TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-143-3p
miRNA Sequence: UGAGAUGAAGCACUGUAGCUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr532043 1843 705 1829 21321 355 --
NM_000043chr1021055 111 1156 ----
NM_000051chr1193500 2943 2160 1066 882 854 724 689 191 22303 522 21232 838 --
NM_000052chrX63012 2816 1371 1067 756 140 12212 ----
NM_000067chr82588 523 --1124 --
NM_000074chrX2935 794 ------
NM_000075chr123192 111 43 --182 --
NM_000080chr17131 ----1343
NM_000081chr141826 1663 1582 137 --11637 --
NM_000084chrX126494 6133 5162 4740 4349 2184 2175 1962 1844 1672 1630 1422 25837 5618 26176 5036 --
NM_000089chr73695 101 60 1619 1702 --
NM_000092chr2104326 3907 3360 3262 3110 1807 1551 1491 1144 93 41679 981 469 358 13956 24200 3711
NM_000097chr35846 781 363 233 215 21105 919 1328 --
NM_000103chr1541283 1149 168 34 ------
NM_000108chr761893 1855 1707 709 529 250 ------
NM_000109chrX3917 630 340 12669 --1673
NM_000110chr121059 1038 --11043 --
NM_000112chr555552 3812 3748 1248 62 24236 1209 --25015 4836
NM_000125chr673718 3676 3636 2932 2753 172 144 --21491 1227 --
NM_000126chr15--1109 ----
NM_000129chr661300 1101 540 359 304 281 ------
NM_000135chr161895 11012 ----
NM_000138chr1511889 22467 1871 --1551
NM_000139chr1172821 2417 2291 2276 2190 1059 239 1707 12639 --
NM_000142chr42607 191 ------
NM_000151chr1741846 1703 1207 328 ------
NM_000158chr31565 2662 623 --2681 230
NM_000163chr572273 2225 1889 1833 1497 1463 788 ----11869
NM_000167chrX2691 498 11284 ----
NM_000168chr783094 2645 2560 2201 2032 966 865 600 22602 207 --1114
NM_000176chr563836 3254 2786 663 562 114 12512 --12707
NM_000183chr21357 162 1324 --
NM_000188chr102280 189 ------
NM_000189chr23784 553 374 2677 149 2838 267 12298
NM_000192chr1221071 29 ----1116
NM_000208chr1954794 3245 1604 1176 134 1869 13945 1145
NM_000210chr222342 2198 ----11997
NM_000212chr1751991 1964 838 739 526 ------
NM_000214chr2021683 1456 1188 ----
NM_000216chrX53917 3486 2831 774 493 --33550 2670 285 13054
NM_000217chr1295304 4779 4338 4289 4065 3652 1918 978 431 --35202 3817 3590 11788
NM_000220chr114922 701 401 170 ------
NM_000222chr421636 1602 ----11357
NM_000230chr762639 940 932 656 315 67 11908 1714 --
NM_000231chr132615 430 ------
NM_000245chr732259 411 161 ------
NM_000248chr332330 918 601 1991 --12506
NM_000252chrX21143 58 21323 974 ----
NM_000259chr1555725 1912 539 199 35 26179 5708 24083 111 16216
NM_000264chr932259 1261 838 --23340 3070 22882 2588
NM_000266chrX2232 200 ------
NM_000267chr1733233 2522 779 13426 ----
NM_000276chrX51810 1413 853 588 571 1697 22230 1631 --
NM_000277chr121656 1280 1218 --
NM_000280chr114854 732 246 222 ------
NM_000284chrX21900 403 ----1494
NM_000288chr62346 332 ------
NM_000297chr441960 1502 807 718 --31947 1614 354 11858
NM_000304chr175718 429 394 376 172 ------
NM_000310chr141146 1076 176 123 --1484 1534
NM_000314chr102919 565 1748 13254 --
NM_000317chr111320 ------
NM_000321chr1321471 1104 11540 ----
NM_000325chr42620 198 ------
NM_000329chr11807 1651 ----
NM_000332chr6146653 6108 5798 5735 5690 5403 2198 2009 1989 1701 1480 1156 97 43 32754 1265 1186 36620 6509 731 --
NM_000337chr5105987 4838 4235 2644 2526 2209 1451 1377 382 269 31951 1514 1444 --14798
NM_000340chr351356 1146 603 321 93 --11134 --
NM_000346chr1731586 1469 1242 --11291 --
NM_000351chrX64339 2875 1620 1150 479 47 --21389 1297 --
NM_000362chr2262896 2442 1246 1230 1169 385 1466 1221 --
NM_000368chr924123 224 1885 11035 --
NM_000369chr1431810 1439 1293 31796 1682 360 31832 614 151 --
NM_000378chr111807 ------
NM_000393chr231930 1517 711 --11608 --
NM_000397chrX82096 1935 1666 978 797 680 478 220 1355 11789 --
NM_000408chr273076 1308 999 868 743 524 234 ----1732
NM_000421chr172319 64 ------
NM_000430chr1783428 3286 2904 2869 696 687 388 320 ------
NM_000435chr192744 382 --1301 --
NM_000436chr541558 1531 479 38 ----1209
NM_000439chr521715 218 1315 ----
NM_000444chrX1102 1334 ----
NM_000446chr731044 1003 221 ------
NM_000448chr1193021 2099 1274 1193 690 461 443 382 228 --11235 1825
NM_000449chr161401 1150 965 569 471 82 11113 ----
NM_000452chr1331768 470 316 ------
NM_000461chr352825 1189 594 483 188 22912 1422 21369 876 152
NM_000480chr1141640 1559 1185 1086 1449 11426 1396
NM_000484chr212978 198 ------
NM_000489chrX123302 3061 2937 2908 2618 2159 822 774 638 567 460 168 --13415 12831
