TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-140-5p
miRNA Sequence: CAGUGGUUUUACCCUAUGGUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX32846 2822 2501 --23379 1334 --
NM_000084chrX106194 5123 4419 4386 2724 2083 2012 1394 1360 1058 16261 26709 321 11414
NM_000089chr72316 300 ------
NM_000109chrX42425 1999 874 304 1616 ----
NM_000125chr683567 3514 3313 2902 1543 1346 411 65 23415 2628 ----
NM_000138chr1542549 2188 2016 343 --32591 1827 187 11051
NM_000165chr621627 680 ------
NM_000167chrX31664 1616 327 --21743 119 --
NM_000168chr753281 2841 2271 849 239 12214 23313 2771 --
NM_000189chr2----2772 233 --
NM_000208chr1964387 4356 3547 3503 1802 1767 ------
NM_000210chr221645 948 --1860 --
NM_000214chr2071802 1672 1395 1280 1259 1163 448 --21184 620 --
NM_000217chr1264528 4235 2010 1806 1793 384 --15126 --
NM_000222chr46842 819 576 379 360 171 --11649 --
NM_000242chr1052383 2003 1958 1705 517 1138 --1125
NM_000248chr342575 2338 2295 194 ------
NM_000267chr1763017 1401 681 569 531 334 12432 11198 --
NM_000280chr114975 938 370 148 --1956 --
NM_000288chr6----1367 --
NM_000291chrX2747 349 --1232 --
NM_000305chr7--2430 366 1384 --
NM_000314chr1042745 2635 2055 817 ------
NM_000321chr1341153 672 653 341 --21397 170 --
NM_000330chrX52026 901 850 813 753 22165 1929 --11923
NM_000333chr331136 415 223 --1331 1849
NM_000337chr5116075 5658 4894 2541 2477 2347 2037 1585 349 340 240 26386 4834 46205 5531 4991 1223 26339 1138
NM_000345chr41288 ----1844
NM_000346chr1721460 477 --1544 --
NM_000352chr11----177 --
NM_000362chr2252784 2737 2296 606 537 --2463 330 --
NM_000368chr984574 4503 4447 3526 3406 771 682 364 --34479 4298 1694 --
NM_000399chr10----1934 11150
NM_000430chr1753108 2942 2670 517 446 --11329 22955 867
NM_000462chr153440 430 140 --2404 332 --
NM_000484chr21----143 --
NM_000489chrX73262 2989 2572 2132 605 325 166 --31382 1073 981 --
NM_000523chr2----11164 --
NM_000527chr1942195 1656 1542 641 --22440 1843 --
NM_000533chrX3626 485 46 ------
NM_000599chr254251 4115 3603 3553 86 ----13847
NM_000601chr71366 --1109 --
NM_000617chr1221530 382 --22283 1610 --
NM_000618chr1255968 5575 4689 1231 305 15443 14271 12522
NM_000631chr22----1178 --
NM_000719chr1266426 5796 5325 4946 4162 2518 --42601 1337 965 374 --
NM_000793chr1474275 3751 1986 982 785 195 165 --24866 1625 --
NM_000801chr2021076 795 ------
NM_000809chr4139197 8826 7235 6586 6255 5829 3470 3047 1849 1611 1383 1131 829 27068 2813 25801 953 --
NM_000813chr575156 3937 1449 1280 1145 944 152 1891 13643 --
NM_000814chr1543615 3555 2573 939 --41236 1113 843 627 --
NM_000827chr542049 1666 119 100 12075 42632 1985 165 111 --
NM_000828chrX42135 342 208 41 ------
NM_000829chr1141817 1417 684 639 ----22236 478
NM_000875chr1585499 5427 5316 4774 4503 4314 1801 569 --35208 2488 437 --
NM_000901chr442111 1715 1017 572 1989 11769 --
NM_000919chr5------1482
NM_000933chr20----1242 --
NM_000950chrX62952 2900 1364 683 356 120 172 ----
NM_000965chr32438 411 ----11078
NM_000977chr16------1377
NM_000990chr1143725 3261 1183 242 12972 33170 713 37 --
NM_001001323chr1241240 1171 1068 282 --23141 2781 --
NM_001001481chr823328 120 ------
NM_001001556chr151363 --130 --
NM_001001787chr11131 ------
NM_001001890chr2154235 3074 3025 1557 1284 --1737 --
NM_001001974chr1031868 1757 1470 --1527 --
NM_001001998chr1------182
NM_001002295chr1031176 1108 143 --1183 --
NM_001002838chrX31467 735 306 --1581 --
NM_001002860chr1453578 2959 2904 1074 885 14611 31743 1584 1468 --
NM_001003407chr10105103 4222 3979 3860 1926 1812 1513 1391 1331 101 11675 54692 4282 3805 3774 1583 --
NM_001003681chr2262140 804 630 403 396 41 --1173 --
NM_001003682chr13575 461 128 --21057 941 --
NM_001003698chr621752 1319 11303 1230 --
NM_001003712chr12123948 3835 3733 3581 3034 2726 2680 2542 1391 1152 498 90 --11581 --
NM_001004065chr963078 2742 2630 2582 1282 370 --23910 3368 --
NM_001004317chr664107 3175 2930 1695 967 448 --24121 147 1110
NM_001004360chr2----11585 11917
NM_001005353chr12975 388 --11309 --
NM_001005732chr211255 ------
NM_001006600chr512159 --32145 440 169 --
NM_001006610chr161883 --1205 --
NM_001006658chr11133 --1580 --
NM_001007097chr954590 4374 4222 1632 577 --34896 4708 4323 11692
NM_001007156chr154351 212 180 124 1254 1603 --
NM_001007237chr132780 2673 2635 --1613 --
NM_001007250chr12311 212 --156 --
NM_001007553chr11803 124 1187 --
NM_001008220chr553947 3444 2732 330 39 --12718 --
NM_001008239chr1843379 3328 2796 1440 2640 401 13435 --
NM_001008388chr42116 71 --1224 1837
NM_001008405chr731665 1307 479 --1417 1100
NM_001008408chr7135918 5743 5665 5537 5247 4325 2440 2374 2174 1614 905 862 147 --11924 12555
NM_001008491chr231327 734 486 --1351 2710 265
NM_001008539chr855365 4649 3781 1044 997 1700 24689 392 --
NM_001008564chr132746 249 --22162 701 1274
NM_001008925chr443563 3422 2682 452 11344 32818 2509 386 --
NM_001009569chr1011165 21110 1096 21078 434 --
NM_001010000chr1843047 2802 1071 858 --32891 2169 279 --
NM_001010867chr146696 5421 5274 864 --24560 2215 1574
NM_001010888chrX64642 4570 3931 2964 1812 889 --1697 --
NM_001010891chr596411 6375 6216 6145 6054 2469 1953 1214 861 --46735 5367 2785 1187 --
NM_001010922chr154118 1073 767 229 34 11212 13086 --
NM_001010935chr11773 ----1396
NM_001010942chr1231285 1125 428 1381 21161 173 --
NM_001010986chrX72087 1775 1744 970 793 347 26 1142 32190 707 74 --
NM_001011663chr102862 93 11016 ----
NM_001011666chr7116578 6353 6020 5509 5149 1705 1481 1465 1402 870 347 --31608 1204 762 14156
NM_001012423chr1572481 2214 2147 2088 1160 936 443 --21839 108 --
NM_001012614chr4----1752 --
NM_001012761chr522156 693 12243 --12033
NM_001012977chrX21334 1220 --1444 --
NM_001013031chr1032957 2649 947 12531 23197 2705 --
NM_001013399chr62749 30 --146 --
NM_001013415chr441366 585 381 189 --1566 --
NM_001014434chr11577 --2803 159 --
NM_001014797chr1077854 7300 7098 6525 2226 2193 1003 27089 6002 55397 2737 1960 1366 216 23088 1975
NM_001015045chr42384 130 --12372 1313
NM_001015055chr2------1344
NM_001015877chrX2773 405 21987 938 --154
NM_001017371chr231324 967 868 --1942 --
NM_001017405chr42941 845 --1222 --
NM_001017926chr831451 1132 667 1326 1174 --
NM_001017999chr132224 1462 609 --12127 1488
NM_001018025chrX173 --161 --
NM_001018050chr2283331 2800 2670 2474 2381 2242 522 368 --31110 722 294 --
NM_001018056chr91616 --1567 1378
NM_001018057chr1121190 1111 --21349 1081 --
NM_001018067chr145178 1307 1010 119 --24161 806 --
NM_001024372chr832266 2185 87 141 11683 --
NM_001024463chr151420 --1799 --
NM_001024808chr1231746 854 532 ----1107
NM_001024924chr4------1382
NM_001024934chr6------1239
NM_001024937chr171477 ------
NM_001024947chr5------11026
NM_001024948chr163189 2942 2732 2276 1072 769 12211 ----
NM_001025068chr31361 --11742 --
NM_001025076chr10156220 5687 5638 5596 5403 5198 4250 4142 4121 2428 2114 1655 1646 1566 458 --55946 4400 3938 1344 606 --
NM_001025077chr10187578 7045 6996 6954 6761 6556 5608 5500 5479 4693 3013 3004 2924 1816 823 540 237 95 --67304 5758 5296 2702 1964 403 --
NM_001025079chr374028 3871 3044 2789 2596 1431 498 --23684 365 --
NM_001025105chr52955 404 --1115 --
NM_001025356chr1232812 1957 287 --190 22526 65
NM_001025580chrX63855 3844 1608 796 744 97 ------
NM_001029863chr633071 2808 1968 33042 2585 1145 ----
NM_001030006chr1742247 1725 484 28 --1197 --
NM_001031804chr1644391 3161 1730 27 ------
NM_001032288chr2051599 1445 556 484 340 11350 1231 --
NM_001032296chr1382681 2414 2369 1922 883 264 119 110 --1485 --
NM_001033057chr31702 21352 569 21442 1364 --
NM_001033087chr201686 --32797 2766 512 --
NM_001033117chr374734 4317 4150 3030 1627 1490 249 33417 3185 630 ----
