TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-141-5p
miRNA Sequence: CAUCUUCCAGUACAGUGUUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX85494 4594 4521 2773 1012 511 421 32 16788 26635 6228 25525 225
NM_000259chr15104950 4795 2115 1561 1541 1353 1258 389 286 265 25177 1407 25860 4445 --
NM_000368chr9164520 4466 4175 4140 3872 3633 3613 3182 2962 1862 1384 1199 997 833 817 463 --13365 --
NM_000599chr2224546 4465 4035 3777 3415 3341 3183 2977 2963 1827 1598 1579 1481 519 453 436 373 353 301 291 279 271 23730 3263 54014 3231 2953 1781 1508 1921
NM_000719chr12155436 5133 4514 4370 2433 2120 1138 805 646 489 463 293 237 204 171 --35846 4120 1299 12203
NM_000813chr555514 4969 3822 2218 453 24810 939 21731 499 1307
NM_000831chr1144501 4379 2400 2273 2110 1851 1667 1358 1247 642 513 349 65 58 25692 5484 13921 --
NM_000875chr15146589 6158 5977 5625 5267 5044 4389 2318 1002 828 821 487 142 65 26335 5086 24944 4383 --
NM_001003652chr18117088 5874 5843 5664 2529 2170 2135 1417 581 226 220 48351 7782 2428 1886 16410 12019
NM_001003674chr18116492 5487 4740 4297 2466 2281 2194 1999 1860 1297 425 1286 1853 1840
NM_001003675chr18116492 5487 4740 4297 2466 2281 2194 1999 1860 1297 425 1286 1853 1840
NM_001004342chr194995 4637 4396 4144 2246 2080 1202 1075 354 --15480 2362 218
NM_001004419chr1284084 3935 3772 1829 1704 1419 1076 962 --3977 947 591 13244
NM_001005473chr5165941 1889 1445 1208 1079 1068 1048 1000 991 979 967 955 946 938 889 585 --36418 2468 1160 --
NM_001007278chr1394167 3833 3774 3652 1889 1824 1284 769 742 1790 11084 1731
NM_001007466chr6113694 3331 1717 940 851 731 720 191 153 140 114 15065 1458 --
NM_001010891chr5116452 6384 5531 4744 4712 2084 869 692 536 237 104 182 ----
NM_001014797chr10207634 7161 6977 6961 6877 6774 6750 6647 6533 6421 6274 6145 6067 5924 5327 4971 3204 2071 813 121 --26942 5206 15486
NM_001017440chr7187744 7634 7310 7297 6961 6245 6201 6140 5610 3183 2932 2922 2611 2432 2322 1806 1748 1288 --26379 5400 --
NM_001018091chr1582049 1131 705 678 619 516 267 83 21838 115 --161
NM_001031695chr22165405 5296 3684 3659 3538 3412 1984 1907 1395 1167 1030 1010 966 453 346 331 --12173 --
NM_001033087chr20102620 2582 2145 2023 1193 396 390 109 93 73 13313 --21112 53
NM_001040284chr1655004 1137 525 395 382 --45821 4904 4729 1842 22254 79
NM_001042355chr16114901 4664 4622 4615 4602 4433 4382 3746 1715 884 427 24342 4037 54745 4212 3822 1961 682 13336
NM_001042412chr16114901 4664 4622 4615 4602 4433 4382 3746 1715 884 427 24342 4037 54745 4212 3822 1961 682 13336
NM_001042599chr297653 6866 6838 5746 4773 3017 2054 1030 200 11419 --1124
NM_001042603chr12105379 4976 4644 3987 3866 2090 1068 828 779 398 1660 25177 3678 --
NM_001100108chr1127316 6523 6428 6398 6093 5484 2287 2166 2044 1141 281 45 --26983 1011 11639
NM_001106chr3179747 8499 8403 6235 5981 3590 3517 3441 3026 2918 2890 2014 1801 1074 754 643 637 --27767 3750 --
NM_001113490chrX82633 2592 2541 2415 1140 977 739 369 12571 --13313
NM_001331chr1192534 2340 877 859 817 804 588 457 370 ----12757
NM_001650chr18103956 3349 3079 2903 2706 2648 1047 788 175 167 12863 13505 --
NM_001918chr1149255 8207 5998 5746 3523 3410 3384 3297 2895 2885 1983 1239 1184 983 27247 3393 27607 1537 11021