NM_000493chr61381 ------
NM_000503chr851803 1761 1666 1509 471 ------
NM_000508chr44965 897 748 198 ------
NM_000509chr42167 44 1179 ----
NM_000522chr73945 909 896 --11098 --
NM_000523chr22400 148 --2864 747 --
NM_000530chr111136 ------
NM_000533chrX61965 1338 746 307 201 68 176 11909 --
NM_000538chr1351413 677 341 211 37 --11267 --
NM_000544chr6_cox_hap183300 3120 2177 1063 1027 832 423 39 22981 2086 --12237
NM_000555chrX217882 7122 7111 6923 6666 6114 5638 5510 5345 5262 5159 4889 3135 3017 2745 2403 2191 1377 1286 841 668 27232 2411 37848 7627 7143 --
NM_000573chr132175 472 29 ------
NM_000574chr141256 1246 106 67 11303 21153 496 --
NM_000582chr42423 395 ------
NM_000585chr41223 184 ----
NM_000598chr721526 196 --1506 --
NM_000599chr253480 1419 1242 954 877 ----33963 98 93
NM_000600chr7----1299 --
NM_000601chr71452 ------
NM_000602chr741451 614 309 24 --11233 1509
NM_000609chr1042990 2679 2306 189 --32069 1265 1237 --
NM_000610chr1192849 2766 2603 2437 2399 568 550 482 355 ----1802
NM_000612chr1153621 2915 2567 626 208 1836 ----
NM_000615chr1152545 2525 1929 1216 65 2949 128 22198 132 --
NM_000618chr12156524 6116 6110 6046 5896 4746 4324 4281 2554 2318 1903 1802 1308 1283 711 24239 1487 ----
NM_000618chr12156524 6116 6110 6046 5896 4746 4324 4281 2554 2318 1903 1802 1308 1283 711 24239 1487 ----
NM_000619chr121533 1460 ----
NM_000621chr1361429 1315 1078 968 448 133 1204 ----
NM_000627chr23887 371 195 ------
NM_000633chr18114865 4580 3461 2033 1739 1636 1563 1490 894 496 225 24527 1825 23269 1914 14811
NM_000651chr132175 472 29 ------
NM_000679chr5----1513 --
NM_000684chr1041161 523 302 108 ------
NM_000685chr31818 ------
NM_000685chr31818 ------
NM_000686chrX31417 1344 399 2530 249 ----
NM_000693chr152242 82 ----11519
NM_000702chr132254 1989 415 11483 --11853
NM_000719chr12116674 5991 5115 4667 2504 2485 2018 1906 1718 1422 1038 14101 56628 5465 5365 994 121 --
NM_000721chr132111 1969 1655 22428 499 --12258
NM_000726chr23991 123 27 ----21357 72
NM_000735chr61197 ------
NM_000756chr81431 ------
NM_000782chr2031275 170 126 1290 ----
NM_000783chr102543 395 --1168 --
NM_000788chr441336 1070 1033 522 ------
NM_000792chr16952 907 858 764 688 370 ------
NM_000800chr531614 1289 583 --11438 --
NM_000801chr204940 432 267 251 ------
NM_000806chr541280 717 334 134 21928 1472 ----
NM_000809chr4208807 8679 8247 8189 7843 7166 6849 6425 6258 6144 5736 5720 3578 3351 3190 3077 2697 2443 1417 781 28076 7437 27739 5760 --
NM_000813chr565164 3603 2143 631 422 341 1145 22052 367 --
NM_000814chr1584086 3513 3251 1124 863 724 347 33 32676 910 837 --13443
NM_000816chr52587 432 ----1498
NM_000817chr211128 196 ----
NM_000824chr43864 821 770 139 ----
NM_000826chr432333 1857 336 12194 1299 --
NM_000829chr1132224 1654 1467 1643 1731 --
NM_000831chr165669 4241 1699 1676 970 370 --14861 --
NM_000833chr1621119 24 --11353 --
NM_000838chr642184 2076 1871 1119 --1590 12048
NM_000857chr42484 147 ------
NM_000859chr521638 517 --1677 --
NM_000860chr461531 1486 654 473 336 68 1489 ----
NM_000864chr131116 980 28 ------
NM_000868chrX32446 2336 474 ----1338
NM_000870chr531312 994 354 11496 11146 --
NM_000872chr10133 ----1204
NM_000875chr15126549 6465 5986 5534 5504 5152 5117 2620 2208 1244 1200 507 34862 4451 2670 26001 4920 25132 2810
NM_000876chr631402 485 262 1288 1917 --
NM_000885chr262148 1778 1460 696 533 419 ----1409
NM_000891chr1722688 843 13291 13195 21095 685
NM_000899chr12103932 3829 3732 3661 3510 3119 1098 274 211 120 22802 941 --22941 1553
NM_000901chr41600 ------
NM_000902chr362511 1176 1066 696 573 538 --21273 215 --
NM_000908chr52775 129 ----1194
NM_000917chr102141 60 1334 ----
NM_000926chr11269286 9156 8863 8654 8477 8310 8226 7992 7946 7893 7655 7356 6202 5961 5724 3329 3085 2599 2593 2228 2220 2039 1959 1408 1343 904 --69407 9076 2279 1669 1396 1113 17863
NM_000933chr2031707 1686 173 11754 ----
NM_000935chr321228 1017 ------
NM_000944chr432360 1769 693 --12043 --
NM_000945chr221322 48 --1289 --
NM_000950chrX113551 3447 2972 2415 1309 757 735 726 510 183 31 12380 11439 --
NM_000956chr1431111 939 49 ----1979
NM_000962chr961123 773 493 234 153 91 11169 ----
NM_000964chr1741179 992 562 325 ------
NM_000965chr311145 1219 ----
NM_000983chr171459 1263 472 461 400 147 79 11503 ----
NM_001001132chr213576 497 173 ------
