TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-139-5p
miRNA Sequence: UCUACAGUGCACGUGUCUCCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX52569 2406 736 711 467 --12987 23166 87
NM_000084chrX106842 6292 6278 2551 2429 1574 1429 1088 506 369 12448 ----
NM_000108chr711259 21841 52 1234 --
NM_000109chrX62662 2641 2554 2441 401 281 ----1212
NM_000112chr565341 1967 498 330 268 176 1385 24799 3453 14913
NM_000158chr31483 --1655 --
NM_000168chr732589 1043 270 --23182 565 --
NM_000176chr5133796 3748 3717 3615 3502 2891 2880 2819 1361 1245 1058 595 56 180 13277 1881
NM_000176chr5133796 3748 3717 3615 3502 2891 2880 2819 1361 1245 1058 595 56 180 13277 1881
NM_000176chr5133796 3748 3717 3615 3502 2891 2880 2819 1361 1245 1058 595 56 180 13277 1881
NM_000210chr252152 2053 1638 1446 79 12085 --1331
NM_000216chrX64037 3378 3037 1484 1149 1094 13891 23844 3122 --
NM_000217chr1285235 4594 3374 1938 1796 1205 1040 631 33255 1587 97 13834 11684
NM_000267chr1793344 3268 3255 3121 3098 2871 1201 378 301 22581 496 13401 --
NM_000314chr1062962 2887 2756 2684 2550 903 11024 12988 --
NM_000332chr6137009 6927 6220 6026 5857 5030 4358 2387 1254 1181 645 408 60 --166 --
NM_000337chr596512 6208 5909 5534 2011 1655 1226 744 632 25284 566 ----
NM_000462chr1541815 1168 500 126 1436 21787 1637 11477
NM_000489chrX63038 2927 2655 2319 648 89 ----12459
NM_000555chrX147749 6967 6912 6854 6840 6827 6806 5910 2065 1853 1788 887 824 143 21971 349 26426 53 --
NM_000601chr7----1426 --
NM_000610chr1162895 2704 2528 2195 1213 554 ------
NM_000618chr1276439 4900 1937 1380 1234 916 594 12594 --11135
NM_000633chr1895099 4569 3850 3695 1848 1783 1712 1330 541 --24736 1501 11233
NM_000719chr12116647 6506 5355 5320 5298 4982 4790 2054 1461 1293 831 25712 367 ----
NM_000806chr531498 1349 374 1339 11484 1662
NM_000811chr53631 501 312 1715 ----
NM_000813chr595368 5003 4772 4084 3672 1386 1283 843 136 14906 13885 --
NM_000824chr42658 127 --1139 --
NM_000826chr442410 2009 1946 307 --12039 --
NM_000828chrX62196 2162 2060 1833 1717 1409 ------
NM_000829chr1172267 2243 744 687 521 485 340 1396 12324 --
NM_000838chr632780 2538 2265 1935 11026 --
NM_000859chr571695 1649 1230 1216 669 434 249 11437 1410 --
NM_000875chr1565699 4670 2766 2139 440 422 ----24498 2493
NM_000935chr3----11162 --
NM_000950chrX31240 1052 895 23277 436 22842 1200 13492
NM_001001323chr1272665 2218 2180 876 832 322 291 2750 537 --1917
NM_001001331chr32652 338 1816 12586 --
NM_001001395chr1252452 454 410 304 290 --12486 --
NM_001001549chr732801 2676 425 --31872 650 440 --
NM_001001664chr243871 3864 1242 852 --31467 1006 647 --
NM_001001890chr2163507 1596 1272 740 326 155 --13627 --
NM_001001933chr13566 515 390 ------
NM_001001995chrX11809 11842 11178 --
NM_001002258chr251871 1845 730 314 66 --182 --
NM_001002296chr851137 1076 1059 908 484 --11208 --
NM_001002843chr1551272 979 911 810 84 ------
NM_001003652chr18108342 6263 6137 3366 2562 2496 2422 2240 1900 1406 23436 533 38182 6793 2786 16960
NM_001003681chr2281930 1750 1477 615 586 264 167 95 11774 ----
NM_001003760chr623058 113 11059 11312 --
NM_001003800chr983490 3378 3008 2578 2385 1190 1097 517 ------
NM_001003800chr983490 3378 3008 2578 2385 1190 1097 517 ------
NM_001004317chr654338 4047 4011 769 123 ------
NM_001004360chr241350 428 176 66 --175 --
NM_001004419chr1253745 3658 3427 3325 3081 11279 14191 --
NM_001004720chr221074 734 ------
NM_001005366chr121925 ------
NM_001005463chr1062590 1599 923 807 781 632 --1620 1897
NM_001005473chr554434 2312 1945 403 48 14361 --15906
NM_001005782chr23884 798 375 ----1420
NM_001006600chr562449 1933 1909 1777 320 172 --1283 1802
NM_001007094chr1064216 4180 3366 3279 1199 646 --1538 13456
NM_001007237chr162886 2700 2641 953 658 619 --12324 --
NM_001007466chr6134740 4679 3426 1504 1445 1406 1354 1093 977 816 649 383 253 14640 --14617
NM_001007559chr1862063 2038 2011 1509 657 278 ----165
NM_001008225chr72772 264 --1652 --
NM_001008239chr1883819 3541 2550 2341 1498 1211 990 114 ------
NM_001008408chr7166398 6281 5857 5734 5164 5152 5137 5128 4996 4688 4080 2112 1625 1525 1092 32 --11123 145
NM_001008540chr2189 1387 ----
NM_001008660chr113584 379 367 11550 11231 --
NM_001008738chr532090 1792 144 --12124 --
NM_001008925chr442172 1126 389 71 11008 --151
NM_001009569chr1041284 1267 447 30 11519 ----
NM_001009899chr3116406 6259 6246 5998 5537 5528 5244 5208 4861 4009 1062 15114 16155 --
NM_001010853chr621121 487 ----12443
NM_001010862chrX52319 2273 2232 1176 500 147 11313 --
NM_001010888chrX74637 4615 4268 3945 3472 2860 1079 ------
NM_001010922chr163751 3457 2987 2762 1632 1126 24010 1514 13682 --
NM_001010942chr126841 504 468 459 316 115 1830 --1974
NM_001011666chr766228 5434 4114 1740 454 37 14415 ----
NM_001011708chr282482 2371 2299 2087 1926 814 559 157 --32953 1009 460 1244
NM_001012279chr6194 --128 --
NM_001012393chr1185086 4807 3813 3793 3469 1021 1007 601 --25132 1300 --
NM_001012423chr1572930 2741 2466 2197 1893 717 181 --2726 243 --
NM_001013699chr122395 29 --1537 --
NM_001014797chr10127138 6463 6077 5275 5236 2968 2580 2271 1682 778 758 554 26417 1898 37102 6436 1873 11597
