TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-139-3p
miRNA Sequence: GGAGACGCGGCCCUGUUGGAGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr511967 ----1806
NM_000212chr1721964 899 12146 ----
NM_000217chr1224933 1852 ----15198
NM_000393chr21596 11858 --11400
NM_000495chrX------174
NM_000503chr821234 256 ----1447
NM_000533chrX1530 --168 --
NM_000618chr1226122 464 --1128 --
NM_000719chr1265115 4194 1342 405 349 189 162 25898 111 --
NM_000814chr152693 404 23981 910 ----
NM_000817chr211208 --1455 --
NM_000829chr1122270 2040 1791 1424 --
NM_000855chr11----185 --
NM_000901chr4----12306 --
NM_000944chr411600 ----11727
NM_000951chr191412 --1158 --
NM_000958chr5------1414
NM_001001481chr813238 11217 1565 --
NM_001001549chr722070 749 1999 1929 21072 460
NM_001002296chr811345 11232 1201 --
NM_001002860chr1424111 1782 11110 14351 --
NM_001002876chr221366 ----167
NM_001002909chr172726 109 ----1549
NM_001003694chr3----1497 --
NM_001004065chr933613 728 243 --2513 26 --
NM_001004317chr613920 ----14384
NM_001005415chr19------1426
NM_001005849chr17----1578 --
NM_001006684chrX------1454
NM_001007024chr1744101 1445 1112 253 --33171 997 881 --
NM_001007279chr22----2269 193 --
NM_001008738chr5----12159 1354
NM_001011713chr14------1127
NM_001014794chr11----1207 --
NM_001017405chr41654 --198 --
NM_001017415chr1------1539
NM_001018050chr22----2735 101 --
NM_001018108chr1511539 --174 --
NM_001025076chr1076051 5981 4673 3923 2361 1984 328 ----199
NM_001029875chr542650 1159 1005 841 22547 956 ----
NM_001032280chr621593 682 ------
NM_001033045chr233167 458 116 22929 1493 --12961
NM_001037334chr18--11891 1624 --
NM_001039479chr141129 --12295 --
NM_001039538chr21685 --1863 --
NM_001039711chr1----1231 --
NM_001042599chr246714 2801 1972 512 --16731 --
NM_001048183chr143146 2352 1277 1058 23531 1447 ----
NM_001106chr367925 7606 7184 2174 2076 562 1356 ----
NM_001206chr93906 471 241 ------
NM_001364chr1134672 1329 344 13448 14692 --
NM_001386chr892141 1783 1569 952 854 815 606 336 172 ----12190
NM_001438chr112339 --13302 --
NM_001649chrX32072 490 341 --12496 --
NM_001729chr4------179
NM_001730chr1321121 309 1265 ----
NM_001949chr61710 --1288 --
NM_001991chr17--21360 171 194 --
NM_002006chr445837 5444 2019 1462 22191 1673 1829 --
NM_002015chr1313298 11029 11080 --
NM_002033chr1111209 ----24073 2715
NM_002084chr52266 254 --2662 69 --
NM_002157chr2----1135 --
NM_002202chr51755 --1732 --
NM_002253chr42201 195 ------
NM_002293chr1--1356 1213 --
NM_002359chr1763589 3394 1611 1444 1245 1141 ------
NM_002375chr352008 164 52 30 23 ------
NM_002381chr2----1228 --
NM_002398chr21969 --11446 --
NM_002442chr122579 183 --11720 11093
NM_002588chr531793 1294 696 ----11727
NM_002655chr824296 3846 14495 --13897
NM_002698chr1922597 2319 --12375 --
NM_002716chr1163683 3519 2486 2380 251 191 22745 1406 1403 --
NM_002719chr1452322 2261 1841 1563 806 --1611 11805
NM_002731chr112784 12884 --1728
NM_002745chr2251708 601 569 96 85 --24446 1013 --
NM_002753chr41588 ------
NM_002763chr12152 71 --1417 --
NM_002833chr151354 --1119 --
