 1225 528 54 11451 --21476 622
NM_020530chr221113 ------
NM_020546chr553013 2929 1059 582 555 1533 22654 2151 --
NM_020647chr8----1562 --
NM_020662chr621880 145 ------
NM_020665chrX1554 ------
NM_020673chr2066928 4993 2414 1190 1125 141 47246 5794 5335 763 22267 81 12123
NM_020699chr144686 4680 1284 906 1152 11238 24049 3853
NM_020702chr931547 1194 147 --11396 --
NM_020704chr752209 2188 1724 1553 90 --12403 --
NM_020717chrX74258 3202 1948 1357 978 426 166 11771 21719 476 24839 1443
NM_020718chr1665312 4948 2023 836 531 449 13990 --1610
NM_020732chr6--11129 ----
NM_020734chr1242362 1050 714 409 1490 ----
NM_020738chr21604 11743 1185 --
NM_020747chr53752 113 66 ------
NM_020752chr1032236 351 226 ----12347
NM_020753chr171198 ------
NM_020754chr341288 1018 484 65 ----1978
NM_020760chr241627 1469 1341 300 1722 --11297
NM_020761chr1761902 1644 1524 523 436 22 ----1239
NM_020762chr121154 ------
NM_020766chrX34151 4047 1688 14169 11498 --
NM_020772chr1748441 7430 7318 6900 ------
NM_020774chr1865843 4986 1896 884 666 144 ------
NM_020776chr1831923 894 673 --22237 579 1120
NM_020791chr1711236 --1520 --
NM_020795chr1731416 1311 496 --1246 11497
NM_020801chr51144 21688 1018 --11063
NM_020807chr1661493 639 492 467 364 24 --1192 1284
NM_020810chr1453495 3284 1100 957 30 ------
NM_020834chr1431859 1420 1409 1208 11695 --
NM_020839chr331556 544 174 ------
NM_020841chr1233544 3311 57 1964 ----
NM_020845chr1262175 2077 1765 750 61 53 --21907 219 --
NM_020850chr1632624 2589 1304 21131 835 11324 1332
NM_020854chr181510 ----1485
NM_020856chr1941377 994 481 177 ------
NM_020858chr153869 620 148 1280 ----
NM_020865chr3------1360
NM_020868chr221918 1555 1147 ----
NM_020870chr4----11860 --
NM_020899chr1742456 250 63 29 --1326 --
NM_020918chr1042907 2770 687 59 1792 ----
NM_020921chr1433563 544 284 1102 --11337
NM_020946chr9--11075 1190 1698
NM_020977chr45830 626 193 89 80 22117 39 ----
NM_020983chr1232209 1963 575 --21890 1752 --
NM_020987chr101341 11341 ----
NM_020988chr1611145 ------
NM_020993chr1272818 2501 2272 2248 2197 649 642 ----22286 49
NM_021005chr151448 1969 ----
NM_021007chr262434 2048 1971 1917 1853 228 --1355 --
NM_021033chr13--33166 2844 2609 ----
NM_021064chr621428 466 1488 21397 311 --
NM_021069chr441828 1620 1381 37 1817 --1145
NM_021072chr5--1581 ----
NM_021079chr1762777 2752 916 558 277 126 22904 980 21050 143 --
NM_021090chr2284796 4535 4362 3364 3071 1063 1013 454 34263 1164 926 ----
NM_021096chr2242883 1241 685 503 --23293 2212 --
NM_021116chr7128206 7783 6804 6677 6322 6081 5604 3109 2948 2922 2419 87 31421 749 97 13545 48089 5920 3320 841
NM_021117chr1161692 875 817 311 232 92 12209 --11900
NM_021120chrX52507 2501 2213 2047 285 ------
NM_021135chr642659 2467 1075 700 136 32229 2102 199 --
NM_021140chrX1379 ------
NM_021148chr731794 404 361 11820 1185 --
NM_021163chr723134 2579 ----12468
NM_021200chr1131136 886 227 --21045 1002 --
NM_021202chr2042777 2000 1931 991 22508 1173 12292 --
NM_021220chr201109 ----1139
NM_021239chr1421243 213 --1400 --
NM_021255chr1434133 2582 170 --1783 --
NM_021574chr2222021 1636 ----11538
NM_021614chr5192 ------
NM_021629chr343886 3271 1799 207 ----13488
NM_021633chr13408 104 36 --1122 --
NM_021639chr12762 343 1935 ----
NM_021647chr471640 1247 1115 939 221 202 92 --13471 1575
NM_021648chr63858 802 707 12676 --12207
NM_021813chr695511 5307 3820 3608 1821 1637 1379 1227 1198 ------
NM_021911chr595349 5110 4762 4590 4559 3686 2213 812 49 33613 3532 1037 21990 893 --
NM_021912chr1533654 1428 1382 --13814 13351
NM_021949chrX22270 1825 1769 12470 12134
NM_021954chr1311300 22953 925 --180
NM_021956chr61478 1406 ----
NM_021960chr1158 ------
NM_021961chr1166522 6407 5818 1946 1797 1080 16055 35758 4686 1126 --
NM_021964chr346374 5508 2471 2364 12403 11571 12210
NM_021977chr643303 2576 2433 1318 11015 --12901
NM_021984chrX31004 360 299 11572 11323 --
NM_021987chrX31004 360 299 11572 11323 --
NM_021990chrX31004 360 299 11572 11323 --
NM_022039chr104554 179 144 40 --1427 --
NM_022048chr1575239 4217 2487 1823 1098 1053 1033 15775 13855 --
NM_022049chr141793 1670 1283 269 1754 --1555
NM_022051chr11101 ------
NM_022062chr112581 515 11950 ----
NM_022123chr141215 ------
NM_022130chr5--2959 46 ----
NM_022140chr511723 --1788 11561
NM_022166chr1695188 4980 4896 1306 1250 1072 867 619 169 36049 4180 4107 12424 --
NM_022458chr753080 2355 2302 1161 985 --12406 11014
NM_022462chr1953810 2414 2346 1349 93 --21254 614 --
NM_022465chr1212966 ------
NM_022473chr1573965 2915 1746 1361 1211 892 118 ------
NM_022474chr1422068 495 --1631 22223 794
