TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-142-5p
miRNA Sequence: CAUAAAGUAGAAAGCACUACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr591487 1444 1409 1357 1292 782 686 522 80 --31515 703 163 11983
NM_000043chr1041166 911 467 432 --2486 106 --
NM_000051chr11203540 3517 3477 3388 2957 2723 2380 2296 2167 1308 1152 1138 1063 923 907 687 264 82 59 51 --13240 --
NM_000052chrX163434 3350 3299 3272 3187 3131 3108 3058 2878 2636 2485 2193 2179 1337 312 188 --11365 23098 2666
NM_000053chr1351837 1728 1473 1435 238 ----21972 1734
NM_000081chr191724 1599 1546 1408 1163 714 404 192 35 11858 1548 --
NM_000084chrX196589 6532 6344 5983 5923 5610 5452 4997 4682 2727 2364 2353 2023 1960 1846 1340 943 782 592 56954 6291 5903 1050 663 45950 5843 5484 1954 22446 1739
NM_000086chr16----1230 --
NM_000090chr23668 276 208 ----1903
NM_000091chr272844 2586 2453 1889 1084 1033 810 11057 22887 875 12812
NM_000092chr2154353 3703 3378 2987 1761 1724 1562 1553 1510 1268 1035 737 508 259 232 --24401 1221 1412
NM_000093chr9----22265 941 --
NM_000096chr32780 89 2909 276 --1136
NM_000097chr341041 465 438 74 1971 41221 1068 471 397 1237
NM_000109chrX92657 2377 2364 2207 2140 1946 1713 919 500 52420 2031 420 346 123 11732 --
NM_000110chr121231 456 --1432 --
NM_000115chr13112518 2301 2234 2123 1952 1940 1875 1861 1002 443 139 136 1167 12433
NM_000125chr6104226 4189 4085 3618 2593 807 645 516 68 47 32607 544 222 ----
NM_000129chr651434 1387 576 508 241 ------
NM_000138chr1552594 2191 931 616 370 32415 2145 140 12222 --
NM_000151chr1731929 1557 722 11543 31895 1879 326 --
NM_000161chr1481689 1628 1401 1381 1375 1363 584 481 --52002 1940 1811 779 112 --
NM_000163chr5112353 2283 2093 1991 1923 1911 1682 827 786 438 220 1715 --1580
NM_000165chr671701 1373 1204 1185 1087 569 505 --11394 --
NM_000167chrX41758 1604 1552 100 1702 31668 1429 107 1716
NM_000168chr792781 2663 2344 2233 978 863 491 150 100 23375 2361 22879 67 --
NM_000176chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_000176chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_000176chr5123826 3725 3665 3652 3357 3137 1343 1111 582 103 96 52 42476 1527 537 502 13483 --
NM_000189chr262397 2245 2056 2044 2005 786 11523 1806 --
NM_000192chr1221194 186 11396 11287 --
NM_000210chr262353 2229 1868 1723 951 436 12119 ----
NM_000214chr205679 612 522 395 351 --1472 31417 1140 586
NM_000216chrX153639 3386 2797 2652 2568 2511 1589 1072 947 690 595 573 497 466 126 13290 ----
NM_000217chr12165333 5315 4807 4745 4365 4340 4113 4106 3329 2094 2013 1660 1178 525 221 104 23253 95 25150 1021 1893
NM_000222chr462092 1759 1581 1417 431 143 32020 1879 592 22036 1742 --
NM_000237chr881867 1820 1699 1564 685 413 369 156 --31942 1707 1671 --
NM_000240chrX42060 1505 499 319 ------
NM_000248chr3162698 2467 2309 1989 1071 938 891 881 826 689 517 341 312 261 187 123 31983 1048 529 3831 751 147 1463
NM_000251chr21173 270 60 --1250
NM_000252chrX21105 340 31275 1087 519 21370 1286 --
NM_000264chr962991 2730 2433 2293 2235 449 --12383 --
NM_000271chr181441 1477 --2465 426
NM_000276chrX62236 815 736 591 479 410 1242 ----
NM_000280chr1141000 662 406 240 3990 761 183 ----
NM_000291chrX5828 648 642 630 334 --1604 --
NM_000297chr482054 1839 1827 1656 1482 160 139 112 ----1151
NM_000304chr173752 287 236 ----11090
NM_000313chr361014 895 292 232 142 79 --1299 11103
NM_000314chr1083251 2981 2811 2157 1262 994 385 288 22683 300 52509 2433 2351 2195 538 --
NM_000321chr1381792 1711 1651 1109 551 387 344 282 1606 31458 1401 566 --
NM_000325chr42672 269 ------
NM_000328chrX3432 317 123 1327 --1335
NM_000329chr14889 321 173 82 --1799 1598
NM_000330chrX52188 1940 1837 1667 369 ----11446
NM_000332chr6116862 6832 5761 5749 5114 2021 1577 1399 1191 621 108 34846 2233 2036 67040 5738 5227 2530 1846 1143 11674
NM_000337chr5166220 6165 4928 4794 4524 4471 4133 4088 2649 1715 1472 1213 1053 888 513 53 1477 11086 14531
NM_000338chr154808 758 148 26 1854 170 --
NM_000340chr3101492 1412 1296 1279 1155 1104 1061 528 114 108 1279 1949 183
NM_000346chr1771711 1384 1307 1284 694 438 111 11330 --1378
NM_000347chr14----1219 --
NM_000362chr2263654 3631 3241 2401 1171 887 13618 12490 13567
NM_000380chr9--127 --137
NM_000389chr651187 1155 514 475 234 --1239 --
NM_000390chrX153406 3351 3207 3129 2638 2573 1374 1278 1160 1026 417 350 341 206 32 --22079 408 22584 1076
NM_000408chr2133279 3099 3009 2719 2660 2443 2149 1297 1057 1047 814 165 139 33081 916 574 1180 13379
NM_000430chr1793658 3426 3017 2877 2645 2614 1369 1248 481 1714 1323 --
NM_000436chr541366 175 107 40 1239 2468 133 11592
NM_000448chr1182982 2967 2937 2370 807 642 621 472 33240 2358 466 13289 --
NM_000450chr141774 1763 1185 121 ----11798
NM_000452chr1341651 1570 496 484 1215 22099 2065 1532
NM_000461chr3114197 3843 3683 3423 3104 3042 1067 898 516 228 88 1599 23768 1799 13753
NM_000462chr1571571 1330 673 318 232 174 67 11871 ----
NM_000480chr1181412 1183 1167 534 465 154 122 24 --11643 11437
NM_000489chrX133116 2939 2890 2651 2408 2275 2105 991 906 717 528 306 51 22164 955 23266 1257 13429
NM_000495chrX41052 725 713 89 1453 ----
NM_000503chr861449 1292 644 637 520 149 --21764 1164 --
NM_000509chr41149 --142 --
NM_000521chr51105 ------
NM_000527chr1942327 1636 107 64 1113 --12172
NM_000533chrX41930 1654 1518 1322 ----11983
NM_000553chr82427 248 --162 1604
NM_000555chrX217408 7179 6742 6651 5642 5235 5083 2954 2938 2615 2600 2520 2444 2207 2181 2134 2002 1284 1269 1245 108 76966 6522 4790 1539 1006 955 930 15923 --
NM_000586chr4------165
NM_000598chr731513 1406 419 21537 1081 41577 1558 1553 345 --
NM_000600chr73416 280 128 1398 ----
NM_000610chr1172921 2838 2819 2184 1845 1206 973 22667 2453 22155 634 --
NM_000615chr11113000 2948 2550 2543 1181 1104 862 846 789 750 218 1469 22528 713 2603 533
NM_000618chr12236420 6357 6291 6114 5192 5157 5027 4925 4752 4438 2638 2458 2277 2074 1919 1720 1626 1164 812 698 646 231 78 35863 4487 512 25899 628 35214 4935 4428
NM_000621chr1321212 272 --2419 136 --
NM_000627chr23885 627 271 ----2603 359
NM_000633chr18115128 3944 3437 2010 1911 1806 1751 1512 1399 1389 752 --15186 14401
NM_000637chr82102 90 ------
NM_000680chr8----1403 --
NM_000682chr2----11898 --
NM_000684chr1041185 1175 1119 525 11110 ----
NM_000685chr33866 328 278 --1883 --
NM_000688chr3198 ------
NM_000693chr1531251 609 117 11646 11515 --
NM_000701chr12231 68 ----1291
NM_000702chr162259 2185 2151 2097 1874 715 ------
NM_000706chr122616 311 1289 2784 91 --
NM_000724chr1041300 1265 677 644 11376 ----
NM_000726chr241219 1159 1140 556 11417 1126 --
NM_000739chr7----1519 1101
NM_000780chr891222 1139 1054 1039 937 837 815 514 307 --1312 --
NM_000793chr14115145 5135 4935 4662 4251 3891 3731 3654 3447 1519 1387 --21858 1853 24711 3221
NM_000801chr2051116 1095 816 711 430 --2404 254 1121
NM_000806chr5111519 1453 1289 754 694 615 524 464 447 394 83 ------
NM_000808chrX1820 --1292 --
NM_000809chr4319213 9077 8974 8574 8453 8372 8191 7847 6866 6498 6261 6142 6024 5921 5757 5718 3679 3519 3464 3148 3066 2944 2928 2892 2563 1823 1320 956 779 332 203 58117 6840 5957 2741 1650 48855 8777 2777 2064 17821
NM_000811chr51658 --1238 --
NM_000813chr595166 4956 4935 4137 3635 3513 1935 1738 1148 35300 4452 924 24009 1099 --
NM_000814chr1563633 3587 3363 2666 1197 1099 174 34089 3675 1644 12714
NM_000824chr44960 935 925 856 --1940 --
NM_000826chr472327 1888 1848 1658 857 769 666 32118 520 417 12561 12337
NM_000829chr1142092 697 557 366 1713 --1202
NM_000838chr6132361 2246 2213 2201 1996 1969 1814 1784 1768 1737 825 718 292 --12548 --
NM_000839chr32491 374 1382 ----
NM_000844chr361114 946 849 760 406 163 --1182 --
NM_000872chr1021565 1262 ------
NM_000875chr15136682 6286 6023 5816 5508 5466 1678 1298 1117 572 505 394 206 42641 1461 1374 1217 16313 15687
NM_000877chr282776 2420 2166 1902 1026 1009 265 115 12129 21965 836 13109
NM_000885chr271940 1924 852 779 725 519 508 21413 676 21904 1580 11610
NM_000891chr17133232 3165 2824 2733 1458 1422 935 809 692 595 452 242 33 13671 33689 3226 472 23368 2472
NM_000899chr12183798 3692 3616 3576 3113 2919 2908 2833 2822 2812 1587 1452 1172 1070 378 248 123 80 34352 1325 568 34417 4395 3513 23833 149
NM_000901chr4102576 2513 2318 2299 2117 1772 994 869 673 25 22211 1590 ----
NM_000908chr53731 131 109 --1716 --
NM_000910chr481963 1951 1761 1643 1497 1248 760 95 --21503 1481 --
NM_000917chr101713 --1162 1265
NM_000927chr72455 242 ----1221
NM_000933chr2051324 1144 1088 319 91 1673 ----
NM_000935chr381273 1125 1015 968 812 371 253 126 1153 11040 1919
NM_000937chr171311 --1396 --
NM_000944chr442177 1817 363 262 12062 22056 389 11507
NM_000945chr261841 1654 1631 455 377 200 41393 1370 471 294 1624 1789
NM_000950chrX123597 3553 3502 3115 2726 2589 2521 2344 2252 881 135 66 43052 3013 1061 990 33534 2715 98 --
NM_000956chr143765 696 355 --1952 1910
NM_000995chr41429 ----1407
NM_001001132chr2141443 955 355 175 ------
NM_001001323chr1273152 3135 2919 2794 2456 963 588 12848 157 --
NM_001001331chr342703 2691 924 766 1620 11671 --
NM_001001344chrX52485 2307 2109 1965 1016 12417 ----
NM_001001395chr12122564 2462 1960 1763 881 802 737 658 566 443 336 48 1371 1991 1702
NM_001001396chr163250 1002 890 848 773 315 22836 2735 ----
NM_001001419chr5235236 4933 4841 4751 4397 4284 3982 3845 3821 3815 3689 1887 1775 1333 1284 1091 857 844 517 433 303 62 51 13657 35204 1969 284 23347 748
NM_001001436chr164818 598 573 567 ------
NM_001001481chr8163164 2987 2707 2219 2207 1395 1274 1168 1028 781 487 266 260 202 80 58 --12921 --
NM_001001484chr1062394 2299 2025 1981 848 212 32171 2156 2089 --1568
NM_001001567chr21----1176 --
NM_001001586chr11455 ----1515
NM_001001664chr2123706 3638 3085 2788 2652 1349 1343 1328 1067 262 250 178 23653 3362 23808 3676 1393
NM_001001668chr1983867 2813 1390 1313 978 597 510 375 1987 13908 13902
NM_001001684chr1732569 2537 2500 22357 1740 11910 22305 308
NM_001001787chr12359 134 1166 --1372
NM_001001890chr21103669 3662 3530 3343 3267 3251 1618 1467 642 545 34256 3301 552 23654 1604 1373
NM_001001933chr13170 126 94 ----1430
NM_001001971chr1031266 387 108 --1291 31258 1034 883
NM_001001974chr10122248 2191 2078 2017 1954 1892 1855 1769 1576 1524 703 355 42359 2163 1563 133 ----
NM_001001995chrX101873 1721 1651 1392 1220 710 498 255 232 217 --11208 21344 695
NM_001002233chr872044 1942 1612 742 410 326 204 --32114 2109 249 --
NM_001002257chr2103432 2936 2850 2605 1426 1033 692 680 672 524 13121 ----
NM_001002296chr861373 1325 1298 1249 389 275 --1196 --
NM_001002838chrX71690 1494 1483 1419 1267 280 119 --11881 --
NM_001002860chr1484537 3379 3333 3220 2871 1817 394 266 --44681 3816 350 50 34477 1612 331
NM_001002909chr1732156 1743 358 --12214 --
NM_001003407chr1095142 5085 4808 4725 4363 4263 4212 3972 308 --24049 1587 --
NM_001003652chr18238514 8445 8423 8417 8368 7740 6934 6677 6441 6277 6160 6142 3471 3254 3245 3142 2887 2870 1735 1290 1062 871 230 98592 7124 6899 6712 6467 6222 3167 2102 419 35537 2777 2341 18265
NM_001003674chr18236749 6702 6614 6589 6182 6154 5973 5378 5369 5307 5128 5087 4978 4921 4524 2737 2693 1556 742 555 467 343 135 35448 1657 376 25576 1054 --
NM_001003681chr2252047 2008 858 340 176 32035 530 112 1192 --
NM_001003688chr481234 1170 1113 990 790 462 409 354 --1267 --
NM_001003712chr1292705 1108 1022 969 913 907 435 155 80 42938 2899 2675 322 33429 2642 1010 --
NM_001003760chr6103540 3399 3071 2949 2789 2612 2605 1204 651 151 21340 1024 73141 2879 2800 1354 1006 805 453 --
NM_001003790chr84765 740 656 185 ----2273 167
NM_001003792chr36971 963 947 822 476 167 --3778 481 296 11175
NM_001003800chr943533 2327 1048 171 ----12570
NM_001004317chr6134240 3794 3536 3520 3178 2933 2742 1260 1022 838 313 185 103 64449 4217 3344 457 320 279 --33974 3617 1249
NM_001004346chr441198 1139 222 157 170 1422 --
NM_001004356chr4----11480 --
NM_001004360chr2121967 1928 1903 1815 1761 1567 1386 1264 1217 774 423 325 2436 207 21839 510 --
NM_001004441chr551713 1476 1154 1076 419 --1349 --
NM_001005217chr441161 921 324 98 11115 21128 944 2955 221
NM_001005377chr19------1284
NM_001005386chr2132079 1895 1752 668 614 495 376 352 298 245 155 131 51 1975 1655 12073
NM_001005404chr1764382 4055 3619 3328 3263 3213 23084 194 ----
NM_001005463chr1092607 2561 2529 2340 2291 2177 1723 993 638 --62363 1733 349 212 152 139 1609
NM_001005473chr5116524 5873 5329 4675 4217 4134 2349 2318 2152 1152 743 1279 44203 2627 1628 258 12512
NM_001005505chr311554 ----11775
NM_001005527chr321095 868 --21262 185 31239 1151 537
NM_001005739chr22814 581 1782 --1337
NM_001005743chr1461337 1162 1153 1101 932 372 1977 180 --
NM_001005781chr22458 120 --1236 --
NM_001005845chr851906 1755 1535 1292 73 1370 ----
NM_001005849chr172425 152 ----1467
NM_001005920chr16----166 --
NM_001006600chr5162431 2360 2148 2064 2005 1883 1843 1833 1608 1590 1544 924 627 405 391 348 51826 1623 887 668 86 12295 12322
NM_001006635chr22326 83 ------
NM_001006684chrX2559 82 --1395 --
NM_001006944chr112703 174 1157 1517 --
NM_001006945chr15607 574 255 204 136 ----2589 239
NM_001007024chr1764139 4026 3440 3193 1746 1619 --24334 3128 14294
NM_001007067chr841111 960 376 320 1279 11042 --
NM_001007097chr9135033 5022 4791 4782 4733 3969 3842 1524 1362 1249 882 580 476 21269 1154 --11668
NM_001007098chr14854 808 655 153 ------
NM_001007156chr1561869 1777 621 615 606 333 --11969 --
NM_001007189chr5150 --1111 --
NM_001007226chr1721265 489 --1917 --
NM_001007237chr142558 2365 2105 1861 1338 1471 32866 2153 618
NM_001007246chr2171669 1486 1337 784 671 382 252 --21822 148 --
NM_001007257chr141341 1231 1022 613 --21247 1074 11521
NM_001007466chr675132 4540 4520 3952 3647 289 279 12005 34499 3322 1694 --
NM_001007538chr1341888 1669 1433 327 11454 11908 1303
NM_001007553chr171108 1059 460 301 258 249 190 21166 898 --1972
NM_001007559chr1841620 632 177 155 31415 723 323 22046 775 --
NM_001007794chr12128 121 --2648 632 --
NM_001008239chr18123840 3406 3336 3021 3014 2961 2719 2372 623 546 317 57 13137 33366 259 246 --
NM_001008405chr771561 1500 1459 1302 1268 496 392 ------
NM_001008408chr7156258 5930 5334 5089 4951 4896 4883 4791 4373 4058 4002 2562 1885 1263 302 21447 1276 24512 1967 --
NM_001008491chr292061 2024 1774 1631 1416 513 373 161 120 1635 1583 --
NM_001008495chr8102029 1774 1602 1471 746 478 324 265 245 212 21522 831 --12101
NM_001008536chr12617 236 ----1721
NM_001008539chr8185410 5360 5266 5129 5094 4627 4445 4245 4135 3848 3531 3469 3461 3343 1565 1338 1093 449 --24397 1788 --
NM_001008541chr10122332 2232 1697 1684 1585 1553 1525 1479 893 824 536 397 --11590 11472
NM_001008564chr1352230 2147 1848 1408 546 32133 1676 1430 ----
NM_001008707chr1431847 1776 1183 11897 21914 1521 --
NM_001008710chr821566 371 21669 359 1155 --
NM_001008726chr146479 377 365 263 177 89 31735 1582 35 ----
NM_001008738chr582790 2672 2654 2462 2183 2119 1971 497 11107 --1776
NM_001008777chr172140 98 ------
NM_001008779chr21242 --1278 --
NM_001008783chr63663 625 88 1690 --145
NM_001008860chr153800 306 240 --1222 --
NM_001009185chr51188 --2182 113 --
NM_001009552chr83611 528 419 127 1424 --
NM_001009554chr4184754 4579 4452 4286 4124 3805 3618 3575 3443 3433 1572 1483 1394 1036 751 733 559 130 23127 459 23491 1122 13088
NM_001009555chr461701 1664 1315 1307 590 369 11658 11458 --
NM_001009569chr1071622 1549 1500 1156 1068 589 225 11483 1443 --
NM_001009881chr12630 156 ----1410
NM_001009894chr1231143 463 183 21421 592 2620 160 --
NM_001009899chr3186542 6479 6460 6183 6070 5232 4399 4332 4237 4005 2593 1824 1218 1048 981 547 332 220 23975 2145 46524 4940 2005 616 --
NM_001009909chr1173698 3679 3632 3328 3262 2992 2901 23705 2550 22885 114 1125
NM_001009958chr73427 420 247 --1617 1570
NM_001009959chr272027 1636 835 824 756 659 196 12239 ----
NM_001009960chr7102577 2238 2200 2118 993 862 817 773 631 554 22397 1021 1965 --
NM_001009993chr294478 4469 3821 3444 3022 945 848 547 391 21784 839 11119 11827
NM_001010000chr1883446 2960 2844 2707 2632 2268 924 347 3865 395 210 33531 3226 2359 --
NM_001010861chr1112743 2619 2585 2491 1924 1073 969 468 448 298 125 21081 119 21027 528 22657 994
NM_001010888chrX104345 3408 2957 2902 1727 1220 1108 945 414 99 94534 4394 4239 3839 3402 3172 1029 173 26 44013 4003 1656 869 13961
NM_001010895chr972028 1299 1275 447 252 109 32 1548 --2708 514
NM_001010924chr103862 383 195 ----1832
NM_001010927chr65416 391 231 160 39 ------
NM_001010934chr7--2911 142 11089 --
NM_001010935chr14832 702 686 356 21009 122 --2765 405
NM_001010942chr1251164 1050 997 386 323 11074 179 1342
NM_001010971chr14996 874 745 707 2825 309 --175
NM_001010986chrX102537 2478 2288 1997 892 873 762 631 225 159 22175 837 32356 844 275 --
NM_001010989chr164531 509 225 211 ----1423
NM_001011513chr4113514 3125 2766 2759 1175 881 817 561 469 305 137 33766 2793 240 62925 2713 2603 484 402 219 --
NM_001011537chr3122294 2140 2120 2037 2010 1941 1803 1771 581 311 125 85 --1361 --
NM_001011546chr204744 321 265 182 --1342 --
NM_001011553chr74876 280 241 98 --1778 --
NM_001011657chrX31052 901 356 --1973 --
NM_001011663chr1091104 774 689 675 437 320 262 244 96 11048 1707 1972
NM_001011666chr7196276 5811 5754 5394 4965 4957 4818 4684 4535 4262 2553 2536 2382 2283 2255 2052 1908 1508 671 86301 4703 2033 1928 1024 950 159 132 --25739 4058
NM_001011713chr1461622 1288 1111 1101 452 158 --21117 305 --
NM_001011885chr1531793 1280 403 11268 --31464 701 198
NM_001011885chr1531793 1280 403 11268 --31464 701 198
NM_001012393chr11115025 4960 4510 3931 3431 3377 2068 1341 738 159 54 --14995 --
NM_001012415chr9----1831 --
NM_001012423chr1592833 2804 2725 2664 2220 2036 2003 1147 904 --12647 1506
NM_001012425chr1----1132 --
NM_001012478chr191643 ------
NM_001012732chr441208 1156 1114 198 ------
NM_001012754chr1361943 1846 865 748 204 180 22006 1959 52173 1953 1856 1711 1606 --
NM_001012755chrX124926 4904 4874 4819 4211 4130 3844 3583 1629 1558 652 29 34101 3631 3200 13641 --
NM_001012761chr542697 2569 50 27 41989 1879 281 236 1273 --
NM_001012968chrX112769 2665 2626 2468 2436 1816 1721 715 670 657 178 12152 52787 2357 1930 1084 122 12186
NM_001012974chr6----1262 --
NM_001013399chr63774 439 316 1806 1131 --
NM_001013406chr751607 1178 1144 1086 125 41379 1185 578 483 ----
NM_001013415chr461498 1453 1250 1162 1035 303 --11580 --
NM_001013437chr182411 332 --1293 --
NM_001013659chr19124569 4272 3558 3473 3399 3384 2162 2080 1244 1036 403 378 --54966 2061 1117 408 70 --
NM_001013699chr12150 ----1529
NM_001014283chr133842 775 166 1433 2820 612 --
NM_001014286chr131100 ----1125
NM_001014434chr12587 47 --173 --
NM_001014831chr19------1659
NM_001015045chr421827 746 12207 2818 423 --
NM_001015877chrX143081 3042 2662 2630 2423 2413 2007 1195 1175 1048 964 943 497 158 --22708 953 11957
NM_001015882chr9166 2268 200 1324 1168
NM_001015887chr341845 1685 1230 385 21763 750 21880 1321 11728
NM_001017368chr1762749 2394 2315 1119 565 460 12826 ----
NM_001017369chr461093 995 943 722 421 168 --11066 --
NM_001017371chr291160 1139 1002 553 526 486 431 236 86 139 --1154
NM_001017395chr3123480 2921 2364 2220 1394 1102 1024 890 836 691 436 222 1730 1182 13054
NM_001017415chr1--2796 130 --1578
NM_001017420chr831456 1352 1125 2358 304 21390 1257 21462 272
NM_001017424chr141814 1506 1282 59 11785 --11426
NM_001017440chr767673 6271 5028 1453 1083 217 38064 1430 1031 25843 2860 --
NM_001017923chr1471702 1370 1129 652 386 268 65 61042 595 260 214 194 156 31572 325 228 --
NM_001017926chr891620 1429 1370 1352 1190 712 440 427 250 31743 1577 1342 1610 --
NM_001017928chr3------1212
NM_001017992chr5101454 1178 1145 1010 984 969 622 445 334 68 1463 21513 1043 11519
NM_001017999chr172347 2086 2039 1625 762 604 395 ------
NM_001018067chr1195389 5216 5168 5110 5056 4500 4381 4323 4311 4130 1618 1554 1363 1115 1084 760 530 483 33 55256 3326 1877 848 616 32075 499 142 34945 1725 1122
NM_001018090chr1592805 2549 2169 2075 1072 1015 941 311 254 22460 1779 12387 1106
NM_001018100chr153810 700 318 1260 1305 1719
NM_001020658chr161698 1677 1213 1081 456 368 21169 172 1185 --
NM_001023567chr1562225 2197 2112 2086 2046 912 11791 12376 1509
NM_001024372chr852306 2009 1988 1758 547 22077 1703 11834 --
NM_001024596chr19143653 3641 3562 3526 3388 3201 2869 2742 2635 2495 612 431 241 74 21336 794 23683 2644 1106
NM_001024649chr5152968 2710 2677 2658 2619 2609 2429 2137 1936 1108 1100 994 311 285 155 1412 ----
NM_001024660chr361652 1471 1359 1243 377 292 ----1646
NM_001024680chr291592 670 473 464 359 187 166 148 81 1223 --1612
NM_001024847chr382437 2347 2339 1768 1609 986 521 417 22410 314 21934 276 --
NM_001024934chr63697 509 49 1519 ----
NM_001024948chr1173095 2841 2821 2809 2439 2414 2402 2383 2260 2233 1211 885 772 534 360 231 183 ----12535
NM_001024948chr1173095 2841 2821 2809 2439 2414 2402 2383 2260 2233 1211 885 772 534 360 231 183 ----12535
NM_001024948chr1173095 2841 2821 2809 2439 2414 2402 2383 2260 2233 1211 885 772 534 360 231 183 ----12535
NM_001024956chr11125125 4783 4716 4348 4154 3812 3552 1745 1294 641 292 198 44590 4520 2351 1164 44942 4579 3679 1522 --
NM_001025068chr351263 667 337 268 253 21304 510 21806 547 --
NM_001025076chr10106255 6227 5296 4561 3783 2069 836 565 495 33 11478 31859 1570 1164 1737
NM_001025077chr10167613 7585 6654 5919 5141 5112 5054 4973 4712 2194 1923 1853 1045 658 251 33 34828 2836 867 52928 2522 840 585 202 12095
NM_001025079chr3133984 3918 3610 3403 3359 3322 3264 2665 1599 1394 703 680 167 23849 3296 23274 2611 13941
NM_001025233chr12102382 2359 2265 2121 1899 942 789 328 315 137 12164 ----
NM_001025266chr3154902 4808 4712 4368 4087 4014 3701 3374 3193 3091 3005 1437 1169 186 55 14951 14256 --
NM_001025366chr641800 1719 316 184 21653 1222 1269 1408
NM_001025580chrX164191 3944 3914 3780 3750 3635 3525 3048 2754 2711 1126 637 563 439 207 200 23924 3721 41491 950 826 101 44174 2644 1066 749
NM_001025616chr451552 1257 1228 673 418 21612 571 3537 507 280 1403
NM_001025780chr941488 1210 607 267 11317 1528 --
NM_001029858chr6153411 3207 2861 2762 2535 2472 2304 2271 2204 2105 1093 999 872 652 590 1663 1443 12462
NM_001029863chr6103074 2559 2366 2331 1110 890 860 787 350 191 --32766 971 634 1344
NM_001030007chr16153722 3657 3556 3517 3339 3236 3098 2931 2921 2679 1411 1067 905 223 27 --21199 367 13297
NM_001030055chr14194707 4701 4692 4445 4186 4052 3968 3641 3192 3078 3049 1812 1757 1516 1058 1000 823 814 712 32994 1823 210 34752 4747 4503 1481
NM_001031679chr1293578 3390 2877 2827 711 640 488 224 204 33467 2273 1236 2650 645 --
NM_001031684chr251470 1135 1125 413 207 --11273 --
NM_001031690chr7--22628 1005 22709 164 --
NM_001031694chr1----1957 --
NM_001031695chr22115323 5179 4577 4485 3947 3790 3670 3336 2110 1231 865 35386 1813 156 --21330 1187
NM_001031710chr771092 1035 978 853 696 183 58 1152 ----
NM_001031715chr15----1181 --
NM_001031716chr251032 926 797 100 68 4303 152 116 32 ----
NM_001031723chr44488 375 193 39 ------
NM_001031804chr16114190 4027 3915 3745 3523 1413 1407 1319 1090 523 495 11494 2947 908 11419
NM_001031812chr5102251 2157 2075 1973 1821 1697 1475 811 205 195 1374 1764 11567
NM_001032221chr911696 ------
NM_001032280chr661726 1441 1389 1372 1340 529 --31731 1706 1097 --
NM_001032282chr871096 947 921 491 320 236 34 --1814 11317
NM_001032283chr1261021 767 685 395 254 185 --1207 --
NM_001032296chr1372740 1121 817 619 575 375 259 12839 3239 234 229 11005
NM_001032380chr1072008 1828 1471 1465 559 270 153 3729 353 295 1400 --
NM_001032394chr6112824 2663 2567 2224 2064 1771 1076 796 703 696 487 --12719 --
NM_001033002chr17182 --1229 --
NM_001033025chr141346 978 618 580 --2251 94 --