NM_002843chr1152960 1139 1033 1027 420 ------
NM_002851chr7----1508 --
NM_002852chr3----1249 --
NM_002897chr21581 --1536 --
NM_002924chr1--1167 1230 --
NM_002945chr171643 --1712 --
NM_003010chr171129 --11682 --
NM_003011chr9----1420 --
NM_003020chr151316 ----1464
NM_003042chr3------11699
NM_003107chr642187 1946 1616 180 ------
NM_003108chr257266 7026 5401 2256 2106 16183 --1293
NM_003200chr19----21825 663 --
NM_003216chr2242255 685 542 449 22604 143 32039 634 433 --
NM_003221chr632820 491 209 --13760 --
NM_003257chr1511037 --11114 --
NM_003292chr121707 1690 ------
NM_003305chr4----1355 --
NM_003459chr22632 493 --1578 1735
NM_003468chr273697 1312 726 446 416 144 51 --1211 --
NM_003472chr611071 ----11088
NM_003590chr233593 1565 253 21414 1167 11510 --
NM_003625chr12----143 --
NM_003632chr17----1832 --
NM_003644chr1796572 5563 5363 4948 4121 1242 413 374 216 23985 884 36322 5727 2062 14870
NM_003660chr19----1551 --
NM_003685chr191789 ----1195
NM_003713chr111282 --11506 --
NM_003728chr41466 ----1534
NM_003895chr21------11672
NM_003913chr622638 182 13564 ----
NM_004161chr22395 117 ------
NM_004183chr111627 ----1755
NM_004272chr52715 46 --11673 --
NM_004329chr10----2528 295 --
NM_004331chr8--1767 1623 --
NM_004430chr841839 1040 389 256 ------
NM_004498chr15------1388
NM_004525chr22384 146 1167 ----
NM_004571chr2153180 2972 2310 2234 1256 --1135 --
NM_004588chr1143240 2838 632 37 --23670 3645 --
NM_004643chr141565 1261 ----
NM_004841chr1----1837 --
NM_004937chr17--1285 1343 --
NM_004978chr111625 1488 --1579
NM_004981chr22----1391 --
NM_005057chr121213 1178 11697 ----
NM_005077chr9----1390 --
NM_005116chr2044026 1627 1620 882 --2843 177 --
NM_005156chr9--11398 13588 21718 676
NM_005229chrX51210 1091 802 451 241 ------
NM_005252chr14----1297 --
NM_005259chr2----1989 --
NM_005386chr201886 --1812 --
NM_005461chr20----11471 --
NM_005550chr161113 --1155 --
NM_005594chr12------131
NM_005599chr1----11465 --
NM_005604chr612163 --1259 --
NM_005634chrX1445 --1537 --
NM_005639chr1211926 --1334 --
NM_005647chrX33465 634 130 ------
NM_005652chr1631196 1140 171 ------
NM_005686chr141422 1411 335 300 --1634 --
NM_005688chr3------11105
NM_005730chr1243602 1080 652 341 --22741 1290 --
NM_005782chr17----2254 43 --
NM_005828chr1753633 1391 976 384 331 23233 884 24109 352 --
NM_005909chr5----13435 --
NM_005967chr12----1684 --
NM_005977chr131393 --1692 --
NM_005985chr20----1661 --
NM_006037chr284694 4375 4044 3225 3048 1824 1465 39 ----13855
NM_006136chr7135 ----1294
NM_006390chr121653 1313 ----
NM_006454chr432483 1243 635 ------
NM_006549chr12----166 --
NM_006557chr91110 --11492 --
NM_006743chrX------1792
NM_006762chr1----1132 --
NM_006775chr612929 22083 136 --11193
NM_006777chrX------12253
NM_006814chr2022547 2476 1902 1222 --
NM_006887chr2------1488
NM_006896chr71970 --149 --
NM_006981chr922441 426 ----11201
NM_007030chr565179 5156 4689 1057 463 314 --1265 13945
NM_007106chr1322626 994 --1751 12538
NM_007174chr1251895 1806 1725 1620 155 ----12013
NM_007249chr1358096 6859 3390 1114 197 18270 --19246