NM_001033569chr17----138 --
NM_001033578chr862224 2057 1892 1809 1504 835 --2479 24 --
NM_001033659chr1741281 381 284 77 --21556 515 --
NM_001033723chr892747 2669 2661 2445 2028 966 670 602 58 --11085 --
NM_001034841chr16115415 4687 4301 4153 4000 3992 3523 2044 867 586 218 14168 44999 4240 3766 1153 --
NM_001035003chr431204 199 73 ----11076
NM_001035254chr942481 2354 497 213 ----1238
NM_001035chr131171 1046 349 --31319 839 253 --
NM_001037164chr731601 1386 231 --11613 --
NM_001037172chr32549 133 --21152 520 --
NM_001037174chr241497 727 553 138 ------
NM_001037872chr22525 469 ------
NM_001039111chr3------1446
NM_001039538chr253230 2636 2434 1164 97 --13250 12398
NM_001039580chr434765 3447 1603 2785 229 24115 69 11548
NM_001039590chrX63403 3101 3040 490 459 321 --21221 623 --
NM_001039618chr1175930 5177 4311 1694 1301 1170 964 1858 15465 14452
NM_001039690chr1641951 1595 1579 93 --22322 2103 --
NM_001039792chr9------1497
NM_001039888chr11672 --2786 534 --
NM_001039937chr13103464 2522 1357 1223 1213 1128 634 552 204 22 1868 ----
NM_001040001chr621545 473 --21447 766 --
NM_001040020chr721462 208 --1201 --
NM_001040107chr12----2601 580 --
NM_001040142chr242178 729 594 418 1862 12400 --
NM_001040152chr7105029 4471 3555 2054 2043 1907 1300 1040 495 441 11019 23328 1636 --
NM_001040152chr7105029 4471 3555 2054 2043 1907 1300 1040 495 441 11019 23328 1636 --
NM_001040214chr622075 1483 12121 21576 615 --
NM_001040284chr16115921 5774 5689 5352 5187 5112 4678 2161 1970 1744 489 25398 1675 11129 --
NM_001040441chr1105421 5067 4693 4514 4115 4090 4000 3789 1017 413 ----14419
NM_001040458chr52381 39 --21653 1563 --
NM_001040613chr831381 1314 1045 --21613 346 11165
NM_001040613chr831381 1314 1045 --21613 346 11165
NM_001040708chr81815 ----1424
NM_001040712chr942749 1168 304 291 --22722 114 --
NM_001040875chr83683 607 489 11917 1408 1788
NM_001042383chr343447 2268 1152 437 12545 22176 224 13054
NM_001042403chr12167 11005 1179 --
NM_001042404chr11477 --2430 194 --
NM_001042406chr61825 --21262 450 --
NM_001042473chr103507 357 31 11755 22001 1499 --
NM_001042475chr6----1258 --
NM_001042494chr1553435 1306 1067 243 81 11171 63751 3174 3055 3029 2800 1418 --
NM_001042537chrX11826 --12408 --
NM_001042543chr431561 265 114 --31538 1008 338 --
NM_001042550chr9----1137 --
NM_001042555chr1233900 758 202 --14084 --
NM_001042599chr2117187 6781 6565 6521 6032 5698 2901 2276 1614 910 205 36829 2313 789 36283 2720 983 --
NM_001042601chr332084 648 370 12772 22107 1058 --
NM_001042603chr1274498 1673 1171 1020 865 454 42 24053 3933 13610 25209 4742
NM_001042604chr333732 1258 311 ------
NM_001042646chr362038 1827 1810 1429 494 258 --11853 11949
NM_001042681chr132325 2131 1645 --12376 1580
NM_001043351chr141863 1680 822 763 11923 1320 --
NM_001046chr531018 773 476 --11951 --
NM_001049chr1482461 2349 1967 1909 856 676 533 432 --21835 1728 12177
NM_001071775chr1341514 1373 485 140 --11946 --
NM_001079874chr1----11610 --
NM_001081472chr1----1383 --
NM_001121chr1021924 1266 --11577 --
NM_001146chr811894 ----1291
NM_001148chr42614 200 --3856 760 599 --
NM_001149chr1031384 374 170 --21232 218 --
NM_001167chrX136458 6404 5753 5053 4459 4414 4321 2256 2138 1808 963 407 228 --45889 4885 2636 956 --
NM_001174chrX32023 1894 238 --21661 1458 --
NM_001186chr2132279 147 26 ----13140
NM_001198chr651881 1826 1746 1677 758 11530 32158 1559 945 --
NM_001204chr2166200 6140 5808 5697 5525 5517 5124 4809 4767 2993 2235 1896 1772 1703 740 253 17603 17573 17626
NM_001206chr932949 2817 549 22545 1083 1537 --
NM_001219chr721498 131 --1873 --
NM_001231chr1----1452 --
NM_001233chr751962 1514 238 128 72 ------
NM_001237chr421052 1036 --140 --
NM_001241chr222083 206 1691 21642 755 --
NM_001256chr1742660 2642 2614 132 ----1329
NM_001271chr1553168 1992 1146 987 193 --12723 --
NM_001278chr101129 --21052 83 --
NM_001304chr1733505 3425 2926 --1236 --
NM_001321chr12----181 --
NM_001349chr22177 82 --1556 --
NM_001364chr1121172 69 --11628 --
NM_001386chr841553 911 750 265 --12356 --
NM_001390chr18103428 3412 3286 2754 2549 2337 2213 1039 937 153 --1566 12244
NM_001396chr2122102 872 --1887 1115
NM_001401chr921575 481 --11178 --
NM_001412chrX53182 2925 2408 294 271 12307 13748 --
NM_001424chr16----157 --
NM_001431chr621077 310 187 1226 --
NM_001438chr153443 3021 2717 1071 635 ------
NM_001453chr62706 215 --11467 --
NM_001460chr152746 2739 2708 2204 676 12402 180 22902 687
NM_001497chr922712 997 --41781 527 518 466 --
NM_001543chr54875 859 343 188 --23694 1915 --
NM_001560chrX81022 917 754 637 574 476 134 107 --199 --
NM_001616chr233392 3035 1080 11157 1370 --
NM_001627chr342245 1917 1517 643 --11563 1861
NM_001649chrX62445 1734 1568 653 611 227 ------
NM_001650chr1873923 3906 2600 1476 1201 885 773 24128 1603 ----
NM_001663chr142422 89 --22512 852 --
NM_001664chr32956 394 --1332 11040
NM_001668chr1----143 12245
NM_001678chr17------11394
NM_001690chr34903 538 344 261 --1577 --
NM_001706chr31251 --1986 --
NM_001742chr761573 1388 1146 512 503 30 11310 1363 --
NM_001753chr72257 135 --11685 --
NM_001755chr1612265 --12130 --
NM_001759chr1243821 2016 1218 557 --2956 525 --
NM_001858chr6113833 3705 1967 1391 1195 1137 968 857 698 495 46 13922 1649 14389
NM_001859chr963390 3040 2648 1302 1208 246 --21066 706 11552
NM_001895chr201375 ----11094
NM_001918chr1169093 8672 8246 7440 7342 7232 7185 6880 6297 6275 6209 2748 2392 1862 1697 1541 36558 2184 2033 49157 3702 2595 1041 18082
NM_001946chr12--1726 ----
NM_001949chr663216 2486 1198 859 683 123 --22072 721 13071
NM_001977chr441622 1427 500 365 ------
NM_002006chr463779 2153 2108 1511 1013 346 25679 4174 34782 822 151 --
NM_002024chrX41991 1896 303 36 12003 1228 --
NM_002025chrX118876 8714 8209 6497 3610 3597 3188 2912 2449 2174 38 43650 3351 2881 1020 23287 1358 17355
NM_002063chrX3473 213 79 ----11000
NM_002074chr1141 --11136 --
NM_002077chr922167 547 1769 2732 91 --
NM_002095chr8----1389 --
NM_002128chr1342052 1995 543 378 11906 --1207
NM_002156chr21133 1313 1295 1126
NM_002158chr243137 2449 2391 1197 --23691 2720 1773
NM_002182chr342452 2171 2044 513 1225 22793 2634 --
NM_002198chr5------1794
NM_002232chr121191 93 --11032 --
NM_002245chr11708 ----1522
NM_002251chr2021945 92 --11817 12538
NM_002264chr384896 4840 4459 4429 3698 1154 849 606 13822 21916 422 --
NM_002265chr172991 229 --11225 --
NM_002267chr1332276 737 242 --21638 606 --
NM_002268chr31179 11688 11443 --
NM_002270chr531844 532 356 24893 1247 35682 5253 1962 --
NM_002310chr532247 2172 1568 46145 3997 2289 916 ----
NM_002334chr1131471 783 173 ----12059
NM_002336chr1264475 4064 1398 1053 424 339 ----11018
NM_002359chr1743336 3030 845 529 140 23481 2812 --
NM_002382chr14----188 --
NM_002399chr1511111 --1571 --
NM_002444chrX1384 11452 --195
NM_002449chr5------1954
NM_002480chr1241377 1263 1067 224 --11425 --
NM_002499chr1542004 1736 702 607 --12267 --
NM_002500chr261218 503 411 318 91 21 --11135 --
NM_002515chr1421343 749 --1364 --
NM_002519chr111493 --11310 1471
NM_002556chr1131706 700 141 1804 1810 12155
NM_002577chr333211 2832 2622 1886 12772 1230
NM_002581chr9115645 4811 3973 2163 2076 1921 1907 1541 1178 829 290 12187 24148 3496 --
NM_002583chr12----141 --
NM_002595chr1211314 11516 1332 --
NM_002628chr331045 837 258 --1156 --
NM_002634chr17----2145 95 --
NM_002641chrX51635 738 643 407 255 2751 365 1230 --
NM_002645chr1152554 2072 1952 392 315 12437 22080 598 1514
NM_002655chr885125 3452 3304 3224 1757 1295 1283 60 --25052 176 --
NM_002657chr2053641 2558 1323 606 272 --33688 1357 716 --
NM_002717chr82694 176 --1648 --
NM_002718chr332593 2240 1984 --1610 1578