NM_022497chr373074 2696 1286 1046 638 609 43 ------
NM_022552chr2--1107 1899 --
NM_022648chr254316 3236 1544 1097 814 14205 13052 --
NM_022650chr5--1172 2883 623 --
NM_022652chr12----2115 67 --
NM_022716chr122958 1941 --1585 --
NM_022719chr2253232 1273 1014 404 121 33768 2854 956 ----
NM_022733chr1--1912 --1245
NM_022739chr1711049 ------
NM_022745chr152919 2734 2555 1899 507 1579 31997 1084 441 --
NM_022758chr653163 2041 1160 692 265 1730 1591 1985
NM_022763chr332450 828 236 --1368 --
NM_022776chr321378 116 ------
NM_022778chr161439 1318 1104 461 419 389 ------
NM_022780chr211856 --21635 1493 1236
NM_022781chr972623 2535 2057 1094 1060 890 584 1511 ----
NM_022817chr241666 792 42 30 --21765 364 11943
NM_022831chr11479 1118 ----
NM_022832chr4----12261 1971
NM_022843chr1311197 --1363 --
NM_022845chr1612201 1634 --11929
NM_022893chr211078 2946 826 --1180
NM_022894chr22649 306 ------
NM_022898chr1454354 4059 1264 1012 809 23221 878 14052 --
NM_022913chr5--1268 ----
NM_022970chr1021291 959 2275 141 ----
NM_023002chr1982096 1792 1456 858 709 439 401 202 1289 ----
NM_023010chrX----1773 1656
NM_023012chr12----1562 --
NM_023105chr86747 700 549 280 231 125 ------
NM_023106chr86747 700 549 280 231 125 ------
NM_023110chr86747 700 549 280 231 125 ------
NM_023111chr86747 700 549 280 231 125 ------
NM_024086chr1783690 2932 2695 1354 1195 812 226 81 ----11111
NM_024294chr653163 2041 1160 692 265 1730 1591 1985
NM_024321chr191106 ------
NM_024345chr911624 34581 3804 1519 11292 --
NM_024408chr132292 834 104 1511 23483 381 --
NM_024423chr1834193 4079 3664 12840 ----
NM_024492chr6--1518 --2959 304
NM_024513chr3103102 2759 2645 2637 1378 1286 1130 823 547 399 13731 2294 173 --
NM_024524chr331092 780 92 1663 ----
NM_024525chr11501 --1649 --
NM_024612chr1731038 345 161 1775 ----
NM_024613chr8--11409 --1436
NM_024631chr11----1551 --
NM_024640chr13386 223 94 --1109 --
NM_024659chr21863 ------
NM_024665chr354453 3570 3272 724 320 23855 367 ----
NM_024740chr1113368 21449 408 ----
NM_024761chr985198 5147 4250 1850 862 740 719 236 14398 11026 13441
NM_024770chr2116224 5375 4887 4184 2707 2497 1995 1493 1263 727 374 26152 1359 11228 --
NM_024779chr12----21640 84 11385
NM_024787chr81163 ------
NM_024811chr1131775 1457 457 11244 ----
NM_024884chr1414355 23818 362 --13295
NM_024922chr1651634 834 764 646 443 52019 1967 1918 1749 1371 1108 --
NM_024939chr1651142 645 495 234 28 21456 74 ----
NM_024946chr161515 --21533 308 --
NM_024947chr347974 7077 1273 692 ------
NM_024949chr453984 3678 1686 838 143 44694 4206 4137 1286 21486 736 11495
NM_024953chr1231963 765 286 ------
NM_024963chr7135441 5095 4219 3895 3710 2269 2146 2044 1295 1000 410 112 64 23919 694 24175 1664 --
NM_024989chr277568 3254 2750 2217 1074 707 76 16127 11428 --
NM_024993chr23379 155 82 1548 ----
NM_025133chr2--1306 ----
NM_025134chr1632455 2226 563 11575 ----
NM_025160chr172650 1064 973 909 741 571 179 ------
NM_025179chr173571 3432 3352 1810 1654 1611 228 --1158 --
NM_025191chr1----1912 --
NM_025203chr231374 1331 1020 1466 ----
NM_025214chr1822561 647 --22380 1754 --
NM_025221chr4----21348 1051 --
NM_025224chr2072023 1876 1835 1448 716 311 149 --11481 --
NM_025235chr1021492 424 ------
NM_025263chr631579 1315 685 11218 ----
NM_030576chr1762096 2012 1777 823 622 372 11991 1591 --
NM_030583chr82906 225 --1651 --
NM_030594chr1511198 ------
NM_030621chr1432669 1259 785 11527 --13837
NM_030627chr533734 965 681 14111 13069 13059
NM_030634chr162302 2114 2022 1004 816 129 --12235 --
NM_030647chr765032 4285 4037 4015 1919 41 25199 1324 14230 --
NM_030648chr454431 1883 1703 1214 175 14626 ----
NM_030660chr141318 ------
NM_030664chr102310 157 ----11497
NM_030674chr1213897 13720 1968 23729 61
NM_030752chr6--1477 ----
NM_030758chr222896 512 11453 1322 --
NM_030762chr1211655 --1247 --
NM_030767chr952532 2270 700 449 111 --22115 218 --
NM_030803chr22345 268 ------
NM_030806chr167819 7811 6878 6722 6157 1087 38929 6602 2260 18014 11408
NM_030815chr203650 210 109 2735 29 2545 257 --
NM_030816chr133611 2998 127 11356 ----
NM_030884chr341822 1771 246 240 ------
NM_030885chr361944 1747 1675 789 41 35 ----1467
NM_030906chr111418 --1143 1212
NM_030915chr23645 514 31 22340 37 ----
NM_030918chr145039 1313 1026 532 14244 35067 4880 3643 --
NM_030937chr11931 11415 11132 --
NM_030964chr533329 3223 455 --13352 --
NM_031216chr18------1120
NM_031266chr51342 ------
NM_031268chr1685364 4216 1138 1048 888 467 351 93 1191 21955 336 11011
NM_031286chr1----1319 --
NM_031289chr125935 196 122 100 46 ----1111
NM_031293chr16192 ------
NM_031422chr18157 ------