NM_001015877chrX63064 2961 2310 2210 1030 883 12797 33057 2334 2057 --
NM_001017395chr373656 3472 3326 2805 2631 1000 441 22909 2438 13566 --
NM_001017979chr44787 638 624 99 --1591 --
NM_001018004chr152700 583 1230 1730 --
NM_001018115chr3------1623
NM_001020658chr141506 1435 1117 1110 --1503 --
NM_001023567chr1562421 2322 2028 1914 1697 720 1862 42477 2129 726 243 --
NM_001024649chr54864 774 682 441 22571 210 ----
NM_001024666chrX----1521 --
NM_001024947chr51837 --1322 1904
NM_001025076chr10115893 5781 5541 5061 4620 1313 1250 776 769 316 92 1615 ----
NM_001025079chr393268 3180 3122 2774 1542 1113 852 757 181 ------
NM_001025107chr162633 2482 2454 2246 2227 2011 --12474 --
NM_001025108chr283888 3079 2753 2607 1671 1354 891 67 44047 2904 2570 907 13750 --
NM_001025580chrX63199 2887 2670 2645 1660 92 14261 14273 1407
NM_001025780chr95532 447 386 290 257 ----11479
NM_001029858chr653365 2487 847 253 69 12320 22198 767 --
NM_001030007chr16103813 3736 3298 1567 1454 1222 1193 791 599 91 23439 416 12806 --
NM_001031695chr2275224 4683 4196 3826 1474 1266 528 --24232 259 --
NM_001031812chr551998 1736 1560 701 75 1318 ----
NM_001032280chr621590 1286 1592 21072 479 --
NM_001033057chr362071 2009 1536 1462 1392 555 1290 1441 --
NM_001033117chr3113520 3145 3086 2989 1547 1107 1030 1015 838 403 37 --11185 --
NM_001033506chr11188 ------
NM_001033518chr782712 2694 2520 2495 2028 1910 832 799 1636 1138 --
NM_001033561chr172871 354 --1736 --
NM_001033723chr851903 832 623 305 274 --1923 1296
NM_001033925chr1062149 2133 1986 791 357 25 --1687 --
NM_001034841chr1655392 5292 5144 4755 1696 35558 4198 286 --13655
NM_001035chr121311 961 --1419 --
NM_001037164chr722059 1977 ------
NM_001037172chr361035 1016 926 912 481 465 11129 ----
NM_001037334chr1862051 1973 861 831 413 304 --11957 1642
NM_001039538chr263676 3629 3558 799 618 404 --23053 127 --
NM_001039590chrX93792 3553 3067 1483 1298 967 735 645 35 ----13157
NM_001039618chr1195468 5347 5047 4951 4767 4271 1602 586 252 --12151 --
NM_001040152chr775072 4330 3619 3521 3098 1242 1220 14566 --14543
NM_001040159chr421219 970 --11196 1528
NM_001040181chr31350 1432 11086 --
NM_001040284chr1654435 1392 1378 1146 588 --11133 24076 1838
NM_001040712chr942188 1025 552 516 2687 659 ----
NM_001040876chr4----1163 --
NM_001042355chr1674859 4785 3874 3682 3411 1212 405 45374 2152 1148 1113 14766 25061 3315
NM_001042413chr974004 3223 2970 887 837 740 705 --11145 --
NM_001042555chr12124197 4013 3997 3911 3769 3758 3748 3582 1397 1384 1304 1201 --13052 14551
NM_001042599chr2137733 7190 6256 5964 5956 5869 4782 4754 2929 2150 1969 1095 968 15212 24764 3137 11216
NM_001042681chr11350 129 21633 484 1981
NM_001042749chrX61837 1682 1497 773 534 25 --1805 --
NM_001044305chr671350 1258 1222 1069 503 403 391 11100 ----
NM_001071775chr1321385 454 11747 165 1443
NM_001106chr3209549 9232 9016 8698 8579 7775 7248 6377 3821 3543 3421 3266 2973 2859 2384 2023 1519 1175 971 220 69255 9111 8015 6656 3597 268 29596 1662 --
NM_001167chrX136711 6585 6169 5988 5540 5334 5213 4989 4897 4462 1733 1320 191 ----26732 1684
NM_001198chr651709 897 859 647 63 21986 481 ----
NM_001200chr20----1412 --
NM_001206chr942997 2728 1069 431 --1180 --
NM_001241chr282105 1927 1828 1820 1660 1540 814 308 --1435 --
NM_001259chr765602 4080 1982 1586 1158 1075 188 14113 --
NM_001270chr541133 1011 881 200 --1214 --
NM_001417chr1211403 11894 --11700
NM_001438chr183565 3517 3490 3281 3145 2765 2419 2253 13458 12485 12454
NM_001455chr674001 3984 3262 3001 1321 1221 339 24890 761 11907 --
NM_001498chr661191 1053 871 358 322 103 ----11153
NM_001546chr63592 507 257 ----1419
NM_001554chr1------1112
NM_001614chr17------1164
NM_001616chr263489 3387 2827 2242 682 467 --22253 1035 --
NM_001642chr1131181 515 299 21313 1046 1129 21055 153
NM_001663chr1442742 2439 1777 648 32683 949 431 ----
NM_001668chr131715 774 282 --1437 --
NM_001759chr1284680 4386 4034 1748 1490 853 409 389 --14745 --
NM_001783chr19----1317 --
NM_001802chr161986 175 --1921
NM_001830chrX63979 3721 1420 1105 249 40 23188 1006 ----
NM_001854chr11378 1285 ----
NM_001859chr973954 3928 3430 3352 1214 1177 887 13157 ----
NM_001967chr32615 467 ------
NM_001999chr541494 1209 948 216 --11105 --
NM_002015chr1393252 2624 2529 1193 1002 801 431 357 238 21221 227 ----
NM_002025chrX127198 7118 7033 6915 6717 6272 5653 3073 2303 979 534 157 23098 1805 28548 1898 --
NM_002076chr1262383 2028 926 266 180 75 --162 --
NM_002126chr1734093 3250 740 13181 11354 --
NM_002137chr751701 1514 838 231 32 ----1219
NM_002145chr171370 ----1319
NM_002146chr1761331 1287 1234 1157 988 402 21349 1254 --153
NM_002203chr584096 3963 3843 3376 2860 2538 1326 1134 --24035 3748 --
NM_002214chr742278 813 243 231 13470 15618 --
NM_002228chr121072 396 1788 --1384
NM_002247chr1062217 1900 1680 96 33 23 ------
NM_002264chr394580 4182 4140 3595 3300 1853 1352 1249 183 1706 ----
NM_002268chr32598 572 --11604 11744
NM_002270chr5135620 5469 5189 5110 5091 4521 3681 3624 1692 1480 1145 340 181 12208 35626 4962 1084 11342
NM_002271chr1352424 2343 2054 916 423 1986 ----
NM_002351chrX61599 1298 676 492 485 396 --1115 169