NM_001033045chr2144402 4046 3871 3430 3403 3094 2952 2920 1387 1228 1116 866 383 172 14325 43800 2838 1782 1704 11083
NM_001033047chr462513 2460 2012 941 574 83 1997 --1533
NM_001033049chr2162179 1636 1529 868 451 437 --1354 --
NM_001033057chr362109 1965 1759 1688 1429 487 21923 622 1135 --
NM_001033059chr671910 1645 1451 805 608 442 284 --11781 11489
NM_001033087chr2082982 2844 2436 2341 2335 2298 431 280 12196 12107 --
NM_001033117chr394374 3870 3645 3484 3300 3018 1472 1162 501 ------
NM_001033506chr112332 115 ------
NM_001033507chr12429 72 1560 2568 488 --
NM_001033518chr742905 549 216 81 --2116 60 --
NM_001033557chr281311 1252 1235 1150 1091 251 172 51 11121 ----
NM_001033561chr171886 --1609 --
NM_001033566chr173143 62 43 --1110 1687
NM_001033659chr1751681 1559 1542 491 80 21397 1184 11039 --
NM_001033925chr1071832 1694 694 347 328 220 103 --12007 21954 1710
NM_001034837chr52124 85 ----1783
NM_001034841chr16105538 5491 4855 3648 3629 2154 2112 511 483 135 25027 3878 45258 5018 3884 1920 22017 682
NM_001034850chr581565 1522 1458 1360 1162 126 114 102 --21637 1316 1230
NM_001034915chr841493 1303 1285 600 ------
NM_001034954chr1052834 2780 2536 1159 31 --13270 12742
NM_001035260chr1071543 1428 1403 1303 1076 345 217 --31342 311 241 --
NM_001035511chr141854 1776 1454 1386 --52119 1517 1476 648 588 --
NM_001035chr161303 1280 531 522 368 183 ------
NM_001037164chr7102068 1651 1644 1404 1355 1334 1290 609 312 119 21976 391 ----
NM_001037172chr321370 1213 31252 1240 964 1232 --
NM_001037174chr282253 1904 1664 1577 414 315 306 52 11672 --22110 595
NM_001037339chr151486 1239 622 569 385 21869 1575 11786 --
NM_001037535chrX81561 1388 1177 1139 971 591 549 252 1230 21247 456 --
NM_001037631chr22458 122 --2449 24 --
NM_001037631chr22458 122 --2449 24 --
NM_001037637chr52276 268 ----158
NM_001037954chr1193189 3034 2697 2142 934 874 862 737 383 33162 1408 895 12788 --
NM_001038493chr241399 1204 1182 486 21525 1498 --11546
NM_001038640chr152979 290 ------
NM_001038702chr5102462 2277 1898 983 857 841 600 449 401 263 22650 2191 22547 307 12065
NM_001039141chr2232570 1764 991 1304 --2339 286
NM_001039199chr20125016 4252 3977 3500 3350 3315 1730 1708 1295 744 351 175 23827 1097 1600 --
NM_001039348chr231055 955 189 1423 171 11025
NM_001039372chr73631 439 52 --2476 423 --
NM_001039538chr2113476 3304 2724 2489 1403 1226 964 889 845 278 215 32470 2304 91 13158 --
NM_001039547chr3267915 7872 7412 7040 6847 6780 6199 5515 5218 5056 4991 3197 3137 2995 2504 2383 2093 2052 1351 1332 947 875 839 829 681 107 58090 6305 5021 3104 302 62466 1593 1292 1233 960 498 36815 3223 219
NM_001039570chr22114550 4521 4490 4475 4104 1389 1145 1113 726 442 375 ------
NM_001039577chr163676 1466 1204 1050 526 451 ------
NM_001039580chr4154988 4798 4751 4642 4240 4195 3930 3604 3361 3326 3301 923 562 144 100 21681 858 54130 1769 689 603 247 25077 641
NM_001039590chrX113886 3466 3426 3027 2915 2836 2506 1416 1133 626 602 ----24048 1422
NM_001039618chr11235782 4854 4710 4568 4457 4314 4119 4008 2309 1904 1554 1477 1413 1346 1290 1136 1015 994 844 689 341 333 22 45882 5111 3975 1992 24998 4180 12346
NM_001039649chr13------2294 30
NM_001039770chr332292 2185 1843 ----1763
NM_001039840chrX215826 5630 5574 5561 5555 5547 4453 4410 4372 3775 3686 2432 2238 1919 1228 842 715 655 644 506 210 65208 1790 1354 1184 774 108 36053 3937 2273 11633
NM_001039937chr13163905 3555 2677 2621 2572 2560 1577 1083 1041 863 823 795 597 525 348 152 13683 43257 3114 1434 1382 2771 374
NM_001040001chr621523 681 1732 3725 405 171 21966 25
NM_001040057chr751481 1347 1267 464 439 21357 1195 ----
NM_001040092chr82353 105 151 ----
NM_001040108chr1492587 2490 2349 2324 2085 2074 1996 780 583 22135 1185 12028 1766
NM_001040110chr741755 1737 1708 97 21611 1587 ----
NM_001040142chr272403 2242 1903 1732 751 550 311 12102 32067 1574 1569 --
NM_001040152chr7104666 4638 4592 4584 4527 3888 3181 1567 1232 831 --15065 --
NM_001040153chr133868 837 386 --1809 --
NM_001040159chr451463 1210 1005 601 434 1195 1160 1293
NM_001040181chr361055 933 422 190 91 36 11029 3412 129 111 --
NM_001040202chr4132399 2392 2351 2324 2227 1813 1794 751 601 579 458 297 175 22287 126 11702 --
NM_001040214chr652388 2100 2047 1579 753 31830 960 817 1935 --
NM_001040284chr16215962 5577 5542 5311 5264 4884 4666 4651 4616 4544 4338 4069 4026 1913 1881 1777 1306 1156 1048 314 267 45205 1701 1638 1591 64414 3745 1895 921 787 493 15880
NM_001040402chr472917 2875 2847 2814 2095 2058 2010 12746 21236 390 12390
NM_001040424chr2132081 801 347 11845 32125 1814 743 --
NM_001040429chr1392897 2872 2319 2191 1387 898 776 114 84 12845 43391 3119 1093 1023 12611
NM_001040441chr1145070 5043 4814 4490 3631 3434 2118 1669 1477 1255 815 603 347 109 --3374 277 174 45443 5431 4891 4846
NM_001040446chr5112687 2617 2447 2266 2221 2012 1067 963 622 440 360 22642 2186 12508 --
NM_001040450chr15112682 2520 2197 1838 906 748 577 559 552 419 185 21848 833 --1712
NM_001040458chr541815 1737 1717 1185 11610 21749 1280 1280
NM_001040619chr121399 416 11018 --1503
NM_001040624chr82990 273 22365 1738 --1945
NM_001040633chr72228 215 --2907 166 --
NM_001040665chr7164672 4235 3970 3619 3481 3199 3066 1805 1510 1016 951 857 677 403 349 56 --21908 670 1269
NM_001040697chr115616 561 550 149 60 --1198 --
NM_001040708chr82958 160 --1271 1304
NM_001040712chr993515 3212 3201 3000 2755 769 628 598 456 13019 22917 246 1915
NM_001040876chr451729 1380 1211 662 417 --188 --
NM_001042355chr16195422 5233 5227 5073 5067 4981 4850 4076 3960 3638 1893 1694 1345 912 443 371 309 262 108 34885 1463 1378 1770 24183 1259
NM_001042403chr123386 249 70 1242 1845 3811 319 121
NM_001042404chr171911 1760 1449 1365 1252 1229 249 --2580 133 11509
NM_001042406chr63963 906 877 1811 11100 --
NM_001042413chr994110 3973 3738 3586 3470 3089 1048 650 623 24138 591 23280 3253 --
NM_001042414chr132229 89 156 ----
NM_001042424chr483278 2484 2336 2276 2157 1290 951 850 12872 12243 1806
NM_001042440chr542059 1892 1390 227 1268 ----
NM_001042473chr1062108 2047 1701 1625 743 182 1770 1533 22030 466
NM_001042479chrX62028 1856 677 325 256 57 1557 21742 622 197
NM_001042481chr14102367 2165 1868 1857 1803 820 780 351 259 168 32540 982 122 ----
NM_001042493chr682005 1947 1884 735 564 457 333 30 1526 21371 588 --
NM_001042494chr1573733 3666 3302 1394 1165 1120 931 --11269 1540
NM_001042517chr137869 815 364 282 253 206 83 --1820 198
NM_001042533chr3102972 2850 2797 2629 2558 903 665 427 390 310 2731 405 1482 134
NM_001042537chrX92436 2309 2111 1835 1578 929 470 437 266 1946 41974 1862 911 667 --
NM_001042543chr481455 1399 1176 1075 1026 574 341 281 1145 ----
NM_001042550chr931526 677 568 2257 129 1216 --
NM_001042555chr12154730 4609 4428 4154 4042 3929 3733 2955 1755 1556 1222 730 464 283 33 53953 3871 2962 349 97 33721 3467 1810 23832 3706
NM_001042573chr17----12015 --
NM_001042599chr2207665 7296 7127 6977 6702 6622 6346 6305 6286 6151 5918 4927 3075 2970 2074 1960 794 769 705 338 47219 4988 2890 681 35605 1540 1102 22906 1572
NM_001042601chr382951 1285 1259 757 671 595 533 304 43215 3126 2238 854 1544 --
NM_001042603chr1285370 4419 3627 1974 1688 1434 1316 772 33876 1344 649 ----
NM_001042604chr3224877 4815 4678 4651 4400 4305 3720 3407 3345 3160 3123 1727 1645 1566 1129 1041 858 632 604 535 190 96 21268 53 64902 4624 3811 1510 878 461 14578
NM_001042618chr14----184 --
NM_001042646chr381772 1758 1616 1365 1339 1243 754 538 --21993 1831 1172
NM_001042681chr162405 2149 1896 549 469 291 1119 ----
NM_001042692chr23466 377 162 ------
NM_001042749chrX61765 1742 1694 1394 597 59 11791 31547 521 237 --
NM_001043318chr1494157 3887 3857 3797 2512 1468 870 799 616 24055 3694 24036 3033 --
NM_001043351chr142056 1732 639 604 31811 1565 909 ----
NM_001046chr572800 2614 2588 1142 436 416 399 43005 2825 976 376 ----
NM_001049chr1432031 2004 1829 1816 12219 --
NM_001071775chr13101443 1354 1248 1215 686 670 502 411 289 115 2782 149 21362 1338 11745
NM_001078chr11702 2516 508 ----
NM_001079874chr131971 1850 372 21622 679 42068 1989 1778 782 22126 1655
NM_001099678chr3146255 6056 5873 4771 4619 4344 4098 2393 1584 1321 1310 1179 637 196 46382 6120 5501 997 14520 --
NM_001100108chr1217924 7339 7214 7139 6990 6800 6088 5448 3351 3329 3241 3082 3054 3012 2856 1603 1550 1308 1281 990 839 15274 38381 7978 1608 --
NM_001106chr3299774 9604 9581 8835 8242 8145 7837 7346 7217 7211 7070 7037 7018 6991 6791 6435 6055 5905 3772 2757 2646 2474 1969 1532 907 525 345 134 120 47673 7081 6008 5990 11744 18688
NM_001121chr1071941 636 454 392 347 204 122 --2582 545 1179
NM_001123chr103571 269 169 ----1290
NM_001126chr161014 928 818 802 704 169 --11049 --
NM_001149chr1051287 1068 1010 180 144 --1905 --
NM_001156chr101427 --1178 --
NM_001160chr1272808 2037 1962 1781 607 484 342 186 22250 2193 --
NM_001167chrX156561 6436 6357 4732 2592 2310 2025 1811 1264 1249 1234 1056 971 333 71 2868 815 46652 5913 1848 1040 14933
NM_001174chrX32128 1877 203 42260 2050 1836 1558 22197 2098 --
NM_001177chr1262378 2143 1550 588 489 466 ----22281 580
NM_001186chr21123161 2980 2970 2810 2413 2341 2250 2054 1178 580 554 419 13098 22595 2096 --
NM_001198chr692446 2348 2295 2067 1876 1650 978 790 765 22208 479 11830 11940
NM_001200chr204974 206 99 46 --1122 1259
NM_001204chr2237725 6774 6246 6099 5686 5384 5230 4860 3023 2567 2512 2362 2178 2143 2083 2001 1985 1727 957 445 421 135 87 46351 5427 2650 2505 67467 6255 5582 1166 903 898 36768 5591 5395
NM_001206chr9153033 2839 2717 2455 2448 2016 2004 1116 1015 891 799 599 459 382 312 32588 2254 763 ----
NM_001219chr761673 1656 1521 1505 369 362 32253 2232 1815 11533 1233
NM_001241chr262135 1885 1715 719 277 233 21819 1748 52439 2287 1903 671 666 --
NM_001256chr17132899 2811 2533 2392 2296 1819 1808 716 659 639 390 312 278 11875 12102 --
NM_001259chr7215841 5644 5516 5201 5020 4721 4549 4064 3954 2445 2420 2328 1367 895 871 829 793 768 703 509 200 44643 1633 1419 665 25114 1403 15775
NM_001270chr541081 1035 367 327 2814 177 2827 445 --
NM_001278chr105964 938 826 426 161 11187 11209 --
NM_001284chr52525 190 --1582 --
NM_001290chr441062 908 815 323 1859 11052 1959
NM_001304chr17113862 3739 3562 3130 2973 2780 2461 677 424 356 342 23823 3477 32724 1306 699 --
NM_001308chr10----178 --
NM_001310chr12112551 2278 2036 1950 1911 690 491 471 387 327 175 1599 32658 1940 768 --
NM_001315chr671940 1572 1397 909 378 221 176 --22222 1982 11596
NM_001326chr115469 425 319 172 82 --1358 --
NM_001332chr531321 398 157 1276 31277 1099 1052 --
NM_001333chr92281 194 --156 --
NM_001351chr381715 1511 1491 1160 710 514 278 145 --2601 111 --
NM_001356chrX82498 2399 2302 2245 1787 1576 336 323 --22463 1643 11598
NM_001364chr11114764 4060 3789 3435 1555 1416 1027 640 422 353 82 --24800 1136 24794 431
NM_001379chr192219 207 1281 1269 --
NM_001380chr1021084 1010 ----1971
NM_001396chr2152451 1796 1012 345 247 42596 2096 2023 40 ----
NM_001400chr141347 1138 389 355 --11051 1502
NM_001407chr341213 1170 1101 494 2234 217 21185 1152 --
NM_001412chrX123552 2937 2902 2859 2834 2694 2530 2302 1319 1176 906 832 2878 514 63628 3042 2456 1324 1112 202 --
NM_001419chr19124708 4675 4547 4414 4229 3988 3494 1228 961 888 308 113 34623 4191 141 14236 --
NM_001427chr762135 1982 1952 1771 383 328 --31491 452 235 --
NM_001429chr2241052 858 330 242 --1423 --
NM_001430chr261847 1738 1507 682 388 377 --1177 21989 770
NM_001432chr4183874 3691 3631 3545 3312 3257 2898 2868 2760 2401 1030 1010 944 721 397 151 140 117 32717 880 224 21364 67 13396
NM_001438chr1103286 3085 3079 2958 2367 1066 908 409 312 240 --23330 2359 13560
NM_001448chrX51581 1552 513 443 80 11659 31778 279 152 --
NM_001451chr163463 456 429 11131 11035 --
NM_001453chr661776 1593 1356 593 469 225 21213 262 1414 --
NM_001455chr674695 3971 3561 3326 3289 3197 130 11723 44222 4195 3398 1531 --
NM_001480chr187798 448 417 403 367 256 154 --1204 11179
NM_001491chr682621 2280 2172 1787 914 610 219 209 1406 22411 1730 --
NM_001511chr42543 193 --1581 --
NM_001518chr761104 1087 1030 460 290 231 ------
NM_001523chr19----1307 --
NM_001527chr6204889 4569 4538 4460 3772 3370 1736 1607 1601 1591 1485 1432 1341 1278 1038 896 323 213 162 101 --21410 1350 193
NM_001530chr1481110 1031 1017 754 417 274 256 86 --2966 957 --
NM_001546chr651118 1081 580 396 348 21386 951 1362 --
NM_001554chr13597 530 215 --1624 1605
NM_001557chr211259 --1928 11220
NM_001584chr1141127 414 322 312 11217 41148 1138 162 157 --
NM_001608chr21223 --2795 335 1729
NM_001609chr10134190 4000 3936 3903 3713 3346 2972 1092 965 883 726 118 49 23677 1289 21132 942 24364 739
NM_001616chr2133350 3285 2743 2703 2656 2266 1271 1245 1076 570 432 411 137 23144 2314 21152 991 --
NM_001621chr7112942 2653 2498 2364 2274 1025 937 693 463 372 146 1500 1292 21132 593
NM_001627chr391850 1722 1711 1512 694 551 392 348 305 1333 ----
NM_001650chr1893911 3336 3070 3001 2797 940 888 480 280 --22956 250 13447
NM_001656chr541459 604 155 48 22012 1889 1522 21680 593
NM_001656chr541459 604 155 48 22012 1889 1522 21680 593
NM_001656chr541459 604 155 48 22012 1889 1522 21680 593
NM_001660chr32666 230 1651 ----
NM_001663chr14102734 2565 2089 1971 1864 1766 956 881 855 357 3592 527 336 11049 12297
NM_001677chr15997 867 772 383 123 1804 3928 404 328 21010 905
NM_001679chr34768 704 644 282 1518 ----
NM_001690chr3102569 2488 619 610 603 597 295 217 183 97 --21781 415 --
NM_001695chr8113862 3794 3409 3366 3346 3050 2663 1389 826 761 199 23691 1554 33959 3506 857 13473
NM_001701chr981615 1467 1307 1114 459 426 220 116 ------
NM_001704chr62515 459 1490 138 1396
NM_001706chr32320 71 ----1278
NM_001709chr11102761 2656 2611 2241 1058 932 886 515 408 309 12287 22341 103 --
NM_001718chr651237 990 435 147 105 ----11138
NM_001730chr1341304 402 225 188 1574 11072 --
NM_001731chr124819 607 201 154 --2805 235 --
NM_001744chr53453 445 170 --251 42 --
NM_001752chr112410 157 ------
NM_001753chr7111836 1825 1701 1664 1552 1528 1402 715 601 264 238 11671 1392 11806
NM_001755chr1661859 1477 551 481 354 309 1536 21869 1457 --
NM_001759chr12105008 4810 4717 4329 4292 1803 1359 975 646 78 11790 11377 21778 1582
NM_001781chr122906 200 3966 682 672 1103 2288 119
NM_001789chr341240 540 495 412 --2464 459 --
NM_001792chr187914 907 720 404 291 213 82 --2451 238 190
NM_001797chr163768 681 667 --1747 --
NM_001801chr5131 --1475 1430
NM_001806chr1972985 2592 2438 2066 798 748 22 --22950 524 21184 507
NM_001812chr4--2234 82 1115 --
NM_001829chr41644 --1882 --
NM_001830chrX103975 3913 3734 3619 3580 3496 3472 3176 1357 197 22505 1218 23078 493 21188 191
NM_001850chr3------142
NM_001851chr64714 669 613 302 --1694 --
NM_001854chr161471 1338 1302 1242 1078 148 1577 1466 11123
NM_001855chr92606 574 --1745 1585
NM_001858chr6205079 4949 4860 4849 4431 3972 3876 3716 3582 3571 3323 3310 3223 3215 1667 954 615 574 385 220 3519 502 252 33628 3159 1735 12011
NM_001859chr9113596 3206 2971 2733 2606 2445 1324 1191 989 546 101 1886 11081 --
NM_001881chr102478 46 1114 1467 --
NM_001882chr52185 175 1391 --1521
NM_001894chr2241235 1182 1135 1028 --21038 1033 11144
NM_001903chr51792 --1878 --
NM_001905chr13611 104 65 --1118 --
NM_001918chr1209028 9019 8835 7511 7211 6753 6241 6235 6117 5655 3555 2395 2342 1650 1456 1273 1026 676 670 331 1903 38706 2264 1896 1213
NM_001924chr12459 170 160 2484 422 --
NM_001957chr482099 1910 1777 1587 766 477 392 344 --22175 747 22262 2129
NM_001968chr45843 832 359 314 157 ----1853
NM_001969chr14113947 3263 3249 3159 3035 2785 1279 955 510 358 117 --22613 826 1782
NM_001977chr491721 1704 1533 1345 503 442 338 273 166 1298 31352 481 447 11395
NM_001980chr126808 779 753 394 346 284 32018 861 744 12265 --
NM_001981chr192259 1934 1539 955 773 688 464 282 137 22194 1579 12062 --
NM_001999chr571393 1188 586 348 238 134 81 1225 11130 --
NM_002006chr4175694 5147 4936 4706 4362 3839 3665 3644 3559 1953 1514 1366 1187 697 269 127 52 44790 4191 458 205 35771 4801 2187 44625 1319 1292 792
NM_002009chr15112737 2561 2322 2277 2152 2061 1869 1019 920 489 90 1828 1939 1765
NM_002015chr13103331 2953 2648 2543 1308 1262 1121 1109 1074 958 1660 1834 1932
NM_002024chrX92097 1929 1839 1419 477 289 257 250 144 1557 21716 70 1665
NM_002025chrX279321 9182 9148 9071 8848 8371 8342 8170 8079 7763 7305 6614 5722 5665 3029 2973 2093 2069 1908 1885 1284 1203 1160 668 264 194 119 47908 3146 2957 2577 38496 7207 1425 --
NM_002033chr1163918 3597 3470 2828 822 673 23969 3376 22910 500 --
NM_002040chr21193134 3109 2572 2419 2296 1993 1275 1173 1011 951 931 909 656 421 409 184 171 94 70 22426 131 32838 2166 2134 11118
NM_002048chr911342 21269 989 1857 21172 974
NM_002061chr171872 1263 630 561 355 275 269 1704 ----
NM_002063chrX51270 1244 1090 871 82 174 1807 1813
NM_002069chr7101911 1713 1677 706 682 602 565 433 349 301 11619 21859 593 --
NM_002072chr94984 971 628 267 1893 1165 --
NM_002076chr12102906 2775 2050 1211 1083 558 358 276 256 120 ------
NM_002077chr992178 1989 1944 1889 870 735 628 558 501 22038 749 ----
NM_002078chr31268 --2468 213 --
NM_002089chr42548 268 --2586 203 --
NM_002090chr44664 514 201 193 1441 1540 --
NM_002105chr11----11066 --
NM_002107chr11393 ------
NM_002114chr63477 208 112 133 1365 --
NM_002126chr17114172 4139 3613 3578 3217 2935 2718 1664 1626 228 98 1536 11122 --
NM_002128chr1352441 2392 2239 1973 460 --22281 1650 --
NM_002137chr762355 2196 1755 1479 857 539 1297 ----
NM_002139chrX1146 --1185 --
NM_002140chr95947 887 470 351 101 125 1286 11015
NM_002145chr171304 1404 ----
NM_002163chr1671300 1293 821 491 483 414 118 --1242 --
NM_002166chr23688 659 27 3614 583 264 ----
NM_002184chr52186 81 --2209 63 --
NM_002190chr641253 314 294 256 --2381 332 --
NM_002193chr221800 219 31519 1405 1396 11608 --
NM_002199chr48965 875 848 785 653 356 92 44 1793 2809 67 --
NM_002202chr51196 ------
NM_002203chr593852 3633 3109 1492 1450 457 359 128 97 24175 3882 1562 23455 227
NM_002210chr2113457 3375 3106 2663 2333 2253 2214 875 685 251 99 32429 1349 1238 41087 659 347 53 3536 487 294
NM_002214chr7195591 5249 5161 5061 4817 4690 4652 4642 4449 4440 4356 4161 3999 1565 658 584 306 238 69 44856 4473 3976 2035 45134 3915 1949 768 --
NM_002223chr1273086 2641 979 747 599 549 442 1905 ----
NM_002227chr131333 1110 828 21309 814 11297 --
NM_002235chr1241602 1570 563 494 --11065 11416
NM_002239chr251174 1094 1078 763 262 ------
NM_002240chr214660 425 98 91 ------
NM_002242chr2--1499 1732 11979
NM_002245chr12108 76 1644 ----
NM_002247chr1041704 1521 1502 162 21999 447 ----
NM_002253chr431040 980 446 --11437 21363 1125
NM_002264chr3155051 4876 4297 4166 3866 3679 3322 3076 1987 1970 1062 964 678 412 401 34959 3451 2026 23283 1227 13270
NM_002267chr13121861 1772 1641 1550 982 798 671 493 475 381 151 112 11765 ----
NM_002268chr341780 1446 1402 255 21588 1503 21707 1239 11462
NM_002270chr5235563 5521 5389 5323 5163 5127 4919 4854 4809 4679 4584 4566 3854 3779 3743 3705 3545 3490 2184 1752 1055 480 224 21968 1914 21257 1049 24516 2231
NM_002271chr1362307 1797 841 525 334 71 11505 11670 --
NM_002293chr142745 2674 880 198 22659 1972 42769 2546 2518 2448 --
NM_002296chr171674 1552 1521 1201 1087 414 237 11099 11715 21757 1374
NM_002310chr5236372 6010 5626 5204 5120 5061 4820 4553 4428 4359 4353 4185 4176 4022 1672 1639 1485 1424 1386 736 643 482 232 46021 5956 1821 851 36587 1969 826 16408
NM_002315chr11----2271 249 --
NM_002332chr12------1138
NM_002334chr1142073 1790 223 44 --12082 --
NM_002336chr12204985 4881 4830 4811 4391 4321 4124 4013 3984 3609 3588 3251 3222 3170 3158 1411 839 540 361 254 --24110 3938 14069
NM_002349chr291670 1580 1445 1387 1323 1310 1104 522 307 11504 11416 --
NM_002351chrX31760 1618 376 --127 2363 273
NM_002356chr6112577 1136 921 736 350 327 318 282 275 128 111 --12557 --
NM_002359chr1774303 3079 3061 1630 959 890 720 1983 ----
NM_002370chr11126 ----1135
NM_002381chr24907 355 288 221 --1702 --
NM_002384chr182994 973 --2844 795 --
NM_002395chr671236 1154 1120 593 491 191 110 2286 78 21283 456 --
NM_002397chr541627 1606 804 244 12251 ----
NM_002399chr1531367 388 371 1920 11125 --
NM_002402chr781185 1037 1011 938 334 242 210 126 ------
NM_002403chr12385 99 ----1391
NM_002408chr144807 338 297 98 1756 1270 1310
NM_002439chr52329 86 --1241 1226
NM_002442chr1251758 1518 1429 425 257 --11508 --
NM_002448chr41782 --1738 --
NM_002449chr541286 1201 326 255 1297 21240 799 11064
NM_002451chr9103836 3786 2499 1284 1205 1177 1024 839 749 243 23375 3227 33932 1161 460 31296 1223 732
NM_002480chr1251342 1238 1096 1036 974 11362 --11268
NM_002481chr1178009 7832 7813 7638 7549 7543 6936 6730 5914 5847 4959 4907 1881 1834 1620 576 208 32543 939 704 36426 2981 322 --
NM_002492chr33453 380 38 ------
NM_002499chr1572468 905 664 653 558 349 327 11831 3400 384 308 --
NM_002500chr23947 496 406 2524 477 --11001
NM_002501chr1952906 2686 2629 1280 1257 ------
NM_002508chr121258 514 11857 31876 1867 1628 --
NM_002509chr203875 707 633 --1712 --
NM_002515chr1451873 1623 274 219 73 --12041 --
NM_002519chr1131353 615 195 1960 --1129
NM_002522chr1753001 2648 1111 602 497 1531 23182 441 12777
NM_002523chr711053 --11107 --
NM_002526chr681741 1731 1141 632 278 266 255 83 11504 1346 1660
NM_002542chr32216 205 ------
NM_002544chr171299 1237 1312 --
NM_002546chr81499 2775 621 2766 628 1655
NM_002569chr15173 ------
NM_002570chr151115 --1882 11021
NM_002577chr3123967 3283 2835 2492 2486 1545 1334 947 873 866 580 293 33465 2811 183 54036 3958 3019 2925 308 1541
NM_002581chr9115663 5544 5377 5092 4839 3619 1899 1557 1544 686 140 23953 1317 25431 4553 --
NM_002594chr2092380 2329 1654 1554 980 918 630 349 244 ----12444
NM_002595chr12141759 1700 1615 1546 1464 1458 1434 1387 781 725 710 527 385 139 21861 164 11394 --
NM_002605chr1531177 1055 33 ----31039 968 936
NM_002612chr7122132 2084 2009 1988 1956 1686 839 833 704 679 357 23 12117 2571 549 --
NM_002613chr16105350 5260 5240 5075 3552 2065 1962 498 432 138 --14365 --
NM_002623chr203684 268 23 2706 597 1692 1165
NM_002627chr10----281 70 --
NM_002628chr351048 1008 879 501 357 1899 21153 262 --
NM_002645chr11143082 3041 2729 2576 2544 2453 2380 2360 1237 1098 1043 1029 557 289 42742 1128 380 114 --22565 630
NM_002646chr152079 1763 1698 1372 359 --22097 806 --
NM_002655chr8165334 5155 4965 4514 3781 3755 3685 3489 3380 3323 3242 1608 597 237 81 65 44720 4565 3211 2034 22054 1990 --
NM_002657chr2093855 3563 3356 2725 2568 1306 825 509 247 33911 3791 2430 --13751
NM_002687chr1461327 1187 1175 504 436 305 11124 2998 846 --
NM_002699chr161473 1428 1304 1228 562 97 21512 1466 31536 1422 478 --
NM_002709chr2193613 3498 3443 3268 3027 2920 2859 2784 2621 2598 1431 1353 1172 834 662 634 581 480 101 43344 3229 1225 690 12336 --
NM_002710chr123975 451 240 ----1830
NM_002716chr1183151 2536 2345 2309 932 742 588 262 ----1452
NM_002718chr3132310 1961 1892 1844 1809 1754 755 748 626 587 507 96 38 --22686 135 --
NM_002719chr14112380 2338 2019 1786 1712 1666 790 698 586 422 393 --1885 --
NM_002726chr6----1153 --
NM_002727chr104618 466 174 132 --2193 50 193
NM_002730chr191959 --1943 --
NM_002731chr1133083 2715 2657 2232 2049 2024 1941 1223 987 897 864 852 131 1670 1320 --
NM_002734chr17142120 2054 2047 2005 1812 1646 1636 1418 787 627 243 223 144 67 21751 423 11732 --
NM_002736chr761831 865 739 636 462 171 41915 1654 566 437 21667 596 1231
NM_002737chr17116648 6163 6145 5451 4671 2343 1754 1583 1214 796 81 46355 5441 4463 706 16462 26076 1338
NM_002740chr392821 2745 2196 2167 1023 1012 909 628 468 1441 22640 495 22472 91
NM_002745chr2283342 3106 1767 1232 452 277 161 111 43585 3574 3223 3149 23676 421 --
NM_002748chr153854 180 59 127 41194 1189 940 119 --
