TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-142-3p
miRNA Sequence: UGUAGUGUUUCCUACUUUAUGGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr5----1625 1317
NM_000059chr132578 83 ------
NM_000080chr17--1731 --1786
NM_000081chr171292 1181 733 565 391 259 226 --11866 --
NM_000084chrX96581 6262 5780 2427 1707 1679 1415 217 111 32593 1540 152 --140
NM_000125chr664150 4004 3346 3289 3258 1345 14056 --23562 660
NM_000138chr1521667 131 12609 --1573
NM_000153chr1431282 464 309 11490 2620 216 11695
NM_000163chr51288 11578 --1590
NM_000167chrX11769 11313 188 --
NM_000176chr532898 2519 652 1141 ----
NM_000245chr772170 1897 1741 786 471 107 56 21681 591 --22065 1564
NM_000246chr1641063 919 753 42 1984 ----
NM_000259chr1575424 2507 1898 1342 784 549 413 34727 1281 680 22228 1312 --
NM_000264chr942937 2488 688 510 ----12402
NM_000276chrX61834 1678 885 788 628 375 1578 ----
NM_000297chr431292 1257 583 11663 175 11996
NM_000321chr1371631 1520 1157 1137 662 558 26 --1671 --
NM_000325chr43494 482 95 1206 1276 --
NM_000362chr2233256 959 60 1540 23119 920 --
NM_000368chr974460 4262 3600 2983 1326 1265 723 --13237 1978
NM_000430chr17103552 2940 2637 2490 2478 1452 868 793 763 295 1909 ----
NM_000437chr141898 1630 1527 577 --1133 --
NM_000461chr364253 4015 3347 1550 342 37 ----14400
NM_000484chr213906 836 53 ----1225
NM_000489chrX73436 3261 3235 2802 2555 2147 920 --1604 --
NM_000555chrX127471 6473 6284 6028 5452 2327 2288 1774 1343 1110 885 876 16166 11420 11732
NM_000600chr7----1124 --
NM_000618chr1286612 6334 5444 2523 2476 1781 832 340 25367 1754 15890 16071
NM_000633chr1845097 4672 1487 238 --11871 --
NM_000719chr1224452 2191 14707 26643 1874 14903
NM_000724chr1021833 1630 --21653 640 192
NM_000767chr1941179 977 368 252 21106 295 11385 --
NM_000809chr4179264 9101 9009 7469 7385 7263 6911 6164 6073 3455 2419 2399 2099 2041 1701 515 385 1704 ----
NM_000813chr5105036 4761 4589 3868 2158 1574 1453 419 184 106 14531 1445 --
NM_000814chr1543880 3812 2553 40 ------
NM_000824chr4------2302 251
NM_000868chrX1162 12600 11734 --
NM_000872chr1011168 --1120 11574
NM_000875chr1554683 4288 2788 2377 1809 37055 6499 470 ----
NM_000880chr81331 1884 --1851
NM_000899chr1241462 1295 754 21 2825 642 14229 --
NM_000901chr442479 1758 1644 1021 --21950 713 --
NM_000912chr853270 2779 850 591 77 ------
NM_000919chr52590 488 --1602 --
NM_000944chr432428 1514 430 --1153 --
NM_000945chr211911 11690 ----
NM_000949chr5----2260 99 157
NM_000950chrX73607 3572 2969 840 374 220 42 174 ----
NM_000966chr122380 278 ----1718
NM_001001323chr1262663 1067 954 933 311 119 1264 ----
NM_001001331chr352465 2212 1093 976 853 ------
NM_001001395chr1262296 1905 1014 580 537 528 32347 1050 39 ----
NM_001001419chr531247 742 539 11538 1532 1964
NM_001001481chr852639 2463 2166 1194 856 --2933 483 11359
NM_001001484chr1022458 317 1756 1689 11798
NM_001001664chr274141 3246 2760 2709 1192 342 304 --22585 534 --
NM_001001933chr11535 ----1578
NM_001002006chr2--1218 2742 328 --
NM_001002838chrX61888 1334 1298 1261 657 302 --11768 1203
NM_001002860chr1464674 4635 3012 1593 1162 434 24613 3849 24346 3884 11417
NM_001003682chr131286 949 481 --1574 1935
NM_001003698chr6--11533 21301 1209 --
NM_001003712chr1253894 3830 2929 705 165 --1497 --
NM_001003800chr933507 3126 420 ------
NM_001004342chr166006 5678 5001 4947 4608 580 15413 36113 3714 250 --
NM_001004722chr22919 405 ----21017 104
NM_001005463chr1072097 1927 1678 786 720 672 577 ----11750
NM_001005473chr565934 4977 4901 4426 178 61 --46230 5969 5411 4247 --
NM_001005751chr101103 ----1176
NM_001005753chr231662 1483 818 172 --1323
NM_001006658chr12734 198 --1551 --
NM_001007024chr1723537 2926 33350 705 528 33258 2715 1701 --
NM_001007098chr13803 647 576 1628 1375 --
NM_001007257chr131296 1035 71 ------
NM_001007278chr1355140 4357 4153 3838 1448 1438 --13315
NM_001008239chr1821187 402 --43378 3174 1258 638 --
NM_001008388chr44864 760 114 70 ----1829
NM_001008541chr1021711 686 --11747 1348
NM_001008660chr111576 ------
NM_001008738chr562725 2603 2353 1114 984 895 21878 318 21008 770 --
NM_001008925chr433328 2912 1318 12160 1509 12253
NM_001010888chrX84133 3856 1393 699 472 368 58 47 54168 3348 2967 487 296 1226 --
NM_001010908chr103212 167 41 ------
NM_001010986chrX167 12504 1346 11898
NM_001011666chr724482 933 76581 4908 1971 1611 1405 1090 1060 --25894 4940
NM_001012393chr1173963 3444 1222 1178 971 964 676 --35105 545 65 11668
NM_001012398chr162332 184 --1862 --
NM_001012614chr4--1102 --1281
NM_001012753chr1961026 942 858 504 152 68 ----1422
NM_001012968chrX21966 744 11025 22313 691 --
NM_001012989chrX3557 499 148 ----197
NM_001013438chr33819 717 390 ----1193
NM_001015877chrX53101 2354 1908 1111 939 --21217 242 --
NM_001015880chr1021542 1436 ------
NM_001017371chr22561 137 --11396 --
NM_001017926chr831497 528 212 --11450 --
NM_001018064chr91335 ------
NM_001020658chr12616 534 ----11514
NM_001024460chr631064 907 182 --1223 --
NM_001024463chr1531168 450 389 ----21027 174
NM_001024647chr1297432 6608 6280 4972 4923 2528 2243 1840 1045 57661 7043 6844 2968 683 24707 196 --
NM_001024847chr312316 11008 ----
NM_001024947chr51176 --1833 --
NM_001024948chr143042 2887 1034 121 12213 22876 2206 --