NM_002731chr143110 2358 2004 224 1185 ----
NM_002738chr163907 714 346 ------
NM_002740chr332767 2094 652 1189 186 12407
NM_002747chr1881777 1692 1486 1477 577 350 250 228 ----11897
NM_002750chr10----1195 --
NM_002755chr15----1851 --
NM_002760chrY65976 5468 4846 4255 4095 503 --45939 4707 4219 3832 14828
NM_002825chr7----1438 --
NM_002827chr2011237 --11827 --
NM_002834chr1243275 1638 925 173 23465 1320 24110 163 --
NM_002842chr19----1495 --
NM_002849chr1211011 --1815 --
NM_002858chr121327 922 --31266 316 284 --
NM_002874chr921809 1629 --1796 --
NM_002886chr3134413 4299 4242 4114 3825 3487 3203 2083 1822 1665 1636 503 97 --11127 --
NM_002890chr52918 260 --1779 --
NM_002906chr113743 668 42 12330 12203 --
NM_002918chr192875 773 ----1987
NM_002938chr411372 --1487 12026
NM_002941chr331447 556 44 ----1237
NM_002968chr162880 122 ------
NM_002970chrX----1343 --
NM_002994chr411868 --1307 --
NM_002998chr842024 1962 795 35 11735 ----
NM_003012chr83769 362 170 --33194 288 263 1310
NM_003016chr17----11996 --
NM_003043chr364302 3668 3640 2950 1673 368 --1804 --
NM_003051chr151747 1456 1393 788 771 --1332 --
NM_003071chr322024 482 --11933 --
NM_003075chr12175 1108 2328 299 --
NM_003100chr5181 ----196
NM_003108chr246731 6513 5603 600 --26817 2478 16091
NM_003112chr742619 2579 1024 840 1599 ----
NM_003113chr2----1661 2198 151
NM_003128chr252590 1774 559 506 396 --1543 --
NM_003133chr12723 700 --1380 --
NM_003139chr111810 --1202 --
NM_003144chr621811 278 --11464 21707 212
NM_003150chr1742280 2000 1762 829 ----199
NM_003161chr1732655 2245 677 --32736 2260 325 --
NM_003189chr182971 2726 2468 2455 1371 1290 840 432 --43285 2959 2261 1325 --
NM_003202chr5--11226 21754 1590 --
NM_003205chr1521786 359 --1498 11546
NM_003221chr643239 976 499 296 --13534 --
NM_003247chr611961 --1423 --
NM_003257chr1531032 968 164 11349 164 --
NM_003274chr2142658 1925 613 26 --12962 --
NM_003286chr20----1780 --
NM_003298chr335287 1332 742 16223 16027 15053
NM_003304chr3----1632 --
NM_003318chr6199 ------
NM_003320chr1174113 3997 3966 3932 3764 1109 1050 34095 4074 1592 21379 948 --
NM_003338chr10--11833 21591 109 --
NM_003340chr4----1327 --
NM_003369chr1152727 2187 2030 1985 237 --12591 12417
NM_003374chr52730 678 ------
NM_003389chr9271 39 ----195
NM_003390chr111399 --2255 61 --
NM_003405chr22------176
NM_003406chr831323 481 53 --21514 1387 --
NM_003413chrX21407 238 --1781 --
NM_003452chr9------1987
NM_003466chr282447 2352 1930 1810 486 242 157 108 --12393 --
NM_003471chr322107 159 --32095 1516 90 --
NM_003473chr103448 369 44 --1212 --
NM_003474chr1062131 910 875 646 392 257 ------
NM_003478chr1132343 1064 158 13227 12198 --
NM_003483chr1292891 2711 2269 2185 1106 534 191 162 73 12523 1373 --
NM_003489chr2163274 2378 1100 962 947 891 --43189 3160 726 197 --
NM_003498chr1692769 2569 2458 2401 1880 1037 621 303 66 ----12621
NM_003567chr11306 ------
NM_003583chr1283785 2999 2958 2720 2609 1031 916 286 11387 23279 3151 --
NM_003590chr22555 127 ----11311
NM_003592chr7----1392 --
NM_003601chr4------125
NM_003615chr363732 2959 2549 1524 1452 692 11480 ----
NM_003629chr143356 2822 1184 791 --13165 --
NM_003631chr10----1943 --
NM_003651chr122186 59 ------
NM_003692chr92329 283 --1690 --
NM_003714chr552964 2443 2169 2133 1139 180 1700 --
NM_003716chr33846 228 96 --1695 1269
NM_003758chr152366 345 --1382 --
NM_003787chr18----1585 --
NM_003800chr6----12436 --
NM_003825chr152994 458 --11547 --
NM_003831chr1821333 1193 --21789 1350 11444
NM_003850chr131164 ----1474
NM_003867chr8----1550 --
NM_003873chr1052495 698 677 435 110 12537 ----
NM_003884chr321498 1207 1229 --1695
NM_003895chr21--1127 11861 --
NM_003901chr1042248 2233 1990 778 --42397 2324 1674 263 --
NM_003939chr1033909 3469 3166 12546 21106 105 --
NM_003941chr732410 961 53 1517 --21782 568
NM_003968chr31665 --1126 --
NM_004035chr1775171 4588 4213 3784 3777 906 643 11954 3349 310 215 --
NM_004064chr122485 47 --11055 --
NM_004080chr721304 1252 --180 --
NM_004117chr652120 2036 2018 590 202 --11456 --
NM_004136chr1553087 1995 730 373 280 23130 2658 23117 2608 --
NM_004172chr5----21926 1785 149
NM_004236chr15----183 --
NM_004263chr261495 1295 1228 1183 53 37 11704 11658 --
NM_004272chr53626 221 116 --11522 --
NM_004282chr63616 601 455 --196 --
NM_004296chr1493650 3380 3252 2824 2794 2772 1208 574 337 13119 --23600 477
NM_004302chr1242629 2355 2000 43 12336 22845 2096 12517
NM_004370chr631888 717 639 --22211 442 1316
NM_004392chr1332620 2387 1840 --21029 341 --
NM_004393chr342119 1931 322 89 --22318 1561 --
NM_004411chr7--1743 1272 --
NM_004428chr14830 807 260 79 --1107 --
NM_004430chr832695 1876 80 --11026 --
NM_004432chr942205 1547 899 123 ----11643
NM_004438chr233013 2664 1247 --22338 375 --
NM_004440chr621406 1286 --11814 --
NM_004458chrX21737 432 22030 1720 1477 --
NM_004480chr14----160 --
NM_004484chrX2242 143 --168 --
NM_004499chr5----1146 --
NM_004504chr232972 2401 2356 12112 32819 439 384 1773
NM_004525chr231422 1295 401 1534 21236 1013 1972
NM_004569chr14185 ----1113
NM_004586chrX85104 4367 4132 4066 3609 1723 1278 1229 15293 24143 3374 --
NM_004598chr543038 3007 2428 2064 --52673 2207 2106 1236 933 --
NM_004612chr933758 1619 654 ----33314 853 433
NM_004620chr113520 89 29 ----1424
NM_004654chrY21204 1048 ------
NM_004660chrY2335 51 ------
NM_004663chr1531069 375 310 ------
NM_004687chr17197 ----11364
NM_004694chr172701 112 --126 1832
NM_004705chr112295 71 ----181
NM_004709chrX2590 102 --21293 1273 --
NM_004730chr522199 233 --1523 --
NM_004734chr1342495 2010 1076 60 --23295 1228 --
NM_004741chr10146 --2964 322 --
NM_004742chr321220 1138 21203 508 ----
NM_004744chr483055 2560 1350 1296 720 649 289 138 11464 1739 --
NM_004745chr8146063 5400 5350 5158 5100 4480 2781 2421 2128 1704 1513 874 615 416 25258 2450 56195 5987 5675 2740 1324 --
NM_004756chr1941265 1093 967 133 --21333 224 1147
NM_004774chr172182 69 --11154 11009
NM_004776chr2043130 3103 701 471 13170 1597 --
NM_004786chr182191 25 1140 ----
NM_004788chr111898 32017 1961 251 --1323
NM_004791chr133569 108 72 187 --1682
NM_004815chr1104618 4529 3869 3397 3330 3280 3269 1960 1883 493 --31907 1341 882 --
NM_004827chr471927 1501 1452 655 495 231 154 --11414 --
NM_004831chr191733 --21110 921 --
NM_004834chr21941 22950 1197 --11025
NM_004852chr182013944 12733 12008 11756 11070 10122 9471 5662 5634 5126 5107 4214 3253 2781 2446 2322 1761 1455 1062 547 112980 211325 4147 313155 8787 4858
NM_004856chr151116 --1527 --
NM_004857chr1453720 1762 1581 874 174 21783 1466 1942 --
NM_004863chr1474898 1756 1353 804 318 288 80 13719 34155 501 272 13238
NM_004872chr1------1102
NM_004884chr15----11293 --
NM_004898chr422454 392 --12643 --
NM_004921chr131030 522 330 ------
NM_004929chr82409 189 ----11536
NM_004947chr342567 2478 711 125 --32381 335 53 --
NM_004956chr7103537 3449 3093 1817 1570 1183 1161 648 613 534 --23887 1222 --
NM_004973chr631288 594 393 1645 ----
NM_004975chr202657 287 2783 279 ----
NM_004985chr1264511 4417 3583 3100 1569 1500 --22822 756 13072
NM_004999chr634364 1357 130 --44024 3683 423 78 --
NM_005028chr1031980 1974 1836 11913 12131 --
NM_005044chrX73453 3368 2774 1329 1033 987 341 --34496 3349 3226 --
NM_005063chr1033376 2957 2555 --23368 72 --
NM_005065chr14115330 5137 4999 4797 3483 2152 1944 1894 1846 1189 363 11025 11166 13818
NM_005077chr9----1134 --
NM_005080chr222961 608 --2318 213 --
NM_005096chrX4998 851 188 178 --11147 --
NM_005109chr341891 1812 425 81 1189 ----
NM_005116chr20104130 3953 3782 3199 2882 2786 1193 1172 777 351 --31819 1090 138 --
NM_005121chr1722920 700 --21324 981 22901 2435
NM_005126chr351822 719 485 338 257 --1300 --