NM_002758chr172493 388 ----1431
NM_002760chrY125971 5378 5229 5118 5097 4292 3892 2394 1509 857 796 609 11705 34308 1353 428 26031 471
NM_002767chr171154 2543 195 2523 210 --
NM_002819chr1921250 67 11210 1106 --
NM_002822chr122654 599 2544 526 11139 31836 1823 281
NM_002828chr185717 694 388 349 314 --1934 1821
NM_002833chr1511164 --1382 11476
NM_002834chr12103649 3549 3370 3155 2819 2562 837 362 356 182 1369 23766 3144 22843 267
NM_002835chr74486 312 273 24 1582 ----
NM_002836chr201194 ----1151
NM_002841chr33477 438 213 --1148 --
NM_002843chr1142357 1340 387 108 185 11021 1340
NM_002844chr641041 190 148 96 21435 451 ----
NM_002848chr1241280 1103 861 328 1109 21224 1128 --
NM_002852chr31136 --1217 1603
NM_002859chr123706 432 400 1606 11785 --
NM_002868chr1231742 971 548 ----1273
NM_002869chr1182150 2094 2024 1956 757 518 246 204 11917 1375 --
NM_002871chr131392 712 554 21891 667 31872 613 455 1205
NM_002874chr962307 1605 825 619 435 254 21859 344 11992 11841
NM_002886chr3144694 4537 4248 4028 3915 3332 3241 1596 1444 1371 1200 965 832 101 --44934 4658 3957 3603 11003
NM_002890chr54960 803 695 627 ----1784
NM_002892chr1461572 1270 1190 1116 650 467 1616 11178 11373
NM_002902chr155681 538 513 89 57 140 --1559
NM_002906chr1181986 1760 1476 1461 815 705 362 340 1834 21684 1562 11828
NM_002907chr122380 287 1296 --1106
NM_002912chr62710 634 1232 1727 --
NM_002924chr11623 1532 --153
NM_002941chr34482 169 148 124 --41329 1139 622 158 11348
NM_002942chr321194 421 --1447 --
NM_002956chr1231424 889 332 --1478 --
NM_002959chr183477 2885 1553 1531 1209 1135 818 225 13859 24461 1097 14401
NM_002971chr351162 1089 1040 838 89 11140 ----
NM_002976chr21364 1338 1344 --
NM_002977chr273078 2954 2379 2198 1119 510 96 12335 --23061 2523
NM_002994chr4101955 1638 1500 790 721 678 666 558 485 158 1466 2751 253 1729
NM_002998chr8111982 1916 1729 1626 766 593 582 537 272 118 82 11362 1378 1551
NM_003000chr11120 --1145 --
NM_003010chr1772148 2079 1985 1839 958 544 86 11566 22352 902 --
NM_003011chr921161 234 ------
NM_003012chr873086 2531 2401 2324 861 750 481 --33145 2652 2295 --
NM_003014chr751392 1135 1057 502 392 1175 21149 1092 --
NM_003016chr172335 257 ----11940
NM_003017chr641214 1151 574 223 ----21263 1008
NM_003027chr152407 154 1134 --1146
NM_003029chr11999 21170 986 2467 431 --
NM_003030chr341983 1878 1786 504 11806 11546 1522
NM_003043chr344264 4190 4064 2893 34074 309 85 1283 --
NM_003048chr292729 2630 2609 2172 1727 1099 887 330 273 12314 32820 1796 359 12457
NM_003054chr10----3239 225 220 --
NM_003069chrX4570 504 288 74 1321 --1281
NM_003070chr92330 129 --1546 --
NM_003071chr3102062 1994 1869 1835 838 809 761 647 596 543 1340 2464 246 1119
NM_003072chr19----1370 --
NM_003081chr2031007 782 458 --1163 1948
NM_003099chr15206336 5928 4786 4754 2498 2445 2002 1831 1758 1747 1610 1578 1514 1499 1492 1199 916 761 380 214 55786 4350 2467 2128 47 11859 16450
NM_003100chr52360 311 1126 2176 106 --
NM_003101chr141667 1616 285 117 ----11134
NM_003105chr11186 1109 143 --
NM_003106chr34965 946 928 229 ----1753
NM_003107chr642076 2035 1610 479 32330 2112 1657 --11806
NM_003108chr2156206 5847 5763 5650 5504 5446 5217 5038 4964 4916 4502 2133 1567 1123 284 35866 5319 5080 35960 5193 1308 --
NM_003112chr7153169 3097 3075 3042 2787 2671 2324 2241 2178 1202 1127 953 699 591 166 32531 1961 264 52283 2248 2142 1073 370 13032
NM_003115chr14404 190 115 44 --1409 --
NM_003128chr242840 2467 2401 470 --1178 --
NM_003130chr751287 1214 988 820 188 --1137 --
NM_003131chr642083 779 714 688 --11641 --
NM_003133chr131029 193 151 --286 23 --
NM_003137chr682200 2106 1940 1803 1711 824 792 352 12235 21559 589 --
NM_003153chr12----11120 --
NM_003155chr882842 2550 1928 1828 846 677 603 45 32761 1981 923 32746 813 398 --
NM_003157chr32221 202 3639 120 107 3914 868 295 1357
NM_003161chr1793195 2887 2845 2699 2604 1434 1386 581 154 1518 --22760 2705
NM_003174chr102776 706 1340 ----
NM_003176chr11321 --187 --
NM_003178chr33746 726 37 --31826 751 291 --
NM_003185chr2081350 1283 1203 1174 1132 1082 1009 965 41321 996 114 29 1409 --
NM_003201chr1081005 980 946 868 688 668 256 128 2297 112 2741 199 --
NM_003203chr2122253 2033 1675 784 703 607 388 224 155 89 56 31 21885 714 11783 --
NM_003204chr1711556 11723 11747 --
NM_003205chr1572098 1840 1670 864 814 675 664 11921 32021 2016 368 --
NM_003211chr1271723 1546 1530 538 301 100 90 31266 372 237 11333 --
NM_003221chr6103573 3511 3043 1465 1391 1268 434 137 75 69 14134 1888 --
NM_003222chr2051005 952 845 242 204 --21111 876 --
NM_003244chr18189 ----179
NM_003246chr1552015 2007 1740 1325 307 21857 1748 ----
NM_003253chr2191887 1631 1585 1418 1392 744 708 500 245 21863 1654 1161 31455 1434 1409
NM_003257chr1551087 1006 373 269 249 31054 1017 999 2413 408 --
NM_003262chr3195198 5003 4361 4323 4159 3910 3356 1995 1974 1524 1338 1302 1166 998 453 351 315 225 209 41890 1780 1451 969 21424 757 23955 159
NM_003275chr92460 123 --1410 1170
NM_003285chr1------155
NM_003286chr2071128 1020 965 955 797 408 252 --1873 --
NM_003291chr132698 26 2826 43 ----
NM_003292chr191841 1604 1407 911 860 533 395 217 119 185 --1431
NM_003297chr122131 101 ----1306
NM_003298chr3146166 5961 5633 5587 4871 4845 4819 3869 3818 1847 1568 1346 1303 1235 36000 5755 296 36176 6031 5137 26083 1930
NM_003304chr351495 1397 1377 290 274 --2477 472 1637
NM_003305chr44350 158 150 112 --1178 --
NM_003318chr62242 211 ----1290
NM_003319chr26885 797 778 632 349 265 --2620 256 --
NM_003320chr1164478 4457 1741 1255 1163 1102 24103 4082 24403 474 --
NM_003336chrX61097 1069 918 826 296 284 --191 --
NM_003337chr581725 1673 1449 1408 1368 1217 176 77 21744 379 3590 537 436 --
NM_003338chr1071965 1895 1402 1233 722 399 127 41663 1395 1351 372 1672 1413
NM_003339chr561371 1338 1152 996 604 533 --21053 462 --
NM_003340chr431059 479 49 --2556 119 --
NM_003341chr31512 --1534 1518
NM_003342chr1782700 2376 2364 1145 683 570 544 380 --13009 --
NM_003347chr2231497 1479 220 --21767 283 --
NM_003348chr1261382 1346 687 344 259 62 --71616 487 393 364 359 354 349 --
NM_003360chr4151 --1194 --
NM_003369chr1172594 822 407 296 224 134 75 ------
NM_003371chr931869 1770 1533 ----11744
NM_003372chrX6784 374 217 107 83 60 --1130 --
NM_003375chr103313 158 137 ------
NM_003390chr1141112 698 345 127 1838 1992 --
NM_003392chr394233 4135 4080 4073 3341 2862 1727 1192 95 24281 2994 24369 4102 --
NM_003403chr143695 173 104 2302 81 ----
NM_003405chr221253 1499 ----
NM_003406chr871850 1820 1797 1447 564 417 152 1244 1653 --
NM_003407chr191495 --1510 1531
NM_003409chr185942 433 270 263 24 ----1555
NM_003410chrX72481 2426 2198 1188 906 458 58 1271 1836 42920 2585 357 286
NM_003411chrY101803 1751 1631 1589 1540 1244 688 660 493 273 21833 679 21358 150 --
NM_003412chr3103006 2993 2933 2363 2286 2208 1943 956 694 352 ----1594
NM_003423chr1972602 2563 1950 1928 1718 931 51 12532 31943 1607 997 --
NM_003425chr19140 178 2615 300 --
NM_003442chr114788 702 258 124 --1146 --
NM_003453chr133525 223 65 ------
NM_003455chr11----21251 1028 --
NM_003463chr662996 2291 1103 875 805 594 --2619 501 43363 2246 2067 1051
NM_003468chr2174350 4325 4270 3718 3307 2920 2818 2740 1468 1443 1256 1091 843 820 650 317 227 --24009 277 --
NM_003470chr162666 66 1203 3233 132 127 --
NM_003471chr321550 647 22236 907 21871 891 1560
NM_003472chr641492 1271 950 138 2271 239 ----
NM_003473chr1031060 835 824 --1429 --
NM_003474chr1042316 1529 301 128 12389 22203 1918 --
NM_003478chr11133258 3169 2963 2869 2787 2359 2066 1277 1159 996 662 585 97 --13326 12077
NM_003482chr1232798 1912 835 12308 12561 12237
NM_003483chr1292957 2848 2819 2812 2489 2056 2031 1987 589 42612 1881 885 201 12805 12647
NM_003489chr2193348 3103 2952 2534 2437 1264 729 720 344 1277 22479 357 12676
NM_003505chr751949 1689 1631 1340 258 --21957 1373 --
NM_003506chr881298 1284 1093 486 478 458 326 306 41351 1081 538 395 11314 --
NM_003507chr252010 1988 1632 791 443 --12029 11739
NM_003557chr131652 1562 1475 ----11591
NM_003566chr12143019 2874 2743 2714 2638 2385 2321 2134 1235 1229 1116 977 458 277 11026 13310 22726 658
NM_003569chr62130 86 --1121 --
NM_003574chr18185739 5140 5064 4424 4045 1929 1889 1668 1647 1425 1395 1326 1142 1128 776 337 286 252 45364 4052 1679 1562 25375 357 34084 2265 1452
NM_003579chr1------1144
NM_003583chr12153938 3814 3656 3396 3345 3054 2531 2524 2470 2424 1120 348 190 136 89 33213 200 167 43902 1382 1296 1245 13161
NM_003590chr2204012 3938 3843 3692 3590 3491 3253 3059 2940 2582 1603 1551 1235 1189 796 718 597 494 394 189 12989 44043 3218 1247 930 --
NM_003596chr7----1547 --
NM_003597chr272324 2260 2247 2191 2020 1450 888 21509 367 22155 1974 --
NM_003603chr482035 1991 1839 1592 1456 1402 846 527 22137 1387 12154 1797
NM_003607chr1154374 4213 4177 4035 3838 3727 3318 2997 2738 1080 949 847 737 516 268 --54343 4198 3862 2955 959 14063
NM_003615chr3153821 3669 3394 3372 3313 1597 1265 1216 1179 984 848 834 591 567 413 33831 1333 758 63760 2918 1498 1039 956 344 11238
NM_003617chr194893 4750 3350 3337 3291 3195 1162 519 494 1664 44944 3868 3863 3374 1752
NM_003618chr241273 468 378 305 21209 224 1995 1114
NM_003620chr173959 335 140 11050 --1862
NM_003622chr1252603 2551 1856 543 280 21778 491 42615 2151 2140 1667 11709
NM_003626chr1151349 1079 436 310 189 --1135 --
NM_003630chr64776 716 614 533 ----2731 302
NM_003631chr10--1664 1947 1977
NM_003644chr17115947 5813 5056 4396 2613 2546 1896 1865 1840 1497 503 --1286 16294
NM_003656chr3----1158 --
NM_003668chr121265 --168 --
NM_003670chr361420 1207 1182 1066 487 212 ------
NM_003672chr1101989 1946 1869 1797 1362 1266 737 550 451 347 --11545 --
NM_003676chr15874 764 651 334 39 1726 --1258
NM_003690chr24630 588 426 246 --1528 2217 189
NM_003701chr1321003 833 ------
NM_003702chr81782 --1840 --
NM_003711chr51249 ------
NM_003718chr74361 117 110 33 1567 1515 --
NM_003722chr382601 2133 1949 1918 1845 1683 1677 189 32594 2558 300 --21776 679
NM_003743chr232074 1463 796 22055 202 ----
NM_003745chr161345 --1408 1375
NM_003749chr1352194 1797 1614 881 683 22141 1840 11767 --
NM_003750chr103760 667 312 ------
NM_003758chr1561316 1265 1056 581 453 30 --11567 --
NM_003772chr1181229 1122 1058 1028 1021 419 178 74 ----1816
NM_003774chr12153250 3213 3189 2962 2929 2649 2636 2578 2509 2423 2391 1306 1150 839 474 1223 3482 91 86 1664
NM_003783chr161213 471 424 383 364 328 --11041 --
NM_003787chr1871302 1239 1192 1139 538 473 204 1494 --11159
NM_003790chr1----184 --
NM_003794chr31173 11057 ----
NM_003796chr196444 433 386 245 182 115 --1622 --
NM_003822chr152627 2466 2449 670 128 --32459 2454 2093 --
NM_003825chr1561488 1307 1300 1291 1028 22 1543 --11009
NM_003829chr941152 1111 252 82 --11194 --
NM_003831chr1861855 1693 1529 1376 386 370 --2430 268 --
NM_003861chr1492543 2059 1940 1853 1097 921 804 619 297 32424 1989 1924 22083 2064 --
NM_003870chr1561891 1797 1494 1435 1377 557 22100 487 ----
NM_003872chr272635 2357 2206 2164 2059 775 666 --1340 --
NM_003873chr1072452 2316 2274 2119 1797 1560 320 ------
NM_003883chr53559 546 535 ------
NM_003884chr3121867 1812 1793 1708 1249 746 700 452 431 412 214 196 31583 511 500 2417 201 --
NM_003885chr1742664 2155 1928 239 ------
NM_003887chr272200 1683 1482 770 392 376 257 1175 --11710
NM_003895chr2162050 1896 1737 536 444 263 21628 1356 12100 12141
NM_003913chr6134307 3752 3681 3264 2850 2722 2656 1148 1107 972 773 654 613 13031 64023 3764 3618 3424 3274 578 1806
NM_003927chr181972 1413 1419 --
NM_003930chr792414 2132 1851 1779 1625 663 423 256 102 12240 2523 134 32479 512 298
NM_003941chr7112215 2051 1979 1890 1837 1732 918 908 703 542 452 12373 1930 --
NM_003948chr472583 2427 2209 1763 1647 539 331 11717 21755 415 --
NM_003966chr5257802 7633 7261 7079 7065 7010 6679 6322 6146 5222 5175 4955 2998 2907 2659 2653 2616 2602 2405 2032 1650 1637 1212 979 340 17144 45984 2086 1620 1026 22022 297
NM_003971chr172516 71 1596 1569 1138
NM_003972chr103446 347 220 2898 391 --21099 322
NM_004035chr17114968 4915 4269 3379 3369 3272 2030 1743 1685 1048 336 24020 120 22061 1187 13174
NM_004040chr241350 1265 1021 854 --21060 512 --
NM_004050chr1432723 2685 2592 --22499 1917 --
NM_004056chr85923 875 820 772 427 1837 1854 --
NM_004060chr531195 427 296 ----1890
NM_004093chr13103183 3143 2774 2721 2647 2479 2114 2070 2015 832 12900 11149 --
NM_004094chr14142927 2788 2597 844 838 810 789 669 590 492 486 462 201 113 1893 22966 1124 --
NM_004100chr692285 1647 744 695 405 289 217 171 56 133 1520 --
NM_004124chr1493446 3229 2791 2735 1057 945 813 776 692 --53295 2517 1392 735 601 1187
NM_004133chr871078 993 949 667 544 334 300 42605 2522 2434 977 12613 12585
NM_004136chr1563061 3004 2669 2365 2347 174 12511 23121 271 --
NM_004162chr351178 867 503 400 142 11312 11143 --
NM_004169chr171810 1832 1716 --
NM_004171chr11119268 7497 6060 3298 3165 2895 2784 1856 1453 996 893 59599 8345 8302 6141 201 18066 1743
NM_004172chr51354 21727 316 1463 12026
NM_004183chr111184 ------
NM_004215chr85593 456 400 108 85 ------
NM_004225chr84964 604 576 458 2997 465 ----
NM_004229chrX112220 2198 1778 1694 1632 1607 1534 1370 672 434 105 22022 275 21810 1477 1418
NM_004232chr18143799 3526 3427 3273 2621 1559 1518 1141 899 690 511 326 115 30 43512 3209 2852 2524 11312 --
NM_004235chr92640 554 --1894 --
NM_004242chr62370 361 --2142 30 --
NM_004247chr17----1307 --
NM_004272chr582016 1874 1741 1570 1295 1234 735 171 11266 1724 --
NM_004274chr1462890 2509 2206 2186 1254 697 --22125 581 12100
NM_004277chr651670 1433 1413 1381 1155 --1143 --
NM_004288chr231057 947 131 2757 646 --1850
NM_004293chr9133721 3375 3047 2885 2828 2495 1251 1150 1017 852 783 423 246 --63872 3509 1533 1464 1102 825 --
NM_004302chr1232961 2856 537 --12820 --
NM_004310chr41648 ------
NM_004311chr1052980 2783 1945 1000 982 13046 ----
NM_004316chr1241116 840 809 40 11153 --1959
NM_004326chr161041 806 496 450 438 397 --11065 --
NM_004329chr1051010 956 398 259 215 2442 201 21192 488 21467 1048
NM_004330chr153972 363 93 1230 1771 3798 264 237
NM_004331chr8112624 2345 1986 892 884 877 575 435 364 213 177 --1154 12638
NM_004337chr862276 1969 1473 758 686 490 --1616 --
NM_004342chr782320 2028 1934 1739 1449 742 674 115 ----32204 837 419
NM_004349chr851196 992 497 346 316 21240 424 --1974
NM_004354chr45869 705 694 257 214 1587 3860 816 230 1345
NM_004360chr1641785 1726 292 270 22013 146 12021 1162
NM_004362chr46686 636 607 173 139 76 1677 ----
NM_004364chr191938 --21031 357 --
NM_004365chr5199 1221 1341 --
NM_004370chr62340 251 12131 11587 --
NM_004379chr271547 1461 1317 1302 1274 581 536 --21395 81 11311
NM_004388chr1172 --1280 --
NM_004392chr1392464 2141 2111 1774 1744 1034 884 317 43 --12326 --
NM_004393chr382411 2350 2331 891 620 213 207 194 ------
NM_004397chr11123965 3666 3612 3535 3430 3385 3240 1731 1160 844 97 79 ----23700 995
NM_004411chr73715 690 38 1212 --1277
NM_004421chr11835 --1860 --
NM_004430chr872802 2610 2513 2237 1109 1036 268 32789 2324 2102 32775 2291 1833 --
NM_004432chr9112267 2256 1914 1907 1692 731 494 424 356 194 155 42410 844 667 90 --21624 70
NM_004438chr273216 3137 2774 1306 1138 718 58 13256 ----
NM_004440chr661927 1871 1837 1669 1462 1273 31974 1571 1341 31588 607 451 --
NM_004442chr121748 606 11129 --11105
NM_004447chr1251049 905 235 176 56 --2846 273 --
NM_004454chr321871 696 ----11702
NM_004457chr23625 283 217 21096 611 11393 11172
NM_004458chrX152634 2523 2257 2202 1837 1750 1641 1070 1064 957 696 458 168 75 66 12141 11018 --
NM_004459chr1751852 1461 423 126 60 --21640 257 --
NM_004463chrX1214 --1520 --
NM_004464chr4204209 3606 3239 3216 2952 2915 2770 2763 1725 1622 1453 1369 898 640 598 589 476 469 356 244 32849 1193 189 33874 944 504 1271
NM_004468chr1----1549 --
NM_004480chr142724 266 1535 --1758
NM_004482chr23936 607 142 1724 --1900
NM_004492chr153257 174 78 ------
NM_004496chr1461359 1316 1257 1217 1055 126 --1177 --
NM_004499chr53465 415 42 ----1372
NM_004501chr1134008 4001 3951 3706 3382 3120 3070 2873 1542 1062 332 289 134 31108 902 317 44145 3626 3501 259 22969 1376
NM_004504chr2133031 2997 2914 2873 2470 2244 2178 965 479 433 337 97 35 22560 739 22786 1165 --
NM_004505chr1751859 1696 1671 1327 437 --1108 11597
NM_004514chr1763102 3094 2817 2038 957 838 --2849 669 --
NM_004516chr1971268 1159 804 381 369 324 176 11217 1341 --
NM_004525chr221491 1030 --31550 1433 92 --
NM_004528chr1136 ------
NM_004535chr2031182 612 349 11346 --11196
NM_004555chr162507 477 1371 ----
NM_004561chr1151833 1689 1537 692 682 ----11839
NM_004569chr143715 572 216 1651 ----
NM_004578chr13934 645 115 --1363 1623
NM_004586chrX135302 4882 4370 4222 3993 3946 3928 3701 1865 1113 823 359 166 25142 326 14105 13713
NM_004600chr151515 1475 1010 616 282 1475 31276 1198 602 --
NM_004607chr52221 51 --1243 1191
NM_004612chr9194734 4363 4082 3950 3853 3720 3449 3349 3184 1847 1615 1325 1093 995 932 456 298 252 245 11280 --11681
NM_004622chr252195 1552 916 490 111 ----1471
NM_004626chr111607 1557 --1566
NM_004627chr211519 --1147 1687
NM_004650chrX31917 1332 1268 1681 21461 175 --
NM_004654chrY71207 1088 1038 988 862 440 27 11383 ----
NM_004655chr1741391 1256 1133 422 --11246 11403
NM_004657chr251459 1306 1235 557 163 --21272 1172 --
NM_004660chrY82333 2189 1695 446 338 321 315 245 --11640 11540
NM_004663chr1531477 144 97 1152 21534 1470 11528
NM_004673chr181577 1443 1222 1129 1068 301 217 127 --1412 140
NM_004685chr1392986 2874 2805 2720 2554 1960 859 172 102 2813 409 12384 --
NM_004687chr1721761 28 --11771 11374
NM_004689chr142345 331 --1339 --
NM_004709chrX71707 1340 1208 1142 300 80 25 11646 --11278
NM_004713chr14--1167 --143
NM_004719chr12112443 2420 2170 1884 1834 807 734 723 705 657 410 22613 2184 --11081
NM_004721chr31297 --1246 1307
NM_004730chr571940 1498 1448 1350 356 236 181 1742 1306 --
NM_004733chr33593 536 98 --1489 --
NM_004734chr1323002 517 1254 23142 453 --
NM_004736chr192156 1865 1815 1423 1405 844 797 791 196 --21951 1472 --
NM_004741chr102446 134 1422 --1312
NM_004744chr4203977 3881 3661 3532 3517 3422 2819 1529 1456 1439 1426 1167 859 732 712 671 579 540 453 383 --22812 400 13941
NM_004745chr8146969 6897 6862 6837 6655 6506 5580 4818 4466 2080 2073 1829 1574 822 1355 46481 5744 5550 1550 --
NM_004747chr1061620 1402 1249 1224 643 221 21286 149 11278 11599
NM_004748chr15183873 3521 2987 2937 2847 2719 1670 1306 1126 987 542 358 312 235 197 171 76 27 64183 3331 2944 2784 1352 559 22826 1045 43926 3909 3701 3416
NM_004755chr1461142 1098 1053 849 71 39 --1465 41120 881 788 757
NM_004758chr17----11224 --
NM_004760chr741626 456 433 166 1547 1132 11919
NM_004764chr124609 535 65 45 --2199 135 2193 172
NM_004772chr541580 1571 617 130 11253 1456 --
NM_004774chr17113077 2969 2592 1148 807 609 600 578 506 378 218 1624 1461 --
NM_004775chr18132133 1951 1853 1789 1770 1619 922 802 618 571 445 421 316 32124 433 279 ----
NM_004788chr1162340 2098 1941 1851 1725 799 1394 12483 1903
NM_004792chr2274 41 ------
NM_004795chr1351861 1707 1689 1679 1448 11281 21641 1495 1634
NM_004801chr241420 974 260 86 --148 --
NM_004804chr262396 2071 1957 1799 971 57 ----1383
NM_004815chr1114304 3941 1853 1841 1587 1183 1128 752 709 609 443 24369 1418 31613 1402 921 3804 759 476
NM_004821chr53675 528 505 --1533 --
NM_004824chr661333 1075 922 339 207 180 11433 1966 1227
NM_004830chr63592 344 129 1787 1836 1811
NM_004834chr283198 3185 2715 2681 2201 1177 1078 391 --1823 --
NM_004836chr25878 849 643 223 216 3340 259 131 ----
NM_004840chrX42419 2121 2085 1712 12475 1957 --
NM_004845chrX53738 2943 1172 634 590 --22545 1137 11047
NM_004846chr2----1122 --
NM_004849chr661713 1536 1132 565 381 176 --11111 --
NM_004850chr251545 1288 1222 1172 1076 41463 1432 1370 536 1528 --
NM_004852chr183614068 14016 13930 13695 13609 12884 12828 12588 12373 12143 11970 11789 11464 11447 11409 11060 10658 10408 9735 5461 5325 5007 4794 4649 4012 3895 3787 3545 3516 3387 2901 2854 1865 1654 981 664 511576 10492 9913 4965 3464 913455 12779 11842 11249 10299 10200 9997 4323 2182 --
NM_004857chr1494162 3981 3746 3419 3054 1837 1805 1433 670 34646 3924 55 34220 4023 3462 13502
NM_004859chr17103000 2885 2638 2057 1188 1164 421 230 192 109 1983 ----
NM_004863chr14144693 3957 3726 3622 3328 2045 2015 1844 1551 1360 1209 1141 230 60 11321 24633 260 --
NM_004865chr63345 300 111 --1155 --
NM_004866chr5234891 4701 4133 4054 3871 3815 3766 3748 3674 3664 3621 3279 3170 1950 1795 1653 1508 1392 1280 869 454 167 76 14037 44478 3880 3239 1783 13829
NM_004869chr18101699 1565 1545 1411 1369 1322 1312 642 492 303 1145 --1376
NM_004872chr1----2466 158 --
NM_004887chr52269 61 1354 --1194
NM_004898chr472737 2592 2028 1132 1102 924 760 --11990 --
NM_004921chr192520 2467 2383 2250 1975 1706 827 753 651 12358 21965 1879 --
NM_004926chr1461788 1570 1466 1449 1369 1262 --21389 390 1243
NM_004930chr11646 ------
NM_004932chr561704 1340 1308 391 194 169 2717 62 ----
NM_004946chr52424 334 1436 1399 --
NM_004947chr362548 2496 1938 338 259 214 ------
NM_004956chr754274 3441 1272 579 77 44353 4256 3813 590 53891 3665 365 178 102 --
NM_004962chr102744 493 --1552 1690
NM_004965chr214683 656 484 69 1305 1512 --
NM_004972chr9--154 21129 732 --
NM_004982chr123767 555 30 --2750 109 --
NM_004985chr12134267 4141 3324 3286 3276 3005 2865 1457 1405 884 809 369 148 23558 791 23620 2812 --
NM_004992chrX78377 8302 7042 5438 5374 2755 1373 15480 12948 11193
NM_004993chr1441009 978 965 75 --21488 983 --
NM_004996chr16----11782 --
NM_004999chr6124305 3866 3666 3441 3405 2986 2789 1628 1198 1102 1066 1051 2997 700 1123 1474
NM_005022chr17----179 --
NM_005028chr1072288 2204 2082 1865 1690 270 164 --21797 211 --
NM_005037chr3----1134 --
NM_005044chrX134528 3748 3637 2826 2811 1827 1203 1151 1107 828 658 485 466 --1245 24588 580
NM_005045chr71681 --1327 --
NM_005052chr17------1353
NM_005057chr1101693 1650 1332 1243 766 725 469 274 85 34 --1139 --
NM_005063chr1033769 772 174 13560 1247 --
NM_005065chr14135258 4886 4327 4286 4189 3541 1832 1756 1128 931 683 577 161 45106 2017 1580 1144 11333 --
NM_005066chr15697 211 203 98 77 ------
NM_005067chr32619 76 2920 66 ----
NM_005076chr132820 1272 125 ----1162
NM_005086chr1291704 1642 1473 1405 1337 661 489 139 73 1132 21392 313 --
NM_005095chr151437 879 392 373 325 --22099 1807 --
NM_005109chr351910 722 513 133 122 1486 --12545
NM_005116chr2094506 4439 4381 4375 4337 3278 3194 1377 900 13064 44565 3498 3477 2801 --
NM_005121chr17113411 3269 2854 2597 2326 1493 1484 1350 1139 1008 537 1498 13629 22565 807
NM_005123chr12171 --1327 --
NM_005124chr63961 325 29 2933 311 4776 649 233 73 --
NM_005126chr342118 1638 859 371 22043 1912 42192 1523 1434 877 --
NM_005153chr162536 228 --1632 --
NM_005156chr9134308 4246 3971 3800 3456 2019 1611 1555 1448 1220 1191 821 134 35088 4036 858 33471 3466 750 --
NM_005159chr1552064 2040 1966 550 473 1154 11764 11422
NM_005160chr22196772 5949 5906 5646 5562 5456 5101 5089 4972 4945 4854 4514 1496 1382 1246 1062 937 281 227 25205 2211 26340 4303 25580 4935
NM_005168chr251787 1541 1109 699 373 --21484 561 --
NM_005171chr1231085 816 99 61135 1052 1039 1010 208 69 1969 1906
NM_005180chr1091603 1576 1491 1173 1149 1058 628 421 30 --11135 --
NM_005188chr11178201 8183 8071 7919 7819 7608 7226 6182 5950 5810 5463 5441 2686 2168 1833 716 189 23338 1559 38213 2777 197 --
NM_005194chr202147 103 --1156 --
NM_005204chr103385 305 293 1833 --1618
NM_005207chr2273709 3058 1151 1013 915 212 30 12510 23251 1120 --
NM_005222chr72927 697 ----1946
NM_005224chr192463 451 --1631 --
NM_005233chr362497 2209 661 515 355 165 32597 2301 397 12171 --
NM_005238chr11103558 3485 2968 2840 2826 2663 2633 1169 668 95 13528 1578 --