NM_001024956chr1185388 5189 4498 2028 828 537 417 142 43997 3760 858 508 24230 625 --
NM_001025077chr1087259 7129 5932 5752 3012 633 422 376 36957 5730 556 26609 3003 --
NM_001025201chr2----1466 --
NM_001025242chrX11042 ----11285
NM_001025580chrX43693 3190 1236 775 21295 1267 14288 --
NM_001029858chr663254 2756 2713 2311 762 249 11267 --13271
NM_001029863chr643004 2586 2356 1185 --12225 --
NM_001030006chr173199 146 100 ----22038 397
NM_001030055chr1454196 3982 3822 3174 1261 14038 --21372 162
NM_001030272chr112392 47 ----1359
NM_001031679chr1223043 628 21095 917 1621 --
NM_001031695chr2295412 4430 4142 3653 3371 1456 1337 359 165 15040 --23869 1345
NM_001032282chr8--21176 78 1414 --
NM_001033057chr321994 809 11354 11932 --
NM_001033085chr21105 --1224 --
NM_001033506chr111431 --145 --
NM_001033561chr17--1701 ----
NM_001034845chr4----1531 --
NM_001037132chr72802 77 1660 1382 --
NM_001037339chr131278 1271 303 21542 574 --21764 1439
NM_001037631chr22935 743 1198 11099 --
NM_001037954chr1133165 2220 87 12908 21282 608 --
NM_001039348chr241051 686 212 65 --1256 --
NM_001039538chr273544 3266 2337 2317 945 366 209 1324 1728 --
NM_001039590chrX33175 1594 573 23590 352 --13754
NM_001039618chr1174985 4497 4453 4432 1693 1303 591 ------
NM_001039840chrX66015 3950 1688 1362 1192 934 --21627 619 --
NM_001040057chr731243 1009 400 ----1240
NM_001040142chr232328 1970 1640 1864 1237 12184
NM_001040181chr331081 996 777 ------
NM_001040202chr492535 2313 2215 2183 2066 1749 679 570 69 ------
NM_001040214chr661905 1620 1453 871 398 150 --1636 --
NM_001040272chr932124 813 418 --12067 --
NM_001040284chr1675701 5412 5396 2120 1435 833 97 25692 4696 1575 --
NM_001040402chr421144 991 13101 12103 1214
NM_001040613chr81238 11167 ----
NM_001040712chr943030 2765 2322 2247 22493 32 ----
NM_001042388chr18----1193 --
NM_001042403chr1221028 827 ----1106
NM_001042404chr151928 1824 633 473 29 ----11269
NM_001042473chr1021753 276 31964 1502 165 ----
NM_001042555chr1264701 4226 2969 1500 184 85 13743 1201 --
NM_001042599chr2117534 7412 5676 5614 5503 2649 1554 1286 1039 790 168 16831 37389 7186 909 --
NM_001042762chr721013 780 1734 1808 --
NM_001043318chr1434075 3384 3025 22885 2680 13914 --
NM_001046chr562784 2499 2484 2134 1953 79 12352 1454 12842
NM_001078chr1----133 --
NM_001081472chr1------1318
NM_001100108chr163341 2959 2612 1916 1692 1186 15654 28166 2463 --
NM_001116chr1623103 2796 --21948 396 --
NM_001126chr1199 --1773 --
NM_001148chr462198 2142 762 618 601 88 --1515 --
NM_001149chr1051390 550 503 386 125 --1454 1879
NM_001167chrX96778 6549 6330 5891 5492 5033 1807 599 255 45419 4914 1927 1707 21314 673 11657
NM_001172chr142737 75 --1167 --
NM_001179chr4----1198 --
NM_001186chr2152877 2590 2419 2246 827 12396 22664 2284 --
NM_001191chr2021230 460 194 ----
NM_001201chr443903 1147 299 92 33815 2880 1279 ----
NM_001202chr14------198
NM_001204chr2137618 7604 7234 7046 6356 5773 5736 5441 4795 1476 1405 1369 1203 ----17442
NM_001206chr962995 2562 734 704 396 121 ------
NM_001304chr17113400 3154 3066 2962 1426 1271 1245 1054 828 637 387 ----171
NM_001332chr51371 ----1516
NM_001356chrX32125 1891 808 12438 1105 --
NM_001364chr1193948 3630 1854 1716 1296 942 689 515 397 --23603 68 14560
NM_001390chr1853496 3453 3103 1432 528 12246 ----
NM_001391chr1861177 958 908 404 168 97 ------
NM_001396chr211107 32456 362 117 12057 --
NM_001408chr121544 593 1218 11677 --
NM_001430chr252010 1963 1872 1753 334 --1103 --
NM_001438chr133193 2773 926 22888 1284 --12723
NM_001455chr634433 4113 3475 --14734 --
NM_001458chr7----1655 2116 56
NM_001527chr623096 1492 54128 3268 2973 586 367 197 11716
NM_001616chr293391 2860 1404 1398 973 632 566 351 24 11159 ----
NM_001627chr342187 1925 902 338 1863 ----
NM_001668chr1----1895 --
NM_001677chr11128 1346 ----
NM_001690chr322563 2481 1695 1260 --
NM_001839chr1----199 --
NM_001881chr103485 371 321 ------
NM_001914chr182273 32 ------
NM_001938chr11695 ------
NM_001949chr622351 2283 12437 12735 --
NM_001995chr431329 423 256 --21355 171 --
NM_002009chr1532043 1080 464 ----1176
NM_002015chr1363146 2456 2289 2203 2174 474 33048 280 258 ----
NM_002025chrX98366 3651 3187 3135 2882 2242 2013 1516 1021 16378 38399 1505 306 23345 170
NM_002039chr41849 --2710 367 --
NM_002069chr741235 711 409 314 ----1491
NM_002072chr9198 --1862 1858
NM_002078chr3----1598 --
NM_002126chr1763502 3238 3188 1315 745 513 ------
NM_002128chr1341919 965 887 850 --1156 --
NM_002137chr712393 --1208 --
NM_002148chr2------1529
NM_002158chr252993 2390 1196 759 100 ----13152
NM_002210chr242876 714 476 288 --12279 1456
NM_002214chr795615 5545 5254 4150 811 778 733 628 207 21237 377 14809 15008
NM_002221chr142602 2483 2074 195 1117 ----
NM_002235chr1231268 123 74 --11638 --
NM_002264chr335024 379 273 34257 3824 1919 11482 --
NM_002267chr1332194 2112 171 11608 --11915
NM_002270chr565684 4659 3622 3495 1478 781 13568 25420 1245 --
NM_002310chr596028 5859 5378 5338 4892 2315 1077 661 139 26147 124 ----
NM_002336chr1253904 3851 3660 1051 519 --13079 --
NM_002356chr622564 2031 ----1562
NM_002376chr14154 1178 --1387
NM_002395chr651269 560 340 296 264 --1451 --
NM_002397chr51852 --12028 1688
NM_002398chr231432 619 517 ------
NM_002399chr1511380 ------
NM_002480chr1221505 988 1553 --11392