NM_005156chr944803 3556 2082 1837 1997 31893 850 425 --
NM_005160chr2295991 5525 5117 4986 4550 2674 2328 1612 436 --24999 189 36174 1542 1309
NM_005180chr10--11078 1278 --
NM_005227chr11445 --1541 --
NM_005238chr1133131 2592 507 --12429 --
NM_005259chr21179 --11086 --
NM_005261chr82984 698 --1916 --
NM_005271chr103211 121 78 --21203 927 --
NM_005277chr461403 444 421 131 65 27 11532 1317 --
NM_005302chr7----1128 --
NM_005313chr1551341 1243 905 471 375 --2998 59 --
NM_005339chr494239 4179 3747 3697 2788 1714 490 262 131 --33398 3356 1266 11555
NM_005342chrX22689 2450 22481 2066 12846 --
NM_005375chr6--1398 ----
NM_005381chr2----1274 --
NM_005402chr741350 1279 1258 432 21815 121 --21715 450
NM_005433chr181601 --42786 2045 790 149 --
NM_005436chr1042943 2698 1465 1415 1934 ----
NM_005455chr111650 131 2354 335 --
NM_005455chr111650 131 2354 335 --
NM_005458chr951981 836 434 128 44 --11679 --
NM_005460chr53560 377 162 --2368 85 --
NM_005465chr141970 1727 1499 309 1536 11949 --
NM_005502chr922690 1134 --12867 --
NM_005521chr10----1818 --
NM_005537chr131222 --1125 --
NM_005563chr1----1699 --
NM_005578chr3104617 4520 4242 3868 1927 1892 1121 607 501 84 14200 11227 --
NM_005595chr1------1614
NM_005596chr975791 5012 4339 3957 2577 2519 1601 25308 1557 --2494 266
NM_005599chr121417 446 --21306 282 --
NM_005604chr652210 914 672 514 386 22224 1644 12084 --
NM_005607chr83779 363 164 --1847 --
NM_005611chr1621048 211 ----11111
NM_005626chr12426 26 --1354 --
NM_005665chr163462 3331 1022 866 202 191 14049 34108 781 316 11292
NM_005677chr351116 488 419 255 178 ------
NM_005717chr141142 910 528 77 --21205 233 --
NM_005725chr121577 568 12105 1832 --
NM_005737chr242621 2402 1172 518 ----12531
NM_005744chr15----1188 --
NM_005748chr1243098 2407 2161 1218 --11264 --
NM_005779chr563469 3315 2410 2296 1284 106 22521 1230 33487 3181 2440 12288
NM_005797chr1141532 660 649 295 --1715 --
NM_005822chr642013 1522 704 381 ------
NM_005824chr71201 1217 ----
NM_005869chr5182 --1273 --
NM_005880chr1621252 174 --11599 --
NM_005902chr1533459 3202 524 --14040 --
NM_005904chr1811142 --153 --
NM_005910chr17113805 3765 3500 3474 2703 1134 1067 975 605 473 394 --21190 132 --
NM_005920chr153685 3220 2456 426 245 22777 2739 13118 --
NM_005922chr6------142
NM_005923chr62607 175 ------
NM_005925chr18------1142
NM_005935chr474440 3780 3506 1610 742 528 393 14771 24897 4230 11943
NM_005941chr843257 1551 1532 586 13514 ----
NM_005955chr184772 4637 4078 3960 2207 2126 1799 745 13997 24121 3852 --
NM_005968chr19----164 --
NM_005986chr1332867 2548 498 12135 11957 --
NM_006022chr131802 ----1698
NM_006037chr2124670 3913 3541 3434 3369 3209 3062 1604 1410 1400 532 138 --44323 4017 1457 460 --
NM_006047chr2043501 2332 1246 272 1241 42502 2209 848 252 --
NM_006063chr2----1195 --
NM_006077chr102818 308 --1833 --
NM_006134chr2141461 620 565 493 --21077 311 --
NM_006136chr711254 --31350 886 115 1164
NM_006154chr1572085 1813 1014 785 770 485 96 --2371 172 183
NM_006164chr2------1354
NM_006201chrX3217 160 72 1334 ----
NM_006206chr432702 2205 426 1667 31990 507 65 --
NM_006216chr23638 38 21 --1257 --
NM_006246chr142898 861 1332 11170 --
NM_006256chr172504 2000 1105 1032 1024 917 152 --2373 314 12040
NM_006267chr261426 1357 1298 487 385 369 --11804 --
NM_006277chr21541 ------
NM_006281chr8------21046 50
NM_006282chr2094774 4002 3645 3434 3317 1813 1249 1183 621 13169 11890 --
NM_006283chr865001 4827 4580 4543 685 56 13958 11181 --
NM_006306chrX105952 5555 5538 5429 5362 5313 3792 2167 2060 854 23973 1845 25862 1514 --
NM_006311chr171303 --1320 --
NM_006315chr484174 4115 3741 3344 3118 1460 1436 1228 --1561 --
NM_006320chr411148 ----1789
NM_006328chr11--1542 2421 79 --
NM_006352chr11597 --11604 --
NM_006361chr172274 131 31885 1276 736 1352 --
NM_006375chrX41865 306 202 172 --1729 --
NM_006378chr941361 1180 1145 1099 ----1370
NM_006380chr1754332 3333 3266 2844 70 13919 23929 554 --
NM_006389chr1121072 49 ----1272
NM_006416chr6----140 --
NM_006420chr2042608 2437 2415 2384 --23338 2246 --
NM_006421chr81811 --1892 --
NM_006467chr532404 1904 479 --31836 1597 145 --
NM_006475chr13----1607 --
NM_006496chr12345 240 1635 ----
NM_006504chr1082527 2455 1183 1174 1085 973 786 751 --22915 2185 --
NM_006534chr2033419 3369 2857 --134 --
NM_006538chr294127 3890 3423 3334 2996 1396 1322 736 254 34028 3955 3435 12757 --
NM_006544chr1465602 5447 5091 749 419 269 24458 189 34924 4874 1136 --
NM_006546chr17126641 6319 6206 5760 4926 4889 4756 4272 1635 1590 1087 860 --56649 6128 6093 4437 595 --
NM_006557chr961484 1285 1210 696 632 203 --11435 --
NM_006558chr8----1137 --
NM_006572chr17--12412 --13309
NM_006574chr3----195 --
NM_006577chr2193 --11307 11170
NM_006595chr1131800 242 114 11462 1807 --
NM_006599chr16137983 7517 7275 7105 6786 6588 5445 2637 1148 944 912 326 181 --28039 6364 15411
NM_006609chr252729 1832 828 795 348 ----22759 2559
NM_006624chr102795 381 --11505 12032
NM_006628chr1574385 4181 3816 3405 3042 1368 431 14498 1224 --
NM_006633chr51601 --192 --
NM_006644chr132261 252 --1458 --
NM_006699chr162296 1872 733 447 279 22 153 32004 1737 603 1981
NM_006727chr5----1203 --
NM_006749chr811296 --1202 --
NM_006750chr16107143 6803 6530 6305 5615 2898 2494 628 601 138 --32466 913 721 17656
NM_006772chr64571 159 151 66 ------
NM_006777chrX62907 2560 1800 1143 882 666 --12509 12664
NM_006815chr1231222 1158 904 ----1872
NM_006826chr211080 1913 11021 --
NM_006832chr141266 --1769 --
NM_006876chr11155 1165 ----
NM_006885chr1644123 3529 3127 845 ------
NM_006887chr21697 --1723 --
NM_006888chr1433451 794 744 1886 22590 1258 --
NM_006902chr172287 2025 1300 1218 499 376 201 1881 ----
NM_006908chr721202 331 --1157 11404
NM_006915chrX2769 641 22030 1861 ----
NM_006920chr221947 527 --21973 1514 --
NM_006948chr2122483 300 --12359 --
NM_006981chr932851 2743 2235 ----12213
NM_006999chr541959 830 771 129 --11280 11844
NM_007007chr1221612 387 --11574 21344 899
NM_007027chr31429 --1169 --
NM_007030chr5175029 4953 4781 4649 4507 4274 4234 4136 3559 3357 2039 2016 1884 1269 1263 1239 698 --15009 14834
NM_007034chr1--1905 2977 196 --
NM_007038chr2155515 4421 1889 1142 1128 11714 31633 903 621 24087 2304
NM_007045chr6--1569 178 --
NM_007073chr673689 3285 3041 2629 1239 850 668 --23902 2715 --
NM_007106chr1332705 1061 896 11863 22010 299 --
NM_007146chr1772495 2434 1990 1153 196 189 86 --22606 349 11039
NM_007159chr31383 11462 31548 512 78 --
NM_007175chr822764 1400 --53350 3233 3209 2834 843 --
NM_007191chr12--1502 1136 --
NM_007249chr13138435 8412 7563 6664 6592 6404 6180 5875 5846 3450 2221 2138 590 --49448 8140 3086 801 1581
NM_007347chr1531213 812 266 --33061 2513 684 --
NM_007350chr1253530 2934 1554 990 371 --21442 1276 --
NM_007373chr10----21537 498 11456
NM_007375chr121938 364 --1352 --
NM_012074chr14----1205 --
NM_012084chrX3198 121 78 --1578 --
NM_012095chr1073498 3425 3237 3057 2384 2245 699 32295 127 61 1545 --
NM_012096chr343200 3053 2830 1032 --11282 11414
NM_012101chr112793 786 --11119 --
NM_012137chr182937 2802 1962 1843 1789 704 508 99 --12185 --
NM_012153chr1152547 2432 1653 592 88 --31985 974 131 --
NM_012156chr20103458 3268 2725 2559 2474 2147 2121 851 789 386 --1555 154
NM_012157chr3----11007 --
NM_012164chr9107559 7015 6820 6351 6033 4644 2490 2129 358 220 --67282 7063 6090 5551 5405 2901 --
NM_012193chr1195401 4827 4413 4207 3847 3418 1742 406 260 --44869 2082 1246 832 --
NM_012234chr343116 2555 1228 791 11486 13697 --
NM_012259chr61250 11443 ----
NM_012262chr164281 2081 1443 1101 1049 359 --44927 4392 4363 3840 --
NM_012281chr772166 2038 1610 828 470 391 164 --11732 --