NM_001001323chr1243212 3192 2549 2328 --13036 22945 598
NM_001001331chr372747 2738 2705 2683 2309 2111 614 ------
NM_001001344chrX32487 749 478 ------
NM_001001349chr1731701 1055 501 140 ----
NM_001001389chr1192849 2766 2603 2437 2399 568 550 482 355 ----1802
NM_001001390chr1192849 2766 2603 2437 2399 568 550 482 355 ----1802
NM_001001391chr1192849 2766 2603 2437 2399 568 550 482 355 ----1802
NM_001001392chr11102895 2812 2649 2483 2445 614 596 528 401 63 ----1848
NM_001001395chr1262674 2587 2402 2196 698 50 --12769 1684
NM_001001396chr163439 3198 2731 1090 552 334 ------
NM_001001419chr554299 4165 1631 717 667 ------
NM_001001420chr554299 4165 1631 717 667 ------
NM_001001433chr2032187 1127 702 22349 1028 21975 480 --
NM_001001481chr853010 2985 2625 2487 940 12312 11084 --
NM_001001484chr1022335 1979 12189 1114 --
NM_001001521chr2------1218
NM_001001556chr1511074 1187 1399 --
NM_001001557chr832016 1445 478 --11595 1738
NM_001001664chr283932 3253 3073 2779 2567 468 277 218 34110 415 145 --1561
NM_001001668chr1932711 1296 1062 43571 3174 247 85 13178 --
NM_001001870chr172764 553 --1801 --
NM_001001890chr2183459 2810 2784 2697 1464 1223 1173 728 ------
NM_001001924chr871921 1769 1603 1289 804 597 282 21402 548 11480 --
NM_001001925chr871921 1769 1603 1289 804 597 282 21402 548 11480 --
NM_001001931chr871921 1769 1603 1289 804 597 282 21402 548 11480 --
NM_001001933chr13183 113 47 ------
NM_001001974chr1052354 1890 1632 362 230 1221 1910 12152
NM_001001977chr20134 ------
NM_001001995chrX51435 708 472 432 146 ------
NM_001002233chr862096 2077 1860 1846 1817 112 ------
NM_001002257chr273564 3462 3430 3115 2332 1246 1176 1492 ----
NM_001002814chr853910 3742 2982 1122 112 13328 23668 3156 13290
NM_001002838chrX2308 107 --11700 --
NM_001002843chr1541185 1097 1053 264 ------
NM_001002860chr14104594 4565 4336 4190 4081 3567 936 715 581 404 14703 ----
NM_001002901chr11457 ------
NM_001002909chr1782011 1989 1936 1714 658 628 507 286 1549 ----
NM_001002926chr732540 948 683 12288 ----
NM_001003407chr1021819 310 11432 13531 --
NM_001003408chr1021819 310 11432 13531 --
NM_001003652chr18188612 8038 7731 7696 7535 6840 5393 2988 2843 2779 2611 2376 2252 2220 1865 1630 1547 1497 26114 1514 ----
NM_001003674chr18116612 6241 5955 5907 5466 5376 5289 4590 4405 1710 869 --12644 26649 2433
NM_001003675chr18116612 6241 5955 5907 5466 5376 5289 4590 4405 1710 869 --12644 26649 2433
NM_001003688chr41795 ----11076
NM_001003694chr33564 518 484 --199 --
NM_001003698chr641281 671 575 333 ------
NM_001003699chr641281 671 575 333 ------
NM_001003712chr12113970 3641 3426 3168 2813 2768 1583 535 511 226 157 13349 12877 --
NM_001003760chr642388 1215 773 746 ----11165
NM_001003792chr32949 220 ------
NM_001003793chr32949 220 ------
NM_001003800chr963451 3362 2853 1112 756 294 --1683 --
NM_001003803chr142212 35 ------
NM_001003805chr142304 127 ------
NM_001003894chrY2168 80 ------
NM_001004019chr31392 1349 ----
NM_001004127chr13298 86 --1366 --
NM_001004303chr14770 685 623 201 ------
NM_001004303chr14770 685 623 201 ------
NM_001004304chr1232203 2109 201 ------
NM_001004317chr6104401 4242 3962 3844 3694 3033 2839 2809 2744 1041 --13226 24460 813
NM_001004330chr12--1373 11522 1569
NM_001004346chr41164 ------
NM_001004360chr231991 374 323 --1348 --
NM_001004419chr1274361 4107 3574 3420 710 547 537 23398 1470 11479 13406
NM_001004440chr1--2492 102 ----
NM_001004441chr531236 1145 23 21508 390 ----
NM_001005158chr31516 ------
NM_001005159chr31516 ------
NM_001005266chr152729 480 ------
NM_001005267chr152729 480 ------
NM_001005268chr152729 480 ------
NM_001005269chr152729 480 ------
NM_001005335chr19143 1305 1207 --
NM_001005336chr92592 182 ------
NM_001005340chr72619 148 ------
NM_001005366chr122797 58 1285 ----
NM_001005375chrY61336 706 699 538 345 235 1471 ----
NM_001005386chr222482 454 ------
NM_001005404chr1794512 4237 4094 3248 2842 1563 1484 1072 145 --21504 749 --
NM_001005463chr1072605 2563 1839 1772 1032 444 243 --1590 --
NM_001005473chr586668 6445 5893 5696 5343 4773 2323 2012 26368 5856 26410 195 --
NM_001005476chr22492 69 ------
NM_001005526chr21103 ------
NM_001005739chr22185 30 ------
NM_001005743chr14------11257
NM_001005744chr14------11257
NM_001005745chr14------11257
NM_001005746chr23991 123 27 ----21357 72
NM_001005747chr23991 123 27 ----21357 72