NM_002500chr23410 147 90 --1813 --
NM_002515chr1441750 783 748 353 ------
NM_002546chr82793 104 ------
NM_002547chrX42911 905 532 247 --23676 2941 13716
NM_002556chr111217 12007 ----
NM_002581chr944317 3715 2188 1994 12197 1454 13979
NM_002595chr1271935 1517 1450 763 669 538 113 --1597 --
NM_002605chr151177 --1452 --
NM_002628chr331043 969 818 ------
NM_002645chr1163134 2946 2536 2494 2434 270 ------
NM_002655chr885129 4536 4085 3907 1821 1563 1497 221 21760 25 --25150 3610
NM_002667chr63870 416 326 ----11249
NM_002709chr253529 3398 1018 705 176 1565 11406 --
NM_002718chr352415 2276 861 481 125 21065 967 12531 12163
NM_002731chr143108 2313 1144 571 ------
NM_002737chr1776659 5684 5581 5030 4536 850 189 24753 1532 ----
NM_002738chr162327 228 ----1773
NM_002740chr312122 --22766 187 21049 301
NM_002745chr2254201 3722 1328 1202 439 --11008 --
NM_002822chr123332 233 28 11594 --11599
NM_002835chr7------1158
NM_002844chr61979 ------
NM_002852chr3------1453
NM_002865chr8------1296
NM_002866chr19------1642
NM_002869chr1142074 1655 1510 40 ----11497
NM_002906chr1162292 2065 1785 692 287 161 ------
NM_002941chr331649 1262 350 --1513 --
NM_003028chr933868 2899 1072 1133 31420 1354 1286 13910
NM_003108chr236991 6765 4591 14644 15732 --
NM_003112chr732904 2047 223 1601 ----
NM_003128chr252732 2412 856 697 523 --179 --
NM_003161chr1743368 3270 2932 2478 22777 114 11315 12300
NM_003202chr52595 121 11228 --11799
NM_003221chr643700 3615 2838 351 12912 13838 --
NM_003253chr2131331 1215 1188 11662 1695 --
NM_003257chr152361 278 11351 --2190 102
NM_003274chr211992 --12657 22887 2626
NM_003298chr366243 5840 5291 1294 842 393 15956 16221 --
NM_003348chr1231167 540 148 ----197
NM_003392chr373691 3658 3135 1162 1133 1030 808 32918 1550 972 --13870
NM_003400chr21812 --1854 --
NM_003404chr204779 722 690 277 --11290 11572
NM_003413chrX--1466 1237 --
NM_003453chr13------1267
NM_003473chr103400 162 67 ----1984
NM_003478chr1122946 162 13229 --33137 3109 2046
NM_003483chr121451 1376 32521 2306 533 165
NM_003489chr2143222 2617 177 160 12584 13270 12099
NM_003507chr211778 --31670 1649 559 --
NM_003558chr91495 1109 2682 193 --
NM_003618chr251232 1059 919 277 59 21088 53 2457 46 --
NM_003622chr124804 391 189 23 22314 880 12635 --
NM_003672chr151685 1229 611 327 134 1562 11967 1403
NM_003795chr62572 115 1427 --1246
NM_003796chr19----1417 --
NM_003831chr1831791 1524 193 21634 1196 ----
NM_003872chr223064 2694 --12737 --
NM_003884chr351463 1268 1241 696 227 ----11148
NM_003887chr241773 900 535 123 11579 ----
NM_003934chr92843 833 ----1126
NM_003941chr741826 579 284 44 42279 570 519 407 2345 52 --
NM_003948chr492653 2570 2003 1720 1640 948 716 381 226 1759 22470 2154 --
NM_003971chr171446 --1620 --
NM_004064chr1281312 1106 1093 889 501 249 157 49 ----11013
NM_004077chr1241300 1283 838 288 --1545 --
NM_004098chr10--11019 --11252
NM_004124chr1453423 2683 1251 1076 767 13097 1839 --
NM_004133chr832171 1993 1945 129 ----
NM_004136chr1552936 2659 2525 2489 372 ------
NM_004161chr211326 199 2562 491 --
NM_004170chr931774 1444 87 11340 21847 66 --
NM_004171chr1169144 8789 8024 6386 6135 1801 37797 6648 2011 --23847 3054
NM_004172chr552020 1920 1855 1764 1483 172 --11819
NM_004232chr1853452 2532 990 708 484 11119 23362 2838 --
NM_004239chr14------154
NM_004241chr103772 535 76 1220 ----
NM_004274chr1473125 2938 2776 2683 1244 537 121 11182 11125 --
NM_004311chr10160 1657 --22112 1932
NM_004342chr752018 1969 1591 722 587 1155 --1824
NM_004388chr11106 ------
NM_004393chr352128 812 633 384 126 --1647 --
NM_004432chr952115 1882 1644 561 75 --22204 878 --
NM_004438chr242986 1177 961 326 12796 22800 289 --
NM_004440chr62771 241 11656 2732 506 --
NM_004449chr21--1181 11210 --
NM_004458chrX12031 12215 21918 431 --
NM_004464chr473417 3005 2717 1698 843 718 111 1580 1967 --
NM_004501chr153810 2857 1498 1455 1324 --11468 --
NM_004504chr242865 2389 2113 1036 12404 --149
NM_004519chr8------1223
NM_004525chr24973 535 469 239 --11421 --
NM_004586chrX65350 5145 1128 1051 294 100 --14239 --
NM_004588chr1133781 1517 1452 33265 1459 1364 22457 1074 --
NM_004593chr3------1833
NM_004612chr994756 3603 3583 3484 3315 1761 1528 581 200 11320 --24301 613
NM_004622chr252422 2242 2038 1642 561 --1105 --
NM_004627chr212487 73 1592 ----
NM_004660chrY32050 1822 334 22309 919 1104 --
NM_004663chr1521307 1224 11173 ----
NM_004712chr17------134
NM_004723chr1----2362 44 --
NM_004774chr1732811 2510 2239 22316 1011 --13141
NM_004781chr131596 499 301 --1404 --
NM_004788chr1142478 2310 2018 807 ------
NM_004800chr13------1184
NM_004805chr22422 276 11087 11247 --
NM_004822chr1754032 3842 3221 1513 668 --11010 --
NM_004842chr611550 ----11746
NM_004850chr22558 543 21751 400 --1286
NM_004867chrX2602 65 1157 ----
NM_004872chr1--1104 --1435
NM_004926chr1431761 1723 104 11142 1407 --
NM_004932chr541766 588 74 34 1320 ----
NM_004985chr12134510 4406 3117 3073 2909 1347 1278 940 674 560 530 91 33 ----23532 61
NM_004992chrX87925 7766 7714 6948 6824 3314 2671 983 17416 1290 --
NM_005110chr52313 254 ------
NM_005121chr1773752 3583 3191 3104 3077 2919 2777 13048 13729 --
NM_005126chr361738 618 487 410 261 245 ------
NM_005156chr922122 1466 1999 --15286
NM_005180chr1031517 617 128 21080 67 --1357
NM_005244chr201519 ----1619