NM_005239chr2141913 1305 815 585 11546 --1798
NM_005245chr42313 31 1700 ----
NM_005252chr142685 633 --2690 489 --
NM_005254chr15101401 1257 1250 1234 914 900 476 309 166 27 2526 468 1965 --
NM_005257chr1861258 1196 974 931 527 122 31381 1310 905 ----
NM_005259chr261387 1287 1006 998 331 207 ----21393 1174
NM_005261chr85919 857 712 705 367 1825 1977 --
NM_005271chr103841 393 265 ----31208 995 467
NM_005277chr461798 1610 1500 1223 621 149 31838 1468 385 11955 --
NM_005296chrX4853 410 289 148 --1415 --
NM_005302chr71143 --1458 1362
NM_005312chr91811 12688 11738 --
NM_005324chr17150 --1753 1530
NM_005328chr85780 765 561 304 232 ------
NM_005336chr232217 1939 611 ----22283 380
NM_005339chr4104010 3519 1724 1158 1124 1065 996 497 282 213 11707 33321 1270 807 --
NM_005358chr1341724 1613 1508 1171 21678 1214 21312 346 --
NM_005359chr18206463 6079 5479 5438 5356 4945 4875 4183 2396 1980 1969 1923 1521 1436 618 501 486 379 322 101 21936 1143 25896 5424 11204
NM_005375chr631188 851 303 1965 --1783
NM_005387chr116680 483 465 231 82 66 1589 ----
NM_005391chrX----1134 --
NM_005392chr971813 1490 1397 1355 1340 1195 273 11465 11749 --
NM_005399chr1184436 4333 4216 3829 3811 3765 3295 3144 3090 2838 2814 1732 1215 974 873 647 195 173 --1735 13032
NM_005400chr292987 2952 2921 2835 2275 1973 1937 660 23 --12776 --
NM_005401chr1------1167
NM_005402chr751729 534 371 163 93 ----1363
NM_005406chr183617 501 174 ----11128
NM_005433chr1862811 2431 2233 1991 1920 853 12619 --12474
NM_005436chr10104089 3685 3451 3330 3096 1436 1241 1159 915 710 43000 2749 2605 366 11326 13288
NM_005445chr102326 236 2301 129 1279 --
NM_005461chr2071947 1869 1576 1239 707 592 363 ------
NM_005475chr1293229 3217 2857 2834 2500 2025 912 574 516 ------
NM_005491chrX52117 1730 1703 1685 743 ----11364
NM_005498chr192370 61 ------
NM_005502chr9113086 3056 2870 2726 2319 2270 2185 2099 2041 1150 1059 21103 195 --13230
NM_005504chr12136575 6481 6370 5560 5532 4694 1580 1374 860 806 782 433 278 56315 1838 1452 736 690 35615 4266 1702 25567 2170
NM_005509chr571884 1811 1733 1519 1469 1258 403 1113 21366 123 --
NM_005513chr351404 1306 1109 230 154 11595 --11498
NM_005521chr10----1270 1823
NM_005537chr133339 214 68 --1367 --
NM_005563chr12636 100 --2885 75 --
NM_005573chr52588 103 193 1191 --
NM_005576chr151229 1237 --1184
NM_005578chr3144897 4462 4453 4416 4042 3891 1760 1677 1491 1298 1286 1247 1007 214 24971 496 --13559
NM_005587chr154973 948 798 385 ----1816
NM_005593chr122412 203 --1554 1146
NM_005596chr9156234 6082 6029 5557 5501 4784 4349 2093 1679 1606 1588 1424 456 409 356 15083 14267 1575
NM_005599chr151438 1396 1222 413 328 11477 --11067
NM_005600chr1------1218
NM_005602chr321226 904 1946 21297 1009 --
NM_005603chr1861940 1736 1515 542 243 51 1130 21393 72 --
NM_005604chr682410 2283 1768 1714 854 726 636 105 11866 32557 2478 1010 --
NM_005610chr1126 --189 --
NM_005611chr1641102 1030 873 178 ----11308
NM_005614chr72419 197 --21082 256 --
NM_005618chr6--1493 1659 --
NM_005639chr1221799 380 11244 ----
NM_005647chrX93268 3127 2522 1077 1040 1025 924 905 548 --23105 2157 1512
NM_005650chr2231384 1325 1160 11108 1377 --
NM_005651chr4151 1303 1337 --
NM_005665chr1144883 4692 4194 3697 3401 3374 1271 1194 972 893 837 492 170 149 14472 23729 382 44956 3237 1088 909
NM_005667chr22436 286 123 ----
NM_005668chr5134604 4392 4188 4144 3236 3228 3067 3044 2839 1757 973 611 196 11426 43956 2824 1266 504 14206
NM_005669chr581727 920 869 604 376 322 187 87 1714 11652 21670 407
NM_005680chr24323 278 61 36 ------
NM_005688chr321196 1079 1289 1108 1363
NM_005700chr11------1374
NM_005715chr662548 2036 1018 165 53 27 --32671 1866 179 11747
NM_005721chr221082 143 2833 394 ----
NM_005724chr151217 1612 ----
NM_005725chr182445 1937 1815 1721 1690 863 798 346 32255 537 242 --12124
NM_005737chr262424 2291 2257 1789 1057 725 12919 ----
NM_005739chr1552412 2211 111 98 83 11922 31728 473 395 --
NM_005742chr21571 --1833 --
NM_005746chr7102505 2148 1893 1062 1003 888 795 445 345 77 22554 291 --1751
NM_005748chr12163482 2901 2895 2710 2648 2429 2400 2393 1187 1140 978 876 858 847 832 606 32257 712 351 1159 --
NM_005749chr171197 1268 --1181
NM_005751chr7133 --1462 --
NM_005759chr2124520 4315 3640 3611 3561 3553 3322 1394 1330 969 703 243 --44303 3440 3131 2985 11810
NM_005765chrX5825 729 130 96 77 ------
NM_005767chr131117 1322 ----
NM_005783chr21565 1119 1246 --
NM_005786chr183946 213 95 21004 967 --11017
NM_005795chr262554 2525 2036 1179 1098 462 22412 2242 32583 1202 946 32272 952 855
NM_005797chr1151781 1772 1490 529 523 21454 259 11113 21540 1154
NM_005802chr94660 607 285 124 1532 --1739
NM_005807chr13748 510 474 --171 --
NM_005813chr262545 2165 1695 1050 879 274 42195 317 217 74 139 12662
NM_005819chr173430 2733 2509 2134 1206 1164 683 22606 1266 11112 13317
NM_005828chr17104885 4561 3888 3373 1817 1728 546 524 511 472 24837 3419 21804 1641 25076 480
NM_005832chr381335 1204 1151 1045 1003 936 566 172 ----11086
NM_005839chr14865 289 231 83 --131 --
NM_005841chr411029 --21068 967 --
NM_005842chr135696 665 637 581 514 ----1646
NM_005843chr251966 1775 1758 522 439 --11604 --
NM_005859chr561562 1427 1024 1005 491 470 --1223 --
NM_005862chr36991 969 678 432 340 291 --1384 1753
NM_005868chr7112438 2217 2033 1926 1566 835 773 699 478 198 58 --31894 1685 666 21908 142
NM_005885chr511585 11545 31257 544 317 --
NM_005886chr16----1282 --
NM_005895chr1274109 4025 3200 3183 581 540 424 --31052 989 449 --
NM_005898chr1183094 3036 2637 2458 2294 2265 347 284 12768 22979 1218 --
NM_005899chr1761317 352 311 253 195 50 11515 11206 --
NM_005902chr1583676 3634 3173 3083 2882 1584 718 226 24519 4013 21486 972 14471
NM_005904chr1841373 1119 413 56 11308 11261 --
NM_005906chr661452 1355 1335 543 391 154 ----11470
NM_005907chr6101649 1630 1597 1410 1114 1075 377 189 138 90 ------
NM_005909chr564230 3724 3234 3053 2640 1296 --138 --
NM_005930chr144693 611 306 283 1254 2357 187 --
NM_005935chr4155084 5047 4820 4759 4565 4008 3750 3714 3571 3336 2056 1536 1461 1427 1400 ----11100
NM_005937chr1793849 3653 3294 2785 936 693 448 424 222 14110 13798 --
NM_005941chr8123685 3135 2680 2605 2571 1679 1406 974 534 454 233 223 1719 43616 3301 1282 1254 --
NM_005955chr195471 5269 4719 3667 3587 3434 377 166 141 14067 24367 3598 13503
NM_005964chr1721398 1340 1187 --1274
NM_005966chr262186 2126 1957 1603 1585 387 11634 32336 1728 412 2936 254
NM_005967chr12----1746 --
NM_005986chr1362416 2056 2050 1888 845 832 --2666 594 12198
NM_005996chr1231577 977 521 --157 1476
NM_005999chr141519 579 310 251 1265 21169 87 --
NM_006011chr1584260 3727 3274 3243 1331 716 323 113 --14145 --
NM_006016chr672202 2076 1590 1516 1436 363 234 --1798 11492
NM_006037chr2154305 4259 4100 3888 3590 3574 1711 1587 1579 1435 1118 1082 975 897 685 11504 34372 3493 3373 23699 3178
NM_006041chr17------187
NM_006047chr20123426 3350 3265 2857 2766 1022 752 680 578 521 452 434 42991 2586 2324 312 53041 2675 2662 2213 2199 --
NM_006051chr5162 ----1279
NM_006055chr2102988 2913 2809 2284 1114 988 897 855 785 208 12354 13226 12228
NM_006080chr762446 2032 1869 1039 881 237 12303 42628 2458 785 636 --
NM_006083chr5----1110 --
NM_006089chrX111907 1734 1610 1561 1541 1263 1251 1213 579 274 55 1360 51601 1257 703 157 117 11548
NM_006099chr12874 866 ------
NM_006106chr11123356 3281 2971 2747 2676 2521 2313 1236 424 341 232 133 43292 1320 1033 925 23193 598 22790 2387
NM_006134chr2191531 1347 363 299 239 164 151 126 60 ------
NM_006139chr252295 2203 862 591 373 --1797 --
NM_006141chr16132555 2517 2153 2064 1959 1952 1940 1927 1920 860 830 199 122 --22328 2284 --
NM_006148chr171725 22830 2684 12629 --
NM_006153chr33631 220 139 ------
NM_006158chr871751 1423 1404 693 641 543 176 11527 ----
NM_006164chr22439 147 2402 368 --190
NM_006166chr12122434 2404 2338 2097 2070 1978 1849 1674 889 437 208 189 32650 863 103 ----
NM_006167chr852131 1803 815 688 611 --12408 1293
NM_006186chr251277 1131 1083 1071 283 11164 ----
NM_006190chr21772 ----1310
NM_006194chr1471317 1302 534 482 319 207 143 --21078 883 --
NM_006195chr93985 286 102 --2263 214 --
NM_006196chr2----2247 123 --
NM_006197chr872241 1974 1772 1759 1641 786 371 32222 738 363 12163 --
NM_006202chr1941937 1771 698 255 --1241 --
NM_006206chr442787 2488 1833 825 12943 3285 185 69 --
NM_006207chr8173 1250 --1270
NM_006237chr1372250 1623 1577 1489 731 511 502 --12012 --
NM_006241chr392401 2222 1930 1508 568 462 303 297 205 ------
NM_006242chr2052164 2141 1858 846 632 11567 11436 --
NM_006246chr143218 111 92 11270 --11343
NM_006251chr5122812 2679 2459 2444 2413 2232 2201 1144 921 869 863 502 1402 53215 2736 2715 1178 526 23008 276
NM_006253chr122901 814 11057 --11287
NM_006256chr1152755 2590 2455 2415 2362 2229 2143 2125 1853 1790 1119 1098 1019 620 118 32152 388 322 --32210 607 574
NM_006264chr43401 214 186 ----2574 370
NM_006265chr851431 1349 1001 324 249 --11078 --
NM_006267chr291792 1780 1756 1656 1647 1550 640 406 322 --21858 1216 1563
NM_006275chr2072513 2448 2422 667 407 353 217 2446 200 11756 1225
NM_006277chr22710 634 --2537 520 --
NM_006281chr84829 427 354 336 --1932 --
NM_006282chr2064695 4520 4367 4131 1528 117 --23747 1894 --
NM_006283chr884319 3870 3740 3629 1664 977 765 426 24899 1994 24211 3677 24875 3279
NM_006290chr641916 1521 1377 701 21724 669 ----
NM_006306chrX85936 4005 2209 1765 1391 1294 850 703 --11571 --
NM_006307chrX2345 107 --2121 96 --
NM_006313chr1281580 1335 1208 1146 635 180 140 131 21542 599 ----
NM_006315chr483854 3847 2804 2782 2755 1621 408 370 --13936 14358
NM_006322chr132937 322 1606 1763 --
NM_006330chr871505 1203 1146 1106 610 591 303 21409 454 --11049
NM_006333chr26603 544 501 485 193 172 1256 2532 467 --
NM_006346chr131349 --1183 2484 201
NM_006352chr172000 1951 1834 832 397 185 135 1410 ----
NM_006364chr1441257 864 515 380 1249 11267 --
NM_006366chr661275 1041 487 214 203 101 ------
NM_006371chr3125150 5139 5072 4751 4261 3783 3518 2028 1600 928 762 55 --14279 --
NM_006372chr64502 455 122 110 --1183 1386
NM_006375chrX31713 1626 1222 11408 --11349
NM_006379chr7102221 2111 1892 1706 764 618 541 361 251 85 11939 32116 1441 239 --
NM_006380chr17194107 4051 4026 3977 3737 3381 3371 3272 3055 2921 2900 1612 1508 1131 974 798 778 765 379 34082 2998 461 44088 3088 1602 445 13220
NM_006390chr1291618 1591 1570 1417 1231 482 190 169 144 --21677 43 --
NM_006393chr10174582 4449 4235 3722 3683 3640 1784 1714 1388 1379 1254 902 363 301 212 99 27 14204 33619 3541 1758 --
NM_006393chr10174582 4449 4235 3722 3683 3640 1784 1714 1388 1379 1254 902 363 301 212 99 27 14204 33619 3541 1758 --
NM_006393chr10174582 4449 4235 3722 3683 3640 1784 1714 1388 1379 1254 902 363 301 212 99 27 14204 33619 3541 1758 --
NM_006403chr631401 1373 121 11693 1130 1103
NM_006415chr931289 1241 985 21117 810 --1306
NM_006420chr20103487 3279 2863 2653 2546 2505 2340 2170 911 591 --23195 2121 --
NM_006421chr82958 872 ------
NM_006425chr571521 1467 1444 1011 564 252 113 --41604 1137 644 236 --
NM_006449chr252168 2135 2105 1726 670 --1505 2690 359
NM_006451chr561077 775 732 708 413 134 2812 28 1170 --
NM_006464chr281521 1048 985 949 574 509 265 236 14530 34572 1449 700 --
NM_006467chr5102289 2053 1907 1736 1640 953 854 417 148 29 12275 4769 757 446 73 1763
NM_006476chr112609 268 1560 ----
NM_006479chr125856 356 341 317 44 --1144 1883
NM_006496chr181688 1358 1278 1270 508 429 411 392 --1403 --
NM_006504chr1072942 2631 2478 1815 989 609 531 32888 2781 107 ----
NM_006526chr2042146 2100 685 68 42005 1946 1659 1563 21357 675 --
NM_006527chr42643 534 --1168 --
NM_006534chr2083348 3085 2563 2339 1265 478 166 135 32585 2472 2437 21304 722 12767
NM_006538chr2114180 4130 3934 3895 3692 3223 1664 1218 1173 985 392 1679 --14192
NM_006544chr14366004 5786 5759 5374 5360 5317 5226 5139 5081 4816 4466 4355 4253 4074 4057 3921 3874 2414 2378 2088 2031 1796 1694 1666 1638 1551 1532 1395 1148 969 814 717 480 285 226 169 65738 5326 2399 2258 2046 1730 24433 631 45652 4938 3936 2075
NM_006546chr17136469 6455 6035 5567 5180 4057 2535 2231 2211 1465 917 497 491 15476 26118 1796 21745 897
NM_006547chr741979 477 280 207 --1177 2632 623
NM_006557chr931727 395 149 ----11633
NM_006558chr81329 --2358 141 --
NM_006559chr13258 190 81 1291 --11096
NM_006570chr9159 --1351 --
NM_006571chr81270 --1112 --
NM_006575chr143939 134 97 2555 427 --1361
NM_006577chr281140 1090 982 474 455 301 194 108 --31041 1029 406 --
NM_006587chr4101683 1280 1219 1190 1112 1094 513 497 345 218 1478 1243 11420
NM_006595chr1151853 1795 1496 1304 265 31813 191 183 ----
NM_006599chr16298003 7894 7633 7135 6774 6653 6473 6348 6049 6033 6020 5981 5820 5782 5313 5043 3048 2491 2453 2170 1706 1248 1198 1106 947 886 518 130 79 46945 5245 2971 850 58013 7423 6523 2401 646 47267 5008 2533 207
NM_006609chr292848 2633 2564 2294 2287 880 744 470 272 42593 236 182 82 42031 1899 1887 1876 --
NM_006614chr3173466 3149 3120 2809 2789 2733 2585 2548 2326 1278 1267 1179 943 646 530 409 314 22947 754 32533 2357 1451 33582 3230 1069
NM_006618chr161599 1172 632 511 479 327 ------
NM_006621chr161412 1388 1373 287 236 73 ------
NM_006624chr1081822 801 741 718 292 263 230 219 1620 ----
NM_006626chr9132337 2293 1938 1826 1692 1081 862 808 604 520 432 366 101 2946 574 31947 801 669 11811
NM_006628chr15134322 3264 3162 1704 1646 1534 1421 1181 1036 550 536 302 73 21254 344 23435 3430 11465
NM_006633chr52790 256 1512 1567 --
NM_006640chr1731797 1618 635 --180 186
NM_006646chr1373015 2527 2043 2035 1014 981 48 22924 2832 32490 2223 2143 --
NM_006653chr6----1364 --
NM_006675chr1243386 3103 512 65 1490 2517 336 --
NM_006682chr782801 2600 1013 768 363 184 170 65 12326 12227 --
NM_006698chr2061438 1039 969 439 182 143 11487 11193 --
NM_006699chr152416 2354 912 461 163 11030 2956 904 1181
NM_006711chr162770 691 2762 754 1794 --
NM_006713chr51535 1314 2203 188 --
NM_006717chr9173411 3265 3214 3147 2930 2922 2729 2723 2378 2136 1087 825 747 603 587 549 498 33359 2151 1019 13272 13278
NM_006727chr51378 1513 1194 --
NM_006729chrX155437 5349 4608 4277 3823 3478 3439 2096 1838 1357 1308 1065 1032 811 226 11557 31094 724 565 2780 767
NM_006734chr641538 453 305 258 2429 327 1495 --
NM_006735chr74303 233 89 70 ------
NM_006738chr1583936 3472 2951 1765 1610 1314 640 369 --14593 --
NM_006743chrX3858 730 369 ----1117
NM_006750chr16158124 7959 7949 6806 6552 6483 5770 5146 2682 1907 1473 1154 882 840 801 48101 8092 6519 2932 37476 6633 767 --
NM_006751chr27946 933 802 768 187 84 53 1839 1796 --
NM_006755chr11----1128 --
NM_006756chr871507 1435 1199 1076 534 443 60 1236 31229 199 125 --
NM_006763chr182143 1956 1943 1782 1770 1763 765 520 12094 ----
NM_006772chr611628 --11391 --
NM_006773chr281563 587 304 266 260 195 171 86 21534 573 134 --
NM_006775chr6113063 3017 3001 2680 2542 2376 2353 2173 1117 1043 722 43122 2801 2237 579 23103 2915 1995
NM_006777chrX102885 2615 2603 2403 1100 1018 940 897 653 373 ----1672
NM_006788chr1872133 2125 1358 335 282 261 205 ----21800 1492
NM_006791chr153432 256 131 --1494 --
NM_006805chr571757 1739 1377 617 601 504 259 21086 287 1400 --
NM_006806chr211174 1130 2376 333 --
NM_006811chr206891 869 823 714 667 304 2850 279 ----
NM_006813chr64736 659 610 296 --1331 1158
NM_006815chr124555 361 283 88 11175 2878 538 --
NM_006826chr241303 1110 1058 831 11036 --11014
NM_006827chr1453174 3115 3108 1199 608 23006 992 12957 1526
NM_006832chr1431100 321 51 --21076 106 1742
NM_006838chr1281926 1634 1620 1280 631 118 45 31 1654 11234 --
NM_006851chr12102950 2911 2795 2119 2106 1017 1010 960 445 91 11956 ----
NM_006873chr283431 2955 1161 1040 1011 961 942 682 ----1916
NM_006874chr441151 958 481 95 ----1398
NM_006885chr1693773 3322 2732 1541 1318 1303 657 498 183 32852 1349 545 34168 2583 524 11179
NM_006887chr22221 215 ------
NM_006888chr1433498 3087 2650 42906 2895 913 353 ----
NM_006896chr721156 930 ----11007
NM_006902chr153298 2814 2594 2140 714 1623 --12172
NM_006908chr741166 587 371 180 21149 46 11079 --
NM_006914chr941421 619 333 185 11159 2300 260 --
NM_006915chrX92300 2114 977 800 464 398 302 226 181 22531 2512 12431 1551
NM_006920chr292081 1647 1629 1321 1293 678 389 332 66 --31717 1451 1446 11413
NM_006930chr581738 1268 455 428 316 166 134 80 11409 ----
NM_006931chr1282154 2012 1743 1490 1325 519 471 277 --2480 188 --
NM_006939chr1451037 1011 999 840 85 11164 ----
NM_006940chr1231633 578 108 1505 2683 322 11433
NM_006948chr2192224 2098 1786 1767 1670 889 702 608 139 --1634 11747
NM_006956chr752142 1818 1800 839 550 21771 770 ----
NM_006981chr952882 2501 1945 659 523 41965 1052 377 213 13017 --
NM_006988chr212435 415 11180 --11103
NM_006996chr1101913 1898 1865 1565 1534 1249 596 586 560 260 1334 21634 1262 --
NM_007005chr941215 1193 1146 47 --11303 --
NM_007006chr1683542 3174 2591 2580 981 972 259 100 13497 23547 2819 1552
NM_007007chr12184528 4448 4300 4270 4202 4163 3865 3201 1751 1623 1321 1245 956 721 390 208 190 183 12993 34722 4678 257 --
NM_007011chr15176763 6233 5418 5179 5091 4776 4271 2482 2350 2079 1953 1542 1479 1249 1220 795 693 --16804 --
NM_007013chr83916 741 360 1301 3793 247 175 --
NM_007017chr57894 856 849 658 611 355 268 --1616 --
NM_007034chr12999 661 --3873 696 209 --
NM_007038chr21176067 5577 5007 4977 4903 4670 4527 4302 4134 4050 3863 2111 2075 1892 1849 1670 535 35566 4035 1562 11108 35394 1420 419
NM_007039chr1462299 1863 1854 629 393 309 1901 3805 439 398 1484
NM_007043chr1242163 1825 1616 1374 51916 1695 1332 210 147 --11321
NM_007054chr593721 3490 3046 1203 1134 981 964 944 528 --33914 2872 870 11571
NM_007084chr1371456 1436 1410 1331 1300 1002 586 --11078 --
NM_007085chr361852 1003 625 597 212 126 --31832 733 690 --
NM_007106chr1392749 2672 2607 2095 1905 1072 1040 196 37 1982 22573 840 --
NM_007114chr3143341 3286 3228 3212 3103 3028 2627 2570 2414 2352 1234 803 522 417 186 51142 1086 1005 276 195 12330
NM_007118chr51864 --2873 243 --
NM_007124chr682031 1780 1677 1643 1495 1433 1427 392 31573 772 189 3799 760 656 --
NM_007125chrY71300 1170 981 971 463 328 282 ----21132 903
NM_007137chrX145324 5146 4868 4528 4404 4316 4025 3878 3586 3492 1703 794 778 616 2624 317 --1654
NM_007146chr17132841 2772 2673 2399 2320 1028 888 864 523 469 418 405 200 --31920 353 104 11138
NM_007157chrX52690 2649 2238 711 40 32317 1099 569 1551 12117
NM_007159chr361771 1429 1415 675 334 142 --1194 --
NM_007172chr22103220 2369 2187 2164 2158 1001 989 702 524 513 ----12750
NM_007174chr1262338 2128 1809 676 410 367 --22401 246 12081
NM_007175chr8133566 3520 3320 3308 2960 2797 2585 2543 2317 611 540 191 45 33553 2996 2890 33104 2579 272 --
NM_007191chr122714 49 --1116 2680 232
NM_007192chr1441061 916 459 57 --21094 923 --
NM_007195chr18123664 3554 3536 3330 3140 2877 2871 2616 2430 1476 1088 207 23455 2440 --23365 225
NM_007197chr12--199 21019 928 --
NM_007212chr1112166 2124 2046 1899 1836 1811 870 574 558 159 81 21606 38 11501 --
NM_007214chr681310 1184 1003 943 516 373 364 255 ------
NM_007217chr33320 67 55 ------
NM_007231chrX52411 2330 2057 868 306 1622 1887 12001
NM_007235chr122543 373 1520 ----
NM_007236chr1562347 2252 1791 1783 961 587 1414 12273 1819
NM_007240chr11151 1209 1188 --
NM_007246chr461068 1031 840 676 375 105 1140 1369 --
NM_007249chr13179464 9426 8923 8777 8763 7859 7677 6933 6426 6155 6122 3696 3658 3010 1758 1107 433 36970 3640 1711 68386 8025 7232 6696 6506 5703 --
NM_007269chr1--1197 1100 1563
NM_007270chr721115 422 --11453 --
NM_007271chr661858 1806 1565 1558 1398 1254 31708 424 42 1592 11697
NM_007276chr741144 1020 222 183 21135 22 11095 11055
NM_007331chr472770 2503 2377 2316 2013 1770 467 32292 1988 196 32696 1749 655 --
NM_007345chr1892215 2202 2032 1897 1860 1801 1774 1588 118 22237 332 12112 11780
NM_007347chr15183119 3023 2992 2977 2908 2630 2190 2159 2110 2079 2072 1236 1169 799 665 590 137 21 22398 2065 23170 2964 31084 719 316
NM_007349chr74437 390 379 183 1415 ----
NM_007350chr1284187 3955 3923 1611 1461 797 571 222 34530 4474 3465 31013 391 291 23844 3680
NM_007368chr1341555 1529 1156 601 ------
NM_007373chr1031748 535 397 --1470 11655
NM_007375chr182697 2655 2454 2034 1983 1093 708 694 11840 1303 1186
NM_012069chrX72445 2325 1799 1764 1730 1722 43 --21814 1804 --
NM_012081chr583770 3482 2998 2989 1275 963 149 94 23144 3045 11496 --
NM_012082chr84789 364 245 207 ----2726 259
NM_012084chrX1382 --1524 1456
NM_012089chr1101522 1050 1032 480 442 376 340 266 176 34 11412 21549 1301 11568
NM_012095chr1063322 3033 2863 755 633 171 42922 2704 887 619 22467 1302 --
NM_012096chr3113600 3311 3272 1431 1422 1372 869 793 531 477 136 43502 508 446 108 23628 684 11041
NM_012104chr1183352 3027 2521 1312 898 481 298 59 ------
NM_012120chr6102949 2927 2731 2692 2478 2115 898 778 523 299 --32905 2547 691 11132
NM_012124chr112919 338 1295 --1684
NM_012153chr1162385 2197 2049 1696 911 718 1643 12338 --
NM_012158chr1361863 1856 1683 1281 384 59 1665 11788 31797 1201 1175
NM_012161chr4101090 1080 932 926 767 740 468 266 62 21 --31002 855 793 --
NM_012175chr115944 822 667 275 179 1805 1843 1291
NM_012180chr43632 551 156 1605 ----
NM_012193chr11134347 3887 3460 2085 1146 1085 993 924 601 409 263 192 80 45093 1215 765 494 44352 1749 736 554 --
NM_012197chr931614 1223 1196 --21560 519 --
NM_012207chr1061001 867 334 297 190 84 2241 211 --195
NM_012214chr2266260 6090 5736 5720 5612 5298 5282 5041 4932 4830 4743 4482 4328 3959 2568 2531 1945 1914 1295 1027 902 747 716 367 197 75 55219 1226 949 654 389 55751 5200 1095 965 335 14767
NM_012215chr1071918 1774 1363 1207 766 700 156 1668 --1604
NM_012218chr195683 468 398 390 63 1414 2428 234 --
NM_012224chr431225 845 324 --31203 237 185 --
NM_012229chr1031396 1026 596 1508 1143 --
NM_012234chr373716 3628 3345 2516 1129 378 198 32547 271 216 23701 2319 12656
NM_012238chr1061654 1576 1407 1362 1196 51 21636 435 11280 --
NM_012242chr104743 166 158 60 134 ----
NM_012247chr101681 --1367 --
NM_012249chr2143402 3371 3184 3086 2997 2916 2898 2876 2710 2533 866 798 681 552 183 22865 220 --
NM_012255chr203454 334 47 --1108 --
NM_012257chr75861 831 814 331 205 ------
NM_012259chr621066 520 1929 --11408
NM_012262chr1144213 4001 3943 3716 3677 3553 1802 1714 1650 1544 1374 1085 197 58 55282 4690 3291 2026 914 54655 4635 1034 976 461 14219
NM_012281chr721596 717 11513 22188 230 --
NM_012286chrX2612 419 --1245 --
NM_012287chr3184404 4369 4292 4223 3942 3543 3380 3317 3182 3108 3059 3049 1481 1098 852 614 204 83 44270 3504 1709 894 43723 3194 1657 676 --
NM_012293chr232226 1659 255 ----12272
NM_012297chr482514 2480 2466 2412 2064 2032 2014 665 21970 1693 1589 --
NM_012300chr552154 1619 946 671 377 22400 728 12219 --
NM_012301chr752145 1977 879 667 292 --11879 2825 356
NM_012302chr161189 884 841 400 313 251 1165 11126 1185
NM_012309chr11194670 4648 4596 4515 4457 4330 4221 4076 3997 3982 3316 3105 3072 3015 1764 1727 1541 981 702 ----13333
NM_012316chr175442 4962 4649 1128 385 343 337 11171 ----
NM_012323chr2211256 11141 11171 11148
NM_012325chr2051641 1296 1127 357 142 --21589 1420 --
NM_012328chr751358 1067 583 326 106 ------
NM_012329chr1761405 1242 621 486 296 287 1276 21616 1596 1113
NM_012330chr1061590 1490 1397 1216 652 468 21699 232 11516 --
NM_012333chr151322 1228 623 515 304 11268 ----
NM_012334chr5164776 4510 4424 3581 3451 1797 1411 1327 1248 1139 745 697 624 563 224 197 23874 1255 23251 1156 1733
NM_012341chr101403 --1439 --
NM_012343chr561113 1106 1050 305 280 184 11086 1423 1254
NM_012382chr5164443 4104 3861 3780 3307 3093 1391 1362 1284 973 855 841 695 614 361 278 11192 63763 1696 1537 1309 1278 1127 --