NM_031426chr952470 2309 1997 985 626 22667 330 ----
NM_031438chr51596 11836 ----
NM_031442chrX32372 589 162 ------
NM_031453chr1041834 990 918 538 1101 --11639
NM_031468chr7118177 7578 7207 6683 6485 6312 5969 3045 1538 279 250 --15051 1707
NM_031483chr2031108 823 264 ------
NM_031844chr1------12860
NM_031845chr253150 3129 2318 731 708 12527 12990 --
NM_031847chr253150 3129 2318 731 708 12527 12990 --
NM_031890chr2242324 1183 928 359 22771 176 --13018
NM_031891chr181146 ------
NM_031892chrX2836 749 --1913 --
NM_031924chr61250 1278 ----
NM_031935chr121040 816 ------
NM_031954chr122642 433 11113 22006 1035 --
NM_032042chr552709 2445 1022 703 465 ------
NM_032047chr322241 130 ------
NM_032050chr222739 271 ------
NM_032102chr1132100 579 157 11979 ----
NM_032124chr183852 459 267 21226 80 195 --
NM_032144chr2--11730 ----
NM_032145chr6195 --11498 --
NM_032147chr121763 ------
NM_032153chr311815 ----21986 581
NM_032182chr1041543 1517 585 282 1652 ----
NM_032189chr1394893 4141 4030 4012 3944 1660 1531 819 677 --43843 667 576 142 --
NM_032199chr1043739 3111 2571 1031 ------
NM_032208chr293151 3009 2369 2343 1180 978 537 227 156 1308 21356 736 1765
NM_032217chr4----1878 --
NM_032221chr2011381 --1695 --
NM_032228chr1133159 501 199 41385 690 417 302 12159 --
NM_032229chr13--1438 ----
NM_032268chr1653256 1305 1234 437 70 --33224 864 103 12224
NM_032289chr531833 1568 202 1441 --1463
NM_032291chr11174 ------
NM_032320chr111573 1229 ----
NM_032352chr14----1498 --
NM_032373chr10105640 5445 5398 5290 5243 4677 4386 3975 2270 338 ------
NM_032408chr71316 --11107 161
NM_032413chr15----183 --
NM_032438chr6------2662 28
NM_032444chr16--1911 4984 812 699 130 138
NM_032457chr432838 958 476 --1759 --
NM_032458chrX32885 501 176 23052 911 --12320
NM_032494chr21540 ------
NM_032499chr1511109 1232 ----
NM_032505chr32409 284 1213 ----
NM_032510chr181218 1571 --1879
NM_032521chr2032869 2614 87 ------
NM_032538chr692638 2390 2227 1928 933 370 290 280 174 ------
NM_032539chrX3703 259 31 ------
NM_032558chr91460 ----11176
NM_032560chr142396 117 1411 --1942
NM_032569chr1621459 94 21416 408 --1144
NM_032578chr101495 1285 11321 --
NM_032582chr171617 11791 1263 --
NM_032632chr1421753 701 2713 147 ----
NM_032711chr1733140 258 41 --21370 533 --
NM_032727chr1021186 1127 --11051 --
NM_032765chr5----1916 --
NM_032801chr1122312 1019 2564 349 --1421
NM_032812chr10------127
NM_032813chr13--21061 348 --1159
NM_032818chr941931 1660 381 262 ------
NM_032826chr794766 4581 4210 3899 1852 1213 485 110 26 11606 34494 4374 1639 1514
NM_032833chr132218 956 181 ------
NM_032867chr112586 426 ------
NM_032873chr1173962 3742 3367 1398 1287 1062 379 --2556 542 --
NM_032892chr15128 ------
NM_032906chr43895 255 215 ----1207
NM_032968chrX43783 2660 798 123 1352 ----
NM_032969chrX43783 2660 798 123 1352 ----
NM_032973chrY43775 2655 798 123 1352 ----
NM_032978chr182332 271 1802 --1937
NM_032979chr182332 271 1802 --1937
NM_032981chr182332 271 1802 --1937
NM_033020chr11643 23430 1010 ----
NM_033025chr194230 193 137 118 --1345 --
NM_033030chr2185 11422 ----
NM_033036chr1141741 1362 1245 1074 41657 1520 1146 1115 ----
NM_033044chr11965 ----1950
NM_033089chr205947 560 433 398 37 --11151 --
NM_033119chr162298 212 ------
NM_033138chr71784 12169 ----
NM_033139chr71784 12169 ----
NM_033140chr71784 12169 ----
NM_033157chr71784 12169 ----
NM_033161chr941597 630 223 81 --21758 491 11770
NM_033181chr633137 2776 1334 ------
NM_033201chr1681103 1055 1004 954 859 263 130 73 1841 ----
NM_033211chr51109 ------
NM_033221chr942248 2003 663 27 42642 1090 831 604 11862 --
NM_033222chr941346 1213 997 410 ------
NM_033224chr777240 6181 5782 3006 2685 2525 302 27961 475 22673 2577 --
NM_033244chr1541165 497 263 123 1408 6782 485 204 109 94 79 --
NM_033251chr162394 353 ------
NM_033272chr2--1330 ----
NM_033280chr18------1145
NM_033281chr53677 279 26 ------
NM_033285chr813424 23949 425 23542 837 --
NM_033290chrX43649 3217 317 105 23300 1046 --11029
NM_033309chr162168 94 --1934 --
NM_033326chr1161999 1977 835 818 787 252 ----1107
NM_033364chr31679 11946 --11389
NM_033389chr1734253 3715 1288 --11375 --
NM_033394chr2179 11116 ----
NM_033419chr1741234 482 452 145 11421 2315 170 --
NM_033425chr1163489 3467 3437 2745 1213 451 ------
NM_033429chr1531323 986 657 31116 940 144 22866 692 --
NM_033430chr423108 2820 13506 13849 --
NM_033437chr423108 2820 13506 13849 --
NM_033503chr1593544 2694 1098 784 606 537 523 305 32 ------
NM_033505chr216342 26122 240 ----
NM_033512chr862888 2826 2622 2465 835 348 --2520 484 --
NM_033542chr2041746 1634 669 649 --1301 --