NM_005259chr221022 547 --11306 --
NM_005324chr1731886 1859 738 --1505 --
NM_005359chr1835692 4146 867 12154 --11004
NM_005400chr232617 1072 1049 --2993 254 --
NM_005402chr761816 1647 1264 1253 1182 37 ------
NM_005436chr1093958 3277 1172 1116 1044 960 944 187 129 1462 ----
NM_005445chr10----1291 --
NM_005475chr1252481 623 418 354 114 --12945 --
NM_005502chr962884 1990 1226 1144 1136 132 1178 12689 1935
NM_005506chr452821 2320 1940 1804 309 22709 2053 11962 --
NM_005512chr11------11976
NM_005539chr101207 21264 1069 11257 21201 548
NM_005566chr11----1475 --
NM_005578chr343842 817 775 63 11831 24198 500 13474
NM_005587chr153870 685 348 ------
NM_005596chr9105415 5324 4758 4226 3986 2576 2478 2229 1339 495 11559 11482 --
NM_005604chr632225 1792 177 1530 ----
NM_005639chr1271713 1564 1460 1341 482 270 193 11599 11404 11760
NM_005647chrX12737 ----1452
NM_005685chr7------1120
NM_005737chr211167 11941 12314 --
NM_005739chr1572439 1793 1698 941 933 496 88 21611 541 ----
NM_005746chr722391 635 1836 --188
NM_005776chr14--1799 1722 --
NM_005786chr1841188 284 57 37 --1272 --
NM_005797chr1121374 643 11429 21789 294 --
NM_005824chr73669 200 191 1219 ----
NM_005896chr2----3798 677 614 --
NM_005935chr464629 4282 3304 698 397 178 11495 11423 24082 3730
NM_005955chr135533 5218 1362 13999 34779 4251 3831 14315
NM_005964chr17----11120 11142
NM_006047chr2042702 2567 1346 1231 --12642 13136
NM_006135chr131417 994 374 --11436 --
NM_006141chr1642647 2346 2004 583 ------
NM_006164chr22355 52 ------
NM_006206chr432750 2704 1892 --22521 665 --
NM_006246chr1421133 884 --124 --
NM_006256chr162804 2272 2092 1892 1879 1079 --22243 486 --
NM_006313chr12179 --1443 --
NM_006315chr454527 3383 1212 973 548 13150 1163 --
NM_006320chr42166 142 1791 ----
NM_006345chr43913 180 85 ----1203
NM_006352chr12606 589 ----2796 311
NM_006364chr1411285 1293 2891 871 --
NM_006373chr1711409 ------
NM_006380chr1774336 4163 3757 3332 2989 2946 107 13515 13954 13347
NM_006439chr4----1572 --
NM_006451chr52698 679 --1151 --
NM_006526chr20----32137 1995 1582 1163
NM_006549chr12------1833
NM_006587chr421491 37 1130 11407 --
NM_006599chr16108293 8029 7299 7281 6730 6607 5068 2467 1989 1397 12386 1911 16138
NM_006601chr12----1758 --
NM_006609chr222560 1082 --12571 1648
NM_006624chr1012033 11869 1410 --
NM_006682chr752437 2208 1794 1077 245 1570 ----
NM_006699chr142716 1871 867 278 41770 1740 983 55 ----
NM_006750chr1677657 7265 6108 5151 915 893 723 37529 2035 1756 17732 18037
NM_006754chr7142 --1382 --
NM_006761chr174871 798 273 241 ------
NM_006775chr632972 2168 2050 1542 2775 678 --
NM_006807chr1711009 ----11338
NM_006823chr851012 954 524 490 456 --1568 --
NM_006826chr221079 914 ----1139
NM_006861chr1222122 32 11322 --11443
NM_006874chr43307 292 275 ------
NM_006885chr1664259 3212 3173 2726 1572 1408 13297 ----
NM_006902chr162890 2453 2399 1247 882 828 ------
NM_006914chr941406 235 102 92 1143 ----
NM_006915chrX--22181 1863 ----
NM_006916chr2------1331
NM_006930chr571480 1317 753 743 722 714 306 --11446 --
NM_006940chr1231591 96 80 ----1703
NM_006999chr531845 1832 1684 ----11432
NM_007007chr12104796 4045 3923 3732 3426 1746 1614 1537 1345 1158 13010 13982 --
NM_007011chr1566778 6625 6148 4415 2053 1030 16863 15268 --
NM_007024chr31191 --1148 --
NM_007038chr21125926 4788 4641 4598 4586 3932 2305 2140 1119 1000 252 173 11716 26088 5514 11543
NM_007047chr642469 2354 1839 1712 1416 1980 --
NM_007050chr2067395 5609 5314 5093 2361 457 ----27988 7452
NM_007106chr1341125 577 449 138 1603 12701 --
NM_007124chr62571 154 ----11870
NM_007125chrY11182 ------
NM_007159chr331734 1101 317 --11152 --
NM_007202chr17--2665 98 1246 --
NM_007214chr611286 --21341 1038 --
NM_007220chrX64249 3939 1425 1288 504 47 63286 1303 1092 968 454 294 --14306
NM_007246chr4----1853 --
NM_007375chr142466 1044 731 701 ----1268
NM_012074chr142432 424 --11101 --
NM_012081chr563519 3389 3339 2923 2289 596 12686 1689 --
NM_012095chr1052754 2296 573 62 49 13240 1780 12581
NM_012120chr663032 545 421 378 334 51 1706 1262 11167
NM_012124chr113884 128 30 --1605 --
NM_012175chr11126 1592 1659 1148
NM_012214chr2105956 5488 4839 2085 1818 1595 1180 1161 606 266 11501 192 1578
NM_012234chr373330 2800 2775 2331 2285 550 448 --13621 1315
NM_012257chr7------11048
NM_012297chr452388 2276 1880 159 38 --22447 2041 --
NM_012309chr1153473 3435 3427 3241 1821 ----13258
NM_012316chr155629 4562 4450 4127 3624 14854 --1253
NM_012329chr1731650 600 220 1301 1431 11694
NM_012343chr52931 367 ------
NM_012388chr1552128 939 803 616 425 11224 ----
NM_012421chr11325 ----2423 42
NM_012433chr2------1221
NM_012471chrX31372 217 90 1755 --1599
NM_012474chr12221 63 --195 --
NM_012479chr752213 1774 577 224 39 --1956 1607
NM_013231chr1421301 1262 13160 1461 24380 3647
NM_013261chr463333 2980 2465 1490 1248 1122 22845 922 11003 --
NM_013275chr16----1772 1665
NM_013281chr2051494 1136 1085 1041 89 ----11334
NM_013381chr1231912 824 82 --11925 1727
NM_013436chr24803 664 513 258 1165 ----
NM_013446chr7----1569 --
NM_013448chr14161 1122 ----
NM_013995chrX22307 2026 --12383 --
NM_014016chr351339 1323 1306 1175 418 --11200 --
NM_014023chr1042584 2295 2119 1153 21929 311 1911 11886
NM_014039chr1171357 1131 1078 959 513 254 165 ------
