TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-140-3p
miRNA Sequence: UACCACAGGGUAGAACCACGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000126chr15167 ------
NM_000165chr62356 39 ------
NM_000176chr552891 2724 2490 880 147 ------
NM_000264chr911293 ----1475
NM_000314chr1032756 1023 423 --12888 --
NM_000332chr6106591 6220 5857 5045 2692 1993 1592 1313 771 408 ------
NM_000337chr535166 4821 2213 24932 4250 ----
NM_000421chr171244 ------
NM_000459chr91236 ------
NM_000484chr211343 ------
NM_000489chrX2929 767 ------
NM_000494chr101885 ------
NM_000503chr81151 ------
NM_000582chr42403 167 ------
NM_000633chr1843878 1712 1073 541 14189 23851 1784 --
NM_000719chr1295537 4083 2476 1775 1293 1191 1073 907 713 ------
NM_000829chr112925 521 ------
NM_000903chr1611293 ------
NM_000917chr102164 145 ------
NM_000926chr1199329 8419 8005 7772 6268 3014 2356 795 676 139 ----
NM_000990chr1121160 49 ------
NM_001001396chr154163 3515 3016 1317 1106 11159 ----
NM_001001552chr1254 33 ------
NM_001001664chr232494 1254 647 12997 11468 --
NM_001001938chr953315 1515 829 361 59 ------
NM_001001974chr101599 --1478 --
NM_001001995chrX31902 1320 266 ------
NM_001002860chr1424357 4074 --13804 --
NM_001003652chr1888406 6959 6137 2835 2786 653 147 69 ------
NM_001003674chr1886488 6356 5652 1849 1748 1334 657 419 --17055 --
NM_001005336chr93470 383 373 ------
NM_001005463chr1031964 883 469 ------
NM_001005473chr536535 5106 476 14490 --11947
NM_001006600chr51150 ------
NM_001007226chr174452 251 131 91 11104 ----
NM_001007255chr1158 ------
NM_001007466chr645106 4489 1504 1008 --1254 2979 385
NM_001007559chr185707 441 157 121 64 ------
NM_001008239chr1832598 1174 105 ------
NM_001009185chr51207 ------
NM_001010888chrX44356 3364 2853 1662 ------
NM_001010891chr556193 6179 5406 4930 4299 11121 21745 1248 --
NM_001010971chr11998 ------
NM_001013690chr1232555 2485 228 ------
NM_001014797chr1087102 6812 6463 2968 2421 2066 1596 884 --47139 6078 2272 1874 11684
NM_001015877chrX21202 430 12268 12058 --
NM_001018108chr1532259 374 236 --1810 --
NM_001024649chr52774 502 ------
NM_001024934chr6151 ------
NM_001025076chr1051861 1009 808 316 92 --11251 --
NM_001025266chr333439 711 586 ------
NM_001029858chr643365 1004 767 592 --12199 --
NM_001031679chr1243111 2925 603 490 ------
NM_001031695chr2221266 528 ----1261
NM_001031804chr161223 ------
NM_001033117chr373520 3403 1547 1374 1185 960 37 13835 --11032
NM_001037164chr72278 159 ------
NM_001039479chr1422031 601 --11980 --
NM_001039538chr263558 3181 2643 2564 1088 799 --1619 --
NM_001039590chrX13484 --11484 --
NM_001040110chr731757 432 244 ------
NM_001040157chr411989 ------
NM_001040202chr432448 893 716 ------
NM_001042404chr13243 225 35 ------
NM_001042550chr921350 204 ------
NM_001042599chr267472 7286 5069 4764 1995 1215 --1969 --
NM_001042604chr334752 1101 585 ------
NM_001042749chrX1541 169 126 11499
NM_001042784chr4150 ------
NM_001106chr3137805 7523 6655 6225 6187 3821 3266 2925 2859 2023 1175 763 267 --12974 29598 2386
NM_001200chr201882 ------