NM_033551chr542720 2586 1208 699 12811 1508 12729
NM_033624chr1241708 867 205 104 ----1123
NM_033631chr152772 1350 1201 618 472 13011 1480 1762
NM_033637chr1053919 1200 756 126 74 23722 2815 ----
NM_052820chr94547 466 458 114 ------
NM_052854chr11----1618 --
NM_052876chr1952471 2277 2031 301 292 11662 ----
NM_052885chr1251741 1550 1223 700 483 ----13540
NM_052898chr821748 282 --21631 413 --
NM_052905chr21620 1743 11435 1256
NM_052907chr1233150 3098 1073 174 13751 13077
NM_052910chr1342064 1396 768 229 --1107 --
NM_052911chr183402 357 25 ------
NM_052918chr1042564 1197 552 213 22721 2333 ----
NM_052927chr53688 58 50 ----11775
NM_052932chr1112475 1306 ----
NM_052934chr141914 849 689 648 ------
NM_052937chr832501 1655 97 ----12525
NM_052951chr20--1160 ----
NM_052998chr11163 ------
NM_053002chr3--11193 ----
NM_053016chr9107967 7534 7308 6179 4886 4870 3069 1743 780 291 16729 1679 --
NM_053023chr1142270 1003 357 219 22925 2192 --1294
NM_053024chr3----11095 --
NM_053025chr311728 ----1249
NM_053026chr311728 ----1249
NM_053027chr311728 ----1249
NM_053028chr311728 ----1249
NM_053031chr311728 ----1249
NM_053032chr311728 ----1249
NM_053064chr14------12441
NM_053281chrX--198 ----
NM_057159chr9126 1441 ----
NM_057169chr122823 404 ----12564
NM_057170chr122823 404 ----12564
NM_057175chr431977 1935 681 ------
NM_058172chr431463 473 374 ------
NM_058237chr142755 338 1932 1394 --
NM_058240chr1421043 110 --170 --
NM_058243chr19187 ------
NM_078487chr942156 937 309 189 --12356 13149
NM_080415chr171716 --2895 72 --
NM_080491chr1183964 3521 2805 2668 1550 1379 319 140 1469 1874 --
NM_080546chr942217 1515 1459 146 ------
NM_080607chr2021068 71 --1308 1728
NM_080632chrX----1773 1656
NM_080683chr4--1390 ----
NM_080684chr4--1390 ----
NM_080685chr4--1390 ----
NM_080738chr121743 1321 --12031 --
NM_080743chr621869 1013 ----11807
NM_080759chr1352169 2020 1691 1011 198 1436 ----
NM_080760chr1352169 2020 1691 1011 198 1436 ----
NM_080836chr2064456 3605 3026 1744 731 552 34357 4251 1620 ----
NM_080862chr311033 ------
NM_080872chr863478 3193 3063 917 384 35 --1560 1555
NM_080881chr5----152 --
NM_080927chr3--11241 ----
NM_101395chr211419 12253 --13480
NM_130391chr942499 2300 1332 1101 12810 ----
NM_130392chr942499 2300 1332 1101 12810 ----
NM_130393chr942499 2300 1332 1101 12810 ----
NM_130437chr211378 12212 --13439
NM_130438chr211328 12162 --13389
NM_130446chr374190 3775 3160 2969 603 178 113 --23183 1515 23278 2826
NM_130469chr142346 167 1134 2836 139 --
NM_130846chr121339 --11028 --
NM_133170chr20137610 7522 7346 5645 5117 2619 2355 2162 1757 660 521 500 232 17880 25095 1121 15393
NM_133265chrX63393 3318 2601 2465 894 794 22723 32 1172 --
NM_133266chr115743 333 112 84 73 ----1801
NM_133330chr433118 836 108 12597 12516 --
NM_133331chr433118 836 108 12597 12516 --
NM_133334chr475595 2173 1538 1496 684 558 383 --45317 1627 705 438 --
NM_133335chr433118 836 108 12597 12516 --
NM_133370chr433053 2950 1362 23318 1479 ----
NM_133452chr192814 141 11026 11119 11062
NM_133468chr752394 2140 637 524 272 ------
NM_133474chr451475 1125 1042 646 63 ------
NM_133476chr1221134 430 --1187 --
NM_133496chr113985 2630 454 13202 --
NM_133638chr511034 ----166
NM_133646chr2125067 5049 4959 4571 4498 4342 3870 2123 1889 1623 1214 528 1223 14615 --
NM_134325chr161449 600 519 384 224 183 ------
NM_134447chr191190 ------
NM_138270chrX23274 2850 13200 ----
NM_138281chr17195 1413 1501 --
NM_138333chr912649 1362 ----
NM_138338chr2253328 2643 2384 711 29 12986 2646 140 --
NM_138357chr1021473 501 ----1352
NM_138375chr1831028 927 100 1471 21216 262 --
NM_138426chr711014 2731 114 ----
NM_138437chrX128 ------
NM_138444chr1344897 4877 3344 767 ------
NM_138457chr613296 2219 135 52788 2412 2089 979 319 1292
NM_138473chr1284937 4859 4036 4007 1240 1072 689 182 --44732 4083 1272 601 --
NM_138492chr521322 503 1404 ----
NM_138494chr75361 229 149 135 67 22734 2015 --22594 1081
NM_138558chr11791 --1372 --
NM_138559chr231032 974 288 ------
NM_138576chr1454354 4059 1264 1012 809 23221 878 14052 --
NM_138621chr283978 3956 3186 1045 648 631 451 101 23260 1619 11195 11247
NM_138694chr622308 258 1319 ----
NM_138713chr1688132 7203 6176 6099 5338 5275 2634 2228 37302 6780 3319 16208 15687
NM_138714chr1688132 7203 6176 6099 5338 5275 2634 2228 37302 6780 3319 16208 15687
NM_138731chr1412932 23819 3007 ----
NM_138775chr11----1157 --
NM_138795chr131534 1052 540 11305 --21470 1135
NM_138927chr214902 402 35 21 1680 ----
NM_138959chr156484 2065 1692 1501 412 46603 6147 5912 132 15465 --
NM_138970chr1431863 643 564 ------
NM_138971chr1113054 --1666 11279