NM_002398chr251493 1469 1255 1215 542 ----1391
NM_002399chr1531402 1296 1172 21284 281 1575 --
NM_002399chr1531402 1296 1172 21284 281 1575 --
NM_002480chr1251495 1483 1461 1454 1024 ------
NM_002515chr1481964 1926 1916 1776 1689 1615 534 68 --2821 289 1561
NM_002519chr1171511 585 330 280 271 247 111 ------
NM_002522chr1743787 3729 2630 210 13143 --12966
NM_002577chr374024 3645 3263 3174 1589 1463 1378 ----21215 771
NM_002613chr16165228 4995 4984 4887 4834 4629 3593 3263 1841 1698 1508 619 594 448 401 384 24565 4549 24137 4003 --
NM_002628chr33795 393 159 ----177
NM_002641chrX51955 1845 1586 1237 268 ------
NM_002643chr21161 --1128 --
NM_002655chr8115278 4845 4749 4694 4570 4087 1869 1743 1064 982 405 11394 ----
NM_002687chr141909 1364 11170 --
NM_002715chr52974 262 ----1372
NM_002718chr352586 2314 2262 2078 604 11052 11045 1659
NM_002719chr1462373 2362 2170 1964 1790 653 2684 56 ----
NM_002729chr101796 ----1742
NM_002731chr163139 3028 2937 2038 1218 797 22165 636 13114 --
NM_002737chr1746138 5820 5530 1451 42131 1157 341 240 26666 129 16189
NM_002745chr22134480 4427 4137 3771 3610 3382 2900 1830 1369 1337 1266 880 722 --1731 11275
NM_002748chr1541080 872 416 339 --11039 --
NM_002843chr11123317 3230 3150 2981 2392 2381 2208 2201 1331 1172 842 417 1187 13258 --
NM_002851chr71645 ----1539
NM_002892chr1421482 137 11455 ----
NM_002893chrX180 ------
NM_002906chr1131829 1570 121 12139 ----
NM_002956chr1221290 1247 1292 ----
NM_002971chr331199 463 385 ------
NM_002977chr263452 3253 964 873 327 216 22791 1369 23427 3416 --
NM_002998chr892232 2171 2074 1753 1423 798 610 456 137 --11689 --
NM_003013chr42803 318 1231 1735 --
NM_003042chr351992 1941 1932 1694 894 1632 --11462
NM_003068chr821101 860 ------
NM_003070chr92601 581 ------
NM_003108chr2117086 5717 5093 4549 1471 1291 1280 1217 755 728 67 25585 4608 --14460
NM_003112chr773234 2791 1962 1030 902 460 233 12084 12050 --
NM_003155chr84762 661 333 79 ----1732
NM_003161chr1793575 3319 2770 2455 2226 1330 1227 1058 685 12405 11006 --
NM_003189chr173232 3197 3075 2707 2254 953 704 21362 711 13329 --
NM_003202chr5----11827 --
NM_003205chr1562302 2148 1711 933 387 354 --11908 --
NM_003211chr1241481 1390 1317 119 --11525 --
NM_003246chr151491 11836 11603 --
NM_003286chr204877 814 344 226 --11155 --
NM_003298chr395806 4801 4034 2384 1766 1296 1112 488 466 --11419 --
NM_003337chr521493 1355 ----11103
NM_003338chr1081510 607 536 433 345 182 96 37 21538 564 ----
NM_003390chr118928 848 748 316 293 207 151 34 --1259 --
NM_003392chr373881 3577 1602 1318 1114 779 157 13944 --12952
NM_003409chr182973 110 ----11407
NM_003410chrX42975 2895 693 92 22874 26 22722 1979 --
NM_003439chr743403 1248 791 561 22187 547 ----
NM_003474chr1082103 2041 1870 1847 1656 921 731 236 ------
NM_003566chr1263146 3088 2314 1064 841 479 13217 ----
NM_003569chr6197 1620 ----
NM_003583chr12133843 3740 3700 3684 3601 3516 3125 2842 1544 1034 756 528 247 --12381 12772
NM_003590chr292958 2663 986 779 734 545 377 269 36 1208 13046 21580 811
NM_003615chr373246 3223 2858 2614 1375 447 83 31006 760 498 --23887 552
NM_003633chr582147 2122 2100 1977 1817 1715 1663 337 12328 21960 470 --
NM_003677chr1211448 11604 --21752 272
NM_003704chr42604 509 --1212 --
NM_003714chr542394 2329 636 113 1278 --1123
NM_003743chr22886 800 1908 --1738
NM_003749chr1382390 2328 2319 1629 955 750 513 123 1141 ----
NM_003778chr32791 227 ------
NM_003822chr1103099 2042 2035 1967 1950 934 524 470 261 213 11233 11930 --
NM_003873chr1032511 2298 952 --1534 --
NM_003887chr292226 2217 2111 1546 1433 859 843 825 543 ----11984
NM_003901chr1062566 2494 2442 2177 2005 1985 12293 22392 2252 --
NM_003913chr654295 3223 1522 1298 1192 12933 1675 1203
NM_003941chr742418 2267 709 108 32181 509 66 --1902
NM_004093chr1382994 2757 2680 2537 1233 1084 222 173 12315 ----
NM_004100chr692667 2301 2198 2172 1971 1767 897 513 451 2712 241 1952 11816
NM_004171chr1189563 9326 8126 7968 7668 6743 2622 1585 38831 6143 5924 --28444 758
NM_004215chr8----1449 --
NM_004232chr1853863 3254 2735 718 318 12872 ----
NM_004302chr1272943 2888 2834 1892 637 269 107 11856 --1879
NM_004349chr81151 --11164 --
NM_004395chr5----1289 --
NM_004397chr1163960 1711 1562 945 719 210 32638 1549 1175 13688 --
NM_004411chr72575 278 --1498 --
NM_004432chr932379 1968 576 --22209 1929 --
NM_004457chr241602 1516 418 232 --11412 --
NM_004459chr1751978 1828 1819 514 389 ------
NM_004482chr24977 881 689 53 --171 --
NM_004501chr153488 1513 879 861 494 --11482 23170 1591
NM_004505chr1751948 1927 1830 166 55 --12004 --
NM_004521chr103338 323 309 --1256 1107
NM_004538chrX2713 206 --1321 --
NM_004577chr71562 --1180 --
NM_004586chrX55209 4760 4243 3305 426 13320 14116 --
NM_004598chr593147 3044 2663 2519 2073 1214 843 674 476 1435 13304 13196
NM_004612chr9124235 4228 4221 4057 4000 3219 3105 3017 1622 1005 634 569 14414 ----
NM_004637chr3----11262 --
NM_004663chr1521434 283 ----11146
NM_004734chr1342310 1079 603 255 13084 23127 1068 12500
NM_004745chr8106713 6703 4920 4536 4434 2671 2091 1244 1207 814 12377 ----
NM_004747chr1021181 589 1151 11307 11451
NM_004748chr1573891 3468 3309 2963 2688 1121 1066 --23515 1467 --