NM_002223chr1293957 3406 3200 1165 754 693 312 294 244 23207 2493 12655 23008 1302
NM_002737chr17136470 6215 5904 5839 5535 5381 5112 4607 4170 2583 2568 2031 1832 --65843 5224 5130 2572 809 203 --
NM_002886chr3155131 4921 4050 3818 1714 809 631 599 528 520 498 486 382 376 356 ------
NM_003099chr15216460 6350 6217 6180 6140 5548 5499 5325 5249 5115 4897 4872 4738 4497 4419 4283 4160 1403 893 885 620 15517 --24767 2493
NM_003108chr2177292 6522 5918 5158 2834 2711 2382 2300 2230 2224 1792 660 479 441 149 140 59 36943 5340 537 36972 5235 1352 --
NM_003204chr17111786 1779 1700 1385 1253 432 385 369 338 317 154 --2448 344 --
NM_003369chr1122775 934 --32641 1820 328 22441 112
NM_004028chr18103956 3349 3079 2903 2706 2648 1047 788 175 167 12863 13505 --
NM_004065chrX10268 250 231 214 197 124 105 69 50 32 --2287 88 --
NM_004338chr18116492 5487 4740 4297 2466 2281 2194 1999 1860 1297 425 1286 1853 1840
NM_004748chr1584164 3832 3222 2795 968 935 914 903 1977 1957 23190 1013
NM_004823chr1951511 1355 1210 1200 484 --11215 --
NM_005044chrX93968 3762 2974 1654 1119 983 736 593 24 --41681 1223 216 35 1684
NM_005056chr12105623 5220 4888 4231 4110 1312 1072 1023 642 127 1904 45421 3922 3456 226 --
NM_005188chr11177908 7760 7390 6402 6352 6331 6161 5371 5230 2456 2266 2208 1537 1016 759 470 220 18153 11994 --
NM_005235chr297653 6866 6838 5746 4773 3017 2054 1030 200 11419 --1124
NM_005339chr463481 2883 1588 1276 543 268 --14208 11476
NM_005504chr12126443 5509 5280 4954 4734 4601 1939 1521 1490 1016 587 509 2961 36 25735 1633 --
NM_005798chr1394167 3833 3774 3652 1889 1824 1284 769 742 1790 11084 1731
NM_005901chr18117088 5874 5843 5664 2529 2170 2135 1417 581 226 220 48351 7782 2428 1886 16410 12019
NM_005935chr4155292 5228 4825 4500 4272 4030 2072 1605 1599 1264 1165 894 780 737 487 --15011 --
NM_006282chr2083679 3472 3466 1782 1272 1101 347 146 --23952 3482 14108
NM_006371chr3195091 4702 4334 4222 3959 3706 3695 1841 1767 1629 1622 1472 1454 1419 1262 1158 1008 799 715 ------
NM_006544chr14105725 5419 5017 4996 4542 4297 1581 1214 1004 779 25611 93 --14036
NM_006732chr1981394 365 255 91 77 59 53 40 --1172 --
NM_006750chr16137407 7317 5924 5515 2988 2518 1788 1672 1600 1564 1538 1364 929 16762 16799 17640
NM_006924chr1773561 3551 3118 3059 2722 1737 734 11711 43352 1491 461 451 --
NM_007050chr20197352 6992 6912 6515 6297 5856 5425 4917 3199 3042 2961 2918 2635 2542 2141 1251 1085 852 399 37937 6936 1901 26675 190 --
NM_007249chr1389373 9182 9154 6240 2880 2584 1490 782 26411 166 23511 1501 17799
NM_012081chr593570 3541 2852 2762 2726 2603 2418 926 22 --13214 --
NM_012164chr976596 5560 5130 1734 1612 1423 262 27114 5531 21315 750 11724
NM_013269chr1284011 3862 3699 1756 1631 1346 1003 889 --3904 874 518 13171
NM_014048chr1654556 4261 3305 1384 50 22088 677 33943 1028 135 11018
NM_014309chr22165395 5286 3674 3649 3528 3402 1974 1897 1385 1157 1020 1000 956 443 336 321 --12163 --
NM_014732chr16175792 5386 5070 4997 4578 4153 4099 3942 2354 2270 2160 617 595 576 300 292 28 25873 4384 11448 --
NM_014873chr174261 4078 3975 3878 3507 3279 173 13206 --24285 3120
NM_015068chr7113751 3712 3663 2927 1324 1233 1182 1048 494 439 430 12823 1142 --
NM_015090chr1156121 5832 4467 2373 2343 2301 1877 1541 1314 1067 686 217 58 50 43 15592 11622 --