NM_001005753chr262340 2302 856 552 425 194 ----22163 891
NM_001005845chr831328 602 75 ----31794 1478 325
NM_001005849chr171438 --1132 --
NM_001005861chr32952 698 ------
NM_001006600chr542058 1841 1540 376 ------
NM_001006605chr141189 1001 893 220 ------
NM_001006605chr141189 1001 893 220 ------
NM_001006610chr163970 399 243 ------
NM_001006612chrX3135 126 61 1143 ----
NM_001006613chrX3135 126 61 1143 ----
NM_001006614chrX3135 126 61 1143 ----
NM_001006641chr941766 1157 1145 395 2340 69 ----
NM_001006642chr941766 1157 1145 395 2340 69 ----
NM_001006643chr941766 1157 1145 395 2340 69 ----
NM_001006657chr292646 2563 2340 2245 2069 2051 809 610 257 --22419 857 --
NM_001006681chrX1117 ------
NM_001006682chrX1117 ------
NM_001006683chrX1117 ------
NM_001006945chr11546 ------
NM_001007024chr1784364 3702 3133 1481 997 901 881 517 ----13955
NM_001007025chr1784364 3702 3133 1481 997 901 881 517 ----13955
NM_001007094chr1013820 54427 4406 4273 3401 1050 --13092
NM_001007097chr975094 5020 4986 4387 3693 533 114 21749 944 35127 4127 3534 13444
NM_001007102chr651559 1286 666 472 242 --1212 --
NM_001007156chr1521865 304 --21832 1668 --
NM_001007214chr12223 144 ------
NM_001007237chr152603 2474 2100 2026 296 ------
NM_001007246chr2141692 1679 1270 355 --11587 --
NM_001007257chr121057 427 11180 ----
NM_001007267chr22226 129 ------
NM_001007277chr1111037 ------
NM_001007278chr1374847 4620 3981 3920 3690 2116 2101 13404 14809 13989
NM_001007527chr5----1214 1733
NM_001007538chr1361886 1855 1689 160 146 120 --21785 390 --
NM_001007553chr151161 1110 496 333 75 ------
NM_001007559chr184813 733 634 209 ------
NM_001008220chr543063 1373 669 557 ----11011
NM_001008222chrX11401 --1882 --
NM_001008225chr72744 483 ------
NM_001008239chr1833363 3067 2917 2718 431 23076 2525 --
NM_001008392chr342463 1334 682 463 ------
NM_001008401chr1921479 1225 ----11167
NM_001008408chr796356 5596 5503 5447 5087 2558 1840 665 414 14394 21804 1424 --
NM_001008491chr241534 585 573 375 11281 11422 --
NM_001008492chr241534 585 573 375 11281 11422 --
NM_001008495chr862195 1565 1469 1399 357 161 --21721 1650 --
NM_001008541chr1021734 943 ----1570
NM_001008541chr1021734 943 ----1570
NM_001008564chr1351854 1726 617 437 168 22084 785 11932 --
NM_001008567chr9----1100 135
NM_001008660chr1141436 1402 1185 435 ------
NM_001008701chr1932501 1893 1176 ------
NM_001008726chr143624 569 413 --11450 --
NM_001008756chr362294 2029 1748 1740 986 230 --1103 --
NM_001008895chr1331319 1107 75 --21298 144 --
NM_001008925chr452921 2405 1094 952 267 13040 33105 1325 525 --
NM_001009183chr142128 29 1156 ----
NM_001009552chr82609 508 ------
NM_001009554chr494281 4122 3902 3457 3435 3146 2971 1785 1288 34487 3935 3396 23169 1414 --
NM_001009554chr494281 4122 3902 3457 3435 3146 2971 1785 1288 34487 3935 3396 23169 1414 --
NM_001009555chr431591 442 359 11672 11435 --
NM_001009899chr3156389 5878 5871 5403 4402 4389 2370 2175 1826 1027 918 607 242 188 128 14285 24477 295 --
NM_001009959chr242572 1791 966 219 22140 885 ----
NM_001010853chr683298 3059 2958 2852 2796 2753 316 288 1701 22981 1003 --
NM_001010861chr132587 2483 1798 22715 509 ----
NM_001010867chr1106660 6467 6061 5967 5686 4222 1954 1723 895 616 --16679 --
NM_001010888chrX124218 3909 3834 3809 3522 3087 2811 1697 1070 1013 476 123 11120 ----
NM_001010923chr621666 1322 11093 11316 --
NM_001010927chr62453 37 ------
NM_001010932chr71452 ------
NM_001010983chr3130 ------
NM_001010986chrX52474 2376 2132 699 390 ----2415 43
NM_001011513chr484000 3636 2773 2701 2650 2631 636 446 --23946 928 1277
NM_001011515chr43712 406 46 ------
NM_001011516chr43712 406 46 ------
NM_001011537chr352357 1990 1883 678 245 ------
NM_001011546chr203809 654 318 --2554 116 --
NM_001011553chr74958 722 656 617 --1818 --
NM_001011663chr102704 294 2332 59 1387 --
NM_001011666chr7136524 4807 4355 4334 4210 4177 2406 2271 2054 652 617 562 127 34251 1764 430 24437 1824 --
NM_001011708chr242790 2759 2514 1949 12097 12241 12922
NM_001011713chr1431418 302 262 1391 21035 607 --
NM_001011720chr851377 1169 1152 230 171 1558 ----
NM_001011885chr1551723 1575 1443 1157 224 --1462 --
NM_001012264chr14152 1722 ----
NM_001012267chr911506 11778 21974 427 --
NM_001012279chr6------1156
NM_001012393chr11134345 4134 4117 3908 1067 1056 1028 1011 872 595 504 447 351 --14336 1858
NM_001012398chr164800 439 301 215 ------