NM_012388chr15113017 2954 2935 2631 2571 2309 2023 722 675 550 219 --32343 430 365 --
NM_012414chr14821 293 280 64 --2834 87 --
NM_012420chr1081952 1722 1591 607 462 289 78 71 11902 1768 1152
NM_012428chr152252 175 1789 --1918
NM_012446chr52410 130 1475 ----
NM_012463chr1251517 1506 1232 1174 214 11394 1346 --
NM_012464chr472735 2379 2348 2162 1933 905 625 52935 2777 1900 142 94 12877 1439
NM_012482chr13717 158 50 ------
NM_012484chr52206 104 --1166 186
NM_013231chr1484418 3652 1453 1391 1278 1191 1120 341 --34353 1417 1081 --
NM_013233chr23460 429 203 --1547 --
NM_013254chr122726 571 177 2498 191 --
NM_013255chr7198689 8583 8186 7167 6516 6323 6289 6252 5658 5489 2543 2482 2283 1923 1366 857 743 447 330 57436 6619 6609 1983 990 88782 3264 2739 2128 2049 1478 1107 269 37183 7103 715
NM_013261chr4103709 3582 3328 3190 3030 3024 2761 2565 1107 107 21485 629 11112 --
NM_013262chr661490 1380 1353 1242 1047 258 31469 950 513 ----
NM_013267chr122523 420 ----1488
NM_013281chr2051553 479 415 230 158 --2942 296 --
NM_013302chr1694464 3824 3687 3123 1860 1729 1579 674 611 --23863 1374 21869 130
NM_013309chr1592638 2545 2274 1747 841 673 545 400 184 12603 21924 1070 2589 366
NM_013354chr881369 1237 514 464 433 291 60 25 --2939 123 11158
NM_013357chr82769 737 --1621 1640
NM_013372chr1593003 2942 2874 2504 1350 1042 943 833 250 12812 42584 2570 2446 327 --
NM_013373chr222998 720 11007 11034 --
NM_013374chr3143090 3041 2981 2915 2640 2463 2412 2355 2277 2207 2116 790 700 461 22663 2599 1657 11040
NM_013377chr123575 429 32 2112 91 ----
NM_013386chr171615 1368 1349 1313 1157 612 339 51472 1178 413 394 374 1230 --
NM_013396chr21111465 1280 1142 1040 954 423 295 288 200 149 109 11196 21575 240 --
NM_013436chr22228 74 1747 ----
NM_013437chr8101416 1314 1299 1290 994 922 368 320 188 67 --11085 --
NM_013438chr961698 469 412 133 73 59 21282 258 ----
NM_013438chr961698 469 412 133 73 59 21282 258 ----
NM_013449chr1222105 278 12462 31945 1916 1833 11891
NM_013450chr241187 1106 945 497 --2793 425 1393
NM_013943chr173260 3143 2348 2151 830 270 187 33205 3105 602 62721 2472 2265 818 727 385 --
NM_013956chr8--1128 139 145
NM_013995chrX112427 2349 2190 1968 1949 1038 775 493 292 257 176 32411 2314 1887 2912 820 --
NM_014005chr5102814 2775 2569 2171 1195 1080 425 404 376 235 --31057 96 27 --
NM_014011chr252495 2327 2060 1934 697 22307 2269 1658 --
NM_014016chr351295 1179 611 332 108 21613 1331 21682 675 --
NM_014026chr11------198
NM_014028chr6153342 3197 3081 2651 2425 2114 2063 1257 1185 799 704 669 649 397 226 42491 736 637 597 1276 1282
NM_014034chr661439 1384 1270 513 430 358 21248 266 1212 --
NM_014048chr16155073 4685 4635 4473 4448 4346 4324 4135 3590 1605 1221 1146 972 763 372 35208 5109 1235 14966 22130 627
NM_014059chr131293 ------
NM_014071chr201106 --1412 --
NM_014106chr15112995 2756 2629 1958 1880 1184 431 255 234 193 77 --42520 2213 2185 2097 12661
NM_014109chr851264 992 432 291 206 31220 781 29 1351 2816 793
NM_014112chr8155387 5186 4899 4682 4656 4307 4061 3784 3678 1914 1906 1787 1340 797 756 33605 2044 1195 25392 1038 --
NM_014117chr1692421 2165 1948 1821 1736 988 914 830 634 --1649 --
NM_014141chr7105300 5096 5085 4746 2048 1991 1873 1121 990 828 2917 196 24393 2026 --
NM_014153chr161478 --1611 1716
NM_014154chr341341 1059 424 373 21440 1234 21038 440 --
NM_014155chr11307576 7441 7275 7112 7044 6961 6860 6692 6561 6318 6258 6203 5800 5636 5490 5363 5310 5050 4883 4760 4712 4652 2993 2831 2796 2490 2425 1920 1421 813 46929 6147 5084 879 1436 37085 6235 1156
NM_014159chr32631 602 --1608 1473
NM_014160chr341326 995 550 297 21172 221 11373 --
NM_014166chr131761 ------
NM_014181chr262609 2505 2294 1821 673 403 --1218 --
NM_014191chr1221032 388 --2358 345 --
NM_014211chr531442 1385 69 11727 ----
NM_014212chr123275 68 61 --255 50 --
NM_014225chr192399 385 --1390 --
NM_014226chr141428 ----2279 271
NM_014240chr374125 4006 3710 3582 1544 739 345 1570 ----
NM_014243chr472097 1861 1785 1413 1337 510 378 --21849 114 --
NM_014246chr2231877 1846 1718 1475 21892 537 --
NM_014251chr74756 655 226 131 1628 1856 --
NM_014253chrX62455 2304 2249 950 791 156 11929 12202 --
NM_014264chr43633 217 119 1451 --1505
NM_014267chr112808 164 3610 88 23 3894 878 315 --
NM_014271chrX1332 2226 164 2337 220 --
NM_014275chr51355 --1339 --
NM_014278chr42386 325 1146 1344 --
NM_014283chr141571 1331 555 334 21010 435 1442 21414 229
NM_014294chr88986 932 579 539 490 443 257 190 1351 1246 1546
NM_014296chr361534 1238 1198 537 514 242 130 ----
NM_014313chr131629 1564 1510 --1247 --
NM_014314chr94550 343 333 43 21815 1664 11459 --
NM_014319chr1271847 1739 1566 1387 1256 618 102 1574 41651 1211 662 262 --
NM_014323chr224903 892 668 105 1790 1828 --
NM_014331chr4267822 7807 7713 6794 6744 6734 6394 6291 6236 6071 5882 5294 5136 4978 2989 2955 2395 1382 1207 870 564 540 480 139 127 96 42755 2727 1730 1046 37357 5730 5362 67786 7298 6771 6530 2820 1055
NM_014332chrX----1267 2398 74
NM_014342chr1131388 1095 237 1325 1290 11413
NM_014344chr112803 770 --2819 779 --
NM_014345chr62797 779 --21047 282 1828
NM_014351chr2241070 914 457 443 ----1325
NM_014363chr1331187 1055 929 1425 41222 1141 509 341 1271
NM_014368chr92735 387 12121 1523 --
NM_014372chr171826 1323 829 776 433 201 166 ----42047 1581 1472 451
NM_014382chr3111713 1651 1399 1358 1212 1096 672 665 352 185 148 21769 1366 --1237
NM_014391chr102531 193 ----1742
NM_014393chr8112243 2184 2016 1848 1776 1673 1636 789 746 413 403 32047 550 421 12248 --
NM_014415chr3101619 1506 1408 1396 1187 587 577 519 403 278 --2552 351 11540
NM_014421chr451627 1543 1415 772 688 12061 11582 12092
NM_014423chr5175318 5283 5221 5205 5181 5044 4788 4214 4026 3796 3588 3490 1794 1541 437 416 311 15600 54797 1390 843 559 303 13524
NM_014432chr621135 598 11469 1621 1412
NM_014445chr3112296 2022 1977 1798 1720 1622 915 804 611 290 42 32002 1825 413 1429 12226
NM_014454chr63897 390 309 1376 1983 11027
NM_014455chr11378 ------
NM_014456chr1061468 1257 697 663 468 373 --21860 1346 1131
NM_014458chr121450 545 21052 67 41308 1031 306 98 --
NM_014472chr10----1731 --
NM_014489chr11----1861 --
NM_014494chr1631467 737 699 11699 21781 127 --
NM_014504chr752145 1758 1550 744 647 --22098 552 2493 400
NM_014517chr371509 1360 1342 748 696 394 93 --21934 1502 --
NM_014521chr271875 1831 1752 1257 450 361 309 --21819 1579 --
NM_014547chr152713 213 --1668 1175
NM_014548chr153606 243 192 --186 --
NM_014552chr251533 1477 610 410 301 --21160 268 21556 1307
NM_014554chr1292300 2097 1718 1698 1469 617 527 201 50 21479 603 --12029
NM_014572chr1331197 508 317 11248 2483 357 11683
NM_014575chr34547 447 199 163 ------
NM_014577chr225862 807 789 718 138 3926 639 595 1856 1726
NM_014584chr1461358 1148 519 316 231 211 11337 21188 598 1105
NM_014587chr1641590 620 602 596 11353 --11319
NM_014600chr21624 ----21581 1530
NM_014606chr491314 1232 1196 1149 1077 989 437 325 94 11475 21162 994 --
NM_014607chr272142 1633 1363 781 407 337 121 189 1747 --
NM_014612chr971558 1297 1103 1092 602 458 122 ------
NM_014613chr593057 2243 2177 2138 1967 1216 590 524 368 13112 12063 --
NM_014615chr1672927 2531 1358 835 828 650 520 11377 154 --
NM_014616chr3123332 3249 3155 2597 2255 1371 1082 839 816 446 312 242 1110 23186 2157 --
NM_014629chr851367 1229 905 506 457 --11255 --
NM_014630chr1574010 3988 3269 3142 2511 1180 732 ----11292
NM_014635chr2101740 1679 1583 1309 638 552 427 371 146 23 ----11504
NM_014647chr1672292 2077 2012 1751 662 597 262 --12223 --
NM_014660chr73991 729 67 155 1842 --
NM_014666chr531282 267 96 2479 145 31301 1077 869 2961 351
NM_014670chr231533 1275 1188 --31288 317 133 11603
NM_014671chr761428 1413 1201 1084 244 163 --31470 1054 554 --
NM_014674chr3114020 4007 3751 3442 2810 1614 1295 1104 528 387 335 23959 308 23885 397 --
NM_014678chr222757 105 ------
NM_014679chr1141175 1016 554 528 2940 326 2466 25 1271
NM_014682chr861961 1669 1543 523 338 244 1306 21983 135 12122
NM_014683chr17102186 1992 1811 1693 1553 1366 1327 844 787 670 1221 11792 11798
NM_014686chr1932588 701 528 ----1464
NM_014701chr1583184 3055 2251 1300 1263 1050 508 60 22422 2347 --23377 2842
NM_014702chr6173432 3413 2901 2597 2479 2444 2214 2165 2120 1284 1272 943 900 758 415 382 261 32824 2777 730 12790 12349
NM_014705chr7102084 1846 1714 1624 1564 1472 1309 426 271 87 31722 1368 288 ----
NM_014706chr1271050 983 896 843 749 408 133 ----1935
NM_014707chr751424 659 652 614 244 12024 11937 1858
NM_014709chr25574 568 509 246 226 ------
NM_014711chr16112080 2033 2002 1870 1724 1592 1533 1521 1418 1367 445 12073 151 2439 247
NM_014712chr16--1614 1632 --
NM_014720chr1051740 1504 1285 1173 1143 21798 1645 11433 21570 240
NM_014729chr8102168 2076 2037 1867 911 776 646 623 194 175 167 3811 246 92 --
NM_014751chr882059 1835 1621 1512 455 355 306 230 1298 11609 --
NM_014752chr117784 643 587 349 336 232 133 1595 --1306
NM_014755chr2143612 3478 3093 2880 1703 1617 1592 1159 1141 1124 1074 822 367 118 44280 3765 712 694 --1552
NM_014757chr5112371 2270 2240 2189 2104 2021 1977 576 412 79 48 22207 2182 1358 12129
NM_014764chr122347 72 11266 31133 1128 1123 --
NM_014765chr192672 2523 2267 2010 2002 1956 1043 623 44 1863 32553 162 139 --
NM_014772chr1873109 2429 1414 1143 704 559 322 --13114 --
NM_014774chr1113266 2846 2392 2065 2045 1042 987 716 236 181 116 1354 13148 23072 392
NM_014779chr351085 993 983 439 260 1968 1773 2890 78
NM_014795chr281105 1064 957 539 403 366 332 275 11360 41179 1171 1008 975 1994
NM_014797chr6122607 2523 2502 2148 2102 1218 989 746 629 564 558 237 --1870 11236
NM_014798chr171432 --11837 --
NM_014802chr122853 285 21046 269 21148 712 --
NM_014804chr1731417 160 60 11120 --11253
NM_014819chr542314 2019 1819 315 1909 22241 2218 --
NM_014824chr1121819 1664 1291 11850 --
NM_014827chr161577 664 528 365 353 22 --1444 1186
NM_014829chr592212 2189 2097 1846 1563 1501 660 524 251 2707 570 32343 2285 352 --
NM_014830chr1253918 1556 1112 820 339 23886 3297 43184 2749 1090 760 --
NM_014832chr1331887 672 617 2407 380 31908 1815 506 --
NM_014838chr22112835 2403 2280 1089 1045 963 651 409 393 256 196 22774 720 32888 2454 338 --
NM_014839chr192336 2322 2002 931 830 757 574 332 310 1348 1551 1818
NM_014840chr1293426 3274 3200 3181 3138 2651 1299 733 235 ------
NM_014848chr1572713 2588 2280 1827 1010 926 766 22349 1945 32627 717 124 --
NM_014860chr2122659 2505 2432 2409 1997 1652 906 849 748 677 335 165 1186 --11982
NM_014873chr1144670 4557 4495 4426 4419 4179 3896 3857 3601 3351 916 204 153 69 13836 14511 14608
NM_014877chr17247763 7654 7615 7609 7593 6948 6883 6840 6682 6583 6391 6310 6214 5380 4972 2950 2592 1907 936 830 513 217 206 100 66920 5502 4868 2958 1352 565 47229 5060 4827 4798 17554
NM_014892chr63482 406 209 --1435 --
NM_014893chrY82341 1843 1540 943 672 401 244 114 --1506 1600
NM_014897chr1751170 1130 575 554 529 52350 693 370 324 254 --1287
NM_014898chr1962357 2302 857 426 194 125 --31745 222 33 1571
NM_014899chr5133146 3109 2983 2720 2683 2066 2011 1996 1099 998 460 270 34 12798 43047 3042 2051 586 --
NM_014900chr251085 1050 849 233 225 1287 1733 1358
NM_014903chr1282465 2002 1681 766 434 319 192 31 42320 722 658 216 --12237
NM_014904chr10123715 3558 3295 2798 2625 2619 2513 1560 1221 1147 799 120 24035 1269 --22775 456
NM_014905chr262000 1844 1489 810 758 99 --31823 1289 576 --
NM_014906chr17143915 3842 3512 3398 2933 2667 1610 1538 996 972 833 751 737 533 --34071 3743 1643 --
NM_014912chr10113455 3327 3049 3021 1341 1158 786 604 244 230 137 43411 3141 2357 269 33346 3224 2305 21194 904
NM_014920chr673575 2970 2503 2385 1418 1411 671 --43171 1129 624 217 53370 2345 304 290 116
NM_014925chr121700 --1923 --
NM_014932chr371300 1272 741 422 407 180 136 ----11684
NM_014934chr13113991 2693 2680 2504 2497 1611 1386 1254 816 781 373 24024 1007 21518 795 21365 766
NM_014936chr6102776 2749 1849 1762 1140 965 741 584 419 95 22627 471 21101 140 22055 1949
NM_014946chr2133109 3039 2916 2735 2458 1918 1094 1037 1002 964 874 626 33 32938 1056 502 ----
NM_014947chr1102670 2440 2305 2038 1088 825 440 172 149 104 ----12375
NM_014950chr1461734 1691 1364 1127 551 180 --1192 1307
NM_014951chr1052324 1973 1933 1684 1008 --22434 187 --
NM_014962chr20142568 2419 2376 2358 2351 2271 2077 1110 1102 1081 1067 1038 515 227 1980 42512 2493 2252 735 --
NM_014969chr131037 1014 908 2989 349 21066 974 --
NM_014977chr143530 521 515 ----1486
NM_014982chr14154971 4566 4512 4080 4007 3879 1862 1797 1765 1487 1128 1000 541 308 98 11913 33285 1251 1164 --
NM_014988chr421928 1894 22823 2000 1382 --
NM_014989chr631458 1365 265 --11670 1682
NM_014990chr146910 822 543 462 416 316 ------
NM_014991chr411219 53101 2836 2629 2254 327 11083 --
NM_014997chr772763 2738 2314 2243 1140 728 56 12906 ----
NM_014999chr1281629 1461 1399 1199 1071 653 123 92 11281 --11565
NM_015000chr12122954 2929 2902 2684 2660 2616 2606 2518 1016 972 899 830 12630 32201 223 205 --
NM_015002chr1262168 1620 1425 817 802 617 1327 2761 720 12082
NM_015009chr34742 649 299 164 1773 ----
NM_015011chr1331111 458 402 1442 1433 --
NM_015025chr292604 2314 1976 1064 1018 875 551 338 154 --2484 143 22671 1933
NM_015026chr12214707 4700 4494 4486 4368 3931 3875 3820 3507 3452 3324 3306 1624 1433 1309 1286 914 694 551 472 210 34072 2949 896 64510 3223 3088 2977 1653 425 1934
NM_015027chr1632015 1822 1602 11318 1252 --
NM_015032chr13152436 2240 2121 816 788 751 745 721 663 522 435 324 313 170 138 22026 1036 21016 798 22086 1073
NM_015039chr1124359 4249 4231 3792 3229 2798 1699 1625 976 550 503 44 14050 13117 --
NM_015040chr2113329 3223 2902 2302 2089 1106 925 671 538 180 80 12602 12232 23346 2748
NM_015042chr1554188 3826 3175 2811 1415 43533 3483 1384 1375 --11141
NM_015045chr1062258 2148 2020 622 304 268 --11675 12154
NM_015046chr952707 2691 1850 1811 599 12456 --22570 414
NM_015049chr2113288 3274 3009 2970 2904 2591 2264 2042 2020 1238 411 32240 709 27 13259 --
NM_015051chr982755 2503 2492 849 702 568 241 98 1265 --22068 1162
NM_015074chr1114815 4732 3458 3058 3017 1657 692 475 422 349 69 --34626 3568 759 --
NM_015076chr6114557 3501 3126 3119 1371 1140 764 651 538 373 169 64324 4202 3479 813 687 413 --14525
NM_015082chr552634 2566 1694 384 115 --1589 1622
NM_015091chr144706 633 248 125 1722 1699 --
NM_015092chr16113769 3725 3699 3512 1849 1549 1323 1306 1274 1226 723 14086 14634 --
NM_015093chr661778 1348 1197 661 518 378 11846 ----
NM_015094chr2284462 4129 1824 1774 909 888 310 153 --14691 --
NM_015097chr3121957 1851 1702 1692 797 763 670 434 424 400 366 187 --21879 287 12151
NM_015100chr151980 1764 1668 682 410 22040 564 11745 1119
NM_015102chr1----2397 314 --
NM_015110chr9102515 1827 1784 1545 798 773 564 432 361 344 22539 2070 41736 778 587 541 1826
NM_015120chr23298 116 102 1276 141 --
NM_015124chr2262529 2505 2332 2020 829 159 --12465 --
NM_015130chr471319 1268 1147 1127 907 487 53 --11273 11061
NM_015132chr761799 1491 795 741 683 667 11587 21252 719 --
NM_015137chr8112510 2408 2023 2011 1952 1919 1757 1640 926 626 492 --1266 11818
NM_015138chr15122867 2653 2526 2313 2284 1935 1857 1835 829 627 245 170 22030 656 ----
NM_015139chr1----1161 --
NM_015143chr461401 1377 1331 1302 424 287 --153 --
NM_015144chr16144024 3990 3942 3935 3273 3189 3146 3069 2956 2767 1602 1429 951 116 12645 33952 3278 441 13839
NM_015149chr142086 1467 601 473 1509 2502 324 --
NM_015153chr66702 590 544 299 292 263 ------
NM_015155chr1062827 2082 1317 1153 300 210 12563 42396 1296 1212 749 --
NM_015156chr14123856 3814 3732 3690 3310 3196 2743 2563 1502 1083 999 542 --22753 400 --
NM_015161chr1661428 1399 974 617 355 103 --21543 955 --
NM_015163chr1442018 1886 304 287 --11681 --
NM_015170chr852136 2127 1640 899 838 22312 2241 ----
NM_015172chr171479 1461 1252 1213 1143 1117 516 21405 539 11332 --
NM_015180chr142679 564 1556 1292 --
NM_015186chr94456 383 313 22 1444 ----
NM_015187chr41377 1985 1956 --
NM_015192chr20112775 2677 2493 2473 2263 2171 2008 915 586 429 340 32667 2307 2069 13002 --
NM_015194chr1721901 1705 --22098 2055 --
NM_015199chr362874 2795 2708 1866 239 69 1703 1360 --
NM_015205chr1345172 4854 4822 4636 15287 14835 --
NM_015215chr173046 2503 2437 2310 801 525 172 13173 21283 1086 --
NM_015216chr561209 627 576 352 340 115 2996 29 ----
NM_015231chr111979 2947 25 1844 --
NM_015236chr431057 1000 103 --1591 --
NM_015239chr93352 186 56 --1209 --
NM_015245chr662638 2544 2086 1910 860 563 1296 ----
NM_015261chr111319 1340 ----
NM_015267chr1252176 1994 1775 1438 340 11796 22165 2086 --
NM_015271chr4154234 4129 4061 4006 3881 3576 3102 3062 3012 2792 1627 888 832 521 93 24040 3938 --13567
NM_015272chr1641816 858 392 336 1453 2541 468 --
NM_015275chr1251326 667 522 203 144 1871 21964 1699 1619
NM_015277chr183589 502 297 --2539 400 --
NM_015282chr252769 2725 2700 2009 1965 --22665 400 22750 1091
NM_015285chr1832330 2236 588 --31847 1797 1730 --
NM_015288chr553559 3486 3229 2880 129 13619 23413 2939 --
NM_015291chr1163545 3510 3439 3158 3060 2881 2553 2537 2356 2164 1413 1313 832 782 148 105 11007 ----
NM_015296chr1351141 1104 953 944 159 --21186 395 11157
NM_015308chr114799 707 225 72 2898 839 ----
NM_015310chr8248410 8339 8120 8112 8101 7584 7514 7367 7231 6764 6481 6006 5164 5147 5085 3228 3150 2946 2406 2177 1500 1416 1298 315 58279 5661 5447 1787 438 45559 5431 3049 1174 --
NM_015313chr11184713 4680 4652 4558 4494 4471 4366 4344 4182 3973 3832 3115 1860 1614 1126 432 385 377 43817 3369 1682 896 53788 3735 3650 2920 849 --
NM_015315chr543429 2960 724 127 23439 271 1729 --
NM_015317chr292690 2568 2416 2237 2064 1971 1051 877 517 42793 2349 1795 476 1130 --
NM_015323chr641635 1148 486 271 ----31157 1128 398
NM_015326chr192924 2134 2018 1144 966 871 481 464 445 2925 565 1626 --
NM_015328chr753073 2830 2763 1207 628 32392 1915 510 ----
NM_015335chr12122607 2572 2261 2177 2108 2028 1984 1866 1831 1678 831 609 32477 943 884 22251 642 --
NM_015336chr12102562 2546 2096 2030 2015 1916 1874 225 154 130 11700 11792 12552
NM_015339chr2051024 1003 915 819 406 11015 1276 --
NM_015344chr892196 1972 1872 1686 1602 749 709 139 117 --1648 --
NM_015347chr12102347 2176 2089 1922 1155 1078 737 701 691 399 12773 12444 32999 2275 1174
NM_015349chr692857 2812 2755 2725 2408 1901 1085 475 166 12910 12145 1930
NM_015355chr17121839 1808 1656 1604 1256 720 571 514 477 224 196 46 ----1359
NM_015358chr2191298 1220 1100 1075 983 957 865 336 276 2891 81 ----
NM_015359chr872942 2782 2066 2020 1983 1912 1898 11861 12825 1852
NM_015379chr71215 --174 --
NM_015393chr4113667 3661 3463 3257 2846 2668 1517 1158 996 299 41 21232 968 12931 --
NM_015397chr931797 225 214 1366 1554 --
NM_015409chr1272732 2610 2383 1928 1827 329 62 22785 448 1145 12697
NM_015423chr1121630 1143 --31746 1635 90 --
NM_015435chr86990 977 571 369 211 195 --21388 395 --
NM_015446chr161642 1631 1323 1143 436 113 31678 537 321 11330 2422 192
NM_015455chr5154130 3960 3777 3458 3413 3386 3372 2815 2714 1484 1478 1400 748 450 395 31658 1008 196 11045 24011 3173
NM_015458chr8135099 4285 3941 3872 3567 3554 3377 1381 1257 932 670 213 108 14327 33219 298 243 --
NM_015464chr74821 711 311 45 1898 1858 --
NM_015475chr251080 933 853 805 167 ------
NM_015483chr74724 367 126 42 --2230 120 --
NM_015484chr13857 784 277 1929 2684 82 1242
NM_015496chr81121 ------
NM_015497chr1531099 831 409 ------
NM_015508chr351578 1534 991 573 519 ------
NM_015525chr62191 27 ----1202
NM_015530chr22786 217 ------
NM_015548chr64940 819 371 148 --1153 --
NM_015550chr7103418 3226 3051 2379 1426 1116 1094 1028 545 292 2591 228 33470 3455 2509 22304 930
NM_015553chr695061 4901 4099 1972 1699 1360 1352 875 345 24188 1602 2648 34 13252
NM_015554chr15132801 2453 2398 2374 2095 1819 1156 1095 931 912 413 247 83 32929 2836 2784 22366 806 --
NM_015560chr372718 2246 2143 1955 904 722 155 12379 11136 12813
NM_015565chr21112047 2024 1964 1948 1865 1479 1405 591 494 436 174 31605 267 186 ----
NM_015567chr1361210 1058 1032 972 476 255 ------
NM_015568chr2054098 1691 1635 1084 860 13607 14054 --
NM_015569chr184629 4569 4160 1774 1485 871 498 260 34224 1893 215 13161 --
NM_015570chr731557 1368 456 11322 --1463
NM_015576chr322388 2201 12490 42956 2466 807 413 --
NM_015578chr1961868 1453 1339 1295 697 328 1598 12035 21465 652
NM_015599chr61276 ------
NM_015602chr161799 1787 1693 1483 1428 1341 1434 11255 11659
NM_015608chr102140 74 ----1562
NM_015630chr24844 812 802 283 11058 2783 399 --
NM_015635chr971846 1816 1496 1490 1451 350 125 --51511 1506 1501 1476 864 --
NM_015652chr10152 179 1541 --
NM_015676chr141147 ----1412
NM_015678chr1341669 1371 1118 158 21360 1216 2512 164 1431
NM_015691chrX72885 2039 399 387 281 271 43 ----2233 162
NM_015695chr642115 1880 1858 1767 --12023 --
NM_015878chr8102252 2222 2204 1891 1840 1706 1428 806 588 564 2665 344 ----
NM_015879chr18168014 7987 7719 7243 6728 5587 2863 2770 2588 2373 2153 1465 1355 625 308 283 15225 58241 7083 6225 2234 1419 16540
NM_015886chr8185607 5570 5431 5076 4719 4064 4048 3973 3735 3585 3501 2071 1888 1739 1603 1482 1249 1034 34646 4258 133 21397 689 --
NM_015888chr1133334 3273 3129 2235 2183 2127 2078 1106 592 495 300 166 126 11323 13396 --
NM_015901chr10----1829 1578
NM_015904chr22533 301 2845 793 --1330
NM_015906chr1104428 4356 4067 3064 1939 1493 1138 603 550 496 24057 3475 43834 1855 1833 968 13739
NM_015912chr882515 2331 1764 779 759 381 205 53 22217 2195 ----
NM_015914chr16----169 --
NM_015938chr32397 234 1266 1249 1897
NM_015982chr17----1374 --
NM_015984chr12496 447 --1461 --
NM_015995chr1544992 4602 4592 4584 14335 25532 3608 15453
NM_016002chr11750 --2639 195 --
NM_016009chr1114942 3835 3392 3227 3166 1586 1564 548 414 327 228 44614 3906 1786 1623 14890 140
NM_016018chr882596 2371 2007 1870 1832 1745 746 55 12159 41975 1839 1044 169 --
NM_016019chr731072 737 254 1231 --1396
NM_016021chr6123048 2953 2595 2569 2558 2318 1979 920 871 636 593 279 22765 855 32423 552 515 1627
NM_016023chr8121920 1765 1743 1662 850 692 563 515 410 193 167 117 21372 826 12097 --
NM_016040chr182665 2654 2391 2131 877 785 268 130 42745 2174 616 566 12559 --
NM_016041chr174285 112 72 65 --1130 --
NM_016073chr155964 919 735 299 181 --1909 --
NM_016076chr172885 2508 2419 1003 807 705 216 43239 933 376 253 12025 2995 191
NM_016078chr173166 106 24 --3990 831 127 11117
NM_016081chr482183 1686 1675 1626 1485 835 441 270 32136 1870 737 --11806
NM_016083chr6103639 3283 3057 2884 2829 2610 1412 589 512 99 22762 333 13879 23766 2440
NM_016097chr1861092 1069 1044 1010 959 59 ------
NM_016107chr54465 381 297 248 --2429 253 --
NM_016125chr171380 1429 1505 --
NM_016131chr262228 2006 1980 1694 1595 783 --41836 363 171 136 11789
NM_016132chr1563388 3358 3135 2726 2253 931 23105 369 1582 --
NM_016133chr251655 1435 1423 1374 486 ----11604
NM_016138chr1621548 1286 2479 272 3321 316 311 11301
NM_016156chr1152132 924 758 336 125 11875 1117 11937
NM_016169chr1032098 2042 1086 --2533 507 13148
NM_016195chr103894 736 140 3189 176 125 2854 354 134
NM_016200chr74697 282 213 79 138 1151 --
NM_016205chr431298 1248 967 ------
NM_016206chr3228948 8863 8617 8227 7562 6405 6049 5935 5891 5634 3507 3182 3111 3034 2341 1976 1837 1235 1025 978 264 197 46203 5883 2181 1571 68692 8382 6706 3126 3065 770 56662 6334 5998 5691 3499
NM_016216chr3--1727 ----
NM_016217chr693396 2970 2868 2633 1222 1214 1067 1025 265 22840 64 51373 1337 119 49 32 --
NM_016221chr562334 2105 1911 1694 940 809 12082 21513 559 --
NM_016230chr63395 190 24 ------
NM_016231chr1761540 1529 310 235 213 99 11233 --11692
NM_016248chr13183965 3879 3349 3305 3265 3116 3042 3019 1453 997 946 856 815 763 736 591 145 26 32953 2846 1609 43538 3273 2515 2435 --