NM_001219chr711675 --1686 --
NM_001300chr101353 ------
NM_001380chr101799 ------
NM_001429chr223760 251 145 ------
NM_001438chr112460 ------
NM_001440chr892704 2440 2100 2053 1967 1948 1824 930 254 --22216 1001 --
NM_001497chr932235 2033 874 ------
NM_001530chr1431167 1112 791 ------
NM_001543chr554467 4393 881 726 125 --24134 2969 1739
NM_001570chr31301 ------
NM_001642chr1131312 1054 1045 --11182 --
NM_001649chrX52384 2354 2024 620 277 --1291 --
NM_001650chr1853669 3510 3338 2503 1582 --14092 --
NM_001656chr551814 1332 709 174 33 ------
NM_001659chr1242184 1949 1941 503 --12601 --
NM_001695chr853411 3396 3348 1003 544 ------
NM_001709chr1142693 2613 2460 241 --12603 --
NM_001731chr121873 --1644 --
NM_001742chr711414 ----11643
NM_001792chr181339 ------
NM_001939chrX63538 3453 3327 2778 2487 2361 --13820 --
NM_001949chr652809 2046 845 795 697 ------
NM_002015chr1323018 861 ------
NM_002025chrX79189 8213 7209 6915 3050 2694 1804 --11899 --
NM_002210chr213459 ------
NM_002214chr725625 4661 ------
NM_002264chr364971 3905 3515 966 321 62 --24581 184 --
NM_002270chr565129 4962 4743 1042 321 226 ------
NM_002356chr6----12810 1971
NM_002359chr1751571 1227 961 705 295 --13433 --
NM_002399chr1521283 1043 ------
NM_002515chr141560 ----1823
NM_002576chr1121154 1110 ------
NM_002605chr1511192 ------
NM_002717chr83449 166 93 --1181 --
NM_002721chr91166 ------
NM_002731chr122863 1108 ------
NM_002738chr1641107 972 357 58 ------
NM_002745chr22104427 4347 4137 3416 2927 2877 1274 880 523 154 24043 3738 33383 1338 732 --
NM_002786chr111273 ------
NM_002828chr181382 ------
NM_002830chr21271 ------
NM_002858chr12842 246 ----1446
NM_003026chr92537 148 --1282 --
NM_003038chr22696 320 12619 1617 12296
NM_003071chr332046 715 213 ------
NM_003108chr286878 6588 6120 5584 5097 5030 4459 1153 ------
NM_003189chr153364 3329 3197 710 704 ------
NM_003216chr2273308 2669 2524 2464 2224 1290 704 --11307 --
NM_003234chr321869 1588 ------
NM_003348chr1221606 1333 ------
NM_003392chr373943 3281 2963 2951 1602 1387 229 --1158 --
NM_003406chr84493 409 286 146 ----1446
NM_003412chr32453 445 11023 ----
NM_003458chr353319 1551 1535 556 51 ----14032
NM_003468chr264240 4170 3772 3090 2742 380 ------
NM_003472chr61300 ------
NM_003478chr111221 ------
NM_003489chr2122141 578 --13092 1900
NM_003574chr1865641 5377 3535 1409 1116 288 --13999 11553
NM_003580chr81126 ------
NM_003618chr22842 125 ------
NM_003633chr552460 2313 766 470 273 ----12124
NM_003713chr11636 ----11591
NM_003768chr111172 ------
NM_003769chr121266 ------
NM_003794chr31141 ------
NM_003887chr22843 183 ------
NM_004075chr121549 --1141 --
NM_004103chr81853 ------
NM_004114chrX2860 833 ------
NM_004161chr221438 531 ------
NM_004227chr722295 1088 12775 12267 12907
NM_004235chr92833 291 --1666 --
NM_004242chr62412 391 --1281 --
NM_004326chr121134 238 --11223 --
NM_004368chr1941131 708 366 203 ------
NM_004386chr1922274 2251 ----12261
NM_004392chr131547 --1189 --
NM_004437chr111209 ------
NM_004438chr24743 465 390 169 --23045 2258 --