NM_004850chr22669 442 ----11163
NM_004852chr181414277 12299 11546 10719 10362 9878 9603 4966 2593 2120 1823 1342 1050 156 112813 39609 9069 4643 313473 11670 2786
NM_004859chr1782783 2037 1079 976 701 682 318 21 12027 --1912
NM_004872chr12175 142 ------
NM_004906chr63699 508 211 ------
NM_004949chr1842152 786 711 110 ----1574
NM_004956chr783355 2901 1744 1393 930 658 492 170 ----11323
NM_004992chrX118354 7768 7621 7188 6950 6244 5356 2464 1947 1915 1638 12413 28005 7097 --
NM_004999chr633686 1503 209 43113 3031 2783 709 --1977
NM_005023chr571507 1442 1359 314 270 236 35 --146 --
NM_005095chr151955 1843 1621 851 51 2783 746 1462 --
NM_005121chr17113573 3090 2979 2942 2865 2779 2766 766 729 451 21 --23398 1262 --
NM_005124chr64907 376 275 67 --1953 --
NM_005126chr362213 1807 1643 866 315 39 --21733 121 --
NM_005156chr9125157 5002 4877 4209 1970 1809 1784 1575 1298 1028 610 472 11353 15373 14266
NM_005180chr1041633 1053 487 120 1404 11437 --
NM_005188chr11168364 7403 7209 7092 6253 3063 2962 2281 2187 2156 1901 1420 1336 947 386 121 36881 6198 3215 35631 1465 502 --
NM_005231chr1151352 1337 1119 406 214 ------
NM_005238chr1163565 3553 2921 1084 1057 151 12607 13536 --
NM_005249chr143738 51 21 --1843 1199
NM_005254chr1541329 1301 420 62 ----11388
NM_005256chr111751 1174 1861 --
NM_005257chr1831202 539 521 ----1942
NM_005259chr231470 1220 454 11511 ----
NM_005277chr461839 1545 1513 1318 631 447 --1534 --
NM_005296chrX1239 ----1140
NM_005302chr72351 323 ----1133
NM_005324chr1762029 1797 1751 1331 395 29 --1538 --
NM_005342chrX81766 1022 919 512 493 466 389 208 1613 22502 132 --
NM_005358chr1331579 1257 426 --1155 --
NM_005406chr1821588 629 124 --1545
NM_005436chr10103960 3721 3396 3289 3069 2701 1490 997 841 649 11293 --11476
NM_005455chr131779 1691 600 ----11812
NM_005458chr922017 1919 12056 22205 1827 --
NM_005461chr2031832 1745 1243 --21941 1297 --
NM_005465chr131848 544 210 ----1648
NM_005596chr9135942 5935 5466 5437 5088 4606 4508 3988 2162 1887 1733 623 289 13969 15974 15774
NM_005607chr821026 699 1644 ----
NM_005668chr574620 4113 3556 3540 3389 2992 1576 --23768 3058 --
NM_005682chr1621128 63 ----31396 1378 930
NM_005688chr361203 1132 429 380 263 178 --1460 --
NM_005721chr23705 426 343 ------
NM_005724chr15----1526 --
NM_005730chr1293504 3377 2875 2499 1388 777 713 230 54 --1272 12860
NM_005744chr152166 119 ------
NM_005779chr5103567 3549 3508 3267 2730 2696 1366 1052 968 882 22647 575 13410 --
NM_005880chr1661638 1518 1406 1136 530 351 ------
NM_005898chr1142693 875 643 112 --22499 601 --
NM_005904chr18----11194 --
NM_005911chr231107 392 168 --1268 --
NM_005923chr63615 537 468 --1640 --
NM_005930chr142847 319 1746 2778 329 1648
NM_005935chr465301 4323 1846 984 702 551 --21271 181 14935
NM_005941chr864200 4174 3286 3215 2874 2675 ----13793
NM_005966chr282408 2196 1771 1677 1471 914 729 281 31936 1594 150 11543 --
NM_005986chr1322762 487 1995 ----
NM_006037chr2154612 4334 4276 3984 3892 3880 3704 3680 3097 2966 1849 783 514 475 317 13569 14288 --
NM_006060chr7114216 3780 3644 3482 3232 3222 2775 1649 1317 1259 1049 --11756 --
NM_006154chr1552708 1164 987 386 21 1527 ----
NM_006195chr981281 1228 1015 939 895 254 107 83 ------
NM_006202chr1951728 1714 1588 1481 261 --21376 556 1321
NM_006256chr192720 2620 2181 2103 1865 1001 949 490 185 1907 ----
NM_006265chr821327 946 ----11411
NM_006282chr2064515 1907 1656 1581 1363 851 --13565 23588 480
NM_006306chrX83942 3925 3661 3634 2179 1734 1183 315 12258 --14826
NM_006313chr1221417 1251 ----1648
NM_006317chr52893 708 ------
NM_006357chr23482 183 52 2350 190 ----
NM_006380chr1784301 3292 2999 1764 1483 1066 164 57 23415 1589 21369 429 --
NM_006401chr92323 65 ------
NM_006449chr272182 2096 835 738 617 528 83 1424 1882 --
NM_006496chr121898 1754 --11955 11972
NM_006538chr294149 4012 3964 3540 3455 2863 2845 2791 698 12854 --12802
NM_006599chr16117610 5849 2897 2276 2216 1632 1339 930 704 558 107 --13010 12861
NM_006609chr242988 2091 2063 412 12577 --22473 330
NM_006614chr343405 2600 1378 896 --13601 --
NM_006628chr1564267 4067 2946 1762 1730 376 21636 637 ----
NM_006682chr731081 941 305 ----11857
NM_006717chr953121 2869 2763 2559 284 155 13015 12978
NM_006750chr16158106 8030 7290 7260 6658 6607 5893 5691 5019 2624 1707 1321 1141 542 377 11554 25697 4976 --
NM_006769chr13658 521 94 ----1229
NM_006777chrX42847 2698 2366 2218 ------
NM_006802chr11953 1132 ----
NM_006827chr1443007 2401 2270 806 ----1582
NM_006885chr1664090 4068 3825 2990 787 394 --13361 14192
NM_006888chr14103517 3486 3333 3221 3109 2941 2924 2883 2179 772 1779 12439 --
NM_006914chr931400 462 442 11004 1536 1306
NM_006920chr251986 1432 1354 346 172 11596 1272 --
NM_006940chr1211723 ------
NM_007011chr15116876 6279 6141 6090 5910 5232 4318 1828 1709 1449 1362 22319 969 34452 2527 2387 --
NM_007030chr5105139 4920 4499 4409 4398 4207 1061 813 714 467 13380 --14111
NM_007040chr191763 ------
NM_007054chr5133956 3926 3908 3845 3039 3020 1138 721 448 373 329 236 190 2564 113 13797 --
NM_007114chr363120 2954 2088 2031 1208 509 --12115 43095 2771 330 113
NM_007125chrY61386 1125 1083 962 189 70 ------