NM_138971chr1113054 --1666 11279
NM_138972chr1113054 --1666 11279
NM_138972chr1113054 --1666 11279
NM_138973chr1113054 --1666 11279
NM_138973chr1113054 --1666 11279
NM_138981chr41136 ------
NM_139045chr91125 ------
NM_139057chr1552629 2526 845 638 69 --12459 11811
NM_139136chr1211075 ------
NM_139283chr12--1761 1184 --
NM_139321chr2053901 2869 2607 391 50 ------
NM_144498chr2061865 1690 654 522 416 284 ------
NM_144571chr455135 4843 2119 1933 1790 1266 16653 15782
NM_144578chr1444435 4348 4218 565 14527 ----
NM_144599chr1565120 5092 3907 2133 177 159 11308 14089 14638
NM_144628chr2052679 2173 1879 829 414 1519 21981 530 --
NM_144642chr331373 1231 989 ------
NM_144649chr8----11019 1232
NM_144660chr101299 2414 311 ----
NM_144664chr1111754 22392 241 ----
NM_144767chr1584616 4390 3798 1390 774 667 484 46 21714 547 ----
NM_144949chr221831 51 ----12515
NM_144973chr1245204 1963 1438 640 ------
NM_144979chr4----1140 --
NM_145008chr111151 176 1824 --
NM_145074chr2198 ----1125
NM_145115chr741872 1583 1457 823 12065 ----
NM_145173chr1951657 685 660 622 320 1902 --22230 908
NM_145203chr132896 610 --193 --
NM_145206chr1082943 2764 2334 2087 996 939 473 275 13265 ----
NM_145207chr444817 3643 483 458 33327 2119 1087 --14602
NM_145259chr235135 2176 725 25412 4359 ----
NM_145274chr171725 ------
NM_145279chr141700 546 530 29 ----1682
NM_145307chr1044218 1538 522 280 ------
NM_145686chr241186 710 254 170 11093 ----
NM_145687chr241186 710 254 170 11093 ----
NM_145725chr141187 ------
NM_145726chr141187 ------
NM_145800chrX3943 684 307 1995 ----
NM_145802chrX3892 633 256 1944 ----
NM_145808chr72154 88 ----1296
NM_145861chr121743 1321 --12031 --
NM_145891chr162694 362 --11121 --
NM_145892chr162694 362 --11121 --
NM_145893chr161484 --11243 --
NM_147150chr951225 1164 459 332 182 --1433 --
NM_147181chr4----21348 1051 --
NM_147182chr4----21348 1051 --
NM_147183chr4----21348 1051 --
NM_147189chr821807 1704 --11585 --
NM_147223chr231999 695 91 1651 11697 --
NM_147233chr221816 512 1468 11514 --
NM_148174chr83417 221 155 11569 ----
NM_148571chr1782093 1956 1804 1666 1658 1418 456 188 ------
NM_148921chr1772195 2085 1909 1741 724 539 277 --22290 427 11779
NM_148955chr1556289 4576 4527 4134 1396 35226 2369 1033 12533 15478
NM_152237chr2281594 1566 1503 1294 1079 673 473 83 --1371 --
NM_152261chr1212138 32316 1840 1678 ----
NM_152263chr145287 1521 1043 375 ------
NM_152265chr1147 11335 ----
NM_152267chr2252366 1653 611 166 144 --21738 750 --
NM_152277chr52699 138 12114 ----
NM_152282chr321160 992 1345 ----
NM_152287chr1672196 1776 965 916 559 504 170 1461 ----
NM_152320chr123328 50 38 1680 1163 --
NM_152330chr141764 ------
NM_152375chr192365 2214 1742 611 483 425 308 58 44 --32500 874 446 11815
NM_152384chr281623 1574 1525 1431 1399 1272 196 176 --21350 623 --
NM_152406chr531397 132 37 11303 ----
NM_152407chr533235 2116 178 --22610 823 --
NM_152409chr521385 980 12641 ----
NM_152450chr1552138 2115 2013 1870 204 --11789 --
NM_152453chr15--1171 ----
NM_152470chr1843568 2924 2631 40 11167 21282 315 --
NM_152542chr43663 98 92 11664 11579 --
NM_152594chr152382 140 1922 ----
NM_152605chr1951138 526 263 193 95 --11309 --
NM_152608chr121933 1709 177 ----
NM_152622chr553308 3033 2253 859 111 3647 374 201 1362 140
NM_152624chr547227 1983 1193 1045 --14765 --
NM_152629chr964118 3111 2934 995 548 106 1599 33900 1368 1164 --
NM_152636chr1132393 871 222 ------
NM_152641chr122598 243 ------
NM_152653chr3----1580 --
NM_152678chr33859 690 286 12629 ----
NM_152688chr61188 1373 ----
NM_152699chr323084 493 43614 3532 3359 1487 13364 11139
NM_152716chr1131386 1131 577 --11441 --
NM_152737chr632042 844 587 ------
NM_152744chr752201 1156 1053 438 152 ----11441
NM_152745chr71141 --1758 --
NM_152749chr7------1895
NM_152758chr822748 2416 1244 3905 657 160 --
NM_152780chrX31239 1010 76 ------
NM_152787chrX93578 2672 2663 2532 1553 1351 1101 50 21 ------
NM_152826chr1556289 4576 4527 4134 1396 35226 2369 1033 12533 15478
NM_152835chr122582 1831 ----22822 2790
NM_152896chr9----1738 --
NM_152903chr1332559 1901 608 ------
NM_152904chr171196 ------
NM_152924chr1545465 2212 1489 1033 16725 11868 1117
NM_152989chr1221702 65 11224 1139 --
NM_152991chr111455 ------
NM_152994chr21177 ------
NM_152999chr743859 1135 872 847 1341 11832 --
NM_153050chr2284796 4535 4362 3364 3071 1063 1013 454 34263 1164 926 ----
NM_153051chr2284796 4535 4362 3364 3071 1063 1013 454 34263 1164 926 ----
NM_153184chr32152 33 ------
NM_153186chr9------1107
NM_153207chr1223330 1215 11526 ----
NM_153215chr3--1591 1249 --
NM_153247chr73919 439 356 3302 224 120 11093 1404