NM_001012410chr34478 397 354 318 ------
NM_001012418chr694291 4207 3095 1449 1340 638 528 345 270 11141 21697 1238 14080
NM_001012420chr1582662 2649 2514 690 578 149 92 83 ------
NM_001012423chr1562662 2649 2514 690 578 83 ------
NM_001012456chr7------130
NM_001012751chr102606 430 ------
NM_001012755chrX64683 3402 3169 804 727 714 14605 45046 4424 4383 3177 --
NM_001012968chrX81927 1818 1763 1044 652 638 484 403 --11076 --
NM_001012974chr6137 130 ----
NM_001012980chrX126 ------
NM_001012989chrX1120 --1266 --
NM_001013031chr1033131 2382 2168 13510 1478 --
NM_001013398chr721526 196 --1506 --
NM_001013399chr611007 1251 ----
NM_001013406chr721490 1220 1364 ----
NM_001013415chr421037 474 ------
NM_001013437chr182409 79 --156 --
NM_001013438chr32705 63 ------
NM_001013615chr111034 --2815 140 --
NM_001013620chr12128397 7998 7421 7407 7319 6937 6553 6246 5690 3133 2055 51 47628 5414 513 244 22276 1548 15753
NM_001013659chr1964347 3633 2054 1550 470 376 35447 4517 3800 ----
NM_001013690chr1242426 2416 1787 247 21751 1683 12458 --
NM_001014797chr10128223 8154 7453 7194 6947 6176 2819 2548 2033 1630 987 330 27788 5148 28035 3079 --
NM_001014831chr191655 ------
NM_001014832chr191655 ------
NM_001014834chr191655 ------
NM_001014835chr191655 ------
NM_001014972chr2172 ------
NM_001015045chr432374 700 332 --1632 --
NM_001015508chr8----1143 --
NM_001015877chrX52316 1170 1118 992 548 12855 12244 22673 2386
NM_001015880chr1031263 600 388 1235 ----
NM_001015881chrX31017 789 379 --1367 189
NM_001015882chr93902 852 734 ------
NM_001015887chr351860 1840 1832 1155 439 11657 1617 --
NM_001017371chr241307 1068 509 346 ------
NM_001017395chr332768 1363 218 ------
NM_001017396chr221417 595 1816 ----
NM_001017415chr12183 88 ------
NM_001017416chr12183 88 ------
NM_001017423chr101254 --1512 162
NM_001017424chr131854 483 138 --11320 --
NM_001017425chr131854 483 138 --11320 --
NM_001017440chr7128144 7956 6010 5823 5771 5739 5698 5580 2645 1198 1011 793 26344 1054 3313 307 179 15015
NM_001017523chr1241882 1627 766 504 ------
NM_001017923chr141330 11143 ----
NM_001017926chr811337 --11736 --
NM_001017928chr3------156
NM_001017962chr102141 60 1334 ----
NM_001017969chr9--1212 ----
NM_001017979chr42558 94 ------
NM_001017992chr541457 1102 966 132 ----1305
NM_001017999chr152091 2018 1833 795 255 ----12161
NM_001017999chr152091 2018 1833 795 255 ----12161
NM_001018000chr152091 2018 1833 795 255 ----12161
NM_001018000chr152091 2018 1833 795 255 ----12161
NM_001018001chr152091 2018 1833 795 255 ----12161
NM_001018003chr81273 --1219 --
NM_001018004chr151202 ------
NM_001018006chr151202 ------
NM_001018007chr151202 ------
NM_001018008chr151677 ------
NM_001018009chr331119 1053 76 ------
NM_001018020chr151202 ------
NM_001018053chr151899 1490 666 591 546 --21919 254 --
NM_001018054chr131253 1219 336 ------
NM_001018064chr951833 630 280 225 66 --1207 11878
NM_001018065chr9125979 5163 4924 4892 4650 3797 1281 814 569 240 119 94 45867 5424 3789 2175 11612 --
NM_001018066chr9125979 5163 4924 4892 4650 3797 1281 814 569 240 119 94 45867 5424 3789 2175 11612 --
NM_001018067chr1105147 4622 3407 1507 1491 1434 553 359 302 144 1781 33505 1855 1243 --
NM_001018068chr1105147 4622 3407 1507 1491 1434 553 359 302 144 1781 33505 1855 1243 --
NM_001018069chr1105147 4622 3407 1507 1491 1434 553 359 302 144 1781 33505 1855 1243 --
NM_001018072chr1241882 1627 766 504 ------
NM_001018074chr563836 3254 2786 663 562 114 12512 --12707
NM_001018075chr563836 3254 2786 663 562 114 12512 --12707
NM_001018076chr563836 3254 2786 663 562 114 12512 --12707
NM_001018077chr563836 3254 2786 663 562 114 12512 --12707
NM_001018111chr753608 2895 1564 927 583 43259 1457 1157 834 12517 11257
NM_001018159chr161127 ------
NM_001018160chr161127 ------
NM_001020658chr141527 1222 454 407 ------
NM_001020658chr141527 1222 454 407 ------
NM_001020825chr521311 261 ----1182
NM_001023567chr1572463 2388 2044 1754 693 92 83 11584 --2440 234
NM_001023587chr311157 1108 ----
NM_001024024chr144789 753 739 260 ------
NM_001024094chr563836 3254 2786 663 562 114 12512 --12707
NM_001024218chr141123 --1327 --
NM_001024226chr111038 --11145 --
NM_001024227chr111038 --11145 --
NM_001024228chr111038 --11145 --
NM_001024380chr832227 2050 600 --160 11643
NM_001024381chr832227 2050 600 --160 11643