NM_007260chr11737 1669 1725 --
NM_007357chr11358 --2586 150 --
NM_007359chr1741636 1575 1089 341 --11373 --
NM_007372chr171723 ----170
NM_007375chr11490 --2905 670 --
NM_012069chrX1586 --1195 --
NM_012118chr41456 --1387 --
NM_012199chr134480 3824 1201 ----1304
NM_012215chr101566 11680 1336 --
NM_012247chr102358 98 --1410 --
NM_012301chr7171 163 ----
NM_012325chr2031214 480 468 1153 --11324
NM_012328chr7------11006
NM_013351chr171701 --1258 --
NM_013449chr12----11205 --
NM_014048chr1623764 1910 ----15308
NM_014212chr122230 83 --1834 --
NM_014231chr1222082 608 --11937 --
NM_014494chr1621664 262 1420 ----
NM_014515chr12--155 --1992
NM_014587chr161471 11459 21470 537 --
NM_014588chr201590 --1749 --
NM_014636chr934100 2733 709 24199 2693 ----
NM_014736chr1541016 842 245 31 ------
NM_014746chr224342 3944 ----13674
NM_014751chr812036 --12145 --
NM_014786chr111961 ----1894
NM_014835chr2041706 1543 226 195 --1825 --
NM_014838chr2232793 2522 2131 12753 1146 --
NM_014839chr1----1651 --
NM_014848chr152597 339 --12449 --
NM_014961chr411712 --1479 --
NM_015039chr153256 3120 1219 280 93 13521 11630 --
NM_015059chr151822 1266 --1244
NM_015080chr111953 ------
NM_015092chr1643114 3036 1622 755 ------
NM_015093chr6----1536 --
NM_015132chr72198 90 --11765 1112
NM_015144chr1653339 2634 2494 2483 283 ------
NM_015192chr201309 --12569 --
NM_015245chr632547 1749 525 --12172 --
NM_015313chr111802 ----159
NM_015317chr21665 12222 12704 --
NM_015326chr142834 973 874 139 1812 ----
NM_015338chr2021945 1799 1604 ----
NM_015349chr61108 12893 ----
NM_015353chr1722333 2051 --21098 1005 1942
NM_015444chr3----1609 --
NM_015542chr101888 --1415 --
NM_015550chr732290 1232 1127 --1161 --
NM_015569chr124219 1441 --13107 11825
NM_015576chr322889 1064 --21144 764 --
NM_015695chr611977 1612 21967 650 --
NM_016250chr142783 298 ------
NM_016376chr1743093 3050 716 101 2704 219 --12750
NM_016470chr202475 448 ------
NM_016545chr11926 ------
NM_017553chr15------1176
NM_017634chr8----11398 --
NM_017902chr1085212 4699 4636 4488 4348 3987 1746 869 14757 35192 4173 1541 11301
NM_018045chr111003 --12449 --
NM_018121chr1022235 924 --22836 1239 --
NM_018181chr181502 ------
NM_018202chr1----162 --
NM_018240chr1----1232 --
NM_018293chr3------12949
NM_018362chr1132705 1567 34 ------
NM_018364chr133712 409 352 --12569 --
NM_018566chr11191 --1502 --
NM_018667chr161379 ----12309
NM_018959chr192762 608 --1717 --
NM_019106chr2253317 3206 3169 722 284 --22680 799 --
NM_019593chr2053151 2765 2226 1274 890 12307 1915 --
NM_020127chr1----11871 21693 137
NM_020130chr8----11045 --
NM_020205chr1----1979 --
NM_020309chr1921063 1048 --11057 --
NM_020310chr17----22573 2192 --
NM_020401chr12----1171 --
NM_020416chr422273 316 1531 --12639
NM_020452chr13567 472 305 --21914 74 --
NM_020699chr134961 4905 1942 ------
NM_020713chr2022813 272 ------
NM_020752chr1022813 2055 1923 --1539
NM_020772chr1728275 6789 26979 2349 ----
NM_020776chr18--22484 114 191 --
NM_020858chr15----12307 --
NM_020939chr641433 1416 1363 409 11127 ----
NM_020962chr1552426 2219 1710 1619 675 --1417 --