NM_153260chr1521001 504 1288 --11241
NM_153261chr1621158 1118 ----1406
NM_153271chr15--181 --11006
NM_153321chr1721129 904 --1249 --
NM_153322chr1721129 904 --1249 --
NM_153332chr832638 912 379 ----1194
NM_153333chrX1513 1134 ----
NM_153335chr1761361 1331 1061 454 97 74 1249 ----
NM_153346chrX2773 82 ------
NM_153367chr1053400 2612 978 720 400 13452 33583 3419 39 --
NM_153487chr644489 3016 858 115 32922 1866 275 24550 83 --
NM_153499chr1242367 2104 1983 1933 12167 12575 --
NM_153500chr1242367 2104 1983 1933 12167 12575 --
NM_153616chr153869 620 148 1280 ----
NM_153617chr153869 620 148 1280 ----
NM_153618chr153869 620 148 1280 ----
NM_153619chr1541386 731 362 248 12631 21066 627 11116
NM_153633chr121807 ------
NM_153646chr1432143 1718 1694 11832 12121 11868
NM_153647chr1432143 1718 1694 11832 12121 11868
NM_153648chr1432143 1718 1694 11832 12121 11868
NM_153686chr462470 2205 1966 1563 675 178 ------
NM_153689chr242105 1783 876 718 ------
NM_153748chr1211075 ------
NM_153759chr2--1107 1899 --
NM_153810chr1031313 776 574 23558 314 1860 14868
NM_153812chr172121 1844 1505 825 533 347 194 ------
NM_153831chr81739 11062 --298 63
NM_170606chr71170 21746 1470 1429 --
NM_170607chr1731550 1459 588 --21348 1193 --
NM_170665chr1242921 1743 1459 637 23267 316 11503 --
NM_170696chr1521477 166 --11278 --
NM_170697chr1521477 166 --11278 --
NM_170706chr193683 3532 3049 1715 1550 1149 1014 636 612 ----13245
NM_170709chr831833 927 680 12431 ----
NM_170711chr192905 816 158 --1373
NM_170731chr1112819 12050 --12155
NM_170732chr1112819 12050 --12155
NM_170733chr1112819 12050 --12155
NM_170734chr1112819 12050 --12155
NM_170735chr1112819 12050 --12155
NM_170775chr5192 ------
NM_172037chr81239 ----171
NM_172058chr83543 403 180 11285 21593 77 --
NM_172059chr83543 403 180 11285 21593 77 --
NM_172060chr83543 403 180 11285 21593 77 --
NM_172070chr221682 313 ----11952
NM_172071chr135319 5283 125 21573 830 22952 608 --
NM_172103chr612674 12490 --1807
NM_172105chr612674 12490 --1807
NM_172226chr1242367 2104 1983 1933 12167 12575 --
NM_173054chr7------1909
NM_173083chr11909 2175 162 ----
NM_173156chr122226 193 1769 1140 --
NM_173198chr942516 1032 897 412 11004 12855 12750
NM_173200chr942516 1032 897 412 11004 12855 12750
NM_173214chr1688132 7203 6176 6099 5338 5275 2634 2228 37302 6780 3319 16208 15687
NM_173359chr311201 11409 1461 --
NM_173465chr521006 946 1316 --1156
NM_173470chrX12676 --1581 --
NM_173476chr1652229 1782 1709 741 125 42274 2221 1976 1537 2689 429 --
NM_173500chr1511275 1953 ----
NM_173503chr17--1131 ----
NM_173508chr15981 415 305 299 162 ------
NM_173510chr2232487 1824 810 32802 1802 1116 ----
NM_173519chr8150 --2641 149 1522
NM_173525chr11----175 --
NM_173536chr433456 1384 644 35185 3332 3268 1690 --
NM_173602chr1242617 900 812 545 13062 ----
NM_173623chr172674 272 --3621 602 547 --
NM_173642chr188523 8026 7482 7005 3419 2365 1284 797 --27764 2317 --
NM_173648chr22911 118 ------
NM_173674chr6--156 ----
NM_173681chr762036 1966 1702 1695 825 38 --1174 1184
NM_173683chr81542 ----11591
NM_173694chrX2895 549 ----12328
NM_173798chrX1514 1157 ----
NM_173808chr11980 1102 11389 --
NM_173829chr574515 4360 2485 2364 1893 1440 1029 15791 ----
NM_173832chr883626 3591 2473 889 536 300 238 169 ------
NM_173849chr141207 ------
NM_174921chr411004 --1757 --
NM_174934chr1143250 3189 2603 537 23535 2811 11339 --
NM_175061chr711378 11814 --139
NM_175607chr311678 11607 ----
NM_175610chr152469 313 ----11321
NM_175611chr21----1185 --
NM_175612chr311678 11607 ----
NM_175629chr2--1107 1899 --
NM_175634chr8----1882 --
NM_175635chr8----1882 --
NM_175636chr8----1882 --
NM_175736chr12157595 5842 5303 2924 1918 1778 1432 1082 1031 883 492 458 314 165 56 27078 2607 ----
NM_175768chr62682 94 1610 ----
NM_175854chr132612 246 12116 12707 --
NM_175859chrX21568 1285 1600 --11103
NM_175861chr1234345 1410 1295 15090 --181
NM_175863chr6--11129 ----
NM_175907chr1832500 2467 447 12826 12694 --
NM_176787chr1861513 1385 1327 595 441 417 ------
NM_176814chr7----1249 --
NM_176823chr133855 2940 60 33782 1293 1215 ----
NM_177398chr121913 1851 11268 ----
NM_177399chr121913 1851 11268 ----
NM_177424chr121706 1539 1371 1442 --
NM_177438chr1432669 1259 785 11527 --13837
NM_177538chr2178337 7834 6594 5829 5486 5431 3319 2852 2773 2603 1586 1286 1179 876 740 603 467 28855 89 ----
NM_177966chr311281 1232 ----
NM_177968chr22677 269 ------
NM_177972chr1173767 3165 3003 1353 647 144 103 22860 1121 1896 --
NM_177977chr1721536 413 --31298 724 714 21578 489
NM_177985chr231956 1852 1510 21974 386 ----