NM_014112chr865332 3700 2026 1266 886 376 ----13430
NM_014117chr162607 62 --1743 --
NM_014141chr744513 3582 3516 490 13894 31707 1161 1112 11732
NM_014240chr353946 3781 1412 1225 646 23333 1463 21108 170 --
NM_014243chr421553 1356 11447 12112 --
NM_014271chrX1695 2753 206 ----
NM_014283chr1------1469
NM_014289chrX1510 11429 11433 1439
NM_014319chr1221830 255 --11464 --
NM_014323chr221808 --11083 1248
NM_014331chr476505 6139 6032 5979 5766 888 597 12798 25403 2790 1392
NM_014382chr31126 --1323 1616
NM_014415chr3144 --1346 --
NM_014423chr585678 5401 3613 3456 1479 1226 93 43 1758 --25301 717
NM_014445chr312441 1631 22281 635 --
NM_014469chr112783 699 ------
NM_014504chr7--157 1184 --
NM_014584chr1421546 548 --21600 189 --
NM_014612chr931353 1070 418 --11053 --
NM_014663chr1------11082
NM_014666chr531340 1229 426 ------
NM_014667chr321860 485 ----22011 759
NM_014673chr8124 ----1100
NM_014679chr11--1139 --21162 982
NM_014686chr1942379 2046 1780 888 11682 3840 741 568 --
NM_014729chr832054 1661 1550 ------
NM_014752chr1111307 --1457 11210
NM_014765chr12968 110 --22101 223 --
NM_014795chr231248 1143 383 2448 325 168 --
NM_014803chr10--22321 552 --12329
NM_014830chr1253479 2825 1492 1411 611 --21527 1358 12700
NM_014873chr143865 3645 942 640 53917 3271 3022 1276 1112 ----
NM_014899chr532327 1960 952 ----22997 22
NM_014903chr124823 742 244 79 --1563 --
NM_014904chr1063285 2592 1381 1371 1169 1161 1107 32649 432 93 --
NM_014906chr1763272 3190 2997 950 468 51 12868 --33495 2984 865
NM_014912chr1052465 1398 1257 853 65 ------
NM_014924chr1412903 156 32661 2181 778 --
NM_014932chr3----11664 --
NM_014935chr143528 2653 2470 231 --23307 440 --
NM_014943chr851191 938 860 356 220 --11156 --
NM_014961chr41327 2557 77 ----
NM_014962chr2062740 2528 2229 1797 1761 1092 11014 --1816
NM_014992chr141324 170 174 1752
NM_014999chr1231646 1525 87 1308 --21500 144
NM_015017chr131150 1064 836 2824 297 ----
NM_015032chr1352638 2536 2465 960 489 1590 --1934
NM_015042chr1573988 1275 922 898 749 463 331 --13462 --
NM_015045chr1021828 836 1187 12095 --
NM_015069chr16------175
NM_015074chr154787 4771 3403 3116 1589 14205 24934 1699 --
NM_015076chr6104363 4137 4101 3529 3402 1652 1304 863 465 337 14019 ----
NM_015092chr1621349 147 11757 --1596
NM_015093chr641324 334 237 80 ----1405
NM_015097chr312348 12199 11627 --
NM_015100chr1------11618
NM_015132chr721369 178 ------
NM_015141chr332499 2466 2292 21724 583 1475 --
NM_015153chr6------1583
NM_015176chr1----1417 --
NM_015187chr42950 335 ----1886
NM_015191chr1122597 2580 --22688 849 22038 926
NM_015192chr2062771 2701 2391 2354 1198 77 12382 22588 413 --
NM_015199chr372664 2529 2482 1139 706 346 288 --32352 511 321 --
NM_015215chr142543 2337 2134 419 ------
NM_015236chr431470 1247 1122 1991 ----
NM_015245chr652420 2356 1728 799 61 --11830 --
NM_015252chr22370 118 1854 ----
NM_015262chr101103 ----1176
NM_015265chr262327 2159 1803 864 767 243 11774 1725 --
NM_015267chr121440 ----1512
NM_015268chr33683 528 175 --1647 --
NM_015271chr454074 3494 3322 3228 3175 21056 42 ----
NM_015278chr643084 2690 1173 1115 11331 1460 --
NM_015313chr1183608 1335 1273 1063 907 755 237 188 21694 562 --11344
NM_015315chr543365 3285 2805 2148 --11163 --
NM_015328chr762503 2200 827 500 494 60 --1861 --
NM_015336chr1232182 776 766 --1186 --
NM_015339chr201973 ----1738
NM_015344chr842062 2023 1961 152 ------
NM_015347chr1292863 2355 1910 942 852 791 658 623 481 --1972 --
NM_015355chr1731979 495 33 21508 180 --1578
NM_015358chr212950 166 ----1855
NM_015375chr185047 4778 4544 4101 3716 3680 3104 1365 34359 1977 88 --1351
NM_015378chr12781 420 12734 12924 --
NM_015419chrX1378 ----1739
NM_015455chr573533 3471 3066 1161 970 652 347 13544 11206 --
NM_015466chr3------132
NM_015475chr21391 1892 ----
NM_015483chr741145 980 865 452 1841 11095 --
NM_015503chr161671 ----1529
NM_015508chr33467 436 100 --11039 --
NM_015516chr11------11459
NM_015534chr13778 286 236 ------
NM_015550chr731321 298 26 23117 3085 12900 23094 1257
NM_015569chr164527 4196 3728 3198 877 453 --11394 --
NM_015906chr174729 4529 3434 2994 1518 1458 911 34351 4261 2965 23683 637 13820
NM_015995chr1555077 4596 4367 1809 852 25391 759 ----
NM_016072chr1232136 838 746 22159 397 --12249
NM_016076chr132822 2149 936 11267 ----
NM_016081chr451705 481 277 235 172 1614 12179 --
NM_016094chr31545 --1775 --
NM_016107chr51412 11288 ----
NM_016121chr13847 85 73 ------
NM_016131chr242065 1849 292 34 11507 ----
NM_016132chr1542868 2851 2666 960 1277 1548 --
NM_016133chr2--21613 252 11525 --
NM_016141chr32544 196 --1646 --
NM_016221chr561730 1702 1579 1476 1454 112 ------
NM_016231chr1761727 1629 1291 1071 129 21 ------
NM_016271chr1831486 719 199 ------
NM_016275chr362505 2393 2050 956 795 69 12297 22512 296 --
NM_016289chr21184 --2754 92 --
NM_016351chr7--179 --1228
NM_016357chr1241069 944 191 54 --2407 359 --
NM_016376chr1764309 4189 3196 3057 1615 531 11443 ----
NM_016396chr1522293 78 ----22719 1894
NM_016422chr1153038 2073 2040 817 456 21990 1184 1316 --
NM_016441chr232168 1684 1643 ----12029
NM_016467chr211129 --21361 1154 --
NM_016530chr1541413 1337 792 428 ----13849
NM_016531chr453723 3347 3050 3036 1377 --23863 1230 --
NM_016607chrX21238 185 ------
NM_016620chr151422 1317 584 95 73 1936 11099 --