NM_012288chr665376 4585 4105 1184 1159 1099 --55180 5063 2120 606 193 --
NM_012296chr1193738 3546 2802 2703 2665 2506 1374 821 406 1534 33784 3767 3324 --
NM_012297chr422042 1646 12387 12631 --
NM_012300chr532231 1941 696 11682 147 --
NM_012301chr731959 838 388 12159 ----
NM_012302chr12358 59 11219 ----
NM_012304chr552066 2051 1037 888 424 --12544 --
NM_012329chr171432 --11539 11662
NM_012330chr1021442 126 139 1288 --
NM_012333chr121236 512 11670 11044 --
NM_012334chr5104724 4313 4037 3255 3181 1433 1337 1047 270 229 --23122 899 13883
NM_012338chr7126 ----1784
NM_012388chr1552770 2095 1221 768 458 ------
NM_012395chr742541 668 428 232 ----1487
NM_012402chr1131378 1007 294 --1274 --
NM_012412chr7----1259 --
NM_012446chr53604 467 30 ----158
NM_012460chr142112 99 --2279 144 --
NM_012474chr1------1220
NM_012479chr742075 1700 1691 40 1174 ----
NM_013231chr1444249 3695 1757 831 11765 31685 687 338 --
NM_013261chr453079 2717 717 587 580 --33455 1431 416 --
NM_013262chr6----1455 --
NM_013281chr2021239 1233 11470 1288 --
NM_013372chr1552318 2092 1178 888 566 12336 --11103
NM_013390chr931199 719 671 --199 --
NM_013402chr1132162 2117 163 184 32429 990 848 --
NM_013436chr21669 --1740 --
NM_013449chr1262989 2776 2676 2406 1171 1146 --1878 --
NM_013450chr23951 447 152 --11097 --
NM_013952chr292524 2429 2007 1887 563 319 234 185 53 --12470 --
NM_013995chrX1156 --1237 12562
NM_014001chr1731438 1191 393 --31657 1129 339 --
NM_014011chr232510 1879 883 ------
NM_014023chr1052407 2102 1926 1151 594 --22582 698 --
NM_014028chr653149 2314 1098 796 579 --32868 693 537 --
NM_014038chr72357 41 --166 --
NM_014112chr855173 4789 3341 406 253 --1226 --
NM_014153chr16----2493 192 --
NM_014159chr3----1599 --
NM_014240chr363734 3394 3192 1549 1430 1195 --23546 1261 --
NM_014253chrX31877 504 274 ----22554 994
NM_014267chr11----1183 --
NM_014271chrX--2751 204 1736 --
NM_014283chr141511 1188 391 199 ------
NM_014286chr962571 2211 1408 559 378 190 --133 --
NM_014335chr1521113 499 --131 --
NM_014382chr33575 563 283 --11386 --
NM_014393chr81105 21920 473 --1895
NM_014423chr545614 4535 852 725 --24661 616 --
NM_014445chr32598 511 --11676 --
NM_014456chr1031492 1296 315 --1355 --
NM_014462chr81230 --1248 --
NM_014491chr761005 932 872 842 67 41 --157 --
NM_014494chr1642262 1949 1917 1633 --1360 --
NM_014521chr241727 1416 530 209 --21150 253 --
NM_014585chr2----1909 --
NM_014607chr231596 743 677 11603 2417 216 --
NM_014612chr931171 513 486 --11311 --
NM_014615chr1663322 3170 1385 1071 1053 189 --13270 --
NM_014630chr1533309 3084 1087 --23475 2597 --
NM_014636chr953728 3405 3312 1581 1250 --44214 3162 3087 1332 13893
NM_014666chr54430 255 235 84 ------
NM_014686chr1961817 1679 444 397 309 80 --1454 --
NM_014705chr731795 1359 1319 11488 11387 --
NM_014723chr20102937 2829 2761 2250 2155 2017 1189 511 434 39 --1544 --
NM_014729chr841551 735 236 127 12057 11891 1366
NM_014730chr1255095 2062 1970 1145 824 ----14920
NM_014732chr16104497 4470 4216 4003 1897 1437 1119 888 742 424 --24312 117 1879
NM_014751chr821813 339 ----12198
NM_014755chr243606 3390 917 182 --1492 --
NM_014766chr711201 12338 2763 71 13291
NM_014774chr141026 976 567 178 11147 2348 101 --
NM_014791chr9198 --1335 --
NM_014810chr153219 800 534 376 323 --22521 458 --
NM_014820chr321759 1311 --31383 523 449 --
NM_014822chr41431 --1679 --
NM_014827chr111345 2454 429 21665 192 --
NM_014829chr532186 821 657 --22247 2030 --
NM_014835chr2062293 2226 2187 926 651 66 --31719 1695 610 --
NM_014838chr2282599 2183 2048 1749 987 735 500 373 --21123 334 --
NM_014862chr1553766 3442 3280 3139 190 11486 24073 3033 --
NM_014873chr174275 4110 3867 3622 1742 1599 1485 13944 13747 --
NM_014891chr711090 --21649 246 --
NM_014897chr1753252 2822 2744 1218 418 --33134 2835 211 --
NM_014899chr542991 936 502 157 --42089 2072 582 409 --
NM_014903chr1261852 693 564 549 351 158 --2876 77 --
NM_014912chr1021338 21 --12599 --
NM_014917chr12241 232 --1729 --
NM_014918chr15----11593 --
NM_014924chr1483023 2792 2457 2147 1942 1164 969 411 --22735 882 --
NM_014932chr331665 1320 53 1551 ----
NM_014947chr11287 --42360 1984 1197 101 13051
NM_014950chr142383 177 --1188 1429
NM_014961chr42440 283 ------
NM_014962chr20----32748 2468 1786 --
NM_014991chr411131 --22459 513 1498
NM_015020chr1683337 3118 3091 2406 1127 732 425 391 13474 --22525 503
NM_015042chr1584043 3806 3578 2919 2667 2642 1219 247 --34228 2800 329 --
NM_015044chr1683245 3009 2369 2260 2230 663 632 73 23087 2147 --12717
NM_015045chr102676 670 --41965 1575 561 372 --
NM_015057chr13199 --2693 124 --
NM_015069chr16----1423 --
NM_015076chr634016 3531 3020 --1969 1336
NM_015079chr1563118 2924 1219 1072 816 632 --1290 13258
NM_015082chr511970 11863 32445 1608 581 --
NM_015090chr1145875 4796 4783 4352 4302 3816 1917 1473 546 279 160 152 89 24 --26218 68 --
NM_015093chr631667 335 32 --1448 --
NM_015097chr342070 680 509 53 --11963 12197
NM_015100chr141860 699 195 127 --1283 --
NM_015134chr172571 173 --1628 --
NM_015137chr842395 2330 1598 676 12503 --11986
NM_015138chr1562826 2778 2055 1045 306 289 --22310 149 --
NM_015143chr431243 1179 291 --193 --
NM_015147chr243309 2797 2577 2139 --21321 918 --
NM_015156chr14113625 3170 2989 2887 946 871 819 479 278 190 36 --11310 --
NM_015161chr1631418 971 466 --11505 --
NM_015163chr144669 574 558 55 ----11971
NM_015176chr121729 1343 --1592 --
NM_015185chrX32085 2063 835 12422 ----
NM_015187chr42952 355 --1940 --
NM_015191chr1152689 2095 631 434 123 22579 600 1910 --
NM_015192chr2062589 2298 1886 811 75 37 1466 1637 12380
NM_015199chr332637 2449 635 11092 22871 2573 --
NM_015206chr1553219 960 787 581 458 1978 21472 1145 --
NM_015235chr101309 --1469 --
NM_015239chr9------1520
NM_015263chr1541223 806 451 373 159 ----
NM_015265chr231748 1004 296 12626 1539 --
NM_015270chr1252338 2234 2076 1775 114 --12310 --
NM_015277chr1811259 --1333 --
NM_015288chr573385 3012 2727 2569 1298 335 114 --23245 834 --
NM_015291chr162975 2654 2322 249 125 80 ------
NM_015310chr8138353 7553 7407 7219 7167 7059 6545 6205 3170 2611 1497 1222 502 12267 56045 5988 5489 5266 1206 --
NM_015313chr1194818 4795 3548 3399 3265 1691 1092 729 121 ----11062
NM_015315chr521170 152 --22597 337 --
NM_015331chr11432 ----175
NM_015335chr1242537 1828 794 106 --21644 265 --
NM_015336chr1222210 1694 11900 11987 --
NM_015344chr832150 1677 475 ------
NM_015347chr1242611 1968 1932 1138 --21919 351 --
NM_015349chr641912 1195 534 332 --13084 --
NM_015415chr12240 223 --146 --
NM_015435chr861335 1032 552 72 61 30 11267 --1406
NM_015458chr864466 4144 3778 1889 812 180 --21346 1321 11961
NM_015475chr22823 96 1393 1421 --
NM_015497chr1521150 453 --1769 --
NM_015508chr341518 1040 465 182 ------
NM_015509chr1211145 ----11501
NM_015530chr22847 42 --1612 --
NM_015534chr12234 176 ------
NM_015568chr2094249 3623 3336 2770 1650 684 577 570 487 --14019 --
NM_015569chr144528 4056 1044 865 23982 443 14463 21552 31
NM_015576chr342849 1130 651 120 ----1720
NM_015630chr21335 ----1177
NM_015633chr1231125 374 244 ------
NM_015698chrX----1207 --
NM_015879chr18177998 7697 7446 6490 6208 6162 6149 3207 2941 2707 2370 1980 1908 1246 1052 653 193 16659 98636 8531 7859 7288 7270 3285 2583 1177 514 13321
NM_015902chr8--1591 1886 --
NM_015906chr154818 4258 4134 1643 935 34531 910 642 --12960
NM_015907chr4----1257 --
NM_015938chr31253 21075 835 --2906 155
NM_015984chr1------159
NM_016009chr164522 4232 3595 3306 858 602 11186 54899 4703 4674 4176 3550 --
NM_016021chr672754 2154 2093 1110 1102 680 377 --1633 --
NM_016040chr132353 2075 427 175 11944 --
NM_016073chr153829 389 36 ----2864 248
NM_016076chr11713 152 22953 167 --