NM_007146chr1752862 2360 2332 1016 357 --1704 --
NM_007212chr111396 --1458 --
NM_007249chr13159336 9114 9082 9003 8165 8152 7444 6437 6136 5947 1654 1423 1087 769 288 18226 ----
NM_007276chr741099 1080 1056 209 ------
NM_007282chr35919 889 687 205 54 190 ----
NM_007358chr12480 45 1238 ----
NM_007361chr143569 186 137 ------
NM_007373chr1031792 1720 1121 --1413 11733
NM_012073chr541439 336 269 208 11270 --2446 110
NM_012095chr1053297 610 598 304 282 --1534 --
NM_012096chr363426 3267 1098 840 317 126 ----13297
NM_012104chr11113775 3679 3167 2590 958 745 496 398 189 182 92 ------
NM_012120chr672858 2642 2491 2347 881 773 214 ------
NM_012156chr2053393 1147 1030 910 873 12844 --1398
NM_012158chr1331833 1633 67 ----11240
NM_012180chr4----195 --
NM_012207chr104852 814 448 169 ------
NM_012214chr2126201 5945 5781 5081 4979 4523 1269 1139 1039 1003 757 165 14867 11100 2837 114
NM_012215chr1061963 1822 1460 1339 683 605 11951 ----
NM_012234chr373750 3313 2618 2333 1290 1027 552 22549 97 ----
NM_012238chr1021641 662 21681 702 1531 --
NM_012249chr253366 1313 983 702 310 11382 --1725
NM_012262chr1114521 4124 3821 3434 1793 1383 1318 959 846 797 532 23462 890 ----
NM_012281chr752298 2278 1617 930 216 ----1557
NM_012287chr354516 4465 3754 3042 638 23358 238 13879 --
NM_012290chr261528 1491 1478 1360 1076 316 11186 --11570
NM_012300chr522374 760 ----12407
NM_012301chr792197 2126 2079 1987 1865 1840 1728 1473 738 ------
NM_012309chr1184786 4773 4534 4151 3410 613 455 348 24368 1831 --14972
NM_012330chr1091805 1738 1301 1209 605 496 489 423 150 11652 ----
NM_012341chr10----1419 --
NM_012399chr2241835 656 319 211 1466 --11911
NM_012412chr7140 ----1124
NM_012416chr911191 --21241 1098 --
NM_012428chr151878 ----1952
NM_012479chr762406 1976 1062 1031 763 356 1245 12289 --
NM_013255chr7108471 8351 7646 6909 6694 6187 5396 3446 3052 931 11222 12276 18824
NM_013261chr4103717 3592 3437 3107 2571 2546 1293 1243 1160 866 12632 23459 2983 --
NM_013390chr911507 --1373 --
NM_013436chr26810 682 672 515 507 325 158 --165
NM_013437chr8126 --1271 1282
NM_013450chr241114 1100 394 68 --2857 785 --
NM_014011chr272546 2404 2278 1699 1681 429 265 --22569 2300 11668
NM_014016chr3111702 1614 1514 1396 1122 1109 1097 1081 483 380 280 ----1406
NM_014021chr133121 3007 325 ----1394
NM_014048chr1685200 5180 4529 4332 3837 3342 1735 593 --15258 12083
NM_014106chr1582922 2833 2614 2560 2265 290 261 242 12356 12291 --
NM_014112chr8115315 5024 4612 4021 3690 3481 2145 1999 995 784 574 ------
NM_014154chr351271 397 342 285 245 11600 ----
NM_014294chr821386 121 1485 ----
NM_014323chr2231062 744 90 ------
NM_014423chr595582 5275 4076 3761 3723 3458 1851 695 45 11714 --1912
NM_014494chr1642349 1686 1576 94 --21836 646 --
NM_014504chr731866 447 406 --2292 42 11320
NM_014577chr222690 48 ----1573
NM_014606chr421373 154 ----11406
NM_014616chr363460 3039 2538 1290 633 111 11207 23399 3360 --
NM_014667chr362388 1907 1840 1753 1708 1625 ------
NM_014674chr333022 2979 507 33642 3113 2729 --13874
NM_014702chr643073 2292 308 251 ------
NM_014729chr851983 1876 889 474 464 --11949 1301
NM_014751chr882159 1999 1864 1713 870 738 583 100 21328 411 1421 --
NM_014755chr294273 4216 4193 3814 3218 3160 897 325 75 1966 --13100
NM_014795chr231250 295 231 1117 11024 --
NM_014810chr163505 3469 3101 2398 1250 1133 --23243 551 --
NM_014838chr2262329 1902 1807 726 388 345 --22617 1892 --
NM_014841chr651293 1062 1053 1041 237 1954 31276 906 211 --
NM_014873chr1144727 4719 4638 4597 4455 4184 3463 3083 1704 1663 1247 642 565 379 --14271 11720
NM_014893chrY41621 828 531 307 1556 1545 --
NM_014897chr1773170 2853 2419 2384 1982 421 413 ------
NM_014906chr1794046 3873 3770 3355 3274 2890 2574 805 685 1411 ----
NM_014910chr191633 ------
NM_014920chr673560 3453 3299 3140 3112 2883 2760 13419 13390 --
NM_014934chr1342864 1291 1123 732 23719 3651 22739 1130 --
NM_014946chr232374 1251 544 1804 11213 --
NM_014962chr2082843 2447 2332 2313 2231 1087 1007 926 --12743 12532
NM_014969chr141181 1120 1026 472 1991 --1753
NM_014982chr1474832 4422 1595 1404 1214 1192 696 --15336 --
NM_015000chr1282958 2311 1157 1147 754 391 330 318 2883 506 11234 --
NM_015009chr31243 1775 1756 --
NM_015020chr1653223 3121 3113 1049 893 1665 13799 --
NM_015026chr1274415 3630 3579 2981 1563 1301 441 --1822 --
NM_015032chr1372719 2694 2616 2528 2172 828 440 ----12203
NM_015071chr556324 6197 1653 1175 371 15941 15068 --
NM_015076chr653488 1530 1430 940 326 --34345 1669 1598 --
NM_015092chr1684665 4552 4101 3974 1672 1408 1008 894 ------
NM_015138chr1582846 2835 2431 1923 1902 777 703 156 --12305 --
NM_015141chr362381 2258 2091 1688 692 98 1236 12749 12337
NM_015176chr121085 75 ----1550
NM_015187chr41283 --1702 --
NM_015192chr2072802 2717 2565 2293 2161 691 645 --22519 598 --
NM_015205chr1354406 2010 1681 628 227 35181 1590 220 1322 --
NM_015215chr1103187 2894 2664 2152 2105 1963 1181 888 371 348 ------
NM_015265chr272582 2471 2375 2359 2076 1785 491 1891 1869 --
NM_015271chr453112 2621 1661 1550 1537 13366 1401 --
NM_015275chr1211982 ----11457
NM_015277chr181723 ------
NM_015285chr1862580 2349 1666 925 778 337 1650 --11877