NM_001024596chr1963581 3305 3199 2903 2445 694 --12755 12797
NM_001024649chr541866 1115 498 282 ----12433
NM_001024660chr311371 11341 11709 192
NM_001024680chr231292 480 91 --11834 1571
NM_001024808chr1231983 1915 762 ----12856
NM_001024809chr1741179 992 562 325 ------
NM_001024934chr62695 195 1168 ----
NM_001024935chr62695 195 1168 ----
NM_001024936chr62695 195 1168 ----
NM_001024937chr172486 479 ------
NM_001024947chr531002 155 145 ----1847
NM_001024948chr143472 2340 513 507 --1743 --
NM_001025068chr311596 ------
NM_001025069chr311596 ------
NM_001025076chr1095959 4672 4516 1947 1673 996 218 51 31 22045 99 35885 5352 4914 --
NM_001025077chr10147317 6030 5874 4610 3031 2354 1576 1409 1118 1098 857 345 299 31 11457 37243 6710 6272 --
NM_001025079chr374039 3369 2618 2562 1307 1169 555 23554 3102 ----
NM_001025105chr531473 1361 1084 --11404 1375
NM_001025107chr1102379 2214 2109 1777 1689 1029 424 333 298 247 --1945 --
NM_001025107chr1102379 2214 2109 1777 1689 1029 424 333 298 247 --1945 --
NM_001025108chr274116 3878 3663 2565 1318 874 116 --11382 --
NM_001025205chr31422 ------
NM_001025252chr832801 1046 62 23103 694 ----
NM_001025253chr832801 1046 62 23103 694 ----
NM_001025356chr1263028 2668 2050 684 581 123 22697 601 52324 2121 424 391 339 --
NM_001025366chr631735 1444 399 ------
NM_001025366chr631735 1444 399 ------
NM_001025367chr631735 1444 399 ------
NM_001025367chr631735 1444 399 ------
NM_001025368chr631735 1444 399 ------
NM_001025368chr631735 1444 399 ------
NM_001025369chr631751 1460 415 ------
NM_001025369chr631751 1460 415 ------
NM_001025370chr631735 1444 399 ------
NM_001025370chr631735 1444 399 ------
NM_001025389chr1141640 1559 1185 1086 1449 11426 1396
NM_001025390chr1141640 1559 1185 1086 1449 11426 1396
NM_001025580chrX114311 3409 3392 3355 3078 2937 1488 1371 700 452 82 ------
NM_001025595chr431627 436 422 --31382 1084 633 --
NM_001025603chr161401 1150 965 569 471 82 11113 ----
NM_001029858chr632300 2115 798 --32364 2290 60 --
NM_001029859chr1162417 2410 2293 814 326 71 --11982 --
NM_001029860chr82324 44 1296 ----
NM_001029863chr621092 743 22572 2317 12170 --
NM_001029875chr592953 2734 1940 1887 1182 1159 959 538 130 12547 --11961
NM_001030006chr173937 664 568 ----22056 340
NM_001030007chr1663803 3153 2936 2911 2784 463 12531 --11040
NM_001030055chr14114609 4257 3851 3834 3648 2918 1612 1583 1386 1358 557 24101 3223 2707 571 --
NM_001030272chr11--1128 --1335
NM_001030273chr11--1128 --1335
NM_001031623chr6----11323 11726
NM_001031665chr191389 ------
NM_001031677chr51401 ------
NM_001031679chr1273421 2763 2423 2313 784 512 70 32786 2378 952 ----
NM_001031684chr211450 21281 427 ----
NM_001031685chr11312 1675 ----
NM_001031689chr91121 ------
NM_001031690chr783066 2824 2695 2500 1996 879 585 373 22451 421 11937 12110
NM_001031695chr2244675 4619 1560 285 --21218 784 1642
NM_001031700chr462006 1702 1601 993 805 605 12351 ----
NM_001031710chr711094 --21017 961 --
NM_001031712chr62363 157 ------
NM_001031716chr21787 1272 11141 --
NM_001031722chr62134 22 ------
NM_001031723chr41346 ------
NM_001031732chr453578 3562 3184 2258 783 --12838 --
NM_001031804chr1643454 2877 591 473 --13261 23802 883
NM_001031812chr52140 45 --170 --
NM_001032280chr631575 1126 682 ------
NM_001032281chr2121 ------
NM_001032282chr81484 --2469 204 --
NM_001032283chr1231094 882 284 1276 ----
NM_001032284chr1231094 882 284 1276 ----
NM_001032288chr2031128 144 62 ------
NM_001032296chr1352220 1830 858 449 226 12339 1961 --
NM_001032380chr1031955 149 84 21696 1357 ----
NM_001032394chr662729 2031 1085 624 532 485 1638 ----
NM_001032395chr662596 1898 952 491 399 352 1505 ----
NM_001032999chr20105252 4178 4055 1710 1177 1060 955 715 455 322 23311 1907 44770 919 899 849 --
NM_001033045chr2114149 3891 3167 2840 2824 1176 1155 1100 868 861 458 44377 4087 2885 627 44094 1737 1624 719 --
NM_001033047chr492583 2355 2199 2085 1931 1858 1680 1619 576 12020 22454 62 --
NM_001033057chr341847 848 832 360 --11782 --
NM_001033059chr62590 148 ------
NM_001033087chr2083231 2891 2289 2113 2104 973 235 161 ------
NM_001033088chr15----1337 --
NM_001033117chr353352 1160 1059 542 487 34269 1957 1892 ----
NM_001033507chr11160 --11698 --
NM_001033518chr742510 1866 1760 178 12295 --11019
NM_001033519chr742510 1866 1760 178 12295 --11019
NM_001033520chr742510 1866 1760 178 12295 --11019