NM_177999chr993517 3173 2882 2852 2840 2623 2421 1165 694 --22810 2445 --
NM_178010chr1221702 65 11224 1139 --
NM_178120chr211022 ------
NM_178126chr171249 11627 1178 --
NM_178151chrX87780 7605 6885 6019 5983 5747 1860 600 --12290 --
NM_178152chrX87780 7605 6885 6019 5983 5747 1860 600 --12290 --
NM_178153chrX87780 7605 6885 6019 5983 5747 1860 600 --12290 --
NM_178154chr143782 612 573 ------
NM_178155chr143782 612 573 ------
NM_178156chr143782 612 573 ------
NM_178157chr143782 612 573 ------
NM_178426chr122346 1469 ----12254
NM_178427chr112246 ----12154
NM_178507chr112772 58 --2654 52 --
NM_178565chr811317 ----1149
NM_178578chr2021821 127 --2256 235 22233 71
NM_178585chr41893 ------
NM_178586chr1432299 366 35 ----1462
NM_178815chr1032250 857 413 31014 820 358 --12071
NM_181349chr773053 2664 2572 825 809 405 41 --12526 --
NM_181351chr1142225 2169 404 57 12674 ----
NM_181358chr153644 3562 3297 2766 2660 31690 1118 111 ----
NM_181359chr182288 2233 2204 1818 377 365 303 102 ----2235 189
NM_181457chr21451 ------
NM_181459chr22456 350 ------
NM_181460chr22503 397 ------
NM_181481chr18147090 6123 6108 5869 5788 5765 5557 5399 5354 5260 1508 1439 1352 431 14426 34418 2216 2092 --
NM_181482chr18147090 6123 6108 5869 5788 5765 5557 5399 5354 5260 1508 1439 1352 431 14426 34418 2216 2092 --
NM_181483chr18147090 6123 6108 5869 5788 5765 5557 5399 5354 5260 1508 1439 1352 431 14426 34418 2216 2092 --
NM_181492chr222506 136 1102 1492 --
NM_181504chr532752 2654 364 11610 ----
NM_181523chr532752 2654 364 11610 ----
NM_181524chr532752 2654 364 11610 ----
NM_181659chr2052074 1289 1110 110 55 ------
NM_181659chr2052074 1289 1110 110 55 ------
NM_181670chr1211415 --1173 --
NM_181724chr123454 396 21 ----11661
NM_181776chr541706 1571 664 620 128 ----
NM_181782chr631644 824 50 1366 ----
NM_181832chr2293696 3588 3284 2428 1174 747 641 517 373 1570 11021 --
NM_181836chr51591 11759 1543 --
NM_181837chr6159 ------
NM_181839chr8--11392 ----
NM_181844chr1751994 1514 1402 474 367 ------
NM_181886chr4------1531
NM_181887chr4------1531
NM_181888chr4------1531
NM_181889chr4------1531
NM_181890chr4------1531
NM_181891chr4------1531
NM_181892chr4------1578
NM_181893chr4------1531
NM_181897chr342007 1664 912 126 ------
NM_182314chrX21685 500 1483 11633 11606
NM_182485chr433568 1199 774 21185 141 ----
NM_182487chr9124229 4190 3392 3233 1692 1662 1171 1083 776 613 136 102 --23138 2966 --
NM_182507chr1282322 2007 1913 916 901 715 632 334 --1185 --
NM_182509chr1451347 1128 641 182 122 11441 11311 1318
NM_182528chr2----1447 --
NM_182643chr821514 557 1779 12199 --
NM_182646chr433568 1199 774 21185 141 ----
NM_182691chr711085 ------
NM_182692chr711085 ------
NM_182729chr1221315 716 11329 21617 258 --
NM_182742chr1221315 716 11329 21617 258 --
NM_182743chr1221315 716 11329 21617 258 --
NM_182758chr1532463 1410 1280 1799 ----
NM_182762chr775341 5189 4697 2041 991 544 201 11390 1859 24807 559
NM_182763chr1147 ------
NM_182765chr1021712 1457 --1951 --
NM_182797chr2041358 551 522 425 ------
NM_182800chr7185 ------
NM_182830chr1432107 1474 35 ------
NM_182831chr1681655 1648 1117 1103 462 430 241 121 1143 3202 61 52 --
NM_182896chr321246 727 367 54 35 ----
NM_182898chr795602 4834 2630 1168 934 919 463 250 207 15964 24889 1115 --
NM_182899chr795602 4834 2630 1168 934 919 463 250 207 15964 24889 1115 --
NM_182920chr31480 1929 ----
NM_182931chr71470 --1117 --
NM_182936chr1421043 110 --170 --
NM_182948chr11702 1788 ----
NM_182970chr2043169 1499 491 429 1407 13353 --
NM_182972chr121795 1755 --1522 --
NM_183002chr1421043 110 --170 --
NM_183004chr1453138 2973 2827 190 59 32879 2862 861 ----
NM_183078chr643676 2765 109 77 ----1459
NM_183228chr173673 561 222 ------
NM_183229chr173673 561 222 ------
NM_183230chr173673 561 222 ------
NM_183231chr173673 561 222 ------
NM_183232chr173673 561 222 ------
NM_183234chr1511495 --1502 --
NM_183235chr1511495 --1502 --
NM_183236chr1511495 --1502 --
NM_183353chrX3956 382 226 11146 ----
NM_183393chr31270 1290 ----
NM_183394chr31270 1290 ----
NM_183419chr821373 1347 192 ----
NM_183425chr2061526 1468 1368 266 182 107 1148 2133 25 1412
NM_194071chr764790 4425 4348 3639 3510 141 15285 25045 71 25150 3732
NM_194247chr243405 3133 353 318 24541 1688 ----
NM_194283chr553541 2887 2808 1483 179 1624 ----
NM_194286chr12126066 5772 4752 4522 2380 2000 1699 987 591 416 172 46 1194 54608 1403 1319 951 872 --
NM_194298chr104485 424 286 257 --1582 --
NM_194301chr14--129 ----
NM_194313chr921279 98 --2526 431 11227
NM_194314chr121612 311 24276 3479 ----
NM_194318chr1332232 2019 314 --11609 --