NM_016081chr432180 883 510 --1761 --
NM_016083chr683223 3134 2699 2686 1170 925 338 137 --23729 1254 --
NM_016098chr61375 --1122 1331
NM_016120chrX41093 464 245 192 --158 11185
NM_016131chr24806 752 735 127 11851 168 1599
NM_016132chr1522236 809 12096 11098 --
NM_016147chr114899 765 76 65 --1811 --
NM_016195chr101764 --3816 806 101 --
NM_016216chr31678 --2865 315 --
NM_016231chr172488 22 ----1128
NM_016242chr4--1449 1570 --
NM_016252chr21285 --2266 216 1392
NM_016258chr1--1785 1791 --
NM_016271chr1832276 1600 60 --31919 1871 1823 --
NM_016275chr331797 300 252 ----1623
NM_016284chr16----1134 1992
NM_016287chr131706 1408 695 --1501 --
NM_016304chr15----1828 --
NM_016351chr72199 163 --2212 76 --
NM_016351chr72199 163 --2212 76 --
NM_016376chr1764371 3760 3368 3286 2934 1616 --1319 11441
NM_016396chr1522921 1124 --3800 397 23 --
NM_016433chr1221611 1354 --167 --
NM_016441chr23560 510 499 11520 21897 1576 --
NM_016485chr611782 11851 1612 --
NM_016598chr331459 190 24 --2244 103 --
NM_016620chr131290 561 69 --1442 --
NM_016626chr1831663 1539 574 --1367 --
NM_016946chr153095 2531 2374 542 201 --2963 675 --
NM_017423chr42640 64 12071 21689 1518 --
NM_017426chr4180 --3629 617 609 --
NM_017540chr532795 2431 455 --22765 2066 --
NM_017582chr13704 226 39 --1517 --
NM_017633chr611521 11574 ----
NM_017635chr1111331 11619 2555 34 --
NM_017637chr998506 8022 6824 6681 3479 3119 1716 1047 856 15858 11078 11794
NM_017644chr393934 3881 3872 3798 3470 1822 1436 1188 28 --24268 898 15191
NM_017650chr784918 4836 4803 4785 2433 912 534 204 11830 45623 5590 1128 657 21954 187
NM_017664chr13--1836 --1729
NM_017666chrX11701 21878 160 31592 787 381 --
NM_017709chr133862 3354 1494 --14251 --
NM_017742chr1831926 1705 689 --21790 1767 --
NM_017744chr182051 1714 978 814 717 642 492 35 --1951 --
NM_017754chr675074 5043 3527 1760 1303 1036 409 --34900 3550 1980 --
NM_017770chr632374 2090 1099 --32680 2334 584 --
NM_017772chr64186 156 66 57 --198 1508
NM_017799chr141220 --1309 21232 585
NM_017801chr342288 1928 838 271 11764 22330 101 --
NM_017810chr162490 111 ----1709
NM_017811chr942539 1964 921 648 1240 21022 912 1866
NM_017812chr7--2114 99 ----
NM_017824chr102621 212 22595 2537 --1237
NM_017845chr4----1811 --
NM_017848chrX73612 3397 2977 2831 1638 1440 1176 13563 ----
NM_017851chr152931 116 1197 --21247 418
NM_017910chr21351 --2283 71 --
NM_017953chr111202 --1844 --
NM_017966chr11--11047 --11469
NM_017987chr1042119 1867 1373 683 --11709 --
NM_017988chr121624 1809 1723 --
NM_018028chr193532 331 325 1379 11337 --
NM_018084chr263239 3073 2674 2265 2236 209 --22649 2322 --
NM_018085chr1128106 7643 6159 6031 5216 2190 1832 1539 1436 1229 473 376 26341 1970 26627 50 --
NM_018092chr162455 103 ----11393
NM_018103chr1------1248
NM_018110chr1621263 424 ----11151
NM_018121chr1072383 2312 993 811 537 361 123 --11940 --
NM_018128chr1741100 409 308 181 --31331 479 222 --
NM_018137chr11549 --11093 --
NM_018157chr1243141 2854 2490 720 --11224 --
NM_018159chrX5684 389 353 332 162 ------
NM_018181chr18----2363 268 --
NM_018184chr332121 1543 243 11695 --11715
NM_018199chr14----11247 --
NM_018202chr1----1251 --
NM_018227chr452442 1216 586 480 32 23129 1270 32760 1961 748 --
NM_018241chr421051 975 --1135 132
NM_018254chr132449 1778 646 --1455 --
NM_018287chr101969 --1987 --
NM_018293chr352649 2591 2162 656 229 --3701 499 402 --
NM_018325chr931162 636 294 --21434 301 --
NM_018339chr911821 1246 ----
NM_018360chrX--1320 1129 --
NM_018364chr143706 1564 956 510 13764 ----
NM_018371chr841330 1045 1018 527 ------
NM_018374chr773377 2106 1976 1892 1476 1131 321 11754 23938 1119 --
NM_018375chr1411543 --11258 11393
NM_018383chr261506 1420 1300 744 576 93 ----1514
NM_018416chr1232321 2027 684 --1143 --
NM_018433chr21513 --1489 --
NM_018440chr8107694 7041 6197 5712 3236 2734 2063 901 543 346 37382 3391 1206 38254 6335 6309 --
NM_018444chr831831 828 816 173 ----
NM_018448chr1231134 823 412 126 1505 1219
NM_018477chr1411073 ----1685
NM_018482chr821837 1650 12463 1931 12258
NM_018490chr11--1722 1100 --
NM_018566chr154851 4397 4229 3591 111 11997 1644 1132
NM_018584chr121111 923 --1377 --
NM_018593chr6199 2167 145 1156 --
NM_018638chr12105710 5623 5422 5196 4404 3986 3952 3551 1728 1464 ------
NM_018649chr10----1494 --
NM_018684chrX11026 --1927 1854
NM_018689chr1542284 1945 1918 834 --22417 2269 --
NM_018698chrX31824 1726 1638 --21923 496 --
NM_018712chr1131382 405 167 --11504 --
NM_018715chr171693 1682 1397 723 482 251 169 ------
NM_018717chr452527 2242 1902 1148 601 ------
NM_018834chr5--1280 1301 --
NM_018836chr141161 842 460 163 1404 ----
NM_018837chr202738 68 1274 ----
NM_018841chr183978 3903 3795 3681 2730 2540 2465 1089 --194 11496
NM_018898chr54727 614 594 404 --32136 1591 25 --
NM_018970chr783176 3031 2627 2296 1093 985 633 538 1441 1229 --
NM_018976chr123767 295 219 1712 32248 417 365 163
NM_018979chr1231906 430 416 11923 12633 193
NM_019008chr2293448 3258 2784 2531 2342 855 577 469 291 --1206 --
NM_019012chr121150 --137 --
NM_019035chr421927 325 11982 1297 12061
NM_019046chr105768 386 317 134 128 --2985 275 --
NM_019063chr22833 413 12093 22135 92 --
NM_019067chrX94804 4599 4421 3673 3146 1884 1824 1128 432 1659 34093 3490 1733 13395
NM_019071chr7----2283 109 --
NM_019084chr1052490 1975 1817 788 733 --11751 --
NM_019087chr531314 547 203 1233 ----
NM_019114chr942493 1571 867 302 1539 1348 --
NM_019116chr1633178 504 227 1170 12369 --
NM_019600chr15----1215 1712
NM_019610chr192163 1775 1507 1469 694 657 635 291 77 21760 90 ----
NM_019857chrX31565 1429 440 11331 11146 192
NM_020122chr2125878 5862 5541 5167 5084 4935 4515 4380 2406 2110 1841 534 --25655 368 11880
NM_020154chr15------2273 86
NM_020177chr522575 499 --43153 1023 433 306 --
NM_020214chr15----1173 --
NM_020228chr1121784 119 --11839 --
NM_020336chr2083168 2443 1388 1040 629 203 122 76 --21005 98 --
NM_020338chr10103471 2821 2763 2666 2362 1495 1425 1403 270 110 --32713 994 912 --
NM_020341chr2051574 766 755 623 307 11295 ----
NM_020342chr232345 139 109 --1635 --
NM_020348chr1042670 2555 2524 306 12023 12616 --
NM_020369chr7------151
NM_020384chrX41706 584 355 89 ------
NM_020429chr772957 2565 2337 1980 1228 906 855 --12869 --
NM_020443chr176929 6018 4371 2625 2038 724 471 11033 12301 --
NM_020463chr241464 1445 1244 516 ------
NM_020466chr684799 4110 3660 3595 3409 1292 538 357 --2724 493 2289 231
NM_020644chr11------1956
NM_020673chr2097546 7085 6081 5623 5320 2944 2338 1162 414 --27745 6268 --
NM_020689chr2051642 1481 1263 1139 1110 --21327 676 --
NM_020699chr175412 4761 4336 4234 1839 993 358 --1743 --
NM_020717chrX94922 4916 4586 4233 3551 3294 3064 235 188 --11285 24508 4353
NM_020718chr1686277 6167 4189 2034 1940 1736 1619 1581 25736 369 25131 4719 25089 2553
NM_020734chr1212990 --13302 --
NM_020742chrX62245 2222 990 657 312 277 ------
NM_020748chr1741996 1607 1482 1463 ----1114
NM_020753chr172811 696 ----1774
NM_020760chr231829 1805 731 11468 --1654
NM_020762chr124961 810 287 266 ------
NM_020772chr17118598 7248 5941 5276 5228 3421 2571 1895 450 118 106 17830 22261 1554 15789
NM_020791chr1751434 1398 1360 1261 377 --1457 --
NM_020801chr51852 --1829 --
NM_020824chr10----2271 39 --
NM_020834chr1461547 1456 1248 633 263 75 --11539 --
NM_020856chr19--11542 1121 --
NM_020858chr1512014 --11619 --
NM_020859chr483698 3547 2981 2901 2834 1018 807 32 2505 403 32621 525 81 23939 2502
NM_020899chr1762411 2119 1957 1675 482 375 159 11544 11834
NM_020921chr1462784 972 745 600 239 192 --41327 935 791 536 --
NM_020935chr294290 3935 2844 1691 1509 1429 1327 1043 353 13325 31842 1567 1118 14446
NM_020940chr1042883 2792 753 78 1560 2516 37 2431 135