NM_004503chr121628 ------
NM_004538chrX1129 ------
NM_004575chr41560 ------
NM_004586chrX21903 626 --13306 14118
NM_004622chr221773 130 ------
NM_004705chr113806 610 299 ------
NM_004788chr11160 ------
NM_004852chr18913932 12299 11865 10719 10336 10238 5094 4157 2785 211435 8642 19610 --
NM_004857chr142732 64 ----13250
NM_004859chr1782379 2037 2026 1920 911 868 795 701 ------
NM_004992chrX57621 5525 1947 1638 351 --27098 1916 --
NM_005109chr321912 1718 12128 ----
NM_005121chr1713433 --23399 1263 --
NM_005140chrX2944 190 --1815 --
NM_005156chr935157 4693 1120 14312 ----
NM_005188chr11106813 6436 5702 5502 3063 2962 1336 1317 947 121 17043 37093 1902 387 1504
NM_005229chrX1113 ------
NM_005313chr152244 205 ------
NM_005349chr4186 ------
NM_005400chr231059 662 644 ------
NM_005443chr4183 ------
NM_005493chr63705 314 34 ------
NM_005542chr721231 59 ------
NM_005599chr12625 306 --1991 --
NM_005667chr2178 ------
NM_005668chr564506 4334 3787 3760 3058 1317 ------
NM_005765chrX1652 1773 --1195
NM_005779chr543310 2646 882 574 --23411 2731 --
NM_005822chr631857 1704 1465 ------
NM_005841chr42948 49 ------
NM_005859chr511091 --11288 --
NM_005885chr53567 398 51 ----1526
NM_005941chr854223 4200 3303 2788 103 145 ----
NM_005955chr184130 3919 3454 2192 851 652 379 332 ------
NM_005966chr252408 2005 1754 559 149 ------
NM_006037chr264897 3097 783 706 514 317 24586 1045 14289 --
NM_006091chr1511765 ------
NM_006106chr1153456 3224 2664 1147 691 1967 ----
NM_006183chr121116 ------
NM_006251chr533298 2344 554 ------
NM_006313chr122647 339 ------
NM_006364chr142934 80 ------
NM_006380chr1733894 3414 1483 ------
NM_006390chr1221302 635 --1614 --
NM_006393chr1034420 3859 3685 13567 14041 --
NM_006599chr1653065 2860 2216 1643 57 12089 12898 --
NM_006618chr131359 1158 226 ------
NM_006667chrX11104 ------
NM_006698chr201215 ------
NM_006717chr942116 1214 500 30 --13122 --
NM_006729chrX35562 4835 3604 11333 1895 --
NM_006920chr21728 ------
NM_006930chr521577 1328 11492 ----
NM_006947chr411383 ----11784
NM_006959chr192347 335 ------
NM_007008chr22914 886 ------
NM_007010chr174688 570 499 443 --1375 --
NM_007011chr15106843 5914 5524 4318 2527 2387 2318 1684 968 390 --11829 11451
NM_007107chr31547 ----150
NM_007125chrY1504 ------
NM_007129chr132972 803 ------
NM_007170chr11675 ------
NM_007236chr1512487 ------
NM_012083chr1011309 ------
NM_012104chr1143726 3679 958 92 --1746 1400
NM_012164chr945865 5165 2625 2012 ----16842
NM_012215chr1041433 629 489 328 ------
NM_012290chr211282 ------
NM_012296chr1153117 1412 983 784 672 --23936 3889 --
NM_012309chr1164971 4459 3535 3444 1830 455 --1614 --
NM_012417chr171493 ------
NM_012465chr1032354 1016 756 ----11270
NM_013255chr798471 7640 3446 3356 2276 1816 1221 1050 1018 ------
NM_013286chr353166 2703 1046 669 532 --2600 250 --
NM_013450chr231206 1122 857 ------
NM_014011chr211667 ----1267
NM_014112chr823412 1040 --1575 13692
NM_014268chr181427 ------
NM_014393chr812018 ------
NM_014399chr72262 200 ------
NM_014423chr544931 1851 911 567 25449 460 ----