NM_015310chr876723 5662 5355 2642 1939 1629 134 28185 1368 37739 6133 398 --
NM_015313chr1174507 4300 3853 1594 1425 715 306 ------
NM_015328chr793088 2810 2202 2192 2076 1975 1080 1073 169 11183 ----
NM_015336chr1282573 2524 2303 2217 2203 641 524 494 12612 --1945
NM_015441chr1------1173
NM_015455chr573800 3675 1070 939 519 457 341 22903 796 ----
NM_015464chr71245 1801 --11049
NM_015483chr721164 1130 ----1871
NM_015564chr563043 2287 1210 1124 813 677 12683 12382 --
NM_015567chr1341218 1186 957 310 --11099 --
NM_015569chr194840 4063 3335 3241 3230 2943 1697 1588 995 --23442 3013 --
NM_015570chr741848 1703 1408 1164 --21683 308 --
NM_015578chr1961721 717 660 384 340 100 --11415 --
NM_015678chr1371657 1557 1536 1231 1160 286 135 --1143 --
NM_015695chr631948 1623 268 11752 --12011
NM_015878chr842158 2092 1988 842 --1479 --
NM_015879chr18137881 7529 7469 6954 6541 3210 3163 3152 2215 1964 1945 1603 750 --48508 6095 1200 861 --
NM_015906chr154598 4071 3338 3290 755 14777 12928 13180
NM_016009chr194310 3888 3186 1259 1114 871 785 675 440 14387 1791 13010
NM_016072chr1242407 2338 1919 426 21885 1767 1321 --
NM_016081chr422141 1707 ----12035
NM_016120chrX3966 907 758 ------
NM_016125chr172576 563 ------
NM_016250chr141326 --1756 1815
NM_016300chr33464 379 368 --1470 --
NM_016374chr161578 1473 1406 1229 481 343 21344 284 21256 256 --
NM_016396chr1572216 1103 1060 884 628 392 310 --1722 --
NM_016436chr2062654 1815 1717 1665 837 642 21808 496 --12611
NM_016441chr252377 2238 1638 1613 96 1267 --12121
NM_016485chr641557 1431 897 741 1794 ----
NM_016531chr443707 3688 3644 3086 1848 ----
NM_016626chr1831728 1475 1375 21426 227 ----
NM_017412chr871250 1144 983 485 453 325 81 --1499 --
NM_017423chr462240 2143 2124 1877 1431 153 22136 220 12017 --
NM_017548chr372131 2103 1994 1893 668 565 496 ------
NM_017628chr484143 4085 3620 1016 940 902 665 636 21444 816 13581 --
NM_017634chr841920 1594 668 99 11718 ----
NM_017635chr112336 268 ----1130
NM_017637chr9109220 8017 6578 6342 6335 3600 2134 2123 566 135 ------
NM_017658chr1464593 4416 3874 3695 3402 1387 24423 1772 21519 936 --
NM_017694chr251957 1763 1598 1425 819 11337 11741 --
NM_017724chr32705 195 ----1255
NM_017801chr341923 942 544 361 --22540 2292 12259
NM_017811chr9--32766 2470 1189 --13018
NM_017813chr8114703 4644 4300 3901 3710 2230 1803 1095 870 630 279 25756 741 ----
NM_017819chr3----1165 1228
NM_017847chr152258 1877 900 808 601 --1188 --
NM_017925chr951690 1414 1379 1290 277 1246 1573 --
NM_018013chr672986 2908 2830 2511 1180 469 432 22678 2234 1734 --
NM_018027chr1063174 2703 2325 1070 981 298 13201 --13136
NM_018046chr531885 699 604 ----1551
NM_018047chr53710 219 92 130 --1899
NM_018061chr13523 360 110 --1500 --
NM_018084chr283122 3076 2742 2670 2652 2434 2313 468 ------
NM_018126chr431252 638 607 ----1973
NM_018181chr1821439 459 --11371 --
NM_018243chr423937 2730 13797 13790 13210
NM_018370chr1252285 2019 1718 1567 442 --32211 1902 203 --
NM_018374chr775220 5114 4718 2019 1904 742 731 ------
NM_018444chr842075 1902 1715 812 ----11526
NM_018448chr1231114 983 167 11096 21242 1193 --
NM_018482chr862557 2455 1936 862 472 161 --12174 --
NM_018489chr132198 1652 779 --12398 11641
NM_018569chr431543 1428 1316 ------
NM_018650chr151825 1542 1451 191 153 12047 32025 770 463 --
NM_018712chr1141577 330 316 104 --11408 --
NM_019045chrX----1789 --
NM_019063chr251627 1582 855 408 259 ----12197
NM_019071chr72781 612 ------
NM_019087chr521668 1536 21304 160 ----
NM_019556chrX11484 --11175 --
NM_019852chr14----1114 --
NM_020116chr441780 1518 1206 675 11810 --11247
NM_020148chr1872602 1209 1161 927 608 425 85 12144 12865 --
NM_020310chr1762711 2692 2569 2234 988 620 --12597 12614
NM_020337chr452946 2377 2076 716 144 --1444 11979
NM_020341chr2031795 1481 503 --22000 1343 --
NM_020342chr262298 2119 832 651 318 70 --1424 --
NM_020346chr1141538 1373 390 120 ----1252
NM_020390chr394776 4325 4142 3780 3372 3363 3259 3035 230 1205 13148 --
NM_020651chr21378 11322 21786 1418 --
NM_020673chr20107377 6743 6476 2824 2237 2224 1544 1049 888 268 37484 5579 5383 11482 15490
NM_020699chr174015 4009 3612 3540 2045 1301 641 24322 3702 33928 1843 1468 --
NM_020718chr16196280 6248 6155 6105 5809 5517 4521 4456 4028 2419 2238 1842 1028 1005 721 648 466 288 120 --1863 35780 433 256
NM_020748chr1741812 1643 384 357 1604 1224 --
NM_020772chr17107896 6994 6688 5778 3428 1910 1890 1824 1498 869 18647 43400 3041 1596 908 11111
NM_020782chr1263779 3659 1458 1380 1299 134 14669 --11833
NM_020794chr161570 1561 1463 1093 599 412 ------
NM_020801chr542576 744 651 44 --1671 --
NM_020826chr1153564 2714 1401 1120 612 --13683 --
NM_020843chr15------2158 120
NM_020856chr1941173 1131 596 149 --11261 151
NM_020858chr1552258 2137 1734 947 511 1466 ----
NM_020871chrX12347 --21993 1914 22582 565
NM_020918chr1083562 3351 3295 3258 668 580 331 52 12959 12417 --
NM_020988chr161253 2181 171 ----
NM_021033chr1362977 2787 1051 1006 808 315 12923 23476 577 --
NM_021038chr3103365 3281 3029 2647 2220 962 678 607 548 86 1396 22993 935 --
NM_021072chr552570 919 859 511 127 ----11054