NM_015247chr16114901 4664 4622 4615 4602 4433 4382 3746 1715 884 427 24342 4037 54745 4212 3822 1961 682 13336
NM_015310chr8147477 6834 5696 5304 5206 3179 2667 2560 2507 2053 1374 1048 608 235 33249 2746 1560 15257 --
NM_015686chrX101905 1662 1010 960 924 680 674 391 335 283 1667 2753 553 --
NM_016089chr3102066 1899 817 718 649 397 311 298 229 22 3804 384 48 --2696 276
NM_016206chr378522 6327 2912 2673 2582 1443 1374 28333 5847 25916 2536 11079
NM_016260chr2116075 5691 5441 3032 1670 1641 1593 1129 1013 364 184 25018 2504 ----
NM_017563chr3106160 5363 4606 1981 1905 1896 1886 1715 1563 296 12504 15567 1322
NM_017594chr9102732 2546 2448 2142 1317 450 439 300 289 269 22512 720 --13366
NM_017848chrX94572 2937 1667 1468 1403 1380 1117 741 33 21780 253 32952 2916 1163 182
NM_018036chr1453437 1576 1555 856 256 127 23560 862 23633 727
NM_018440chr898330 7201 7161 6102 2649 2074 2036 116 64 --27403 1859 16030
NM_018999chr1063626 3450 1253 295 93 45 44697 4092 3592 3290 11171 --
NM_019008chr22143783 3740 3332 3210 2996 2555 2473 2400 1357 1349 1268 1240 950 263 --11222 --
NM_019044chr2104675 4037 3537 3300 2898 1683 1000 980 950 906 1299 1391 14638
NM_020245chr6103600 3237 1623 846 757 637 626 97 59 46 24971 2022 1364 --
NM_020443chr1166393 6244 6112 5562 5084 4630 2563 2368 2268 2222 1789 1498 1093 186 126 111 24462 1179 1410 14650
NM_020466chr684572 4018 3967 3501 1548 1377 1323 664 34484 4320 1186 24752 1596 --
NM_020727chr21103600 3570 3118 3109 2787 2703 2696 681 431 112 12522 12891 --
NM_020734chr1223231 2221 --42185 399 104 92 1145
NM_020739chr1584164 3832 3222 2795 968 935 914 903 1977 1957 23190 1013
NM_020752chr1051787 1102 1047 894 311 22033 59 186 11871
NM_020772chr1788254 6318 6271 6012 3370 1543 1115 1041 47925 3352 3167 1093 15595 16846
NM_021090chr22164905 4336 4321 3855 3688 3679 3559 3292 3207 1900 1753 1226 595 407 385 270 --53783 3253 1546 1313 358 --
NM_021638chr453607 3541 1483 393 344 --11309 24511 4184
NM_021911chr555514 4969 3822 2218 453 24810 939 21731 499 1307
NM_022048chr1596139 5321 5092 1435 1144 457 421 292 81 1451 --23913 2195
NM_022648chr2164168 3542 3410 3217 3166 3079 2970 941 500 429 313 213 139 114 93 38 --13732 --
NM_024408chr1122993 2781 2462 1452 1439 839 769 731 370 128 78 67 ----12545
NM_024607chr8134529 4162 4015 3786 3762 3702 3586 1448 1022 321 87 77 71 ------
NM_024761chr9115109 4779 3930 3794 3780 3532 3482 2116 1907 705 24 ----1803
NM_024947chr3119234 8784 8438 7880 7639 6385 3246 3234 3198 2763 2701 --19541 --
NM_025179chr1154379 3603 3371 3160 3126 1731 1698 1264 807 247 191 139 131 71 28 --24574 4122 14507
NM_030806chr1208593 8377 7647 7587 7516 6918 6795 6198 5771 3675 3228 3147 2662 1846 1670 1520 1153 963 505 115 26828 3071 19024 --
NM_031427chr14135278 5111 5096 4773 4672 4517 1889 1421 1373 1076 1027 473 410 --33715 2014 1032 --
NM_031468chr7187744 7634 7310 7297 6961 6245 6201 6140 5610 3183 2932 2922 2611 2432 2322 1806 1748 1288 --26379 5400 --
NM_032105chr1117926 7598 7437 6359 5951 5890 2755 2693 1302 1182 241 12512 35145 2760 1204 21310 998
NM_032486chr1682714 2067 2015 1891 1829 1067 908 198 12623 22374 1043 22670 2340
NM_052811chr1394167 3833 3774 3652 1889 1824 1284 769 742 1790 11084 1731
NM_052885chr1264855 3410 3297 1023 147 47 --1403 1152