NM_016626chr1831122 169 24 21593 399 1439 11482
NM_017420chr1423178 871 21363 1189 13841 --
NM_017580chr1012255 ------
NM_017610chr1551897 1692 1573 790 396 ----12038
NM_017628chr474944 4486 3361 1742 1673 673 658 15182 --24136 3592
NM_017629chr12563 203 1630 1734 --
NM_017633chr6----11520 --
NM_017637chr9118024 7956 7498 5995 5715 3118 2689 2631 1265 721 183 27145 5860 12369 1836
NM_017640chr6----1848 1887
NM_017658chr1464564 4273 2872 1721 1248 1232 ----11789
NM_017709chr163283 3226 2963 2904 289 267 ----1227
NM_017736chr1631953 985 657 ------
NM_017745chrX----193 --
NM_017778chr841449 1256 1103 263 --11159 1367
NM_017799chr1411477 ------
NM_017810chr16----3731 680 472 --
NM_017902chr1095584 4388 4048 3817 2232 1254 1008 974 889 21121 475 ----
NM_017944chr1142870 2683 603 59 1197 23085 439 --
NM_018017chr1022434 407 1873 11984 1286
NM_018018chr1231488 1251 675 --11386 --
NM_018028chr191380 ----11062
NM_018051chr7----1302 --
NM_018084chr262782 2037 1300 1007 703 207 12693 ----
NM_018087chr1--128 132 --
NM_018121chr1052544 2444 1018 919 572 ----13157
NM_018159chrX11682 --1331 --
NM_018169chr12----1531 --
NM_018179chr12------1131
NM_018181chr181485 1450 ----
NM_018184chr341876 1362 415 140 11717 21627 1542 --
NM_018244chr2011252 11241 --11132
NM_018287chr1021089 300 11047 ----
NM_018293chr392653 2551 2166 1993 1064 942 874 832 538 156 ----
NM_018312chr113746 298 94 ----11445
NM_018325chr9--1180 11490 1136
NM_018351chr1263592 3559 1862 1197 329 242 21516 920 196 --
NM_018362chr1183103 2564 1545 1198 1109 829 737 664 42811 2744 1580 492 ----
NM_018374chr774634 4533 1755 1613 951 709 320 25085 798 --14108
NM_018394chr31546 --1377 --
NM_018403chr353613 3193 1298 1280 652 12991 1971 --
NM_018416chr1212410 1146 42320 729 506 480 --
NM_018440chr8128248 7383 5859 5825 5529 3392 3253 2608 2173 2151 1746 1250 11208 --26383 1950
NM_018448chr1221239 1133 128 ----
NM_018469chr1731420 592 543 ----1986
NM_018475chr41643 ----171
NM_018482chr832277 2259 410 --1794 --
NM_018489chr121869 134 32166 2158 891 21938 1658 --
NM_018557chr221567 97 1215 11509 --
NM_018590chr1041327 669 207 44 11205 1128 --
NM_018685chr731069 209 126 ------
NM_018714chr17145 --138 --
NM_018945chr643260 2771 943 544 13016 22382 811 12504
NM_018952chr171195 --1476 --
NM_018962chr2111419 1565 41297 1247 140 78 --
NM_018970chr742631 1256 760 231 1317 1439 --
NM_018976chr1262576 2496 2328 2273 1851 713 --1431 --
NM_019030chr5295 82 1215 ----
NM_019035chr451922 1813 1746 707 343 --1317 --
NM_019063chr241625 412 382 217 --22091 578 --
NM_019072chr543354 2802 2779 953 21567 1400 14187 23012 3003
NM_019084chr1052534 2283 2177 732 610 --12489 --
NM_019087chr531666 1549 1325 --1202 11432
NM_019593chr2043168 1110 935 922 21200 142 ----
NM_019600chr152731 713 ------
NM_019604chr11193 --1239 --
NM_019857chrX21580 1100 194 11329 --
NM_020116chr431243 1198 516 --11816 --
NM_020122chr295914 5779 5238 4141 3893 3795 1881 1697 483 14938 --12122
NM_020134chr2----1269 --
NM_020144chr751751 689 449 397 293 --11943 --
NM_020147chr152917 674 1732 1442 --
NM_020177chr573169 3118 2635 2491 2101 608 467 1442 ----
NM_020192chr7----2155 134 --
NM_020199chr52377 236 11094 1221 --
NM_020337chr433190 2391 2192 32512 520 228 11973 --
NM_020342chr232396 290 107 12200 ----
NM_020381chr631686 1273 727 31876 818 606 122 11477
NM_020424chr162886 605 1231 --1655
NM_020438chr911401 --1368 --
NM_020440chr132240 987 93 11212 --13054
NM_020463chr21234 --1397 --
NM_020466chr674114 3901 3712 3689 845 817 159 34943 4802 541 --11513
NM_020640chr322193 786 1795 ----
NM_020645chr112516 213 1525 1250 --
NM_020651chr22632 28 21296 1175 ----
NM_020655chr162446 51 11432 --11437
NM_020698chr1262126 2022 802 780 458 228 --166 --
NM_020715chr1452257 1970 1896 907 390 --177 --
NM_020734chr1273304 3043 2456 2193 899 713 688 ------
NM_020752chr1032003 450 225 --12753 --
NM_020760chr251849 1804 1303 1273 1243 ------
NM_020768chr543018 2928 2645 1011 12285 1137 12313
NM_020769chrX186 1642 ----
NM_020774chr1865602 4979 4460 4135 1537 783 14182 24790 796 --
NM_020791chr1711433 195 --21114 341
NM_020794chr131003 127 107 --1361 --
NM_020801chr522353 1987 1365 ----
NM_020809chr1132178 1670 263 11624 11814 --
NM_020859chr463940 2590 1421 766 506 445 12928 149 --
NM_020860chr42965 458 --11012 --
NM_020871chrX42410 2244 320 284 11772 ----
NM_020909chr284159 4091 3693 1542 1429 1247 1091 543 --12763 34140 491 187
NM_020935chr274476 4447 3804 1267 873 601 564 21620 34 ----
NM_020940chr1052950 2622 2557 2256 1912 ----12798
NM_020951chr1942457 753 707 689 41993 1708 863 776 --3849 788 634
NM_020975chr1031599 796 341 --11365 --
NM_021033chr1333220 2582 2185 2518 74 12986 --
NM_021038chr342990 2863 2745 955 1188 ----
NM_021127chr182514 210 1552 ----
NM_021140chrX1377 --1760 --
NM_021144chr93344 222 183 ------
NM_021151chr71431 ------
NM_021194chr1----1240 --
NM_021202chr2032858 2503 1996 1427 22256 409 --
NM_021803chr4----126 --
NM_021813chr664886 4172 4118 3795 2101 240 13717 25771 4625 1119
NM_021914chr1442461 2160 1764 723 1280 2674 496 --
NM_021961chr1154598 2737 1859 680 187 26060 2843 --26337 5353
NM_021964chr395940 5861 5392 5136 4580 4444 4101 624 223 22001 1206 25800 1198 --
NM_022058chr22835 754 ----11674