NM_001033557chr211241 ----1941
NM_001033561chr17--1223 ----
NM_001033564chr631480 1292 59 --2354 245 --
NM_001033578chr852068 873 707 580 104 1173 11860 --
NM_001033602chr1352304 1871 1799 493 403 1848 1799 --
NM_001033659chr1731366 240 155 1322 ----
NM_001033723chr862409 1862 1849 1796 942 549 ------
NM_001033756chr631669 1378 333 ------
NM_001033756chr631669 1378 333 ------
NM_001033925chr1021862 330 1701 ----
NM_001034837chr52702 594 --1260 --
NM_001034838chr52702 594 --1260 --
NM_001034841chr1685508 4924 4708 4361 3788 1485 701 187 34789 3995 1232 23632 3626 --
NM_001034845chr431366 298 90 ------
NM_001034850chr531554 1313 664 ------
NM_001034852chr1431996 1404 173 --11615 11790
NM_001034954chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_001034955chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_001034956chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_001034957chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_001035chr121257 519 ------
NM_001035003chr42567 353 ----21168 228
NM_001035004chr42567 353 ----21168 228
NM_001035260chr1061570 1372 1143 1106 1037 219 1580 ----
NM_001035505chr2142 ------
NM_001035511chr11645 1800 12045 --
NM_001035512chr12752 54 1907 32152 75 26 --
NM_001035513chr12752 54 1907 32152 75 26 --
NM_001037131chr23931 436 402 11310 ----
NM_001037132chr752062 1898 1458 741 30 --1692 --
NM_001037133chr752062 1898 1458 741 30 --1692 --
NM_001037164chr742007 1303 1292 347 ------
NM_001037165chr788886 8865 7414 6681 5613 2751 1039 321 26123 5649 27382 6313 18724
NM_001037174chr222251 1808 ------
NM_001037317chr132587 2483 1798 22715 509 ----
NM_001037332chr572563 2557 1945 911 361 180 26 1742 32194 516 478 --
NM_001037333chr572563 2557 1945 911 361 180 26 1742 32194 516 478 --
NM_001037334chr1871894 895 435 310 295 186 114 11569 158 22432 2305
NM_001037339chr121791 359 ------
NM_001037340chr121791 359 ------
NM_001037341chr121791 359 ------
NM_001037341chr121791 359 ------
NM_001037553chr2185128 4462 4038 1931 1163 353 266 209 --34032 1448 1411 --
NM_001037872chr21135 1473 ----
NM_001037954chr11122968 2942 2772 2654 2284 2144 1397 929 888 747 333 215 22606 1362 21344 1112 1980
NM_001038640chr152760 159 --2144 83 --
NM_001038702chr582485 2221 810 568 500 397 351 114 12244 --1817
NM_001038707chr13817 569 29 1918 ----
NM_001038707chr13817 569 29 1918 ----
NM_001039091chrX51336 1188 1096 565 250 11402 1171 --
NM_001039111chr31321 --1183 --
NM_001039395chr922246 292 12136 --12354
NM_001039459chr731137 814 175 --1749 --
NM_001039538chr233611 2897 1301 ----21153 362
NM_001039550chr22298 84 --1246 --
NM_001039577chr173678 1483 1202 847 510 428 54 ------
NM_001039580chr454932 1140 988 605 351 21539 683 24379 3537 21181 841
NM_001039590chrX22638 142 ------
NM_001039591chrX22638 142 ------
NM_001039618chr11165599 5483 5388 4518 4177 4126 3988 2342 2186 1688 1535 1405 991 773 302 82 2356 98 25773 2089 25006 4184
NM_001039690chr1641707 1473 207 192 ------
NM_001039693chr2114146 4037 3847 3831 3638 3149 2856 2575 1331 1277 451 23264 2671 12695 --
NM_001039709chr20105252 4178 4055 1710 1177 1060 955 715 455 322 23311 1907 44770 919 899 849 --
NM_001039715chr16952 907 858 764 688 370 ------
NM_001039716chr161016 971 922 828 752 434 ------
NM_001039762chr104786 678 449 436 21980 608 1649 12209
NM_001039840chrX85916 5882 5052 3849 1016 853 359 167 21958 922 35564 1522 39 66060 3996 2301 1502 1459 806
NM_001039888chr11689 ----1236
NM_001039916chr124947 932 773 112 --1970 --
NM_001039917chr124947 932 773 112 --1970 --
NM_001039918chr124947 932 773 112 --1970 --
NM_001039919chr124947 932 773 112 --1970 --
NM_001039920chr124947 932 773 112 --1970 --
NM_001039937chr13113831 3332 2789 2720 2568 1090 744 569 172 150 84 --12714 --
NM_001040001chr662046 1925 1831 1547 343 233 1628 ----
NM_001040020chr73427 223 103 11172 ----
NM_001040056chr161185 --1123 1572
NM_001040057chr741345 1339 511 337 ------
NM_001040058chr42423 395 ------
NM_001040060chr42423 395 ------
NM_001040097chr71159 ------
NM_001040098chr71159 ------
NM_001040099chr71159 ------
NM_001040101chr461573 1170 629 436 242 104 31595 192 66 ----
NM_001040142chr221566 519 11759 12346 --
NM_001040143chr221566 519 11759 12346 --
NM_001040144chr1641707 1473 207 192 ------
NM_001040146chr1641707 1473 207 192 ------
NM_001040152chr754486 1747 1388 414 317 34383 1831 1135 33173 92 60 --