NM_020962chr1522293 1844 ------
NM_020973chr4------1227
NM_020980chr1531395 185 173 --1664 --
NM_021003chr141222 ----1340
NM_021038chr373261 3211 772 726 600 366 125 12772 12818 --
NM_021083chrX63505 2213 956 827 573 232 23236 1228 12344 12309
NM_021097chr252474 2388 2046 414 159 --1481 13007
NM_021109chrX----1147 --
NM_021132chr1041300 1216 1174 957 --1116 --
NM_021136chr14------1197
NM_021140chrX3761 274 67 ------
NM_021145chr74778 304 128 114 ----1286
NM_021156chr201724 --21014 991 --
NM_021183chrX--11679 12362 --
NM_021189chr1187 --2973 945 11073
NM_021191chr124756 743 443 232 --22031 805 11015
NM_021204chr4----1751 --
NM_021205chr152753 2622 2609 473 432 22640 1082 --11824
NM_021229chr1211060 ----11105
NM_021572chr631097 1047 1025 ----2898 110
NM_021637chrX11045 --2330 205 --
NM_021639chr1----1723 --
NM_021809chr2071797 1619 807 617 611 159 93 --12460 --
NM_021814chr621228 29 1687 11349 --
NM_021947chr1771343 1322 1173 904 878 844 258 ------
NM_021954chr1353067 2851 2263 1401 690 12793 11091 12335
NM_021961chr1177350 5608 5454 5183 5124 4599 1983 16242 22586 956 --
NM_021964chr3106527 4461 4442 4265 4053 2440 2423 1313 1246 511 --25843 5077 --
NM_021970chr4------1505
NM_021999chr131780 ----1156
NM_022059chr17----1176 1598
NM_022093chr12909 301 --1989 --
NM_022138chr631418 539 197 --11213 1549
NM_022340chr363657 3206 2904 2579 1013 855 ------
NM_022459chr1364541 2345 1092 946 426 199 14939 21489 1156 12317
NM_022484chr741305 1255 463 407 21378 53 ----
NM_022491chr1232671 2510 1378 13204 13122 --
NM_022552chr21143 --1842 --
NM_022659chr8----133 --
NM_022726chr6----1682 --
NM_022731chr1----2288 197 --
NM_022735chr111588 1733 11292 --
NM_022739chr1721015 988 1317 ----
NM_022763chr342447 2194 1972 412 --2811 524 1827
NM_022781chr912071 11059 1461 --
NM_022828chr531137 387 135 --150 --
NM_022831chr171842 1766 1296 1264 1249 55 42 1283 ----
NM_022841chr1552702 1711 1099 543 347 --12293 --
NM_022893chr232106 747 54 --13121 --
NM_022894chr231789 1579 1192 --3486 317 60 --
NM_022898chr1454276 3866 3178 1724 1066 ----13769
NM_023016chr242266 744 504 431 1707 52464 1869 891 643 325 --
NM_024068chr123483 177 31 --1101 --
NM_024306chr1621168 800 ----11044
NM_024492chr631233 981 596 --31412 1009 354 --
NM_024492chr631233 981 596 --31412 1009 354 --
NM_024522chr121526 474 --11817 --
NM_024539chrX1376 --21185 340 131
NM_024545chr2----1574 --
NM_024561chr131173 11078 11221 --
NM_024563chr561232 757 613 562 275 126 ------
NM_024570chr13----1231 --
NM_024574chr4175 --155 --
NM_024575chr1------1490
NM_024617chr93576 248 33 1678 --1630
NM_024639chr632743 2685 252 12415 1987 --
NM_024646chr163930 2972 2662 2470 1314 29 23372 1463 43329 2425 1209 516 --
NM_024665chr343699 3526 2980 96 ----23271 1407
NM_024713chr1561374 1234 1149 615 380 135 1372 1301 1150
NM_024770chr2104695 4250 2561 2522 2323 2259 2154 1706 883 55 14831 46504 5227 2109 244 --
NM_024811chr1121840 503 ------
NM_024953chr1292439 2402 2395 1059 741 597 586 422 218 ----12633
NM_024993chr241428 1306 1099 152 11222 --181
NM_025054chr863685 3498 3443 3012 667 402 23033 704 11495 --
NM_025074chr452824 2772 2371 647 623 13107 1175 --
NM_025076chr22675 32 ----1603
NM_025133chr2------21104 825
NM_025146chr332609 2374 1030 --11958 --
NM_025160chr133621 2653 330 --21076 127 --
NM_025195chr821657 590 ----11492
NM_025222chr342905 2156 2103 494 --12772 --
NM_025250chr752695 1957 852 803 443 --32853 2717 2236 1994
NM_030579chr1643717 2790 966 793 --22383 2347 13538
NM_030621chr1463926 3821 3502 3398 612 258 --23659 2580 --
NM_030625chr1032191 2134 413 --1277 --
NM_030637chr141295 --1534 --
NM_030640chr122808 331 1632 1252 --
NM_030647chr732467 1652 1005 --22418 180 --
NM_030755chr1442670 2070 828 540 ----13088
NM_030816chr163679 3636 3487 3213 3190 1106 1382 13102 1595
NM_030918chr133466 1677 581 --35400 3338 2113 1896
NM_030939chr641043 768 454 70 --1983 --
NM_030953chr541136 404 313 257 --31575 635 496 --
NM_031216chr1831534 356 321 1135 ----
NM_031442chrX43127 3060 2566 30 12388 1290 1828
NM_031453chr1042613 1981 1934 328 --12316 1570
NM_031886chr1962233 2108 1844 1695 784 745 ----12591
NM_032042chr522330 831 --22201 2104 12171
NM_032102chr1122541 817 12563 1977 --
NM_032121chrX62489 2477 1990 1723 544 426 12090 1326 1292
NM_032172chr731045 235 225 ------
NM_032177chr51535 --159 --
NM_032193chr1161747 1735 1436 1307 609 297 ------
NM_032199chr1073842 3442 2674 2467 1488 564 554 --23307 2803 --
NM_032221chr2031756 360 176 ------
NM_032239chr4----11465 --
NM_032246chr1531109 1068 833 ------
NM_032291chr12632 297 ------
NM_032312chr2----1700 1636
NM_032373chr1064310 4130 3951 2339 2003 205 12332 2711 487 --
NM_032379chr11------137
NM_032434chr241399 1343 597 415 --1392 --
NM_032439chr1061537 1115 403 195 132 111 --3649 523 160 --
NM_032445chr1532563 1985 1615 ----12511
NM_032446chr593283 3160 2518 2362 1336 1223 789 764 80 --32403 438 26 1937
NM_032449chr192907 2718 2510 2147 1904 885 648 441 435 11773 160 --
NM_032457chr453067 2584 194 128 87 21390 805 --1907
NM_032458chrX31103 735 191 22317 1268 12153 1384
NM_032486chr16--1255 22707 824 --
NM_032491chr1211232 --1325 --
NM_032499chr154528 513 377 207 1135 --11568
NM_032520chr16----1179 --
NM_032521chr2042290 1146 974 760 23171 2332 22636 1189 --
NM_032523chr23375 206 113 --1176 --
NM_032564chr111646 1400 2372 47 1128
NM_032576chrY----1129 --
NM_032594chr14----1982 --
NM_032682chr353479 2255 2227 632 468 --13197 11063
NM_032689chr1941623 1293 1116 1059 --41561 1513 444 324 --
NM_032727chr103410 204 165 196 11164 --
NM_032737chr1972215 1792 1697 977 512 240 187 --144 --
NM_032801chr1171959 1818 1639 377 360 215 168 1145 ----
NM_032804chr1051987 1875 1740 647 224 --22566 2356 --
NM_032810chr1011200 --1475 --
NM_032858chr1--1101 1112 --
NM_032859chr1333905 933 883 ----1853
NM_032875chr172659 144 --2620 253 --
NM_032927chr41606 --1671 --
NM_032961chr421094 375 --1963 --
NM_032968chrX44144 3351 1283 1059 13666 --21124 948
NM_032973chrY33346 1283 1059 13658 --21124 948
NM_033055chr11319 2709 236 ----
NM_033084chr3----3217 157 64 --
NM_033127chr1----1692 --
NM_033136chr541613 1537 266 207 11550 --139
NM_033211chr531527 473 169 21763 1664 11963 --
NM_033224chr777774 5791 2363 1952 1043 372 37 17954 11021 --
NM_033225chr852647 2370 1000 189 80 ------
NM_033261chr10159 --1426 1132
NM_033394chr23321 288 178 --11611 11540
NM_033407chr1--1254 ----
NM_033495chrX1837 --1197 --
NM_033505chr2146292 6212 6004 5863 5368 5252 4542 4090 1921 1391 1344 1164 369 67 --15207 --
NM_033542chr207731 493 448 417 285 275 269 --1355 --
NM_033656chr2175937 5782 4867 2141 1745 505 479 --15530 --
NM_052832chr832533 2096 1105 1831 22605 2363 --
NM_052876chr1942691 2468 2461 2317 --12655 --
NM_052879chr1243404 2823 1599 926 ------
NM_052880chr222106 75 ----11027
NM_052898chr811846 31279 294 130 21922 541 --
NM_052900chr82466 407 --11516 --
NM_052905chr21579 21921 765 11234 --
NM_052917chr262782 2676 2301 2118 956 703 ----1221
NM_052918chr1033156 2848 1146 22730 84 23396 2904 --
NM_052932chr1131934 841 325 --32020 1842 972 --
NM_052937chr821859 895 --3837 471 125 --
NM_053002chr3----1422 --
NM_053023chr1163034 2457 2358 2283 1269 613 ----11069
NM_053056chr1172911 2884 2343 1150 749 734 718 --21003 465 --
NM_053064chr1453013 1984 1219 1158 915 --1114 --
NM_053279chr832458 1056 780 --32142 1040 323 --
NM_057175chr41899 11952 --1509
NM_057749chr82263 59 11303 --168
NM_080422chr18----146 --
NM_080654chr112902 365 ----11313
NM_080671chr231817 215 103 --32063 1874 1804 --
NM_080867chr1495014 3800 3105 1911 1879 969 767 518 73 --34785 4098 3845 13431