NM_194328chr972623 2535 2057 1094 1060 890 584 1511 ----
NM_194329chr972623 2535 2057 1094 1060 890 584 1511 ----
NM_194330chr972623 2535 2057 1094 1060 890 584 1511 ----
NM_194332chr972623 2535 2057 1094 1060 890 584 1511 ----
NM_194434chr1832163 986 211 11628 --1224
NM_194442chr121705 1574 ------
NM_194449chr18--1890 ----
NM_197941chr563038 2386 2183 1977 1944 697 ------
NM_197955chr15----183 --
NM_197970chr2185 11422 ----
NM_197972chr1----1196 --
NM_198089chr19--1272 ----
NM_198204chr1731550 1459 588 --21348 1193 --
NM_198205chr1731550 1459 588 --21348 1193 --
NM_198213chr121750 --1642 --
NM_198217chr13--2997 209 --1913
NM_198218chr13--2997 209 --1913
NM_198219chr13--2997 209 --1913
NM_198240chr1241322 1146 900 256 ----166
NM_198261chr12----1562 --
NM_198262chr12----1562 --
NM_198268chr153644 3562 3297 2766 2660 31690 1118 111 ----
NM_198269chr153644 3562 3297 2766 2660 31690 1118 111 ----
NM_198270chrX13225 12229 ----
NM_198324chr122187 30 2914 397 ----
NM_198336chr711782 --21266 527 --
NM_198392chr62744 401 ----11468
NM_198399chr321298 1156 ----11480
NM_198400chr1532728 2511 1842 22235 1824 22472 1871 --
NM_198468chr644479 3638 1551 935 ------
NM_198490chr332917 905 81 4764 292 216 98 --1636
NM_198513chr81281 11624 ----
NM_198560chr373542 2746 2711 2440 1481 1463 647 --1530 --
NM_198562chr352202 1472 446 170 122 ------
NM_198597chr102656 336 ------
NM_198679chr941720 653 163 126 3996 893 220 --1355
NM_198700chr11--1406 ----
NM_198793chr373479 2730 1572 1040 1026 406 334 --1811 --
NM_198834chr172763 660 --1195 --
NM_198836chr172763 660 --1195 --
NM_198837chr172763 660 --1195 --
NM_198838chr172763 660 --1195 --
NM_198839chr172763 660 --1195 --
NM_198859chr394514 4338 4091 3613 3603 3450 3303 1310 262 14735 ----
NM_198889chr4----1878 --
NM_198896chr1112117 11874 ----
NM_198900chr12157595 5842 5303 2924 1918 1778 1432 1082 1031 883 492 458 314 165 56 27078 2607 ----
NM_198902chr151801 1735 ----
NM_198968chr1333667 3203 601 135 ----
NM_198989chr133500 57 33 1585 ----
NM_199000chr721508 1500 1179 1231 --
NM_199003chr8--1281 296 78 --
NM_199044chr172908 2640 2264 459 410 77 56 ----1189
NM_199051chr1----1217 --
NM_199131chr1033481 2859 2825 --22287 651 --
NM_199160chr92132 77 --1669 --
NM_199168chr10--1166 --11475
NM_199189chr5--1688 ----
NM_199320chr452423 1831 939 815 770 ------
NM_199320chr452423 1831 939 815 770 ------
NM_199324chr421181 829 13015 ----
NM_199424chr1631730 1628 1308 31795 1176 440 31230 1114 553 --
NM_199427chr20143 ------
NM_199461chr1063532 3256 2322 730 702 332 21438 724 11225 --
NM_199462chr155020 4627 4200 3105 1304 ----11891
NM_199464chr132204 94 --1513 --
NM_199482chr22765 305 --21543 186 --
NM_201266chr233070 2212 575 --11031 --
NM_201279chr233070 2212 575 --11031 --
NM_201403chr141700 546 530 29 ----1682
NM_201413chr212964 182 ------
NM_201414chr212964 182 ------
NM_201437chr82486 56 ------
NM_201545chr11567 21101 384 ----
NM_201548chr241033 221 171 100 ------
NM_201568chr122226 193 1769 1140 --
NM_201569chr122226 193 1769 1140 --
NM_201632chr541479 745 497 80 ------
NM_203301chr1421677 1567 --1548 --
NM_203327chr2054015 3205 1050 745 461 33559 1025 714 23765 821 --
NM_203342chr163415 2809 764 481 411 122 23277 56 21173 535 --
NM_203343chr163415 2809 764 481 411 122 23277 56 21173 535 --
NM_203349chr15--21861 867 11810 --
NM_203382chr531378 1293 341 --1196 --
NM_203446chr2132782 2622 610 12693 21162 741 --
NM_203454chr11439 --11046 --
NM_203463chr231536 1022 99 13975 1398 --
NM_203504chr432002 1602 607 21772 1051 ----
NM_203505chr432002 1602 607 21772 1051 ----
NM_205846chr521322 503 1404 ----
NM_206854chr641296 759 94 49 --1654 --
NM_206855chr654187 2261 1724 1059 1014 --21619 307 --
NM_206876chr242683 2663 412 29 12631 ----
NM_206909chr847974 7101 6245 1579 25568 1675 27611 3056 26820 2261
NM_206943chr2--1210 ----
NM_207012chr1033081 988 28 1425 22600 911 --
NM_207015chr321859 693 12324 ----
NM_207113chr73171 134 42 2253 155 ----
NM_207306chr144287 1512 1460 415 2353 271 231326 1290 1254 1218 1182 1146 1110 1074 1002 966 930 894 862 826 754 718 682 610 574 538 502 466 312 --
NM_207406chr4106278 6125 5755 5747 4872 4704 2345 2034 1780 247 --12599 --
NM_207517chr1511320 1342 11655 --
NM_212460chr761893 1708 1624 1557 1344 471 ------
NM_212464chr1551692 1382 1313 811 213 11979 ----
NM_212467chr1542269 1959 1890 863 22556 121 ----
NM_212558chr943961 3904 782 313 ------
NM_213589chr295579 5528 5211 4957 4951 3766 1254 484 51 --1950 --
NM_213606chr103611 183 53 1991 ----
NM_213609chr32739 122 ------
NM_213648chr541479 745 497 80 ------