NM_021116chr7148012 7982 6401 3626 3427 3361 3194 2713 2299 1462 892 846 222 154 48798 7637 6019 1379 18916 --
NM_021145chr751147 1083 1050 385 323 --11110 --
NM_021155chr1952643 1988 1927 1182 1141 ----12079
NM_021215chr2042272 1726 1611 489 --12019 --
NM_021229chr121464 11203 --1922
NM_021252chr1041905 1735 780 688 ------
NM_021255chr1434070 3234 43 24078 3391 23176 2935 --
NM_021813chr6125874 5761 5651 5585 5497 4348 4242 928 833 423 251 65 24514 4035 1761 --
NM_021814chr64369 325 88 43 ----2352 230
NM_021961chr11137451 6941 6646 6569 6124 4925 4612 4562 1111 1036 1010 781 92 76965 5957 5695 5394 5060 1318 1133 1196 --
NM_021964chr3146512 6403 6387 5638 5080 4863 4798 4412 2451 2050 1069 886 320 85 1822 14619 --
NM_022048chr1595915 5710 4818 2330 2227 1673 1390 1112 50 15006 1612 --
NM_022058chr261679 1363 570 319 212 174 ------
NM_022114chr1134732 4563 4389 4356 4251 3830 3813 3804 3657 3237 2953 926 612 24721 4459 --1638
NM_022143chr721557 520 ----1975
NM_022166chr16106323 6273 6193 5894 5717 5396 5249 5216 4813 223 --13861 --
NM_022351chr8113759 3731 3599 3036 1516 1422 563 444 404 238 98 11009 13134 --
NM_022459chr1336382 5253 4042 --24177 879 1469
NM_022465chr1263060 3046 3011 2849 513 96 --22269 667 --
NM_022474chr1482818 2811 2408 2357 1945 1021 967 441 22051 119 ----
NM_022491chr1273311 2962 2930 2706 2317 1362 1053 1978 ----
NM_022494chr10154 ------
NM_022719chr2293787 3632 3199 1513 1433 1379 613 395 55 --23838 2786 --
NM_022763chr373174 3167 3097 3069 1112 1097 548 ----1689
NM_022831chr161563 1540 1312 1143 625 147 11646 --1216
NM_022841chr1572312 2008 1747 1691 518 51 30 1198 1500 1422
NM_022893chr253080 2593 843 782 91 ------
NM_022894chr231271 401 175 1168 ----
NM_022918chr1131801 1655 469 11534 1229 --
NM_024574chr41437 1372 ----
NM_024613chr821598 1165 ------
NM_024615chr5----1192 --
NM_024721chr862708 2522 1814 1055 476 341 2910 710 --12632
NM_024947chr3119249 9123 8773 7939 7712 2317 2311 2274 1945 1217 836 ----19599
NM_024989chr2188020 7860 7379 6817 6737 6648 6572 6540 6435 5697 5531 5480 5129 5103 3139 1297 923 298 48055 6942 1518 1491 --15899
NM_025083chr1541545 1439 679 303 1448 --1741
NM_025134chr1632490 1664 63 22007 443 ----
NM_025146chr322153 352 12484 12420 --
NM_025164chr1131979 1350 51 --12094 --
NM_025191chr1103531 3460 3387 3284 3003 2836 1293 851 765 50 11357 11024 --
NM_030571chr561009 643 452 386 320 287 11289 --11061
NM_030621chr1484032 3824 3715 3070 1495 1456 1340 528 --24235 195 --
NM_030627chr593919 3903 3868 3668 3648 3633 1238 1066 102 21644 164 33014 2956 2548 --
NM_030647chr7106303 6224 5960 5794 5656 4843 4670 4573 2277 155 25596 2027 14537 12345
NM_030784chr6----1331 --
NM_030809chr1242494 2399 2092 324 --1861 183
NM_030820chr64928 700 310 47 --1836 --
NM_030934chr11392 --167 --
NM_030939chr651176 1046 971 282 206 ------
NM_030945chr552050 1924 933 99 41 --1833 --
NM_030964chr573678 3445 3404 3318 1484 899 578 12673 13573 --
NM_031372chr43608 438 143 1364 1391 --
NM_031442chrX33184 2882 2852 --11112 --
NM_031445chr223111 3034 22149 1042 1276 13441
NM_032102chr1152013 1203 987 849 209 11939 ----
NM_032121chrX32428 2112 283 --12789 --
NM_032199chr1093883 3816 3792 3598 3232 3222 992 532 129 1872 --12835
NM_032228chr1152738 2331 1371 310 189 ------
NM_032291chr151442 1268 684 246 233 --1325 --
NM_032440chr1052705 1103 733 95 27 22351 292 22579 2436 --
NM_032457chr493359 3181 2924 2666 2455 830 560 333 179 ------
NM_032458chrX83394 3291 2640 2540 2156 1360 1213 147 13127 33387 2664 2387 --
NM_032491chr1271066 1043 1022 995 467 225 101 1253 ----
NM_032505chr352719 2536 2036 1830 959 --22711 2064 --
NM_032547chr41274 ----1209
NM_032682chr373332 3200 2459 2258 2244 2220 760 --12814 --
NM_032772chr102536 386 1461 ----
NM_032804chr1052107 983 835 799 436 --32511 2011 1811 --
NM_032810chr1041291 1125 1114 256 1437 ----
NM_032857chr15------1166
NM_032873chr1194510 4396 4347 4000 3371 3118 1209 815 154 11372 ----
NM_032968chrX74174 4005 3977 1632 832 811 660 1957 11658 11050
NM_032973chrY74166 3997 3969 1631 832 811 660 1957 11652 11050
NM_033083chr3102996 2940 2787 2773 2607 2411 2265 1291 857 707 1229 22793 110 --
NM_033224chr7148077 7834 7594 7459 6490 5232 4884 3108 2342 2175 2131 2078 1258 980 57494 4984 2966 2546 1174 12976 --
NM_033285chr884242 2889 2852 1678 1261 1211 1077 408 1687 --14153
NM_033427chr75313 306 262 197 102 ------
NM_033505chr2116747 5805 5671 5405 4371 4149 2076 1567 1458 1347 32 35682 4968 4750 21143 770 --
NM_033540chr33892 107 98 ----11013
NM_033656chr2185930 5331 5306 5069 3978 1608 811 180 13793 24521 3673 23743 972
NM_052879chr1243035 1573 1365 693 --22632 56 --
NM_052978chr1441766 1461 551 353 ----11773
NM_053001chr81389 1256 ----
NM_057175chr462300 2164 2025 795 772 630 1548 12384 --
NM_080832chrX21643 181 1232 ----
NM_080867chr1454601 4562 4513 3848 3199 11874 13266 --
NM_080872chr893957 3791 2793 2771 2620 1033 921 450 291 11630 13070 --
NM_080927chr363385 3291 2649 2159 918 549 12882 23251 3063 1236
NM_101395chr2183233 3201 3155 3089 1360 1240 1195 657 12835 ----
NM_130782chr111197 ----1287
NM_133334chr4126211 6203 6054 5812 5400 5197 4785 4664 4325 2244 1185 653 15927 36125 4998 2214 25298 476