NM_022085chr61116 --11594 --
NM_022121chr61230 ----1272
NM_022130chr521447 1276 ----1100
NM_022133chr841823 219 178 62 11913 1762 --
NM_022166chr1656118 5555 5136 4629 535 --26361 4102 16292
NM_022340chr353655 3484 3429 2979 300 42907 1452 1016 173 ----
NM_022444chr761922 769 719 628 601 48 11496 ----
NM_022459chr13126270 6152 5499 4956 4596 4534 4351 4306 4136 2525 2318 2166 11540 --14967
NM_022465chr1252549 592 456 106 38 22408 1012 13042 --
NM_022484chr711379 --141 1247
NM_022566chr15------1555
NM_022658chr1211008 --1868 --
NM_022735chr111673 11339 1731 --
NM_022763chr342435 2188 1041 919 --1627 --
NM_022781chr962888 629 596 583 251 194 --12184 --
NM_022826chr251226 1039 980 957 823 ------
NM_022831chr141863 1180 284 179 ------
NM_022832chr452328 2187 1753 829 169 2953 643 ----
NM_022841chr1561990 1837 1709 619 90 28 12604 ----
NM_022893chr232956 1077 284 23062 2283 --12479
NM_023076chr1622021 884 --1344 12959
NM_024007chr513060 --12675 1352
NM_024090chr431692 444 224 1637 --21633 1230
NM_024322chr2------1429
NM_024408chr133481 1167 379 12435 12471 --
NM_024420chr11156 --1414 --
NM_024513chr352918 2636 2600 1116 577 --23854 44 1803
NM_024529chr13983 383 258 ------
NM_024539chrX21201 923 --1375 --
NM_024646chr133815 3394 1061 43374 2975 2607 2473 1389 1781
NM_024665chr394004 3698 3141 1408 1301 962 905 333 295 44227 3605 1185 111 21672 1178 --
NM_024713chr1561236 1086 527 342 292 236 ------
NM_024721chr822699 718 ------
NM_024779chr121465 ----1518
NM_024953chr1212634 --12438 --
NM_024956chr152445 160 ------
NM_024989chr2158038 7707 7557 7273 6062 6048 3176 3131 3090 2888 2509 1692 1066 985 251 32252 1465 355 --16997
NM_025054chr863816 3129 2974 1585 1133 413 --23031 1674 13326
NM_025133chr21212 --1139 --
NM_025146chr34941 898 546 458 --22445 1939 --
NM_025160chr133280 2662 2640 --13603 1844
NM_025181chr2--1210 --1598
NM_025191chr1176 1242 13394 --
NM_025222chr322166 918 1243 --12798
NM_025244chr22274 252 --1262 --
NM_030627chr563872 3056 2545 1638 1586 780 1180 1414 11300
NM_030637chr141702 --1587 --
NM_030647chr724879 853 --32505 1907 115 35312 4814 1170
NM_030648chr473953 1929 1063 1047 932 146 55 34384 3639 441 11187 14162
NM_030751chr1021226 111 1508 ----
NM_030762chr122275 222 11895 11759 --
NM_030786chr131566 1174 633 2572 433 ----
NM_030802chr17----1766 --
NM_031216chr1841812 1533 1471 133 --31726 815 203 --
NM_031418chr112404 35 --12491 --
NM_031435chr1273470 3198 2817 2514 2154 867 200 --2745 115 12878
NM_031445chr242979 2347 1360 1084 1800 --13124
NM_031461chr842217 2101 450 174 --2834 79 --
NM_031483chr201701 ----1678
NM_032104chr12523 41 ------
NM_032124chr18--2967 300 1906 --
NM_032128chr4----1208 --
NM_032138chr131477 ----1136
NM_032144chr221857 1367 ----11354
NM_032160chr1842861 2796 1611 29 23685 971 21723 365 --
NM_032181chr21249 ----1909
NM_032199chr1022911 518 12421 33736 932 492 --
NM_032228chr1182439 1260 1030 781 414 295 187 97 ----11127
NM_032229chr13--11175 11167 --
NM_032239chr421476 1240 --11149 --
NM_032256chr1221065 321 ------
NM_032295chr731238 1069 21 ----2424 36
NM_032352chr1421268 433 ------
NM_032368chr1----1621 --
NM_032439chr1051685 1250 1239 1165 194 ----11264
NM_032440chr1052868 1862 1082 613 45 22879 430 2723 686 22738 849
NM_032457chr463792 3121 2944 1407 957 806 --13339 --
NM_032458chrX63431 2684 2238 1269 271 50 --1572 --
NM_032499chr1551742 1569 1252 469 136 ------
NM_032521chr2043165 2370 2098 530 23142 947 22580 2327 --
NM_032539chrX2637 68 --1565 --
NM_032682chr373481 3167 2931 1322 470 358 120 ------
NM_032727chr1031639 412 365 198 11183 --
NM_032786chr122593 553 ------
NM_032801chr1142311 1958 1807 146 --11785 --
NM_032838chr191446 ----1799
NM_032839chr32160 147 ----2507 56
NM_032927chr4----1632 --
NM_033036chr1111717 --11512 11580
NM_033055chr131090 1033 710 ------
NM_033056chr101166 --1484 --
NM_033081chr2011254 11145 1120 --
NM_033092chr11178 --1296 --
NM_033121chr1231729 1288 288 1704 1678 --
NM_033132chr1332153 1447 1437 --21565 325 --
NM_033211chr521867 64 ----194
NM_033224chr777828 7584 7221 5916 5199 1189 937 36668 2943 2143 12657 --
NM_033225chr822653 658 --2999 726 --
NM_033276chr121357 ----1238
NM_033285chr894455 3535 3423 3210 3144 612 475 469 290 --1140 1676
NM_033296chr4----2646 134 --
NM_033342chr5----1281 --
NM_033407chr1------1242
NM_033626chrX41824 735 540 492 21661 1459 21816 438 --
NM_033656chr2141687 758 316 283 --14866 1459
NM_044472chr12607 46 ------
NM_052832chr832771 2691 1910 ----12498
NM_052845chr1273229 2964 2938 2797 2312 891 399 --42570 1186 920 695 --
NM_052905chr22578 300 11702 11919 --
NM_052948chr192370 100 ------
NM_053023chr1142989 2869 2494 1057 22706 1071 ----
NM_053025chr331402 603 214 11167 --21750 513
NM_057175chr432298 1934 510 ----1182
NM_078476chr61101 --1385 11763
NM_080743chr621665 641 12240 --1189
NM_080867chr142525 366 23759 3637 21846 828 --
NM_080927chr353400 2569 2208 1228 329 22549 2341 2243 230 --
NM_101395chr2122229 775 33124 1030 785 12725 1570
NM_130387chr321142 45 1384 ----
NM_130808chr3272 36 ------
NM_133334chr445294 1148 557 391 24160 3946 12116 1483
NM_133445chr952548 949 919 811 339 --23469 2916 11022
NM_133646chr275171 3735 1944 1278 939 909 459 44364 4029 641 108 --15230
NM_138357chr101422 ----1698