NM_014445chr332298 405 295 --1722 --
NM_014647chr1622242 232 12039 ----
NM_014747chr145687 2277 1628 976 ------
NM_014764chr1211256 --11241 --
NM_014820chr32158 116 ------
NM_014830chr1263912 3599 2921 2706 794 403 ------
NM_014877chr1736241 5532 1755 ------
NM_014912chr1043477 2874 1138 360 ------
NM_014932chr31582 ------
NM_014962chr2022313 229 ------
NM_014974chr1041736 1500 1106 110 1322 11279 --
NM_015026chr1223673 307 ------
NM_015032chr131158 ------
NM_015071chr566486 5940 5267 4700 4199 1394 --11176 --
NM_015074chr164628 3849 3313 1728 339 105 14950 ----
NM_015082chr51117 ------
NM_015092chr1623374 3125 ------
NM_015100chr161982 677 548 336 167 159 ------
NM_015156chr1433898 2979 2613 ------
NM_015192chr2022973 2337 --12520 --
NM_015199chr32482 241 ------
NM_015206chr1513464 ------
NM_015335chr1222632 424 ------
NM_015344chr82631 244 11793 ----
NM_015356chr81208 ------
NM_015464chr71770 ------
NM_015508chr321439 1257 ------
NM_015542chr10147 ------
NM_015601chr10163 ------
NM_015878chr811800 ------
NM_015902chr81332 ------
NM_015906chr154049 3826 3338 3281 1585 ----14600
NM_015995chr1553988 2180 1736 1474 418 --12010 --
NM_016072chr121552 --1322 --
NM_016131chr21611 ------
NM_016217chr653637 3624 2433 1422 309 --1186 --
NM_016257chr133479 2435 361 ----12842
NM_016297chr223649 3613 ------
NM_016422chr113514 74 33 1183 ----
NM_016631chr211366 ------
NM_017541chr3155 ------
NM_017610chr151338 ------
NM_017628chr445295 3836 815 562 14365 ----
NM_017635chr111531 ------
NM_017660chr191913 ------
NM_017709chr184010 3766 3216 3047 1473 1423 1154 761 1946 ----
NM_017758chr1711201 ------
NM_017824chr102551 83 ------
NM_017896chr20--1640 1437 13423
NM_017902chr1054905 3873 3523 1528 817 --15770 14765
NM_018014chr21321 ------
NM_018084chr21479 ------
NM_018120chr8161 ------
NM_018133chr332011 1504 390 ------
NM_018440chr858464 7269 5897 944 60 1824 28149 468 --
NM_018448chr1211263 ------
NM_018490chr1111517 ------
NM_018638chr1245450 5158 1973 203 13802 24812 1852 --
NM_018947chr763463 1956 1757 1311 568 160 13132 11129 --
NM_018963chr2121363 1018 ------
NM_018992chr1621546 1113 ------
NM_018999chr1021592 1087 --1812 --
NM_019024chr21442 ------
NM_019084chr1011032 ----22047 331
NM_019087chr511513 ------
NM_019116chr1653625 3017 2607 2297 136 --1733 --
NM_019558chr22381 58 ------
NM_019593chr2032704 2199 946 --1813 --
NM_020150chr1041962 1626 713 645 --1312 1663
NM_020189chr8126 ------
NM_020309chr191319 ------
NM_020382chr1211561 ------
NM_020390chr314487 --1231 --
NM_020440chr142450 1009 509 343 11245 ----
NM_020673chr2057483 6476 5489 382 352 ------
NM_020718chr1676048 5779 5600 2632 1005 439 432 --25810 722 --
NM_020801chr532640 603 434 ------
NM_020832chr11685 ------
NM_020856chr192636 50 ------
NM_020859chr453800 3417 2750 1275 545 ------
NM_020870chr431697 1400 83 ------
NM_020871chrX22581 738 ------
NM_020899chr1742231 2204 708 459 ------
NM_021020chr833505 3425 2702 ------
NM_021072chr521838 127 ------
NM_021111chr911047 ------
NM_021132chr101281 ------
NM_021627chr331042 785 73 ------