NM_053016chr9157611 7479 7402 6982 6766 5986 5780 4961 3166 2624 2235 2131 1902 1278 912 16376 26781 6276 16639
NM_080669chr17164651 4153 4106 4086 4067 3772 3435 3290 3247 1913 1696 1334 1137 1026 516 477 11499 44456 4282 1622 1040 13777
NM_080676chr20102620 2582 2145 2023 1193 396 390 109 93 73 13313 --21112 53
NM_130385chr1192911 2628 997 844 414 350 297 260 122 --2266 189 1627
NM_130847chr11185462 4842 4711 4662 3791 3627 2129 2117 2065 2048 2007 1777 1750 1595 1052 933 219 79 1180 --24421 2214
NM_133170chr20197352 6992 6912 6515 6297 5856 5425 4917 3199 3042 2961 2918 2635 2542 2141 1251 1085 852 399 37937 6936 1901 26675 190 --
NM_133264chr1773932 3799 3555 3437 2981 2756 1052 11232 22914 1006 2901 893
NM_133265chrX82633 2592 2541 2415 1140 977 739 369 12571 --13313
NM_138288chr1421752 38 --12074 22022 487
NM_138444chr1384558 4238 3456 3154 1038 1029 1016 819 1531 34289 557 406 --
NM_138473chr12124786 4459 4094 4024 3960 3873 3664 1486 477 197 153 86 11007 --34693 3878 2023
NM_145259chr2106639 6309 6081 5641 2400 2025 1819 1093 1087 257 --37143 6741 537 --
NM_148170chr1195430 5391 5385 5013 4589 4254 3533 601 289 14387 1587 --
NM_148955chr15216460 6350 6217 6180 6140 5548 5499 5325 5249 5115 4897 4872 4738 4497 4419 4283 4160 1403 893 885 620 15517 --24767 2493
NM_152734chr6165485 5214 5183 4691 4453 4189 3552 3476 1810 1429 1399 970 925 874 462 206 12095 ----
NM_152826chr15216460 6350 6217 6180 6140 5548 5499 5325 5249 5115 4897 4872 4738 4497 4419 4283 4160 1403 893 885 620 15517 --24767 2493
NM_153035chr1133169 2905 2801 2651 2633 2528 2511 2289 1077 1029 981 561 144 22452 687 33202 2462 1056 --
NM_153050chr22164905 4336 4321 3855 3688 3679 3559 3292 3207 1900 1753 1226 595 407 385 270 --53783 3253 1546 1313 358 --
NM_153051chr22164905 4336 4321 3855 3688 3679 3559 3292 3207 1900 1753 1226 595 407 385 270 --53783 3253 1546 1313 358 --
NM_153456chr13116296 5177 5119 4912 4503 2279 1720 1676 1373 1366 163 --32284 1405 852 --
NM_173065chr1102701 2549 1353 1231 582 450 142 132 120 92 1464 1124 --
NM_173642chr1208246 8099 7856 7721 7131 6600 6420 6349 6221 5777 3568 3490 3460 3361 2778 1890 1198 1078 890 470 16911 16144 --
NM_173808chr183763 3142 2931 2910 2882 2870 2862 2772 44160 3781 2904 255 ----
NM_175624chr12117673 7175 6052 5737 3009 2919 2418 2072 1912 1705 1221 31774 1451 1326 32873 2372 2359 17203
NM_175625chr12117673 7175 6052 5737 3009 2919 2418 2072 1912 1705 1221 31774 1451 1326 32873 2372 2359 17203
NM_181481chr18116492 5487 4740 4297 2466 2281 2194 1999 1860 1297 425 1286 1853 1840
NM_181482chr18116492 5487 4740 4297 2466 2281 2194 1999 1860 1297 425 1286 1853 1840
NM_181483chr18116492 5487 4740 4297 2466 2281 2194 1999 1860 1297 425 1286 1853 1840
NM_198484chr3136160 6072 5986 5723 5497 4843 4426 4097 2093 1372 1263 724 648 1603 35044 4290 2464 --
NM_198595chr453607 3541 1483 393 344 --11309 24511 4184
NM_206855chr675839 5173 4550 4337 4065 2139 92 25569 5497 35479 4822 4636 --
NM_206909chr8147477 6834 5696 5304 5206 3179 2667 2560 2507 2053 1374 1048 608 235 33249 2746 1560 15257 --
NM_213589chr2115443 5429 5258 4761 3874 3468 1675 1223 1109 894 293 22165 380 14504 --
NM_213590chr1394167 3833 3774 3652 1889 1824 1284 769 742 1790 11084 1731