NM_080872chr864046 3996 1497 1345 1170 616 --2805 581 23403 1243
NM_080874chr4--21425 1328 ----
NM_080927chr372410 2209 2174 2156 1296 296 231 ----1148
NM_080928chr7----2305 72 --
NM_101395chr2122770 336 ----1783
NM_130807chr19102342 2311 2051 1885 1778 934 744 731 75 32 --21487 281 --
NM_133334chr465481 5337 4891 4256 1916 589 14293 34157 2073 611 1933
NM_133445chr983742 3470 3113 2644 2533 1454 1035 784 --23726 3374 --
NM_133452chr191454 --188 --
NM_133478chr282427 2162 1893 1029 967 849 488 192 --22398 1609 --
NM_133496chr154158 3576 3185 957 583 1102 1430 13200
NM_134424chr123501 311 200 --2801 56 --
NM_138288chr1422233 1508 --1504 11822
NM_138340chr182685 35 --1141 --
NM_138448chr21470 --1333 --
NM_138459chr6----21310 970 --
NM_138473chr1254869 3423 891 748 488 ------
NM_138569chr61223 --163 --
NM_138731chr1464176 2584 1292 1246 153 125 --1168 --
NM_138782chr522307 209 ----11610
NM_138927chr213315 125 61 --1709 1907
NM_138959chr1106608 6363 5436 5111 2025 1814 1126 1095 1053 1044 --25060 975 --
NM_139279chr293087 2854 2805 2773 2748 2456 1410 1107 589 --22902 95 --
NM_139283chr1262571 1789 1758 712 94 80 ----1169
NM_144571chr456649 5146 4696 2771 2326 --66579 5883 5409 2506 669 365 16883
NM_144578chr14115557 5325 5080 3974 3457 3424 1909 1352 923 741 304 14327 1388 --
NM_144599chr1531750 1075 671 ----15119
NM_144633chr33469 150 43 --1226 --
NM_144664chr1131992 1810 500 --1657 --
NM_144775chr1764492 4360 3471 1326 783 302 14522 11008 13062
NM_144778chr1352618 2554 2476 229 143 --12016 --
NM_144963chr831923 1727 676 --11070 176
NM_144979chr41529 ----2453 238
NM_145049chr53971 815 252 --1766 --
NM_145178chr10----1358 --
NM_145203chr133747 675 607 --1114 --
NM_145206chr1012190 13320 ----
NM_145268chr731151 203 65 --1376 --
NM_145284chrX21746 1687 --32465 1552 874 --
NM_145296chr191877 2945 122 ----
NM_145693chr242473 2288 2061 1685 --12537 --
NM_145800chrX5837 357 349 304 193 ------
NM_145808chr742366 2094 1010 194 --22307 723 --
NM_147156chr1031079 981 264 --11024 --
NM_147166chr71127 --1657 --
NM_147189chr82771 554 --1399 1858
NM_152253chr2264189 3894 3750 500 333 86 --11129 --
NM_152263chr165339 4631 3975 1923 1200 754 --65838 5000 4177 2420 1651 319 --
NM_152264chr11----1942 --
NM_152272chr841183 1168 858 140 --1117 11351
NM_152277chr542069 1732 1404 412 1843 21643 257 --
NM_152332chr1442461 906 624 291 22581 409 2829 499 --
NM_152335chr152454 443 --2606 253 --
NM_152381chr251918 1562 518 60 23 --11261 --
NM_152409chr553616 2355 1136 956 285 --11222 2608 336
NM_152422chr931273 1208 224 --1347 --
NM_152424chrX54629 4197 3997 1826 1546 --1509 --
NM_152437chr1232088 691 296 147 11741 --
NM_152441chr12----1601 --
NM_152480chr192122 76 ------
NM_152519chr252169 2078 534 277 168 --1724 --
NM_152523chr21529 --2469 235 --
NM_152525chr2----1161 --
NM_152556chr722119 676 --2346 223 --
NM_152586chr103981 397 298 --2370 227 --
NM_152588chr122680 137 11353 21807 1260 --
NM_152594chr1511523 11530 22302 231 --
NM_152622chr563126 2390 2369 1130 934 828 12431 ----
NM_152624chr566348 6176 5950 4868 2939 1190 --32685 1843 509 --
NM_152641chr1272929 2330 2080 1817 1152 652 43 --1661 --
NM_152653chr31676 1578 3733 549 123 --
NM_152663chr12217 82 --1252 --
NM_152678chr322443 1775 12319 32644 2144 970 11797
NM_152753chr611383 1127 11817 --
NM_152758chr833034 816 747 ----1351
NM_152765chr8181 --32252 1916 936 --
NM_152772chr12----1310 --
NM_152787chrX23373 420 13502 ----
NM_153184chr32755 229 ----11471
NM_153207chr1243781 3094 2555 1295 --1966 --
NM_153255chr6152 195 1864 --
NM_153260chr151261 ----11478
NM_153261chr16----1333 --
NM_153453chr63898 150 144 1384 1235 --
NM_153607chr542554 2357 344 195 13207 --1434
NM_153619chr1543252 2659 1218 866 --22857 390 --
NM_153707chr91125 --1156 --
NM_153756chr141788 1639 1371 752 --11990 --
NM_170606chr761880 1219 518 425 224 64 ------
NM_172070chr241831 1688 911 158 ------
NM_172071chr186720 5995 5935 5443 4945 4592 1073 1001 31356 606 149 26661 5141 --
NM_173083chr121230 306 --1516 --
NM_173468chr485316 4760 4587 3957 3751 2177 1143 160 --55774 4995 4647 4119 191 13832
NM_173469chr1521213 250 --21580 478 --
NM_173470chrX32197 1808 132 --1266 11919
NM_173475chr1631505 558 70 ------
NM_173503chr17----138 --
NM_173517chr7----1315 --
NM_173595chr1264996 3329 1774 924 752 413 11916 1631 --
NM_173602chr1273670 3182 2342 1179 925 624 42 --1445 --
NM_173625chr173782 294 186 --1877 --
NM_173645chr21209 --1221 --
NM_173683chr821300 101 1141 ----
NM_173698chrX31852 1489 1372 11286 2784 513 --
NM_173808chr164249 3939 3002 1468 1160 719 13048 13162 --
NM_174909chr5----1189 --
NM_174916chr1542292 460 398 27 ------
NM_174921chr431161 980 463 --1747 --
NM_175056chr311590 11692 1501 --
NM_175733chr114717 184 127 48 --11615 --
NM_175854chr131935 --11902 --
NM_175856chr5----1136 --
NM_176814chr72960 165 --1174 175
NM_177424chr1------1135
NM_178011chr1082944 2910 2471 2460 1249 1050 882 861 --22401 824 --
NM_178013chr1443091 1947 770 750 1863 22822 145 --
NM_178505chr1043002 948 941 796 ------
NM_178509chr1753871 2862 567 240 105 22964 196 23775 1171 --
NM_178554chr373010 2886 2378 1368 1358 444 92 13423 --12670
NM_178815chr1021035 410 --1469 12119
NM_180989chr1332051 907 303 --11531 --
NM_181354chr82518 128 --1488 --
NM_181358chr122991 714 --13390 --
NM_181571chr102963 382 --1119 --
NM_181645chr11----1715 --
NM_181706chr1141748 1541 907 141 --12155 --
NM_181714chr61584 --21568 617 --
NM_181715chr12346 49 ------
NM_181723chr811990 ------
NM_181809chr173879 3247 2455 1168 842 828 29 --63892 3214 2659 1508 1487 536 --
NM_181836chr542138 322 33 27 --1312 11974
NM_182503chr665272 5060 4909 2100 1290 288 --14784 --
NM_182515chr19116459 6289 6118 5818 5311 4680 4605 4123 2462 1303 471 15724 21999 987 --
NM_182553chr11----1602 --
NM_182663chr131797 1757 820 1422 21916 1543 --
NM_182765chr1021733 557 12003 --12086
NM_182830chr146909 787 756 740 111 88 21885 677 ----
NM_182920chr31889 ------
NM_182978chr184726 605 220 126 ----1756
NM_183075chr421876 761 --21889 1856 --
NM_194282chr432837 2423 2191 --22671 2435 --
NM_194286chr12125702 4920 4817 4232 4226 2397 2048 1961 1673 741 239 59 --35634 1880 1074 --
NM_194314chr144287 4281 3816 1498 --14169 11051
NM_197941chr582685 2632 2524 2409 2253 1941 940 67 1325 1126 --
NM_198047chr2----175 --
NM_198256chr241792 1588 158 26 ------
NM_198279chrX1211 1805 1245 --
NM_198490chr342548 2409 728 103 --12309 13505
NM_198513chr841308 519 472 163 ------
NM_198525chr15----1417 --
NM_198844chr171729 --3813 360 110 --
NM_198935chr2042647 1308 604 172 --13115 --
NM_199000chr752107 1944 1577 1414 554 21972 1499 1588 12138
NM_199044chr152449 2381 2240 1956 1250 ------
NM_199072chr752961 2885 2251 976 660 --1193 --
NM_199168chr1051417 1096 1066 566 102 11079 11354 1627
NM_199320chr432087 410 223 --22461 800 1938
NM_201613chr12------1560
NM_203349chr15----41901 1506 1429 432 1600
NM_203364chr1121133 862 --1448 --
NM_203406chr532106 2017 731 21109 104 42753 2099 2028 193 --
NM_203459chr141986 765 700 152 ------
NM_206832chr17----1125 --
NM_206853chr673558 3050 2748 2635 2568 302 256 --33662 1312 616 --
NM_207015chr311716 --1496 --
NM_207043chr132115 1935 530 --135 --
NM_207111chr752559 2313 1097 536 91 --12747 --
NM_207404chr331514 483 74 --2800 230 12213
NM_207406chr4115626 5515 4995 4799 2628 2606 2275 2189 2011 506 222 --45139 4562 710 614 15478
NM_207410chr61418 --2436 33 --
NM_207411chr892716 2580 2400 2251 1150 1046 622 498 194 12769 1100 --
NM_207435chr122416 308 --21115 392 --
NM_213589chr245423 3590 1763 481 24556 1865 34178 367 39 14956
NM_213609chr33936 297 130 --1781 1737