NM_138369chr51605 ----2266 249
NM_138415chr2221645 644 --193 --
NM_138423chr1542162 847 738 721 1484 11457 --
NM_138426chr732222 1975 138 22069 648 ----
NM_138459chr632559 1406 1288 1764 ----
NM_138463chr171143 --1132 --
NM_138471chr112446 386 ------
NM_138473chr1274847 4698 4520 4099 3415 1937 208 --1890 --
NM_138571chr61238 ----1480
NM_138731chr1432784 1646 66 1637 --12695
NM_138782chr532306 1970 135 --176 --
NM_138959chr196195 4862 4613 4149 2520 2013 1324 939 565 --26598 890 --
NM_139072chr2----1267 140
NM_139126chr62200 113 ----2585 285
NM_139283chr1231625 428 170 ------
NM_139321chr2084228 3900 3487 3310 1613 1508 1039 788 ------
NM_144571chr4106748 6364 6186 5800 5732 5150 4473 2652 2185 493 --12102 --
NM_144664chr1162373 2334 2108 2069 567 444 --1373 --
NM_144665chr111228 --1195 --
NM_144775chr1743741 3127 1015 364 ----14012
NM_144778chr1362713 2674 1752 1089 681 70 11013 11991 11901
NM_144982chr12----1773 --
NM_145117chr113835 274 215 22235 566 12024 --
NM_145176chr683473 3354 3045 2889 2804 2179 936 775 --1431 --
NM_145285chr10------1771
NM_145753chr31389 --1234 --
NM_145808chr7--32504 2386 1164 155 --
NM_152277chr55841 698 672 647 95 ------
NM_152390chr2----1627 --
NM_152409chr563290 3160 2954 2932 382 281 21139 847 --2752 698
NM_152556chr742115 1800 245 68 1934 ----
NM_152594chr1542197 1868 872 381 --21660 1528 --
NM_152622chr563445 3057 2944 2432 320 103 1982 11126 --
NM_152624chr556541 5949 4545 2938 921 25880 460 ----
NM_152641chr1232895 2065 1151 1655 ----
NM_152666chr12695 176 --1640 --
NM_152678chr372725 2646 2608 1081 770 397 172 12321 ----
NM_152707chr101194 --281 58 1858
NM_152739chr731067 908 457 --1993 --
NM_152745chr71140 1854 1109 11113
NM_152753chr632115 663 294 1129 1223 --
NM_152756chr5123596 3503 3167 2954 2925 2735 1654 1425 983 225 119 33 23534 713 1547 --
NM_152758chr862411 1984 1952 1158 337 35 --1383 --
NM_152765chr82600 426 1477 --11748
NM_152787chrX53503 2765 2473 718 46 1201 --11145
NM_152890chr13435 380 342 --1488 --
NM_152896chr9--1832 ----
NM_152902chr1126 --1324 --
NM_152996chr151421 824 707 494 456 --21927 225 --
NM_153020chr661630 1525 1515 1310 1166 251 --11430 --
NM_153235chr622396 210 21979 339 22145 1896 --
NM_153252chrX--1309 --1298
NM_153367chr1052629 1503 977 621 365 13644 ----
NM_153377chr121392 --136 --
NM_170662chr32624 595 ------
NM_170665chr1244512 1212 1192 1025 --1226 14322
NM_171999chr182854 824 190 ----
NM_172070chr261830 1408 810 201 123 41 --12170 11387
NM_172071chr1116074 5665 5487 5281 4944 2165 1649 1354 1005 181 150 32369 2269 1392 ----
NM_172373chr13--1489 1225 --
NM_173075chr421741 53 1447 21491 267 --
NM_173470chrX22196 871 1347 12488 --
NM_173475chr16------1406
NM_173496chr1032972 2513 1034 --22947 1134 --
NM_173511chr263560 3491 1475 1332 759 684 ------
NM_173519chr831604 1286 32 32019 1913 834 --1321
NM_173536chr484369 4189 3679 3636 1112 1105 814 786 --11734 13375
NM_173552chr362293 1789 804 734 626 247 --22100 164 --
NM_173602chr1222829 2775 --22432 240 --
NM_173808chr133124 1502 808 --2726 188 13890
NM_173822chr252184 2146 1400 334 315 ------
NM_174909chr51632 1228 ----
NM_175061chr722099 214 --11639 --
NM_175733chr1131995 621 134 11579 1716 --
NM_175736chr12167840 7561 7367 6676 6540 6348 6029 5462 1755 1431 1202 1081 576 538 164 156 26320 982 ----
NM_175854chr1361792 1089 981 960 292 146 163 1462 --
NM_175907chr1812229 22333 1098 22082 892 --
NM_175921chr574193 3491 1434 1174 440 425 377 33111 1688 1329 --2111 106
NM_176816chr5--21875 230 1515 1537
NM_176871chr852549 1347 1081 794 409 21220 242 --12894
NM_177424chr12722 677 1518 --1319
NM_177538chr258583 8161 5742 2600 2479 108372 7993 7369 6934 6250 6172 5864 5591 1758 1447 22368 2245 --
NM_177968chr21347 22139 203 ----
NM_178140chr572793 2626 2396 2211 2000 788 93 22218 1854 12190 --
NM_178565chr841126 465 358 78 1529 21645 1249 --
NM_180991chr51572 1403 22497 893 --
NM_181354chr821100 200 ----1545
NM_181358chr134129 3859 3848 23833 2723 ----
NM_181704chr213249 234 36 --11329 --
NM_181784chr282471 2424 2366 2151 1993 1007 910 836 ----22259 201
NM_181836chr542355 2317 1975 281 1779 --1726
NM_182485chr443567 3308 2590 773 12563 11191 2668 155
NM_182503chr654018 3615 2120 1810 967 13527 --11231
NM_182540chrX1273 ----1614
NM_182700chr7----11395 11828
NM_182765chr1032087 408 375 12204 21694 366 --
NM_182920chr3----1347 --
NM_194282chr472974 2781 2749 2375 2195 801 580 22840 1015 12483 --
NM_194314chr154083 3638 1610 1052 422 ------
NM_197941chr532902 360 105 22283 485 1628 --
NM_198270chrX52863 2528 1215 406 112 ----11311
NM_198281chr483070 2572 2365 2356 856 708 674 547 1119 2949 411 --
NM_198465chrX22473 28 --22346 266 --
NM_198570chr7----1262 --
NM_198581chr247209 6965 6310 6164 35541 4914 1312 1377 --
NM_199072chr722236 2041 --12791 --
NM_199320chr442709 2115 537 260 12677 1233 --
NM_201613chr121732 1610 1579 1134
NM_203301chr14--2524 415 --1690
NM_203454chr131298 413 116 1325 1167 11199
NM_206853chr6--12779 34069 3557 2634 13384
NM_206855chr634164 2070 1216 35005 1755 591 56295 5783 4860 902 253 15610
NM_207306chr143421 1509 199 81 32821 358 322 14508 --
NM_207317chr51467 ----1304
NM_207517chr1561941 1594 1582 785 552 228 1247 11317 --
NM_212464chr1521398 34 1140 11300 1221