NM_021728chr14125 ------
NM_021813chr655628 4581 4034 251 65 ------
NM_021961chr1156964 5393 1811 1132 1036 1339 ----
NM_022003chr113333 304 290 --1282 --
NM_022114chr164563 3709 3590 3237 926 483 ------
NM_022138chr631353 386 243 ------
NM_022143chr721151 232 ------
NM_022166chr1655837 5216 4403 2044 63 --13862 --
NM_022470chr33934 832 73 ------
NM_022484chr721048 90 ------
NM_022758chr633176 2144 678 ------
NM_022781chr962718 2707 2565 2493 1154 829 ------
NM_024055chr52662 639 ------
NM_024646chr132952 2875 504 --13573 --
NM_024665chr343774 3746 3234 658 11338 ----
NM_024900chr421678 186 ------
NM_024915chr831848 1775 1090 ----1679
NM_025074chr413007 ------
NM_025160chr134258 1664 1279 ------
NM_025191chr13716 450 56 --11025 --
NM_030920chr151949 1644 586 220 127 ------
NM_031476chr1671839 1799 1122 1104 822 144 137 ------
NM_032160chr1831152 862 55 --11309 --
NM_032373chr1045589 4033 919 360 11477 25367 3860 --
NM_032689chr1911219 ------
NM_032961chr421040 478 ------
NM_032968chrX14075 ----11660
NM_032973chrY24067 489 ----11654
NM_033515chr631353 1327 246 ------
NM_044472chr11729 ------
NM_058170chr111177 ------
NM_080867chr1433199 1862 867 11951 13267 --
NM_133329chr211852 ------
NM_133445chr943797 2656 922 864 1675 ----
NM_138554chr912144 ------
NM_138967chr153292 210 73 ------
NM_139072chr22833 558 --1294 --
NM_139244chr61792 ------
NM_139246chr921609 380 ----11583
NM_144571chr446845 4902 2533 2095 1796 ----
NM_144775chr1743401 3254 1757 434 --14901 --
NM_144979chr41533 ------
NM_145185chr1921287 784 ------
NM_145735chr1372781 2383 2337 902 645 459 144 ------
NM_145891chr1631562 247 191 ------
NM_147189chr841599 816 499 300 --11434 --
NM_152376chr12733 63 ----11820
NM_152470chr1873456 2798 1527 474 456 411 127 ------
NM_152641chr1232028 837 229 --1679 --
NM_152737chr631987 1806 300 --1490 --
NM_152756chr52426 52 ------
NM_152787chrX23199 135 --2936 291 --
NM_153261chr161615 ----11100
NM_153685chr1241203 1181 455 83 ------
NM_153810chr1064417 3296 3105 1599 1129 379 15114 14591 --
NM_172071chr147130 6342 5634 2493 --1501 --
NM_173510chr2252632 2372 767 582 218 ------
NM_173511chr273802 3393 3272 2511 1166 1070 784 11375 ----
NM_173515chr62402 206 ------
NM_173642chr178666 7980 7376 6646 3591 2401 168 --16123 --
NM_173645chr21189 ------
NM_173683chr811304 ------
NM_174916chr151779 ------
NM_175884chr731474 496 475 ------
NM_178140chr511951 ------
NM_178313chr211595 ------
NM_178566chr91168 --11530 --
NM_178812chr811069 --11417 --
NM_181704chr2141444 1392 536 240 ------
NM_181836chr522409 153 ------
NM_182503chr645225 3570 1959 1250 --14120 --
NM_182767chr121770 ------
NM_194286chr1231447 1428 249 --14654 --
NM_194291chr842583 802 643 149 11211 11929 --
NM_198334chr112906 763 ------
NM_198581chr227179 1512 ----1163
NM_198965chr121354 ------
NM_199320chr41691 ----1446
NM_201633chr51348 ------
NM_205848chr131721 340 293 ------
NM_206853chr61599 --11529 --
NM_206854chr611860 --1544 --
NM_207371chr101530 ------
NM_207577chr1132871 2737 341 --12548 --