NM_016252chr23820 195 157 --4680 632 325 320 --
NM_016257chr143505 3466 3163 1029 22403 352 1824 --
NM_016258chr11248 ------
NM_016269chr431026 998 148 11186 11048 --
NM_016271chr1892346 2309 2156 2075 1650 1638 580 205 120 128 42065 1577 344 266 --
NM_016272chr2252724 2392 2221 2037 1855 1243 12152 --
NM_016275chr362797 2680 2611 2587 2034 860 52424 944 715 418 399 22632 1013 1469
NM_016277chr6101647 1536 1516 1464 1388 1174 647 339 289 97 ----11119
NM_016281chr1271104 1084 973 848 349 289 88 --1472 --
NM_016306chr32122 89 --123 --
NM_016308chr15664 559 502 344 151 31393 1335 276 ----
NM_016315chr2111909 1834 1737 1634 1625 1469 517 213 174 113 72 21528 671 1476 --
NM_016320chr1121047 1020 1384 ----
NM_016322chr9153181 2973 2866 2664 2486 2269 2180 1992 1256 1182 1116 1099 705 603 338 21109 615 1624 --
NM_016338chr521115 1067 11173 21036 300 1209
NM_016374chr151299 994 475 158 25 21152 61 21225 1093 1105
NM_016396chr15142973 2538 2433 2412 2366 2262 2068 1955 1905 612 580 454 357 249 12934 52420 1854 412 326 166 --
NM_016422chr11112988 2889 2710 2577 2484 2335 2282 981 874 575 118 --12408 33070 2035 826
NM_016424chr1771857 1666 1384 524 497 428 57 --1469 --
NM_016436chr2032184 993 985 ----1884
NM_016441chr282258 2211 2201 2105 1994 1840 868 684 11681 ----
NM_016451chr112312 28 ----1290
NM_016467chr241158 473 449 28 31368 503 218 ----
NM_016472chr1441409 1380 379 109 --11079 21073 429
NM_016499chr11163 --1543 1549
NM_016519chr42534 51 --2502 415 --
NM_016530chr15183827 3762 3684 3550 3356 3180 2998 2891 2857 2759 2748 1111 1005 833 654 581 292 253 14114 44091 3961 3806 2606 --
NM_016531chr4114156 3462 3225 2846 2718 2574 1671 1269 1195 590 98 21104 846 23017 434 13514
NM_016557chr31272 --11042 1716
NM_016559chr341493 1036 987 519 --171 --
NM_016586chr144441 394 333 27 ----1346
NM_016588chr66865 722 680 240 180 156 --1297 --
NM_016598chr321015 120 --2599 176 1940
NM_016599chr461551 1333 302 257 186 61 --11453 1313
NM_016604chr521269 1043 --1887 --
NM_016605chr542745 2356 2227 2114 12663 12657 --
NM_016620chr121237 1051 1581 11294 1181
NM_016622chr261907 1797 1413 591 169 46 3759 692 582 --12136
NM_016623chr82564 108 ------
NM_016626chr1871750 1588 1307 1254 469 370 113 --21672 1247 --
NM_016631chr212778 739 --1222 --
NM_016644chr54550 400 372 184 --1420 --
NM_016929chr674413 3998 3943 3241 3009 937 347 1107 24234 2829 24346 1779
NM_016952chr11123764 3447 3421 3376 3337 3304 1569 1290 1009 809 752 616 23353 169 14015 23467 856
NM_017412chr82530 459 3324 270 153 151 2452 287
NM_017420chr14123799 3395 3283 2446 1449 1249 1096 1008 935 820 759 131 43406 3051 2412 971 33485 3460 685 23858 3441
NM_017423chr4112245 1890 1778 1692 1635 1354 445 436 356 285 159 12054 22162 1904 32092 688 218
NM_017440chr126591 488 440 107 52 21 ----1657
NM_017508chr1162476 2169 1816 554 434 420 12047 1932 --
NM_017519chr63920 914 350 11326 --1926
NM_017526chr14397 166 133 77 1117 ----
NM_017530chr16----1328 --
NM_017544chrX4671 299 278 237 ----1905
NM_017553chr151163 11245 11338 --
NM_017577chr341037 608 449 341 11603 --21563 1084
NM_017580chr103523 399 193 --2528 228 --
NM_017594chr983032 2309 2197 1032 1012 841 629 487 23213 3007 13289 --
NM_017599chr12132034 1838 1729 1677 1631 1615 1427 1416 1386 768 603 575 235 --1441 --
NM_017610chr1592122 2115 1901 1536 845 427 389 320 230 32078 1557 1493 21356 742 --
NM_017612chr125567 498 452 396 148 --2184 39 --
NM_017628chr4175115 4213 3834 3787 3770 3693 3664 3628 3543 3283 2036 1407 1124 1062 1027 712 312 33934 3850 220 23494 1731 25126 2070
NM_017629chr161903 1301 551 496 288 146 --21470 568 --
NM_017633chr673202 2867 2778 2646 2548 1544 1150 11373 3887 882 863 21071 1058
NM_017634chr861785 1564 1213 487 364 277 1576 1446 --
NM_017635chr1171445 1324 1299 1285 538 183 37 --11335 --
NM_017637chr9289321 9277 9243 8475 7626 7569 7340 7225 6890 6865 6855 6804 5739 3779 2771 2758 2736 2510 2466 2440 2296 2255 2005 1993 999 869 760 479 49464 5810 2516 216 29405 5951 17707
NM_017640chr67938 823 808 743 696 125 106 1856 1904 --
NM_017643chr17112923 2770 2722 2619 1975 1911 1125 980 568 155 39 1653 23087 554 --
NM_017644chr3174993 4929 4917 4689 4340 4308 4033 3595 1910 1904 1805 1786 1718 1677 759 473 89 45069 4329 3343 250 33384 590 508 24415 1364
NM_017658chr14214604 4543 4506 4394 3965 3675 3574 3019 1836 1747 1434 1347 1280 878 647 620 505 397 345 287 236 34196 3953 862 34548 3338 1486 11254
NM_017660chr19----1923 13212
NM_017662chr971703 1660 811 493 303 283 203 1724 21943 357 1790
NM_017666chrX31769 1708 1678 11658 31743 1689 1638 --
NM_017667chr7173 1173 1108 --
NM_017672chr1561179 1171 1120 1114 375 212 1260 3877 360 286 --
NM_017680chr931004 734 328 --2312 142 --
NM_017691chr153427 386 38 --1391 --
NM_017693chr1341441 1336 390 79 1351 --11477
NM_017694chr231939 1620 587 1614 12027 --
NM_017700chr42100 57 1138 ----
NM_017724chr34627 240 233 182 1126 1728 1133
NM_017730chr35570 549 533 156 98 ------
NM_017742chr1841893 1628 1400 90 --41954 1821 1807 1681 --
NM_017744chr122114 390 --12036 --
NM_017745chrX2648 194 2554 120 1625 --
NM_017752chrX72143 1891 1853 1772 1650 171 152 32155 2022 273 ----
NM_017753chr98902 819 797 401 362 353 218 196 1327 1877 1780
NM_017755chr55634 624 608 432 225 --1512 --
NM_017761chr121307 473 21023 605 ----
NM_017762chr15102409 1935 1814 1749 1642 660 614 590 513 172 --42279 2235 1832 1556 198
NM_017769chr14112971 2945 2545 2419 2337 1207 1195 933 852 87 60 43275 2913 2557 2365 32729 411 283 42624 2617 2307 2065
NM_017772chr631733 1718 1199 --1579 --
NM_017780chr83869 853 765 193 1758 1833
NM_017789chr2--1860 --1684
NM_017799chr1451703 1496 1290 688 454 ----1676
NM_017801chr362591 2220 1808 539 403 142 1355 1647 52614 2554 2486 2417 2410
NM_017811chr962995 2721 2405 780 466 167 1949 2696 604 11987
NM_017813chr8175815 5180 4500 4446 4143 3768 3645 2219 1890 1822 1494 1426 1240 576 404 209 189 34080 2322 672 42258 2213 1946 964 24388 796
NM_017824chr1082753 2670 2496 1665 1065 870 336 217 32517 1866 1072 22446 641 --
NM_017845chr45831 779 645 540 297 --136 --
NM_017848chrX144298 4152 3772 3293 3282 3146 3024 2857 1672 1595 621 614 606 61 34026 961 658 14111 2998 627
NM_017849chr252920 2228 2003 559 522 --12890 --
NM_017859chr201137 ----1120
NM_017910chr22371 328 ----159
NM_017913chr92436 78 1364 194 --
NM_017921chr1741944 662 605 367 --21966 1961 --
NM_017948chr92372 110 --1400 --
NM_017953chr11753 21012 117 11186 1157
NM_017955chr141268 2491 404 11244 --
NM_017964chr231013 203 70 3843 299 22 ----
NM_017969chr22209 74 ----1175
NM_017974chr251247 1022 973 876 455 --11044 --
NM_017987chr10102090 2026 1972 1814 1791 1744 1571 1381 888 365 1450 12224 --
NM_017994chr783007 2346 2066 1984 1010 660 625 597 --1474 --
NM_017998chr931309 1025 997 1388 1220 --
NM_018000chr252122 1927 1689 1636 626 21935 1776 ----
NM_018010chr331012 463 393 143 188 1571
NM_018013chr662963 2401 2050 2010 676 639 --1594 --
NM_018014chr231004 911 417 --1172 --
NM_018018chr1241893 1244 694 278 --11840 11529
NM_018027chr1053154 2890 2727 2112 1172 --12895 --
NM_018028chr19----11301 --
NM_018030chr1871119 1053 759 376 329 323 274 ----1235
NM_018036chr14104279 4255 3771 3687 3669 3018 1437 1182 1020 999 12830 3599 333 92 11218
NM_018046chr511649 --1255 11878
NM_018060chr1--1335 --1342
NM_018061chr171751 1623 1378 1347 1166 431 232 1154 21413 1257 --
NM_018079chr23395 230 143 --131 1438
NM_018084chr2113022 2800 2641 2419 2277 1273 1154 995 809 375 76 ----32912 2312 1142
NM_018086chr261670 1398 775 494 423 368 11655 21874 1498 1722
NM_018092chr1631102 404 149 21248 436 11186 --
NM_018098chr331183 1040 911 1992 2780 319 11212
NM_018112chr96877 780 383 326 210 140 1253 11061 --
NM_018117chr104651 640 565 263 1692 --1245
NM_018120chr891359 1218 955 510 421 302 205 156 145 21003 456 1310 --
NM_018121chr10112876 2785 2779 2635 2537 2315 2232 2205 1955 1943 751 1531 22398 2151 13152
NM_018131chr103810 760 719 1833 1338 --
NM_018133chr382150 1864 1722 728 687 485 312 267 --31984 1748 798 --
NM_018157chr1283200 2598 2260 2156 1992 1240 912 34 32930 2066 1297 2990 270 --
NM_018159chrX21365 1189 11323 1669 --
NM_018164chr12----1225 --
NM_018169chr121169 1449 --1487
NM_018177chr44913 814 97 55 1308 2794 221 --
NM_018184chr372048 2027 2007 1961 1568 874 256 1348 1518 --
NM_018198chr12551 97 ----1103
NM_018200chr1592580 2489 2418 2369 1926 1604 1029 685 384 --12474 --
NM_018202chr16731 364 348 284 276 215 ------
NM_018207chr111712 --11733 --
NM_018214chr671161 1013 999 458 397 318 271 21091 1024 2822 514 --
NM_018227chr4113225 3159 3005 2924 2782 2560 1168 1043 522 228 122 33166 2203 1091 62916 2071 1283 1058 785 378 22752 2631
NM_018230chr13566 396 62 1120 --1127
NM_018243chr4133762 3379 3281 3184 3020 3004 2608 1575 1212 1028 559 249 84 --53746 530 99 94 89 --
NM_018247chr6133092 2965 2563 2170 2124 1967 1221 1105 927 516 322 256 137 22421 728 22434 1199 1761
NM_018254chr142125 2080 1606 588 32336 2270 333 2516 319 --
NM_018266chr31689 2940 76 --196
NM_018287chr102423 183 11225 2225 76 --
NM_018290chr431243 1172 1042 11026 1877 21274 1035
NM_018293chr382879 2566 2559 2406 1809 804 235 103 52270 2145 1901 1119 815 42224 1927 1027 415 12893
NM_018312chr1132208 1512 371 3559 329 135 ----
NM_018323chr441152 487 413 266 21678 1645 2608 238 --
NM_018325chr931117 1086 505 --31245 661 563 --
NM_018328chr21417 --1410 --
NM_018330chr1041584 1309 1282 612 1430 --11568
NM_018351chr1254050 3900 3659 3211 694 21875 377 --44704 4657 3062 1888
NM_018361chr894026 3449 3168 2715 2702 774 722 583 194 13293 1558 33935 3901 594
NM_018362chr11114042 3898 2948 2702 1303 1202 1007 870 840 530 147 13801 13562 23681 134
NM_018364chr1103855 3619 3432 3160 3031 1381 1163 413 374 86 24069 64 21488 339 --
NM_018369chr54574 542 283 76 3776 594 172 ----
NM_018371chr81620 --11323 --
NM_018373chr14186398 6132 6087 6078 5879 5369 4997 4859 4841 2485 1987 1835 1672 1315 982 761 421 241 21888 1606 46479 4983 4647 581 15973
NM_018374chr7154813 4762 4682 4041 4028 3972 2002 1491 1231 1187 1122 935 763 692 492 83987 3738 1796 1241 1166 755 447 381 53755 3412 2096 2044 1005 14576
NM_018375chr1461791 1344 1327 1302 1295 458 1586 21933 412 --
NM_018383chr262009 1952 1946 1778 1712 639 --21424 548 --
NM_018387chr95507 453 372 144 74 ----1515
NM_018403chr3133862 3805 3222 2691 1578 1459 1407 1201 1164 1135 1092 862 762 --12813 34096 4023 549
NM_018409chr4123047 2466 2451 1297 1254 1120 841 698 625 493 335 117 23225 1096 43231 2770 2411 2229 11127
NM_018416chr1242668 2542 1930 223 1579 11762 --
NM_018423chr1221090 354 --1942 --
NM_018424chr961383 707 674 301 279 246 --21248 569 --
NM_018427chr1661556 1456 1395 1388 1099 455 21305 1063 21232 1158 --
NM_018437chr92538 437 --1427 --
NM_018440chr8288697 8171 8049 8024 7550 7313 6814 6774 6652 6173 5580 3145 3101 3058 3052 3002 2988 2705 2191 2178 1835 1569 1083 884 737 666 430 103 46871 6115 2400 2287 57892 2785 1933 1145 743 --
NM_018444chr881641 944 747 726 681 479 238 153 --12071 --
NM_018445chr153571 517 454 ----1469
NM_018448chr12--1367 31205 1001 274 --
NM_018462chr34625 300 223 34 ----1244
NM_018469chr1731254 1212 1098 11379 --1417
NM_018477chr1421042 867 3990 945 924 21047 160 --
NM_018489chr142314 2069 1877 1788 22293 1856 21953 1589 32086 1908 297
NM_018557chr261525 1435 461 196 151 109 51544 1472 1444 1294 291 --21718 318
NM_018566chr1185113 4879 4310 3914 3502 2023 1805 1749 1536 1500 1168 1145 1112 868 849 800 423 316 14432 15093 24569 604
NM_018569chr451360 1334 1322 1125 321 1267 3493 255 131 --
NM_018590chr1021667 132 11520 11746 --
NM_018602chr1531706 1467 80 --31682 1141 293 --
NM_018638chr12185596 5137 4567 4052 3961 3791 3702 3611 3554 2153 1754 1604 1540 1366 1010 847 444 394 65218 4972 3979 1801 1722 119 24387 3741 1795
NM_018650chr172106 2074 1766 1722 1692 740 535 11932 42121 1529 1415 804 --
NM_018652chr152979 290 ------
NM_018657chr38760 716 694 292 281 248 178 167 ------
NM_018660chr842209 2120 954 903 12434 1177 13104
NM_018674chr2------1688
NM_018685chr761102 1049 1017 834 166 94 1786 31150 1095 88 --
NM_018686chr12159 --1289 1235
NM_018700chr561649 1279 1230 641 548 239 1378 21511 263 --
NM_018710chr871247 956 466 391 292 140 128 ------
NM_018712chr1141477 1374 524 467 --11005 11457
NM_018717chr462820 2591 2313 2135 907 889 --12414 12448
NM_018834chr55893 812 391 208 48 --1354 1238
NM_018841chr1143635 3241 3228 2962 2760 2447 2438 1464 1274 992 560 474 297 234 1406 22630 1405 23002 2795
NM_018847chr941933 1735 1662 1384 11964 11798 --
NM_018896chr17----1301 --
NM_018898chr561914 1804 1518 1511 633 182 --21670 785 --
NM_018945chr6103561 2811 2423 2386 2268 971 752 641 565 487 1532 33436 629 538 --
NM_018947chr7134901 4166 3821 3688 3356 1534 1424 1309 918 819 561 191 55 33802 3682 325 34582 3197 1227 --
NM_018948chr121458 1330 1261 21417 182 --
NM_018952chr17----1524 --
NM_018968chr2190 ------
NM_018970chr7112640 2470 2019 1245 1069 726 530 423 406 246 166 ------
NM_018976chr1231871 340 287 --42781 508 333 251 11963
NM_018979chr12112590 2513 2411 2086 1783 1608 902 790 656 572 488 22612 805 --12198
NM_018983chr41298 --1116 --
NM_018992chr16--11617 11640 1660
NM_018999chr10194850 4355 4191 4057 3991 3944 3869 3779 3692 3266 3119 1717 1611 1287 1237 1144 1026 784 53 --13634 1888
NM_019004chr7102204 2180 2109 1796 925 874 831 465 164 77 21918 192 21862 887 22339 2258
NM_019009chr1142548 2063 1987 1050 --12057 --
NM_019012chr123852 181 94 --1146 --
NM_019018chr53695 508 167 2644 578 2673 231 1622
NM_019022chr18123213 3124 2894 2597 2206 2167 1249 884 773 536 456 237 43061 2499 2078 519 33054 906 796 2808 585
NM_019035chr42192 180 31999 1857 633 3778 492 243 --
NM_019040chr11----1222 --
NM_019049chr1----1284 --
NM_019050chr472284 915 896 835 798 519 281 22149 1767 32105 1557 259 32188 1619 875
NM_019063chr21682 ------
NM_019071chr74517 509 171 61 2731 498 1158 151
NM_019072chr574181 4033 3584 3371 3236 2719 882 13892 34198 3324 1130 --
NM_019074chr151895 ----1986
NM_019080chr1331100 1092 74 11511 21362 1291 --
NM_019083chr1101587 1492 1241 1149 1083 1050 375 135 107 84 164 21447 361 --
NM_019084chr1092605 2464 2159 2074 1970 468 453 410 38 21690 795 ----
NM_019087chr561729 1696 1389 1309 464 63 --2469 70 11302
NM_019091chr261102 899 813 765 748 423 1173 1166 1107
NM_019094chr12133838 3560 3424 3355 3313 2995 2970 2908 2376 1268 700 486 186 12864 --11109
NM_019098chr851740 1197 454 361 308 --1222 --
NM_019106chr2231117 890 836 13174 23429 737 12089
NM_019113chr19269 36 ------
NM_019114chr9102153 2141 1806 1621 958 841 820 428 156 67 32011 1943 788 1173 --
NM_019117chrX62553 1364 1258 1219 1186 131 12354 33016 1390 1121 12160
NM_019555chr361648 1495 1166 591 284 146 11679 21459 1386 --
NM_019556chrX91503 1378 973 953 312 270 182 142 66 21015 243 --21387 921
NM_019593chr20122499 2482 2361 2303 2229 1263 1035 944 760 473 300 242 21245 205 12570 12564
NM_019605chr12689 22 --163 --
NM_019610chr132208 1546 150 11535 2199 189 --
NM_019885chr212781 12642 --12593
NM_020116chr461682 1501 1412 1161 1131 261 ----11548
NM_020117chr53783 661 314 1368 --1329
NM_020119chr743805 2733 2448 943 33948 1072 89 --11598
NM_020122chr2205930 5228 4737 4629 4569 4551 4463 2379 2243 2196 1925 1675 1632 1205 1057 1046 895 829 738 544 26002 952 16055 11895
NM_020123chr1041407 1249 99 25 1500 2222 117 --
NM_020137chrX1299 --3314 309 304 --
NM_020139chr482067 1874 1831 1629 1524 1505 765 285 2495 180 22011 1679 --
NM_020140chr122187 75 ------
NM_020144chr7122062 2003 1990 1723 1608 1467 1374 1337 1326 810 637 616 --1662 1608
NM_020147chr1531084 1020 964 --11074 --
NM_020153chr11------1366
NM_020159chr491680 1567 1473 1246 1194 1145 449 302 239 21214 108 1495 --
NM_020177chr5103156 3147 2765 2718 2504 2080 1218 1209 1109 521 22067 325 22453 416 22788 349
NM_020194chr22600 69 ----199
NM_020198chr1741482 1427 1227 285 11291 --21103 242
NM_020199chr591321 1265 1163 978 965 811 385 247 166 152 135 --
NM_020205chr183498 2845 2821 2803 2734 2699 1290 908 12930 11001 --
NM_020228chr1172280 1918 1576 602 455 310 172 11742 21859 978 --
NM_020232chr18----1198 --
NM_020307chr3--1309 ----
NM_020311chr22680 570 3638 586 311 ----
NM_020337chr4113028 2956 2887 2717 2313 2060 1941 1144 1044 632 308 42547 2277 1210 219 32961 2091 774 22492 611
NM_020338chr1063518 3252 3090 2847 1091 900 13484 22879 1466 13380
NM_020342chr2102083 1946 951 896 752 485 386 375 364 300 52052 1957 1900 1713 700 22602 1810 --
NM_020346chr1131643 1244 68 11440 11403 --
NM_020347chr392293 2280 2017 1992 1905 1659 783 458 122 --2865 791 --
NM_020353chr362040 1753 1498 1322 134 119 21896 107 2593 357 --
NM_020357chr351511 1321 1074 1030 594 1180 21400 1143 --
NM_020363chrY81742 1537 1517 704 612 380 233 57 --21572 697 --
NM_020373chr12--1642 1595 --
NM_020381chr661800 1751 1607 1490 498 121 --21528 1453 --
NM_020383chr102124 117 --1164 --
NM_020390chr3204783 4738 4287 4240 3991 3802 3491 3317 3223 1901 1728 1570 1507 1495 1402 1096 830 798 731 550 --34872 4187 1315 33103 1371 745
NM_020403chr1381722 1471 648 636 612 250 66 30 --2263 124 11615
NM_020429chr742953 2838 2395 1944 ----12874
NM_020432chr771714 1674 1502 389 201 185 156 31776 753 194 11596 --
NM_020440chr163361 2830 2743 1200 377 73 13319 32717 2112 1241 12615
NM_020452chr141763 551 540 516 22170 1939 12142 --
NM_020456chr1362299 2140 742 707 571 67 1431 1175 --
NM_020463chr271346 1227 1134 1101 1069 462 365 ------
NM_020474chr1862041 2010 1681 1329 676 333 ----1601
NM_020525chr12----2425 411 1370
NM_020640chr362039 1662 1566 740 298 136 --11545 --
NM_020644chr11183 --1807 --
NM_020647chr872267 2119 1635 793 586 424 206 11471 12213 --
NM_020648chr18112876 2743 1958 1918 1772 745 638 543 452 238 118 32351 2167 418 1191 32811 580 462
NM_020651chr241798 1768 1716 422 11430 11534 1608
NM_020657chr1961970 1868 1598 1571 757 108 11728 --21798 219
NM_020665chrX----1508 --
NM_020666chr51253 1372 1625 1349
NM_020673chr20146450 6294 5697 4795 4779 2347 2329 2067 1879 1717 1634 1583 1331 1165 47723 7376 7321 2672 57500 6359 5804 2553 316 --
NM_020696chr3130 197 --1288
NM_020699chr1125203 4828 4810 4703 4195 3327 2096 1677 387 340 189 41 23306 936 --25400 4320
NM_020717chrX64719 4422 879 850 689 66 1312 34956 1902 869 --
NM_020718chr16176540 6478 6424 6413 5917 5043 4960 4587 4114 2565 2290 2062 1763 1440 1179 554 25 46104 4674 4597 539 22507 1686 --
NM_020728chr793201 2980 2641 2444 2105 1205 886 764 302 4666 364 131 91 11160 --
NM_020734chr12123373 3319 3079 3053 2812 2529 2448 2304 1206 1078 930 496 --13341 12841
NM_020740chr172320 261 ----142
NM_020742chrX62677 2449 2414 703 687 263 ----1614
NM_020747chr52874 847 3930 186 56 2896 143 --
NM_020748chr17122182 2118 2079 1702 1546 806 778 742 704 652 378 204 21591 798 1154 --
NM_020752chr10122658 2622 2134 2077 1923 880 770 669 582 426 306 195 2831 482 22603 1996 --
NM_020760chr241542 1512 1250 710 1691 21491 683 11728
NM_020771chr681504 1361 1330 944 538 530 430 167 --2277 220 --
NM_020772chr17338693 8539 8184 7790 7601 7594 7434 7426 7354 7266 7251 6951 6914 6861 6535 6391 6211 5967 5641 5449 5434 2812 2796 2637 2333 2062 1898 1730 1557 858 758 515 73 37895 6436 1786 48619 7796 1183 640 27982 6618
NM_020773chr452695 2562 2449 998 287 --12641 --
NM_020774chr18246282 6150 5959 5928 5763 5252 5149 5073 4541 4177 4152 3952 3854 2485 2388 2230 2200 2126 2099 1290 1240 1189 607 348 65546 2077 1681 1488 1300 1075 15998 14802
NM_020782chr12164709 4648 4420 4336 4084 4052 3885 3625 1942 1891 1875 1809 1366 1103 912 349 21661 973 54314 1240 930 692 192 11707
NM_020783chr1841622 1611 1533 792 --41771 620 560 275 --
NM_020787chr1771350 1059 549 482 469 358 232 41130 431 403 335 2557 64 1410
NM_020791chr1731326 1232 429 --21012 128 --
NM_020792chr372720 2673 2592 2103 998 306 148 --52709 2647 2486 1782 593 12739
NM_020794chr161540 1439 1405 1041 541 333 1385 --11292
NM_020796chr5103022 2309 2146 2136 1949 1937 891 837 702 538 --11942 --
NM_020799chr10------1101
NM_020800chr341497 1482 1273 583 1190 2928 29 --
NM_020801chr5112552 2317 2285 2100 2022 1649 993 528 508 476 156 12504 12302 --
NM_020802chr11133224 3186 2798 2298 2162 2091 2062 1191 1143 1021 701 614 396 ------
NM_020803chr432216 692 683 1533 ----
NM_020805chr1851963 1794 1330 1300 256 --31977 1787 698 --
NM_020808chr141083 439 393 333 1862 --1937
NM_020809chr1142174 2130 931 151 179 22090 176 11710
NM_020810chr14123192 3132 2924 2227 1448 1406 951 234 149 121 111 76 33519 2935 2883 3997 944 547 2330 212
NM_020830chr242300 2010 988 744 12269 23174 2709 --
NM_020836chr14--2295 276 ----
NM_020845chr12----11591 --
NM_020854chr182452 98 1266 1119 --
NM_020858chr1582388 2331 2227 782 388 138 100 31 32321 1886 1831 ----
NM_020860chr451125 895 332 275 92 ----11110
NM_020866chr1331073 994 30 154 --1371
NM_020870chr482263 2000 1938 1905 1837 1791 901 373 21429 807 11692 11929
NM_020871chrX72195 1867 1750 1617 674 664 124 1509 32340 2295 882 --
NM_020872chr371624 1427 1163 660 592 580 458 --21729 1594 --
NM_020873chr34714 221 100 54 --1261 --
NM_020886chr1111283 --1402 11339
NM_020935chr2174671 4609 4559 4534 4502 4430 4063 3871 3796 3256 3143 3041 2839 1459 899 474 185 13728 2758 175 --
NM_020937chr143295 134 75 1731 1104 1118
NM_020940chr1062655 2027 1957 1897 319 196 32103 863 850 12858 1439
NM_020964chr18114543 4125 2968 1901 1741 1408 1236 1103 362 75 55 34782 336 231 24701 4223 --
NM_021020chr853522 3423 3331 292 284 --43514 3467 1402 1390 --
NM_021025chr52511 497 ------
NM_021033chr13103526 3248 3194 3106 1076 1062 784 673 231 216 22721 778 12591 --
NM_021038chr363360 3326 924 827 634 616 --13337 21254 211
NM_021044chr12----2272 267 --
NM_021072chr592272 2201 2063 908 892 827 793 375 116 12178 32068 336 69 22282 498
NM_021097chr2132747 2553 2542 2509 2503 2436 2397 2252 1911 978 484 399 338 --12881 --
NM_021101chr332263 738 696 42511 2461 1008 932 42401 895 588 188 --
NM_021109chrX2363 58 ----183
NM_021111chr931386 1191 1117 11404 1887 --
NM_021117chr111566 12314 --12246
NM_021127chr1841458 1359 1157 232 --31221 1201 224 --
NM_021132chr1041242 1016 993 921 --1273 --
NM_021137chr1762329 2256 1901 1735 885 830 --22061 1589 1595
NM_021140chrX3818 734 418 2400 298 1876 1929
NM_021145chr73881 721 191 --11039 --
NM_021148chr782523 2469 2168 2053 1886 1741 1640 324 32426 2244 1833 32496 1839 394 --
NM_021155chr1962333 960 556 510 187 80 12623 22677 561 --
NM_021180chr11709 ----1687
NM_021183chrX142329 2254 2229 2204 1962 1954 1882 1708 1605 569 515 312 240 81 22028 257 32428 1793 524 --
NM_021191chr1221963 327 32236 602 193 22142 781 12401
NM_021202chr2062960 2813 2513 2224 2087 1896 ------
NM_021204chr41375 1215 --2885 733
NM_021222chr121349 166 --31440 249 219 --
NM_021238chr1221616 1307 32059 1681 1662 --22016 1704
NM_021239chr143385 74 61 2238 205 ----
NM_021249chr14--1543 2531 50 1299
NM_021251chr2--1356 --1397
NM_021252chr102208 80 31460 235 113 1252 --
NM_021255chr14164094 3637 3577 3571 3215 3020 3010 2800 2572 2555 1630 955 638 342 330 71 34030 1411 241 24001 28 --
NM_021570chr91117 --1530 --
NM_021629chr3185076 4378 4284 4200 4083 3939 3847 3693 3508 3225 3099 1580 1529 1508 767 737 280 236 --14446 1356
NM_021638chr485027 4619 4612 3804 3151 1567 599 211 13089 44879 733 506 225 14934
NM_021649chr541894 1202 728 343 21478 1347 --11804
NM_021809chr205994 904 705 650 299 11682 ----
NM_021813chr675647 4707 3530 1968 965 851 696 21072 412 35581 3924 1960 11223
NM_021815chr262911 2083 1217 1158 800 553 2659 297 53029 2856 974 373 192 12661
NM_021818chr1461202 187 158 126 102 38 ----11512
NM_021821chr12----4535 293 237 40 --