NM_133473chr1951798 1731 688 333 273 --1563 --
NM_138288chr1462207 1719 1424 1403 840 391 --1232 --
NM_138426chr762394 894 857 741 378 270 22355 1986 11850 --
NM_138444chr1394396 4099 3087 3070 1975 1906 1543 981 703 23439 1535 1896 --
NM_138468chr275977 5837 4675 2531 1515 1087 81 15677 --15945
NM_138473chr12105166 4522 3975 3965 3386 3303 3168 2033 1668 987 1578 --1870
NM_138782chr552317 2234 1906 1678 263 1723 ----
NM_139245chr311799 31690 1631 263 ----
NM_139246chr952041 1936 742 659 380 1501 11581 --
NM_139279chr253307 1423 1013 1005 123 --12517 --
NM_139321chr2064128 4052 2962 2922 1005 345 ----1316
NM_144571chr4147017 6750 6565 6302 5613 5467 5091 4451 4386 2408 2316 2126 253 132 --36527 4396 1880 --
NM_144578chr14105461 4995 4767 4724 4342 4008 3988 3791 1320 919 --14424 23753 1286
NM_144590chr1072668 2514 2014 1947 961 229 79 ------
NM_144664chr1142531 2279 2241 614 ----2874 662
NM_144778chr1352179 1814 1025 957 63 22032 799 12519 --
NM_144963chr852612 1778 1741 767 213 --22725 1699 1555
NM_144973chr1294424 3564 3308 2077 1612 1310 1125 884 507 --25369 162 --
NM_145175chr221379 1288 1479 21313 361 --
NM_145799chrX22643 911 158 --12781
NM_152280chr152881 2806 2737 2495 705 1104 11248 --
NM_152418chr841891 1795 1786 1329 21627 107 ----
NM_152423chrX31029 491 324 ----11107
NM_152463chr17169 ----1329
NM_152556chr742322 2159 1764 1605 1380 ----
NM_152594chr1522231 2147 22136 209 11871 --
NM_152622chr572655 2425 1322 975 840 659 230 1348 ----
NM_152624chr5147240 7209 7073 7001 6501 5781 5661 4905 2688 2619 2591 674 623 171 35440 5315 1932 1267 34519 2105 1367
NM_152641chr1292720 2358 1013 844 817 736 678 340 229 1904 12398 --
NM_152678chr352410 2243 1048 194 142 --11985 --
NM_152716chr1151664 1647 1569 1423 1357 --1345 --
NM_152731chr641189 1052 398 127 --1915 --
NM_152739chr761069 956 791 459 382 212 ----11018
NM_152745chr73911 863 199 ------
NM_152756chr574153 4145 4108 3966 1677 1639 256 --11012 --
NM_152758chr852929 2546 1865 405 204 --22331 513 --
NM_152787chrX173883 3765 3543 3507 3368 3237 3199 2981 2901 2585 2497 2438 1237 935 614 388 290 13428 ----
NM_152835chr152911 2740 2528 2238 930 12613 12766 --
NM_152857chr66995 857 777 358 349 58 ----1757
NM_153020chr651527 1289 1168 1081 677 1625 --1641
NM_153184chr351797 1483 595 182 117 --1705 --
NM_153207chr1261440 1206 1047 892 419 213 --1243 11140
NM_153262chr133182 2127 707 12640 --1747
NM_153607chr592999 2862 2108 2077 1053 983 794 475 58 --21282 1195 --
NM_170606chr731686 1658 1576 11457 1623 --
NM_171998chrX52515 2483 2454 900 665 --11573 --
NM_172037chr831333 430 325 1251 --11244
NM_172070chr262236 1984 1632 876 647 501 ----12176
NM_173468chr4145871 5736 5517 5479 5027 5012 4858 4842 4355 3796 2136 2076 1968 816 --25891 4123 1759
NM_173495chrX52595 2514 1659 1603 483 22447 457 12030 --
NM_173511chr273906 3581 3232 2971 2654 994 798 43803 2963 2512 2457 11131 13394
NM_173519chr832035 1538 418 --21837 279 --
NM_173576chr1031661 876 817 12242 11493 --
NM_173582chr11135070 4167 4121 3947 2261 2096 2034 1889 1393 809 619 543 28 25800 1160 24265 402 12106
NM_173698chrX51906 1870 1829 1398 93 11761 2517 360 --
NM_173797chr541216 915 878 318 ------
NM_174911chr873855 3503 3210 2984 2580 1007 842 1161 --22968 277
NM_174934chr1113609 1221 22469 118 23603 3052
NM_175061chr752053 2033 2015 377 314 1162 ----
NM_175736chr1297844 7819 7563 7140 5852 2725 1648 836 173 25690 1993 17105 --
NM_178011chr1073098 2664 1104 996 877 321 294 ----1337
NM_178566chr941902 1562 1550 294 --11529 --
NM_178812chr851365 1221 1162 1149 992 --11416 --
NM_181077chr1582315 2122 2026 1912 1695 861 522 181 --2726 243 --
NM_181358chr132611 1419 190 --33185 1625 1495 --
NM_181504chr554180 3469 3050 1454 183 --13363 1493
NM_181672chrX32004 1909 1480 ------
NM_181782chr641952 1528 510 318 ----1337
NM_181836chr552331 2149 1016 621 36 12683 1437 1154
NM_181869chr1232760 2720 2241 11138 12074 145
NM_182485chr453437 2666 2592 589 58 12645 13129 12740
NM_182493chr1694383 4263 4125 1630 1095 808 593 440 167 --11796 13693
NM_182515chr1975658 5559 4158 2491 2228 1683 321 46206 6002 4441 1195 26669 553 11182
NM_182691chr72565 167 ----11185
NM_182830chr1442007 1494 650 435 11758 ----
NM_194282chr452988 2816 2327 89 33 ----11993
NM_194285chr1162416 2132 1344 1305 1064 745 11129 13437 --
NM_194314chr1115614 5503 5274 5207 4161 3961 3928 3682 3496 1463 634 14849 12199 --
NM_198270chrX43080 1217 1033 573 ----12738
NM_198273chr52836 766 ----13080
NM_198465chrX52353 2075 1996 412 252 ----1785
NM_198513chr872005 1825 1736 1721 656 612 384 --11777 --
NM_198581chr2127239 7179 6250 5754 5010 2548 1107 883 614 607 250 161 --25970 200 --
NM_198859chr384822 3546 3376 1795 1618 990 909 413 ----11290
NM_199320chr452948 2886 1888 1172 218 --1444 --
NM_203434chr941221 941 479 155 --1267 --
NM_203458chr143222 3018 2984 2713 11070 33243 3214 630 --
NM_206853chr6143846 3799 3677 3285 2895 2571 1528 1373 1315 647 619 514 500 311 ------
NM_207303chr1063597 2954 2903 1364 1119 376 ------
NM_213589chr2105511 5127 5120 4805 4414 4181 4091 3430 2002 166 34311 3968 1000 ----