NM_021090chr2223138 1642 --14343 11539
NM_021643chr211316 --1559 --
NM_021938chr19------1269
NM_021961chr1146870 2763 2620 1313 11759 35884 5871 1362 16913
NM_022060chr14--11235 ----
NM_022114chr124422 3524 --13808 11675
NM_022123chr14----1109 --
NM_022374chr2------1464
NM_022465chr1232389 2177 907 --12866 --
NM_022737chr19----11029 --
NM_022749chr821409 1321 ------
NM_022898chr1434776 1031 150 --24104 3538 --
NM_023009chr1----1544 --
NM_024034chr20124 184 139 --
NM_024337chr5----1259 --
NM_024524chr32985 834 --12464 --
NM_024779chr121432 11445 11128 --
NM_024947chr369366 8853 6260 6183 3544 770 ------
NM_024989chr212795 --11925 15872
NM_024993chr2----172 --
NM_025057chr141841 --1148 --
NM_025061chr19----1267 --
NM_025182chr9----1759 --
NM_025209chr10----199 --
NM_025248chr1733159 2863 454 --12636 --
NM_030647chr765879 5024 4782 2438 1874 291 12496 15894 --
NM_030795chr8----1131 --
NM_031442chrX12021 11257 1594 --
NM_031483chr2033551 3022 947 --1173 --
NM_032144chr2----138 --
NM_032172chr7----1711 --
NM_032268chr1613165 --12197 --
NM_032354chr171143 ------
NM_032430chr19----1449 --
NM_032431chr111831 1685 ----
NM_032458chrX----12775 --
NM_032622chr4----11560 --
NM_032632chr1411712 11820 --11945
NM_032646chr1731217 1168 696 11562 171 --
NM_033259chr3----1795 --
NM_033512chr812034 --2672 436 --
NM_044472chr1----1108 --
NM_052840chr15------21203 560
NM_052876chr1931891 1010 465 ------
NM_052896chr132511 131 118 --12064 --
NM_053024chr31158 --1124 --
NM_053025chr3----11139 --
NM_080388chr1------1165
NM_080552chr201189 1456 1196 --
NM_080670chr5----1885 --
NM_080738chr121388 460 ----1704
NM_080836chr2053587 3200 1912 1661 73 ------
NM_080862chr3----11315 --
NM_133264chr1732901 938 278 ------
NM_144571chr455932 4818 1604 1356 728 ----11538
NM_144579chr232243 2066 1191 --12905 --
NM_145284chrX11564 --1909 --
NM_145313chr1021555 1131 --1395 --
NM_152342chr16169 --1100 --
NM_152384chr211826 --1820 --
NM_152424chrX23855 2865 ----1707
NM_152594chr15------1154
NM_152624chr525971 5300 --163 --
NM_152641chr1212442 22891 1981 ----
NM_152744chr793438 2694 2381 994 932 570 523 410 325 12286 2923 822 --
NM_152780chrX1796 --11291 --
NM_152855chr22------138
NM_152896chr9------1733
NM_153029chr1643935 3108 1306 1075 2851 407 33998 2783 2736 --
NM_170711chr192938 784 --1893 --
NM_172375chr141260 1353 --1889
NM_173078chrX1318 ----1125
NM_175834chr12------1407
NM_175884chr73541 298 183 ------
NM_175898chr1511644 --167 --
NM_176792chr1011428 ----168
NM_178313chr21737 --12156 --
NM_178502chr12------1523
NM_181358chr143155 1564 1412 334 1169 22809 1591 --
NM_181784chr242243 2004 1772 52 1304 ----
NM_182503chr635305 1888 1203 --1126 --
NM_182526chr1423103 3019 --23085 679 --
NM_198147chr17----1443 --
NM_198271chr321996 1434 --11830 --
NM_198396chr171410 ----1385
NM_198511chrX----1172 --
NM_198562chr3--2805 639 1316 --
NM_198686chr14--1421 32603 565 502 --
NM_198965chr121121 --1344 --
NM_199290chr17------131
NM_205848chr142835 2785 1986 769 --2493 320 --
NM_207352chr4------22677 224