NM_021914chr1492367 2321 2195 2132 2117 1711 696 467 236 1202 22279 1843 --
NM_021931chr2021093 1003 21153 1038 1200 11105
NM_021942chr41630 --1881 --
NM_021945chr642613 787 737 478 --22982 267 11382
NM_021952chr1------2196 131
NM_021954chr1353449 3147 3070 2677 1188 12775 --13417
NM_021960chr142812 1809 780 560 21900 546 52234 1873 834 587 241 --
NM_021961chr11157525 7314 7180 6874 6345 6130 5916 5681 2712 2617 1145 978 964 930 663 47262 7250 512 388 16798 27469 910
NM_021963chrX1733 --1558 --
NM_021964chr3316502 6201 6145 6135 5976 5927 5881 5554 5399 5089 4780 4724 4611 4448 4171 2532 1850 1804 1707 1662 1523 1497 1398 1212 1157 1026 891 765 644 420 36 55696 4966 4592 741 208 55847 4700 4153 1322 1171 14494
NM_021977chr6113780 3532 3147 2884 2583 1509 1395 1036 970 941 838 53669 3648 1117 1026 155 33262 1186 1158 13708
NM_021978chr11----1530 --
NM_021998chrX71363 1292 1268 1105 400 391 113 2463 124 41166 927 591 298 --
NM_021999chr136836 814 554 303 296 119 1196 ----
NM_022037chr231025 763 745 1693 --1936
NM_022041chr1672721 2505 2451 1805 1765 155 132 22382 1058 1627 22311 853
NM_022048chr1556288 5531 5021 4037 407 --25550 745 --
NM_022049chr161679 1569 1338 586 464 231 --31804 1222 661 --
NM_022051chr12569 111 --1539 1177
NM_022058chr2102116 1883 1698 1650 1578 1540 822 774 422 360 31857 1344 497 --31660 1321 787
NM_022059chr175932 917 902 632 294 ------
NM_022080chr2062680 2538 2434 801 317 69 22516 782 ----
NM_022114chr154439 3560 1875 1585 1342 2631 418 24125 1454 --
NM_022118chr135563 524 485 244 189 ------
NM_022123chr143552 507 87 --1516 --
NM_022130chr561456 1423 1310 1232 589 279 21159 928 21240 913 --
NM_022133chr851870 720 664 633 67 31860 1175 410 1198 --
NM_022136chr214632 261 203 43 1437 1477 --
NM_022138chr6--11493 --2128 104
NM_022143chr741586 1476 1470 590 --1992 --
NM_022154chr441305 1012 905 406 11087 21323 856 --
NM_022166chr16126367 6343 6151 6017 5923 4604 2431 2387 1675 1576 1476 912 15716 --15476
NM_022336chr232300 2188 1636 ----12412
NM_022340chr383631 3396 2699 1383 945 810 288 157 --11410 --
NM_022351chr8113854 3714 3509 3096 2773 1370 860 756 694 175 23 23341 1334 21257 157 13147
NM_022361chr63460 175 142 1101 1540 --
NM_022459chr13176008 4986 4902 4843 4723 4613 4585 3914 3870 2434 2116 1802 1790 1257 1140 901 129 21294 634 24783 2417 25110 1564
NM_022465chr1282649 2413 1869 578 436 349 290 222 32848 2585 95 --1868
NM_022469chr121292 1035 1813 12179 12427
NM_022473chr15113945 3694 3654 3155 3042 2883 1313 1185 821 568 440 22795 552 23758 345 14428
NM_022474chr1482856 2104 1128 940 825 544 207 189 12766 32531 650 561 --
NM_022475chr45686 655 573 113 49 2755 631 3748 743 698 --
NM_022484chr721029 84 11272 1128 1181
NM_022648chr274616 3718 2883 1804 1726 627 98 24645 1768 --14497
NM_022658chr1291281 1134 917 440 390 309 188 161 54 1100 11002 11343
NM_022725chr1181851 1810 1701 1695 558 400 310 107 12084 12002 11824
NM_022726chr671709 1666 370 346 258 191 176 ------
NM_022731chr1----130 --
NM_022739chr1761190 1043 983 794 201 139 3857 463 328 ----
NM_022753chr1112831 2769 2317 1942 1838 1758 905 721 516 485 122 --1104 --
NM_022755chr932490 684 399 12464 --12503
NM_022763chr3133120 3076 2782 2570 2388 1242 780 768 721 694 620 580 42 1801 32496 2491 2062 --
NM_022771chr1261022 837 810 310 146 99 2903 228 3327 244 36 --
NM_022776chr351546 1429 1049 355 266 1366 ----
NM_022780chr271400 737 590 497 407 192 129 --11310 --
NM_022781chr973282 3258 3236 2687 1338 819 744 22144 333 12205 12883
NM_022782chr12------2345 145
NM_022832chr442364 500 253 182 11659 ----
NM_022838chrX--1270 2299 123 --
NM_022841chr15112745 2599 2427 1784 918 807 693 599 355 289 107 11110 12371 22803 227
NM_022842chr333098 812 433 --13081 12250
NM_022843chr1341310 434 329 45 11019 --21412 1246
NM_022893chr2183183 3098 3076 3039 3027 3021 3011 2838 2020 1198 1111 1009 960 519 391 305 294 242 12783 22934 1095 2924 525
NM_022894chr251311 1087 489 472 159 11761 ----
NM_022898chr14134710 4639 4508 3745 3667 3643 3589 3248 1734 1383 1296 336 275 --34245 3637 666 --
NM_022900chr751090 972 889 288 45 1852 ----
NM_022915chr2----1590 --
NM_022918chr1151711 1623 1355 396 332 21898 1532 32087 1925 1495 --
NM_023004chr22----1244 --
NM_023016chr282528 2430 2405 2355 1061 494 364 319 --2756 585 1379
NM_023037chr135870 800 790 751 344 --2951 930 1388
NM_023039chr5--1177 --1348
NM_023076chr1643002 2150 1887 994 1473 --1389
NM_023927chr531393 984 914 --11083 --
NM_023928chr121674 1965 11057 --
NM_023932chr6----1164 --
NM_024050chr192584 175 --1578 --
NM_024052chr1763055 2402 807 790 419 54 1910 1864 --
NM_024057chr122135 112 ----135
NM_024089chr132205 166 ----1189
NM_024092chr1111204 1781 11245 --
NM_024345chr9186082 5948 5676 4958 4315 4207 4005 3823 2379 2232 2173 1929 1578 1471 1200 1136 704 349 22292 694 45442 3991 2124 654 --
NM_024408chr1143270 3222 2824 2657 2614 2598 2504 2385 894 830 626 568 533 335 --13160 22320 1372
NM_024430chr1851870 1767 724 497 105 --11875 --
NM_024512chr362799 2547 1374 1241 393 57 11299 33282 3184 2644 --
NM_024519chr16----1279 --
NM_024520chr2131 1114 --1276
NM_024524chr393232 2833 2297 1074 950 870 861 649 57 63098 2628 2617 2037 621 289 12356 13073
NM_024529chr1111169 1053 1035 993 869 841 799 736 407 117 44 196 11133 --
NM_024539chrX2879 501 --31078 349 344 --
NM_024548chr3----21642 244 --
NM_024551chr1252017 971 442 124 105 12460 --1511
NM_024561chr1361271 1089 973 446 335 75 --11306 --
NM_024563chr541489 1462 374 267 --11801 --
NM_024574chr4158 --1304 1400
NM_024584chr291283 1251 1173 1075 960 842 476 400 146 2905 360 11112 --
NM_024590chr461863 1857 1225 704 626 31 1771 31898 1872 794 21904 556
NM_024594chr56706 666 469 460 377 264 --21669 269 --
NM_024607chr8124476 4449 3969 3731 3614 1617 1481 1382 1348 986 932 901 13480 22796 587 14364
NM_024613chr871884 1853 1657 1548 1243 465 53 1720 11862 --
NM_024616chr351516 1452 1399 1318 608 ------
NM_024624chr231272 1178 199 31333 266 122 11140 --
NM_024629chr441146 1139 772 229 175 ----
NM_024646chr193952 3918 2770 1583 1398 848 285 212 179 --11276 42684 1457 456 408
NM_024665chr3124621 4581 4427 4304 4060 3829 1716 1626 1019 697 580 472 11149 1620 --
NM_024670chr1021551 1109 --11404 1497
NM_024674chr192985 2886 2772 2467 1170 985 752 701 261 --22906 606 --
NM_024683chr17----1179 --
NM_024692chr271541 1418 1305 1286 1161 444 229 41763 1523 1336 500 21590 77 --
NM_024700chr13867 800 401 1367 1379 --
NM_024704chr201938 1437 11081 --
NM_024713chr1541660 1062 421 309 --11078 11453
NM_024721chr8112586 2451 2257 1930 1918 1852 1799 953 502 410 67 12487 21866 1807 1548
NM_024725chr113715 235 183 2645 259 3705 625 95 --
NM_024749chr142245 786 162 54 2502 271 1108 --
NM_024761chr9164520 4498 4213 3937 3577 2052 2023 1721 1615 1535 1472 1424 902 636 470 331 25022 768 1161 --
NM_024817chr15135910 5868 5516 5169 4499 4108 3748 2311 2303 969 880 657 567 --15045 --
NM_024828chr9101365 1200 1185 1174 544 389 313 157 125 25 21589 176 31507 1101 241 --
NM_024830chr521944 164 21461 815 --21748 523
NM_024835chr17----1101 --
NM_024857chr173227 133 107 261 25 ----
NM_024896chr961911 1814 1724 921 574 101 ----31677 898 267
NM_024899chr185700 675 244 89 47 --2687 260 --
NM_024900chr451907 1880 1536 1444 184 --31933 1859 491 --
NM_024913chr791747 1503 1178 1143 1127 1095 651 496 183 21366 1354 1546 1624
NM_024920chr4111412 1405 1373 1315 977 528 488 375 223 193 39 --1535 --
NM_024939chr1641665 1646 1556 1521 21044 360 --11167
NM_024944chr2141101 453 402 322 1152 ----
NM_024945chr961180 1138 904 794 131 69 --2883 84 --
NM_024946chr1661695 1470 1349 1232 1208 335 --1717 11572
NM_024947chr3259477 9065 8878 8705 8612 7960 7717 6669 6416 6277 6133 6124 3115 2898 2858 2668 2531 2330 1843 1831 1739 1563 517 488 211 57052 2962 1968 1769 1480 26597 1503 16628
NM_024949chr4104903 4510 3584 3556 3422 1979 1594 1506 379 133 2590 190 11909 13400
NM_024953chr12102834 2796 2662 2598 2040 2001 1005 939 128 91 22434 226 21754 1103 --
NM_024969chr24878 597 237 197 ------
NM_024989chr2187547 7265 6122 5917 5858 5190 5109 3200 2732 2591 2101 2029 1948 1929 1909 1675 1433 290 37984 7704 5941 57429 6825 5746 1438 1148 47931 6811 5051 2627
NM_025009chr461968 1665 1302 449 256 136 21937 1640 31906 1822 1647 --
NM_025010chr342813 1970 1913 736 ------
NM_025054chr8124208 3754 3343 3109 2767 1578 1536 1503 1412 993 839 276 43381 1663 1602 270 51608 1357 1144 1139 446 --
NM_025076chr28694 560 499 466 263 217 140 91 ------
NM_025114chr12--1119 --147
NM_025126chr126749 743 644 473 226 103 1617 ----
NM_025134chr16102581 2404 2158 1957 1713 1696 977 954 769 468 --2329 266 --
NM_025138chr1341355 1294 1122 161 21086 320 ----
NM_025140chr121605 --1636 --
NM_025141chr152389 180 --1117 --
NM_025146chr372723 1908 1785 625 450 433 171 ----11047
NM_025154chr731046 967 562 --11450 11062
NM_025160chr173548 3134 3048 1079 950 892 53 14003 33098 3065 382 --
NM_025164chr1142067 1451 835 818 12088 12192 --
NM_025181chr23642 553 183 1620 1335 --
NM_025182chr9----1337 --
NM_025184chrX3853 233 61 --1693 --
NM_025191chr183226 3183 3018 2650 2479 1385 619 102 23089 2470 23410 1395 13299
NM_025195chr851913 1711 1553 1175 771 11562 1166 11542
NM_025212chr4----1118 --
NM_025214chr1872572 2457 2278 2109 1914 748 254 42369 1973 974 344 11838 12296
NM_025222chr342870 2289 1072 172 11040 23062 3000 --
NM_025235chr1071515 1503 1410 631 335 211 164 51800 1692 702 450 283 11957 22117 1763
NM_030571chr571517 1345 412 344 295 177 115 1609 ----
NM_030621chr14153911 3878 3704 3261 3244 2919 2598 1684 1434 920 885 850 618 270 249 33170 2853 2815 1741 33945 3710 1050
NM_030623chr281575 1322 1239 1143 1134 1124 425 38 1502 ----
NM_030627chr5113961 3938 3682 3622 3609 3446 1476 1369 1139 386 232 23723 3690 33615 3274 2922 --
NM_030629chr1631638 330 311 31527 1481 1315 11547 1242
NM_030647chr7246202 6102 5837 5751 5671 5620 5279 5129 4706 4608 4396 2527 2247 2217 2061 1857 1566 1517 1379 1356 1231 1085 919 578 1633 65362 4793 4677 2211 607 272 1613
NM_030648chr4145225 4972 4933 4817 4059 3944 3896 3695 1977 1597 1362 831 764 448 11333 2793 672 --
NM_030650chr2173930 3776 3554 3547 3367 3342 3188 3087 3015 1412 1391 1252 1103 986 655 441 348 13635 22716 819 --
NM_030661chr721651 396 21697 177 --11716
NM_030751chr1061704 1625 1457 1399 437 363 31390 1369 566 21256 473 1428
NM_030759chr103728 664 532 1808 2775 591 --
NM_030762chr1231980 1799 1624 11705 1783 --
NM_030763chrX5799 712 290 284 76 2379 300 1236 189
NM_030773chr2051835 1817 1676 711 277 1355 ----
NM_030774chr1141104 1057 362 31 11319 21568 1076 --
NM_030777chr2082385 2227 2174 1920 1656 747 736 294 ------
NM_030791chr1481863 1822 1778 1730 1696 1599 1453 1248 21539 1338 3732 683 151 --
NM_030806chr1208916 8901 8797 7219 7017 6227 5957 3750 3540 3413 1972 1817 1807 1579 1480 1367 1131 767 757 219 13251 48447 3448 3432 2492 --
NM_030816chr173434 3269 1460 1380 851 474 437 12657 13119 11024
NM_030817chr12143789 3670 3005 2992 2796 2727 2717 2687 2668 1451 1443 1398 808 255 --22968 1502 --
NM_030885chr3102292 2139 1843 905 660 596 315 299 265 229 22251 2033 32231 2013 323 --
NM_030911chr1321416 609 --2547 219 21492 297
NM_030918chr1105311 4321 3648 3532 1521 1381 1359 1089 442 315 14407 1479 15194
NM_030938chr1751170 1086 791 387 147 ------
NM_030939chr661111 918 848 444 333 164 --174 --
NM_030949chr62474 213 --21409 592 11383
NM_030962chr1121562 987 11463 --31489 1411 1285
NM_030963chr6------2486 253
NM_030964chr553661 3646 1253 1081 199 23617 928 2529 229 1830
NM_030965chr1--1567 ----
NM_030978chr9----1140 --
NM_031216chr1882216 2137 838 758 511 434 359 25 51525 696 548 463 428 12098 --
NM_031271chr861637 1626 1402 1360 1053 657 21182 134 21114 391 2450 375
NM_031283chr22851 140 1219 180 --
NM_031296chr4102545 2376 2201 1960 1935 1678 749 618 563 112 12363 12236 --
NM_031372chr431541 681 169 21179 400 4639 449 232 180 --
NM_031412chr12----11068 --
NM_031427chr14135843 5602 5315 4942 4168 3879 3848 3753 1946 1559 1342 368 79 45877 788 644 294 35904 4833 3831 25080 64
NM_031435chr12143360 3325 3206 2984 2843 2771 2286 2252 2166 1406 1361 1023 651 567 23396 2669 1171 33311 1301 971
NM_031438chr541857 1443 408 267 --11498 11234
NM_031439chr881907 1749 1662 1609 1451 757 650 217 11642 1633 11763
NM_031442chrX62735 2527 2145 2117 1195 178 1813 ----
NM_031445chr263426 2789 2454 2278 1121 931 13368 103134 2228 2223 2218 2213 2208 2200 2195 1183 113 --
NM_031453chr1021882 1820 12380 22428 631 --
NM_031461chr821684 1631 1313 --1559
NM_031469chr6103085 3055 2885 2813 2613 2513 754 696 178 116 43394 2726 2690 525 34100 4065 1384 12964
NM_031477chr16----1139 --
NM_031915chr132220 107 ----1250
NM_031922chr64441 381 368 159 --1110 --
NM_031935chr13938 724 715 11001 1220 11014
NM_031948chr16----1161 --
NM_031953chr44444 411 129 104 --1435 --
NM_032042chr592894 2579 2193 1820 1802 1105 1038 1013 844 12358 --12005
NM_032047chr331808 1586 798 ----32345 948 681
NM_032102chr1172343 2052 2003 1182 1173 1062 278 32997 2553 1989 42545 2498 464 205 --
NM_032121chrX72132 1955 1902 1894 478 460 329 --32258 298 239 1354
NM_032124chr182951 193 ------
NM_032139chr191913 1883 11130 --
NM_032144chr261812 609 367 224 96 54 21773 1215 --11655
NM_032145chr651955 1868 1505 594 249 31700 148 54 170 --
NM_032153chr32894 410 --22385 2051 12179
NM_032160chr18164328 4065 3501 3483 3444 3158 2926 2902 2738 751 711 626 390 301 213 190 --33643 1161 53 --
NM_032172chr72960 148 --1796 --
NM_032181chr22798 669 --2808 772 --
NM_032182chr1021618 1062 --21489 547 --
NM_032199chr1083398 3183 2789 2728 1522 1421 1122 650 1870 13281 --
NM_032217chr411111 --1459 11001
NM_032221chr2042063 1937 1640 727 21524 576 1501 --
NM_032228chr11133547 3541 3501 2936 2886 2745 2681 2168 1249 1195 1189 1176 153 22651 898 52917 2856 1115 906 142 --
NM_032229chr1341049 954 844 786 21106 867 1948 --
NM_032233chr143747 728 154 1127 ----
NM_032236chr11438 ----1220
NM_032239chr471245 1217 1170 1155 926 312 180 1565 1155 --
NM_032246chr1541277 1156 1091 461 --31195 1190 953 1882
NM_032295chr741279 1253 544 136 21506 1373 --11023
NM_032307chr921084 881 144 41070 890 793 417 --
NM_032352chr1451288 1235 1135 954 365 --1186 --
NM_032373chr10235922 5779 5536 5077 5068 4978 4821 4538 4246 3927 3754 3665 3626 2210 2183 2016 1995 1963 1729 1703 1303 944 391 44908 4478 2169 1463 53739 2064 1736 1121 985 11168
NM_032376chr17------1734
NM_032380chr53417 76 69 --1389 --
NM_032408chr771209 961 853 809 468 268 148 ----1791
NM_032410chr85419 396 360 183 162 2311 274 --11215
NM_032424chr1141562 1458 1426 590 1527 11392 --
NM_032436chr131641 155 2983 929 1896
NM_032437chr1----2152 132 --
NM_032439chr10121533 1483 1389 1294 1141 618 367 314 278 267 163 74 11444 31316 562 242 --
NM_032440chr10112860 2458 2284 2150 1050 977 876 715 541 422 173 1896 12007 1597
NM_032445chr15112425 1762 1635 776 722 610 595 451 394 326 250 --22414 907 --
NM_032446chr5103477 3123 3033 2980 2754 2673 1044 902 654 570 --43390 3249 846 490 13171
NM_032449chr162840 2513 2382 1793 809 245 1381 1984 11040
NM_032457chr4133890 3859 3291 3005 2998 2557 1289 1249 1239 1208 592 403 394 12675 21385 1009 1969
NM_032458chrX153411 3372 2992 2960 2753 2743 2337 1378 1294 1273 827 488 316 305 212 --23038 1283 12287
NM_032491chr1261276 948 875 312 306 177 --2852 87 --
NM_032505chr3112557 2544 2430 1931 1837 1801 1777 821 608 416 376 21055 105 32602 2437 1751 1253
NM_032510chr1882373 2298 2041 1735 1662 524 330 122 22497 166 21623 312 11694
NM_032511chr61320 --1447 --
NM_032521chr20113206 3188 3137 3072 2734 2665 2556 2448 2024 794 173 --63149 3110 2153 2043 1959 461 12947
NM_032539chrX4606 555 332 120 --2786 533 1738
NM_032547chr481327 516 481 376 293 263 89 24 --21084 217 --
NM_032557chr45813 704 215 141 89 1360 --1678
NM_032560chr142852 831 1422 --1924
NM_032582chr1781871 1704 1679 1346 1185 565 448 160 --2179 108 11620
NM_032583chr16------2340 273
NM_032632chr1481964 1635 1424 1260 1250 667 407 375 21970 685 --11592
NM_032682chr3103257 3041 2911 2847 2474 2303 727 635 539 329 13155 13239 --
NM_032717chr45871 862 135 91 77 ------
NM_032737chr1922484 953 160 22698 637 --
NM_032772chr102519 412 ----1223
NM_032784chr61672 --1922 1841
NM_032796chrX5625 565 540 289 156 1207 1105 --
NM_032800chr12931 96 1757 --12697
NM_032801chr1152418 2069 1759 922 744 11999 --1736
NM_032810chr1051397 1317 1167 1040 599 1122 --31543 1030 422
NM_032811chr1151865 1653 1587 1443 172 21427 512 11403 21468 1302
NM_032832chr641299 1261 660 135 21652 1575 21747 1519 --
NM_032833chr1102421 2272 1891 714 685 677 610 473 452 403 22452 792 22536 2052 22634 2393
NM_032842chr741730 1308 1140 267 --1688 1213
NM_032846chr1441195 1169 1065 960 21248 1072 ----
NM_032857chr151160 1180 ----
NM_032859chr13163048 2544 2448 1451 1427 1407 1152 960 909 815 797 749 551 489 113 33 13100 33844 1585 461 23865 938
NM_032864chr13307 134 102 1601 ----
NM_032866chr1593103 3036 2914 2777 2476 2341 851 412 260 --22976 2879 --
NM_032867chr11----1659 --
NM_032873chr11104121 3835 3469 3181 3164 3149 2924 2876 1788 429 14439 12862 --
NM_032876chr1431902 1543 502 ----11516
NM_032884chr11329 --1346 --
NM_032905chr1061317 1248 847 382 234 152 --21297 1277 --
NM_032918chr124902 303 165 90 --41289 1284 1153 521 --
NM_032927chr42609 525 1719 2617 592 1255
NM_032932chr17116288 5398 4924 4684 4600 4521 4167 2508 2421 1628 1200 --35734 1901 226 25625 1264
NM_032961chr451381 1072 949 442 214 2976 398 11109 11298
NM_032968chrX104047 3655 3576 3548 3201 3085 1195 823 774 299 13610 13794 11428
NM_032973chrY114039 3647 3572 3544 3196 3080 1388 1195 823 774 299 13602 13786 11428
NM_033055chr151148 427 340 251 97 1922 1868 1998
NM_033056chr104702 616 258 97 1734 ----
NM_033058chr83922 817 777 ----1974
NM_033081chr2031051 299 199 11064 1288 31407 1161 580
NM_033083chr383306 2440 2278 2098 1330 938 465 62 11136 12932 --
NM_033089chr2031292 385 82 --1250 --
NM_033119chr162689 183 ------
NM_033132chr1382216 2161 2121 1985 1978 890 718 649 21939 681 12208 1837
NM_033161chr931918 654 87 --21948 143 21961 529
NM_033211chr5121914 1852 1741 1617 1321 826 713 606 480 437 407 294 21637 656 11990 1509
NM_033224chr7157708 7397 6947 6019 5948 5737 5576 5527 3081 1757 1637 1588 1494 1097 1037 26361 1395 --27536 5751
NM_033260chr66734 621 200 186 83 76 1194 2786 751 --
NM_033285chr8154374 4071 4032 3843 3752 3614 3585 3465 3450 3357 3224 3066 619 302 121 64429 4318 4305 4112 2752 918 2416 353 23471 2800
NM_033389chr17154890 4802 4672 4659 4571 4491 3962 3297 3169 1098 548 417 269 221 112 --34006 3654 81 195
NM_033394chr241587 1499 429 230 41510 1308 1238 640 11128 21487 465
NM_033396chr11--2339 320 --1162
NM_033427chr71563 1248 ----
NM_033495chrX21063 159 --1904 --
NM_033502chr61165 ------
NM_033505chr2196498 6139 5354 5046 4836 4826 4473 2130 1977 1827 1800 1744 1557 1252 1233 1203 590 317 311 21445 194 36012 2082 186 1397
NM_033512chr882561 2304 2213 2204 1237 539 240 115 12240 --12164
NM_033515chr651377 1216 1054 997 903 --11135 --
NM_033540chr33410 85 73 --1850 --
NM_033631chr173658 3594 2913 2877 1384 1303 1019 23296 1135 12597 --
NM_033666chr104946 841 795 204 --174 --
NM_052832chr8152608 2547 2329 2117 2071 2034 1989 1133 846 771 726 499 391 301 268 52991 2981 2950 2349 1942 2273 213 1806
NM_052851chr1331720 621 220 21902 930 22286 1573 31786 403 236
NM_052854chr113633 445 414 1484 1490 --
NM_052864chr492232 1983 1878 834 696 636 598 336 211 --11755 --
NM_052879chr12113829 3759 3651 3569 3410 3339 2932 2826 2695 1493 1045 23532 3486 12524 12605
NM_052885chr12204676 4639 4567 4312 4276 3656 3530 3186 3168 3085 1885 1408 1186 1165 1102 988 787 756 216 194 34223 4133 3773 34894 4849 4171 11856
NM_052886chr881715 1315 769 419 353 271 237 201 --1174 32150 1676 51
NM_052900chr871762 1519 1371 1294 1176 533 511 31321 1151 325 11595 11778
NM_052904chr641335 1221 397 213 2279 100 41415 1159 1100 511 --
NM_052905chr261607 1542 1464 1360 556 144 11851 21250 63 1434
NM_052907chr12123855 3611 3578 1556 1521 1400 1190 1069 966 873 239 31 1479 22961 710 --
NM_052910chr1392200 2176 1776 1479 1391 855 836 740 489 --41879 865 860 778 --
NM_052911chr184985 856 89 65 1384 2233 197 --
NM_052913chr63239 40 23 1460 1205 --
NM_052917chr2153316 3260 3253 3132 3047 2910 2751 2072 1252 1169 942 905 414 264 79 21237 398 43408 3304 1022 316 --
NM_052918chr10133745 3406 3259 2856 2369 1375 1258 1168 785 559 411 344 111 13347 191 --
NM_052927chr562242 2086 1873 1862 861 835 --21631 405 2282 197
NM_052937chr8122734 2195 2150 2124 2102 1869 1076 953 762 656 579 550 42291 712 440 181 21803 570 22365 332
NM_052958chr81694 1115 176 1262
NM_052965chr171330 1014 913 854 326 75 28 --31311 1030 213 21342 434
NM_052966chr1123768 3425 3336 3103 2960 2777 1400 1212 370 214 206 171 --63552 2634 1410 1405 1186 717 13890
NM_052978chr1431628 1254 691 ----11799
NM_053001chr82305 274 --1375 --
NM_053002chr331138 114 31 --31145 394 125 --
NM_053023chr11123263 3247 2801 2278 2235 2093 1331 968 893 810 572 511 32955 2508 2448 13118 22517 42
NM_053024chr331370 1330 1201 31221 300 131 31475 584 87 --
NM_053042chr4112746 2554 2412 2260 2143 2079 598 484 433 400 289 11970 12065 --
NM_053056chr1152936 2153 1132 562 437 2873 324 --2591 299
NM_053064chr1462873 2713 2611 2259 1171 160 32864 2329 2194 22450 2291 --
NM_057161chr6------1539
NM_057175chr4112620 2206 2180 1826 1816 700 445 370 349 144 32 12554 12272 --
NM_058170chr151402 1286 1175 430 121 1640 1560 --
NM_058172chr431852 443 427 ------
NM_058237chr146863 726 708 666 287 89 11038 1698 1688
NM_078483chr584119 3720 3192 1292 1186 781 705 654 1434 24113 347 --
NM_080546chr982077 1873 1722 754 541 438 337 188 --21410 344 12306
NM_080617chr202803 96 --4878 832 791 317 --
NM_080671chr251980 1528 425 255 106 ----12230
NM_080743chr6112619 2389 2297 1896 1821 1771 965 582 357 234 114 --22590 220 1868
NM_080752chr203442 416 92 ------
NM_080764chr22113206 2918 2737 2302 2175 919 749 463 308 287 184 --23262 3150 --
NM_080832chrX71806 1429 1411 673 517 156 62 11365 41487 508 148 80 --
NM_080836chr2053691 1039 695 193 31 34741 421 360 --14635
NM_080867chr14205019 4875 4747 4499 4415 4365 4183 4110 2022 1978 1857 1602 1535 1228 1019 940 601 130 76 67 44561 3410 1392 918 155 13512
NM_080872chr8103976 3317 3305 3023 3011 2553 1446 1362 1348 53 --33925 3240 2873 1151
NM_080923chr11282 --124 2326 104
NM_080927chr393307 2725 2438 2224 2134 825 618 512 167 52301 2274 2215 2188 1027 52638 1178 856 810 599 11073
NM_130387chr31339 --2325 89 --
NM_130446chr364348 3995 2951 1566 288 135 ------
NM_130469chr14--1691 --1744
NM_130809chr5103058 2919 2757 2507 988 853 744 634 626 110 1195 43083 965 885 693 42978 2529 1152 1015
NM_133264chr1773920 3185 2879 1332 1064 692 545 --11272 --
NM_133265chrX113683 3190 3131 2846 2717 2327 1024 985 344 130 63 --13646 --
NM_133334chr4196071 5761 5192 5184 5173 5152 5122 4850 4839 4269 4261 4210 4184 2076 1170 1053 890 547 156 12344 36337 2488 82 --
NM_133445chr953640 3473 3377 2701 1057 1828 13572 163
NM_133468chr781995 1835 1667 1566 1019 937 391 42 --1781 --
NM_133493chr6164363 4078 3915 3905 3492 3405 3320 3258 2982 1558 1463 1374 1271 1154 295 187 34553 4468 2887 44626 4349 3431 3005 --
NM_133496chr1254429 4208 4094 4030 3998 3960 3940 3897 3655 3626 3603 3295 2778 2767 1717 1677 1219 1186 1125 1117 684 677 665 153 29 44129 3770 3435 608 31501 1440 1197 23884 1345
NM_133646chr2175577 5435 5093 4806 4760 4488 4480 4258 4145 3822 1877 1779 1773 1466 1117 348 163 1967 35328 4724 339 25474 5182
NM_134428chr9----1322 --
NM_138286chr19104405 4099 3212 3142 1644 1439 1416 1097 904 793 53780 3051 2997 2914 2769 44315 2844 2826 427 12722
NM_138288chr149695 580 374 330 319 271 246 223 176 --1493 11577
NM_138290chr72357 31 1311 --187
NM_138316chr1051080 890 401 369 282 ----11031
NM_138333chr952645 2188 937 892 659 22056 830 174 --
NM_138335chr44895 792 658 291 1715 ----
NM_138340chr184688 516 502 72 1603 1214 1167
NM_138357chr1041426 726 617 471 --11190 --
NM_138400chr783431 3342 2888 2836 2257 1051 882 157 23468 2719 22725 344 --
NM_138423chr1572191 2146 1970 1862 1431 887 137 42220 1948 1816 395 2279 60 12095
NM_138426chr742453 2205 1610 223 --2759 626 --
NM_138444chr1394818 4160 3909 3739 3686 1997 1948 1291 84 24771 4120 --34433 3888 1154
NM_138459chr6133563 2709 2674 2335 2252 2231 1205 1190 1058 975 896 432 265 11317 12739 --
NM_138571chr62102 84 ----1226
NM_138572chr642032 998 845 225 23258 952 13265 13353
NM_138694chr6123652 3505 3009 2879 2721 2330 2270 1061 838 449 281 139 1379 1556 --
NM_138731chr14154217 4168 3972 3961 3780 3637 3523 3123 2648 1048 978 868 525 399 171 23179 2895 43473 3250 1363 983 44258 3319 3094 265
NM_138771chr751461 1199 1019 170 97 167 11380 11065
NM_138782chr552390 2310 1554 398 80 41738 883 740 592 11951 22233 687
NM_138792chr151105 --134 126
NM_138805chr3----1317 --
NM_138927chr2131070 810 186 1166 11014 --
NM_138959chr1126309 6036 5642 5543 5505 4576 4173 2437 519 512 393 22 96809 6016 2720 2567 2338 2310 2251 1646 1545 1155 12262
NM_139207chr1281888 1839 1412 838 705 262 169 140 22126 1430 22251 421 --
NM_139245chr32698 497 1373 --21426 677
NM_139279chr253423 3031 2544 906 65 23274 1012 23069 2922 12894
NM_139283chr12101587 982 921 770 755 621 507 498 476 157 22230 2206 12430 --
NM_139319chr1281825 1639 1418 1360 682 499 473 35 1443 11428 11585
NM_144563chr22772 724 2816 266 1716 --
NM_144567chr1132713 2390 2356 2329 2207 2031 1728 1720 743 729 712 303 221 22304 247 41127 1093 753 748 32825 2074 161
NM_144571chr4226660 6407 5926 5120 5080 4879 4807 4540 2789 2681 2134 1739 1663 1637 1510 1441 1423 1378 1145 672 407 214 74641 4470 2691 690 599 458 248 21673 991 34619 370 142
NM_144574chr143597 501 459 --1607 --
NM_144578chr14165469 5399 5269 4795 4753 4665 4485 4075 4036 4030 3883 3563 812 615 581 226 21077 736 14940 --
NM_144579chr252240 358 351 345 170 1327 12133 --
NM_144590chr1062875 2280 2105 1108 156 63 11184 2937 108 --
NM_144599chr15155205 4830 4351 4177 3560 2127 2101 1965 1734 1303 747 667 568 383 301 35434 4867 3520 34368 1247 857 --
NM_144600chr1621263 619 31682 1639 571 ----
NM_144628chr2092685 2594 2163 1213 888 859 734 112 83 ----12538
NM_144631chr2--2290 28 ----
NM_144632chr2122055 1856 1711 1656 947 885 816 721 658 626 133 38 21999 1678 --22068 1966
NM_144633chr341489 1198 563 246 1594 11410 --
NM_144643chr42391 30 --1444 --
NM_144664chr11102199 1838 1764 1676 1001 968 703 511 472 287 32614 2132 1906 1994 12218
NM_144710chr231363 1211 96 --31416 1088 48 --
NM_144721chr4162645 2506 2286 1949 1882 1023 990 955 860 745 677 656 479 419 403 382 3827 214 53 12805 1834
NM_144726chr561079 986 919 816 786 774 1242 21189 1184 --
NM_144775chr1764364 3780 3591 3391 3282 498 13306 24630 1368 --
NM_144778chr1382454 2316 1952 1849 1833 1031 756 704 1783 --22338 797
NM_144963chr8152597 2442 2084 2070 1902 1688 1677 922 905 849 734 707 649 389 276 3716 248 63 32476 2174 1708 42414 370 332 269
NM_144973chr12185348 5273 4687 4633 4495 4126 3805 3592 3427 1668 1540 1401 1112 927 792 770 632 498 55184 4563 1124 552 477 ----
NM_144979chr42628 76 1647 --1616
NM_144982chr124706 308 298 286 1761 --1779
NM_145000chr54486 397 168 155 1112 ----
NM_145013chr1142062 1892 628 402 --12190 --
NM_145025chr631128 1120 1040 --2921 96 11015
NM_145037chr381579 1483 1466 1394 1247 1131 603 314 --21114 193 --
NM_145049chr52358 60 1999 --1151
NM_145071chr321081 1070 --11086 --
NM_145117chr1163006 2835 2570 2034 861 232 --22947 2860 12602
NM_145174chr2231301 1199 1035 --11022 --
NM_145176chr6133563 3410 3362 2919 2773 2509 1332 1278 1119 727 623 530 370 11414 22360 584 12608
NM_145185chr1941757 1735 1729 1579 --21745 679 --
NM_145203chr133803 658 342 --2976 136 --
NM_145212chr251447 1292 451 135 42 --11207 1581
NM_145243chr11183 --157 --
NM_145251chr14131481 1419 1366 1287 1237 1224 1136 635 469 349 252 242 157 31446 1406 581 31302 573 483 --
NM_145259chr2247130 7029 6951 6920 6715 6065 5606 5481 5380 5298 5191 5019 2354 2141 1977 1799 1626 1368 1333 816 498 317 244 60 46902 6209 4758 1051 46849 5908 2478 212 26825 5764
NM_145263chr482271 1616 1475 939 434 391 322 174 21544 572 32240 1557 196 1202
NM_145284chrX92295 1766 1730 1591 711 646 493 448 76 12302 22281 2167 --
NM_145307chr10154491 4473 4387 4240 3770 3757 3451 3088 2851 1883 893 757 562 421 392 11103 24336 4263 1148
NM_145313chr1051423 333 290 189 121 --11569 --
NM_145315chr62468 124 1386 1108 --
NM_145735chr1342670 281 99 88 22812 261 1142 1346
NM_145756chr1821506 1193 11214 11088 21395 1145
NM_145804chr1131374 1327 859 --11302 --
NM_145808chr7103003 2758 2725 1929 894 681 620 558 551 108 32107 1980 1150 ----
NM_145891chr1661655 1632 1073 182 148 91 --1423 --
NM_145913chr124749 710 227 81 ----146
NM_147128chr761522 1479 1432 1099 422 352 ----11041
NM_147156chr1031317 1018 541 31443 311 278 1994 --
NM_147189chr892264 1980 1798 1492 1465 890 402 349 99 1315 ----
NM_148894chr491222 1183 1113 970 475 455 429 387 259 31142 939 160 3928 481 421 21247 226
NM_152230chr10--1152 ----
NM_152261chr1251991 922 586 538 210 1444 12055 --
NM_152265chr121456 500 11590 --11559
NM_152272chr821367 498 1226 2524 125 --
NM_152275chr2112401 2363 2336 2210 2120 1973 1753 916 895 715 59 42272 679 267 85 --1117
NM_152277chr5112133 1963 1762 1668 1656 1637 1524 595 538 264 46 1819 12000 --
NM_152292chr491715 1645 1469 593 580 504 467 366 266 --21579 86 4711 347 302 169
NM_152332chr14112262 1915 1903 1844 1066 733 720 695 403 339 332 2584 546 41155 1082 819 175 --
NM_152344chr1751239 1171 573 559 477 1356 1277 --
NM_152389chr241594 1484 1353 584 11391 --11310
NM_152392chr2193 ----199
NM_152400chr472081 2048 1780 1678 1636 1604 674 21625 254 --11587
NM_152407chr5163275 2775 2746 2738 2640 2601 2432 2153 2097 869 853 548 482 232 130 57 31280 1236 460 ----
NM_152409chr593438 3392 3183 2986 2206 932 312 288 69 23430 2383 189 23065 736
NM_152414chr881673 1325 1262 1032 641 626 275 73 ------
NM_152420chr91760 --1687 --
NM_152423chrX51176 1138 521 468 342 1616 11124 --
NM_152424chrX114376 4242 3887 3786 3091 2906 1819 1579 1404 1338 729 13475 23792 1772 13491
NM_152437chr12122489 2413 2208 2174 1940 995 668 591 584 398 339 182 --22402 2351 --
NM_152440chr12--1907 --1150
NM_152442chr1261324 1275 913 492 432 197 2479 315 31283 869 333 --
NM_152450chr1541324 278 265 134 --2839 476 --
NM_152455chr1541914 1882 401 114 11021 --1594
NM_152470chr1863936 2950 2645 698 577 77 13877 14056 --
NM_152487chr161339 1300 981 953 918 187 --1962 1987
NM_152490chr11213 ----1257
NM_152519chr252158 1470 813 713 119 1382 --12222
NM_152536chr33967 850 474 --1467 --
NM_152551chr6103018 2692 2604 2115 2063 1148 799 793 127 97 --3943 219 203 --
NM_152556chr7102585 2076 1988 893 793 570 390 361 232 156 12104 31034 652 504 --
NM_152581chrX5994 595 393 362 314 --11404 21336 514
NM_152588chr1261347 1317 751 645 596 156 --21610 1237 --
NM_152594chr1582353 2305 2264 2256 2000 654 487 36 21589 844 --12238
NM_152608chr1122554 2535 2459 2288 2180 1598 1020 995 983 811 477 193 1650 62118 2040 1987 1004 487 482 12277
NM_152622chr5153482 3425 3265 3097 2757 2618 2229 2128 1229 1189 1183 636 506 337 240 --12440 11023
NM_152624chr5306869 6793 6734 6548 6330 6318 6192 6120 6081 5937 5872 5330 2640 2629 2601 2506 2459 2381 2089 2038 1908 1863 1496 1469 1376 1211 1157 963 756 274 25352 193 26772 5388 --
NM_152632chrX2513 193 --1109 --
NM_152638chr1241172 924 806 207 --1237 --
NM_152641chr1252773 2665 1777 384 173 22499 413 21183 114 22901 1093
NM_152653chr33491 198 107 --1210 --
NM_152660chr141016 974 961 131 --1112 --
NM_152680chr482354 2136 2007 1951 1602 1522 541 395 --12210 --
NM_152682chr421113 696 31607 256 99 31505 1350 236 1513
NM_152686chr542036 1628 605 102 12454 22358 956 172
NM_152695chrX61624 1588 1531 714 582 430 ----11721
NM_152699chr363121 2626 2535 2420 2408 489 13789 23553 212 --
NM_152704chr133878 289 154 11051 1805 --
NM_152716chr1151574 1243 589 527 312 11637 ----
NM_152727chr162269 113 ----1261
NM_152731chr621240 910 ----1772
NM_152739chr71930 1355 1972 --
NM_152745chr7----21138 1016 --
NM_152748chr74420 342 335 70 ------
NM_152754chr7113783 3523 3500 3171 2741 1308 1166 768 745 341 261 13484 32853 2597 1077 13637
NM_152756chr5164064 3290 3157 3015 2995 2813 1384 1133 1038 898 831 746 615 511 310 194 23793 1063 --23918 3280
NM_152758chr8102624 2170 1993 1913 1058 998 801 554 400 122 21937 811 12497 --
NM_152787chrX173896 3705 3678 3360 3163 3106 2958 2793 2760 1509 1281 1207 781 645 350 133 39 13339 22929 1026 23214 832
NM_152793chr7104484 3866 3588 2000 1820 957 866 790 479 425 44680 4477 3448 1217 21979 1597 24332 1908
NM_152835chr182201 2195 2073 1147 1018 914 314 172 --42880 2639 2144 963 1392
NM_152857chr63958 718 398 --1912 --
NM_152896chr93569 347 313 --2864 537 1823
NM_152902chr151495 1337 521 426 72 11620 21932 1419 --
NM_152990chr611171 --11208 --
NM_153015chr81848 1756 1387 143
NM_153018chr1763309 3189 1214 682 328 135 --23358 2472 --
NM_153020chr691615 1583 1520 1493 1455 1320 1154 304 99 41700 1540 320 150 ----
NM_153184chr342012 1853 1447 1215 21332 313 ----
NM_153207chr12113672 3524 3363 3179 3155 3109 3055 1638 1503 928 315 33433 3413 1121 33917 2893 2806 --
NM_153208chr163769 600 162 1904 1224 --
NM_153223chr571117 1066 450 373 219 190 44 3112 55 22 1165 --
NM_153234chr552644 1845 1830 1730 846 1485 32066 1788 543 1320
NM_153235chr652344 2270 2257 2237 160 ------
NM_153240chr381155 1128 1037 844 383 286 103 80 ----11138
NM_153261chr1641562 1302 1090 221 1313 1391 11618
NM_153262chr1122768 2054 2002 940 823 544 524 373 356 341 287 131 11266 21151 314 --
NM_153267chr95846 771 641 288 118 2783 752 --1100
NM_153332chr8143276 3059 2870 2479 2412 2298 2140 2037 2019 950 819 367 186 92 23216 2370 22406 1166 31187 826 255
NM_153340chr1--185 --193
NM_153341chr11333 --1100 --
NM_153354chr55903 785 722 362 227 1237 1965 1801
NM_153365chr4102598 2431 2245 2036 1707 990 916 820 794 309 ----11964
NM_153377chr125331 305 120 101 53 1286 1275 --
NM_153449chr121472 --2189 70 --
NM_153453chr63980 397 338 --1781 --
NM_153456chr13156260 6194 6134 6118 5090 4799 4361 3883 2515 1547 1385 789 248 151 139 --44712 4302 4081 1338 --
NM_153607chr5113192 2895 2845 2838 2500 1251 1219 1204 1178 902 599 12545 52804 2658 2611 1938 1061 12680
NM_153613chr15------1171
NM_153634chr1251640 1419 1374 458 58 41538 1402 1305 416 ----
NM_153646chr1452567 2190 651 306 151 --12303 --
NM_153686chr4142462 2243 2149 2005 1918 1706 973 734 716 586 565 282 245 28 2152 111 ----
NM_153689chr282293 2235 2005 1800 1792 1545 896 374 ----11652
NM_170606chr751898 1636 1494 1385 106 --11210 1759
NM_170665chr12104527 3584 1355 1177 941 837 538 453 351 52 1180 43973 1051 761 231 --
NM_170707chr11738 2340 178 1659 --
NM_170710chr4123212 2743 2588 2541 2493 2234 2115 888 742 612 144 76 33048 482 207 1829 --
NM_171998chrX112505 2358 2346 2250 1837 1753 1740 1553 980 265 72 --12472 --
NM_172037chr8--11495 2931 86 --
NM_172069chr242054 1788 769 143 --42243 1794 1592 1540 --
NM_172070chr292023 1959 1898 1853 1822 845 532 357 68 32195 2045 1530 ----
NM_172071chr1257462 7396 7312 6894 6869 6755 6473 6225 5774 4957 4904 4640 2893 2454 2434 2066 1741 1350 1010 683 670 589 308 285 23 15022 56463 5537 5506 5222 272 15662
NM_172240chr122996 285 11339 11388 --
NM_172373chr136474 443 298 250 219 174 11061 2436 138 --
NM_173075chr451570 1477 1211 416 104 --11144 --
NM_173083chr151241 1215 387 196 134 21132 62 --1885
NM_173354chr2161913 591 466 201 181 150 --12135 --
NM_173355chr23742 239 200 190 2126 74 --
NM_173359chr381860 1726 1488 1478 1430 1234 751 25 11763 11874 --
NM_173468chr4165971 5540 5389 4578 4540 4529 4254 4113 2394 1437 1193 1091 1007 873 141 81 1614 11344 --
NM_173469chr1551490 326 184 123 39 21065 982 31504 1017 482 11207
NM_173471chr331056 1013 801 ----11109
NM_173490chr5--126 ----
NM_173491chr541213 1203 1051 327 ------
NM_173494chrX4918 230 91 59 1845 1627 --
NM_173496chr10132811 2657 2146 2137 2060 1973 1936 1011 980 828 778 584 552 --22939 2819 --
NM_173500chr1531130 539 325 21300 208 --21060 1053
NM_173505chr185899 792 463 363 90 ----11105
NM_173510chr2282902 2840 2585 2307 833 805 722 94 --32937 2606 2326 --
NM_173511chr2103966 3689 3573 3152 2828 2779 2434 1164 817 208 13324 13109 23029 429
NM_173515chr621026 416 ------
NM_173519chr841850 1781 1291 1281 11479 11708 --
NM_173531chr19143884 3866 3852 3753 3131 2628 2433 1328 1219 1158 1132 942 872 801 52912 2891 2827 2500 1342 22750 651 13276
NM_173552chr392518 2274 1870 1845 1548 986 790 390 213 32468 1968 419 42443 2177 1630 773 --
NM_173567chr1284 77 ------
NM_173570chr342168 1773 738 269 12103 11948 --
NM_173576chr1072290 2268 2144 1731 1422 905 182 --51908 1599 772 535 206 22075 2050
NM_173582chr11175826 5131 4679 4277 4185 3865 2461 2449 2205 1273 1083 1058 1035 941 845 684 126 46077 4914 3878 2238 36263 4063 1040 15724
NM_173644chr20122007 1775 1648 1557 1440 1276 1245 806 732 681 327 105 21987 691 1415 --
NM_173647chr23825 114 73 --160 11121
NM_173653chr3----31399 365 175 --
NM_173654chr382315 2112 1802 1715 1586 889 789 266 1229 42388 2254 2244 1613 22382 2215
NM_173665chr53634 547 233 --1718 --
NM_173670chr521037 147 --2874 383 --
NM_173688chr82319 87 1237 1158 --
NM_173698chrX51634 1320 460 260 69 21742 1330 21470 593 1762
NM_173797chr51119 --1153 --
NM_173808chr1113800 3731 3595 3411 1799 1570 1336 1195 998 641 158 14394 23976 1076 --
NM_173812chr1271488 1137 1121 507 294 260 93 21162 1089 31348 1218 594 --
NM_173822chr272052 2043 1768 852 606 490 172 21818 1584 21679 1449 --
NM_173829chr5275686 5093 5043 5033 4969 4963 4882 4219 4181 4152 4111 4003 3914 3898 3878 2218 2154 2031 1802 1255 1055 880 864 840 668 450 322 45414 4994 4930 1159 35185 1105 901 21178 938
NM_173851chr8153989 3823 3265 3046 3014 2846 2616 2559 2457 2429 1507 1275 877 573 398 --21458 128 23574 644
NM_174890chr108687 664 507 310 233 211 167 158 1543 ----
NM_174907chr3131 --1128 --
NM_174909chr55891 840 277 142 94 ------
NM_174911chr8123413 3302 3269 3217 2913 2755 1366 1306 887 823 654 207 13552 43775 3749 3128 527 13421
NM_174916chr1552351 2128 716 500 217 21756 932 32034 1739 273 1324
NM_175061chr762058 847 669 500 218 123 2601 160 ----
NM_175607chr331181 278 181 21174 298 ----
NM_175736chr12137200 6942 6725 6708 6180 6001 5411 5327 5106 2185 1514 1357 202 17772 1895 15912
NM_175747chr621063 1003 11071 1838 --
NM_175767chr521870 1765 --21893 1747 1602
NM_175854chr13122464 2341 2312 2001 1811 1766 1702 942 845 365 298 227 32646 2318 1853 ----
NM_175856chr53739 730 69 1240 4685 249 111 88 --
NM_175861chr12205942 5875 5656 5039 4647 4435 3968 3643 2370 1775 1731 1141 1080 955 711 689 646 563 395 250 35731 5004 4474 64904 4822 1991 1371 882 718 15987
NM_175866chr141487 960 394 90 ----2969 105
NM_176814chr781508 1250 1064 1036 964 416 399 55 11187 11121 1385
NM_176815chr373018 3004 2882 2798 2391 1988 128 12991 12963 --
NM_177531chr84361 209 143 115 1194 157 --
NM_177538chr2358887 8798 8761 8755 8469 8131 8062 7735 7070 6546 6095 5790 5655 5381 3337 3062 2995 2725 2685 2586 2540 2389 2202 2172 1885 1840 1538 1238 828 692 555 419 237 221 208 43482 1132 146 81 28154 2556 22190 99
NM_177968chr261934 1763 1504 1481 888 536 1776 21464 643 --
NM_178011chr10173210 2950 2678 2613 2420 2090 2018 2010 1998 1194 1093 1012 774 546 416 392 378 --42161 1245 897 570 2188 41
NM_178033chr12374 193 --132 1485
NM_178043chr4----147 --
NM_178123chr24764 712 258 250 1954 1893 --
NM_178135chr451377 1308 480 459 74 --2560 277 --
NM_178140chr562767 2703 2634 1836 300 253 --1942 12611
NM_178148chr61547 --2583 578 --
NM_178313chr2101947 1885 1846 1808 1559 1537 1338 562 556 238 --1228 --
NM_178470chrX3667 596 102 21617 395 ----
NM_178493chr173433 361 354 1329 --1339
NM_178505chr1093496 3246 3120 2853 2828 1080 791 365 176 53642 2914 2234 1466 1447 53648 3537 2465 1390 631 11435
NM_178509chr17124073 3496 3259 3175 2937 2847 2771 2732 2512 929 515 138 4545 419 347 299 12749 21189 258
NM_178517chr172526 454 --1100 1539
NM_178539chr1251746 1400 816 703 447 21873 95 1504 21487 757
NM_178558chr751202 1186 1145 969 338 --2891 483 21258 129
NM_178566chr93308 139 59 --11641 --
NM_178815chr1062723 2499 891 850 761 727 42599 2530 2057 1100 21688 874 --
NM_181077chr1542218 2105 2044 912 11789 11534 1509
NM_181354chr851654 1339 1169 535 107 --11226 --
NM_181356chr641017 1010 272 99 --1353 1368
NM_181358chr1134096 3308 3190 3080 2804 2682 1250 1217 1186 1016 900 851 386 21110 1088 23919 508 13790
NM_181504chr5134170 4066 3380 3184 2828 2741 2725 1623 1547 1409 1127 1014 360 ------
NM_181571chr102973 330 31115 716 94 ----
NM_181670chr1251496 1382 1365 1272 1163 --11447 1576
NM_181672chrX72014 1921 1826 609 515 416 323 3543 534 368 ----
NM_181701chr972369 2270 2195 1845 1697 797 72 ----196
NM_181723chr861863 1851 1642 1508 684 327 11800 22002 1856 --
NM_181773chr22------1254
NM_181782chr651943 1838 1652 497 304 1632 12329 1230
NM_181784chr242614 2576 2557 590 12499 12339 --
NM_181787chr8103814 3552 3543 3348 3092 2705 2648 1395 1331 1182 33489 3077 1539 1437 --
NM_181844chr173636 530 107 ----1508
NM_181869chr12102893 2122 2047 1866 1780 692 569 427 79 70 1171 22335 2278 163
NM_182398chr141331 2299 156 ----
NM_182485chr4133607 3559 3524 3281 3207 2758 2679 2632 2555 1341 1269 452 136 53360 3110 1349 1167 263 83618 3487 3328 3301 3212 3031 2834 998 13493
NM_182487chr9114373 4367 4035 3929 3489 3184 3043 2851 1543 756 364 --14388 --
NM_182493chr16174050 4020 3924 3908 3826 3366 3305 2161 2040 1151 1066 1009 921 500 350 291 278 --54346 3573 2073 1091 436 13263
NM_182501chr283296 2608 2256 676 636 630 303 107 23087 3062 32087 463 458 --
NM_182524chr44745 573 263 98 1236 1619 --
NM_182540chrX1313 --2857 142 --
NM_182559chr12129 --3362 277 126 --
NM_182565chr172745 614 ----1129
NM_182569chr173498 176 114 --1196 --
NM_182691chr781297 1286 1222 1080 1058 357 316 119 1564 21329 436 --
NM_182700chr771980 1942 1929 1775 1767 690 285 21253 770 1783 1166
NM_182703chr1551357 1136 412 233 162 ----11434
NM_182765chr1042022 1804 114 95 3900 251 30 32100 1517 262 --
NM_182830chr1431973 1802 610 2798 63 12250 1899
NM_182944chr141450 1349 1131 --
NM_182970chr2043489 2741 1608 1005 11239 24102 3472 --
NM_182975chr141149 428 188 60 31175 1100 1000 ----
NM_182976chr14631 255 185 31 2199 132 2318 263 --
NM_183061chr32258 236 --1342 --
NM_183376chr1552626 2547 2110 1908 753 --22468 2255 12595
NM_183387chr14133 2940 581 ----
NM_183416chr141743 1419 624 613 31594 323 127 ----
NM_194071chr7165359 5352 5227 4980 4689 4606 4517 4256 3370 1476 1385 1309 1244 894 254 64 25399 4706 43802 3439 1470 1151 --
NM_194247chr2114535 4335 3927 3174 1076 787 431 417 290 275 75 13558 23945 2822 --
NM_194282chr492785 2647 2209 1933 543 224 174 151 94 11245 32427 1890 345 --
NM_194285chr11113172 2739 1117 1044 760 724 552 427 331 313 88 1781 23455 801 12579
NM_194286chr1254575 2278 2078 1553 1238 --12087 --
NM_194291chr8132974 2794 2420 2325 2120 1982 1922 1186 778 605 597 583 563 22928 260 32876 1080 246 --
NM_194298chr1092002 1976 1864 1283 799 566 379 165 57 21335 150 --41549 1506 1410 36
NM_194314chr1265642 5633 5537 5451 5228 4519 4430 4128 4110 4058 3986 3980 3908 3589 2179 2142 2120 1890 1785 1590 1435 1278 1136 806 555 324 55573 5528 4152 3879 3681 ----
NM_194317chr231848 449 441 --11017 12729
NM_194439chr461307 364 332 316 231 222 1290 --2370 298
NM_197941chr542134 792 338 163 12846 1476 12879
NM_198074chr11336 --21363 865 --
NM_198215chr1031266 387 108 --1291 31449 1258 1034
NM_198256chr231537 688 317 32056 447 209 ----
NM_198270chrX133398 3380 3023 2960 2517 2496 2451 977 942 920 746 661 197 23373 991 --12686
NM_198273chr5103023 3015 2673 2514 2378 2342 2245 1942 898 141 --1298 23064 1087
NM_198279chrX41085 948 799 407 --1125 1437
NM_198401chr871704 1619 1607 1417 1320 533 439 11721 --1231
NM_198402chr3----1280 --
NM_198459chr161012 907 825 740 285 107 1235 2853 695 --
NM_198463chr31408 --2413 296 --
NM_198465chrX102749 2493 2094 1968 1925 988 305 167 122 93 ----1237
NM_198468chr6174568 4354 4258 4232 3970 3425 3187 3124 1689 1444 1365 1328 1041 742 673 382 240 44576 4246 506 132 43689 1339 1254 855 --
NM_198507chr53545 164 120 1176 2479 29 --
NM_198511chrX41797 1619 1586 175 --11806 11176
NM_198513chr871548 1452 792 767 464 419 210 21974 379 --11982
NM_198581chr2227392 7301 6799 6172 6113 6027 5771 5466 5143 4695 2874 2846 2215 2121 1912 1836 1177 839 537 490 246 189 67082 6723 5636 1183 341 183 35171 1113 603 22166 170
NM_198715chr1195612 5454 5404 5148 5127 5026 4864 4464 4390 4233 2232 2138 1978 1641 1415 1222 693 606 389 35522 3971 277 12406 --
NM_198859chr3115093 4928 4154 4010 3278 3271 1729 1424 1396 318 210 --1684 14487
NM_198892chr4159 ------
NM_198935chr2082884 2632 2508 2403 2391 2234 2206 898 11071 --1947
NM_198990chr772547 2225 2150 907 523 360 344 11058 32514 2324 1265 --
NM_198991chr182628 572 --1634 1733
NM_199000chr752171 1787 1589 1459 394 --21895 1868 1919
NM_199051chr1------1265
NM_199072chr7153162 3124 2912 2830 2821 2759 2241 2093 1231 784 768 328 196 187 153 32379 2233 208 12511 --
NM_199136chr72480 427 ----1442
NM_199141chr191217 ------
NM_199320chr472630 2485 2364 2302 2090 1073 580 1320 11964 12811
NM_199346chr22139 38 --275 31 --
NM_199355chr1651822 1363 577 372 236 21800 1628 41651 1643 1555 1328 11791
NM_199461chr1072915 2699 2281 1283 1112 384 320 12926 4711 470 443 368 --
NM_203301chr1441209 512 323 316 2363 117 31622 673 279 11557
NM_203349chr15102225 2201 2150 2134 1906 1737 1714 1627 1452 219 --2498 78 --
NM_203364chr1141102 798 392 149 --11011 --
NM_203371chr1151865 1169 742 251 124 2680 107 21380 182 --
NM_203390chr851621 1525 1304 1163 591 21631 603 31759 1603 109 1338
NM_203394chr1241977 859 606 579 32736 2437 2146 12579 --
NM_203406chr5132726 2165 2120 2111 1057 820 803 618 605 517 380 326 212 32061 545 98 12959 --
NM_203458chr1113735 3603 3481 3231 3024 2898 1121 759 210 76 40 33811 3047 589 31159 1062 340 1931
NM_203459chr1182429 2154 2097 1993 1969 1912 1852 1710 1650 1053 1027 1006 1000 870 694 564 352 97 1446 22103 452 1844
NM_203463chr294919 4142 4024 3769 3445 3113 1109 1067 1011 33792 3471 191 31814 1368 407 13375
NM_205848chr162816 2671 2395 894 595 355 1973 ----
NM_206853chr6133942 3927 3428 3214 3122 3079 2668 1433 1215 1023 608 317 248 64096 2829 1653 1617 1406 1293 43795 3666 2626 726 13970
NM_206886chr1--1231 1185 --
NM_207015chr372295 2217 2018 1486 499 322 286 11605 1515 --
NM_207303chr10154025 4018 3936 3366 3236 2765 2632 2601 1472 1380 972 938 803 461 448 2892 175 34181 4151 81 --
NM_207311chr121367 ----11230
NM_207325chr1981851 1772 1603 1443 818 769 755 469 1556 --11365
NM_207352chr4102698 2526 2391 1881 1791 515 509 199 43 25 22618 1913 12719 --
NM_207362chr2----1108 --
NM_207372chr1042450 2374 2349 700 --22312 1939 --
NM_207406chr4146207 6084 5803 5429 5409 5235 5219 5057 4987 4652 4236 774 440 151 25797 1284 16505 --
NM_207413chr82185 99 1308 --1440
NM_207429chr1152556 2249 2217 773 749 --22121 363 --
NM_207517chr1542012 1937 1371 444 41951 1739 428 183 11772 11852
NM_212558chr9103742 3663 3605 1565 1364 1146 851 726 399 178 --53377 2953 2900 1615 1100 24111 4065
NM_213609chr32430 110 1874 --2677 292