NM_001040153chr132699 363 ------
NM_001040157chr442400 2201 1140 418 ------
NM_001040158chr52119 103 ------
NM_001040159chr45458 444 179 73 35 ------
NM_001040172chr531312 994 354 11496 11146 --
NM_001040173chr531312 994 354 11496 11146 --
NM_001040181chr321022 204 ------
NM_001040182chr321022 204 ------
NM_001040183chr321022 204 ------
NM_001040199chr321022 204 ------
NM_001040200chr321022 204 ------
NM_001040202chr472474 2459 2408 2057 1729 656 295 12009 --21854 359
NM_001040214chr632147 434 248 172 1813 --
NM_001040260chr42900 273 1908 11096 --
NM_001040261chr42900 273 1908 11096 --
NM_001040272chr952133 2015 1567 935 85 ------
NM_001040273chr1032088 2081 817 1659 1311 --
NM_001040280chr641062 596 400 389 ------
NM_001040284chr16125972 5891 5758 4777 4149 3981 3849 1571 1494 961 893 265 15190 85658 5142 4937 4636 4134 3938 1098 852 1640
NM_001040402chr442534 1973 537 354 1413 1622 --
NM_001040409chr24847 645 366 331 ------
NM_001040429chr1373616 3382 2878 2777 904 642 551 1655 ----
NM_001040441chr184876 4565 3432 1743 1394 1181 760 59 21910 1056 24049 888 --
NM_001040446chr512449 22725 416 --11765
NM_001040450chr1552923 2242 1094 967 587 ------
NM_001040453chr1552923 2242 1094 967 587 ------
NM_001040455chr1121332 1313 1347 ----
NM_001040458chr531317 276 122 --132 --
NM_001040653chr352533 2516 828 725 194 1692 1788 --
NM_001040665chr784852 4799 3490 1913 1747 1014 763 700 --14467 --
NM_001040708chr831070 727 162 ------
NM_001040709chr141992 1879 907 490 --11629 --
NM_001040712chr963101 2752 1033 702 669 622 1311 1544 --
NM_001040876chr42731 537 1241 --11558
NM_001042355chr1685195 5182 4876 3278 2017 1556 1422 394 157 11407 14638
NM_001042361chr1051508 1479 978 592 196 ------
NM_001042364chr1051508 1479 978 592 196 ------
NM_001042365chr1051508 1479 978 592 196 ------
NM_001042387chr1051508 1479 978 592 196 ------
NM_001042393chr1051508 1479 978 592 196 ------
NM_001042396chr1051508 1479 978 592 196 ------
NM_001042397chr1051508 1479 978 592 196 ------
NM_001042403chr124807 407 315 80 1954 ----
NM_001042404chr13787 409 355 ------
NM_001042412chr1685195 5182 4876 3278 2017 1556 1422 394 157 11407 14638
NM_001042414chr133294 201 72 ------
NM_001042424chr442832 820 532 392 11100 ----
NM_001042425chr631575 1126 682 ------
NM_001042453chrX31550 1277 166 ------
NM_001042459chr32262 248 ------
NM_001042473chr1052126 2003 777 318 294 ------
NM_001042476chr1642189 1409 727 130 1766 ----
NM_001042481chr1472452 2063 1994 1951 958 692 308 11912 ----
NM_001042486chr2011464 ------
NM_001042492chr1733233 2522 779 13426 ----
NM_001042493chr621662 729 ----1181
NM_001042510chr83536 289 131 11818 1587 --
NM_001042511chr83536 289 131 11818 1587 --
NM_001042517chr132932 338 ------
NM_001042533chr373305 3018 2974 2645 2072 2052 281 ----12463
NM_001042537chrX52465 2219 2050 1898 913 ------
NM_001042555chr1274430 3557 1001 843 667 137 69 13330 23030 76 1656
NM_001042599chr2137380 7293 6461 2725 2173 2159 1962 1768 1632 1522 1289 854 654 --46812 6407 5624 221 36920 6895 5927
NM_001042601chr343142 3121 2073 1997 23073 718 12181 --
NM_001042603chr1285194 4695 4534 4401 3967 2063 666 644 --14894 --
NM_001042604chr3124661 4514 4454 3656 3649 3158 1868 1568 1479 1472 654 130 14059 ----
NM_001042632chr2032243 2184 115 ------
NM_001042633chr2032243 2184 115 ------
NM_001042681chr141883 1866 1778 1062 --12152 --
NM_001042682chr141883 1866 1778 1062 --12152 --
NM_001042682chr141883 1866 1778 1062 --12152 --
NM_001042683chr62710 589 ------
NM_001042724chr193818 775 716 230 23 --1212
NM_001042749chrX41981 1286 585 36 --11369 --
NM_001042750chrX41981 1286 585 36 --11369 --
NM_001042751chrX41981 1286 585 36 --11369 --
NM_001042762chr741025 985 250 27 --1335 --
NM_001043318chr1473775 3345 3279 2575 1660 1551 882 23266 540 ----
NM_001043351chr132091 1737 705 21830 896 --1848
NM_001044305chr631545 613 193 ------
NM_001044385chr263787 3682 3143 829 403 128 --22866 2738 32710 2624 204
NM_001044722chr52140 45 --170 --
NM_001044723chr52140 45 --170 --
NM_001046chr542899 1889 921 807 1199 ----
NM_001048183chr153178 3145 2572 1109 837 21447 152 13523 13531
NM_001071775chr1371618 1540 1330 735 642 562 397 1206 ----
NM_001077628chr13652 199 69 ------
NM_001079874chr141968 1728 1529 105 11902 11415 --
NM_001083620chr432331 1855 335 12192 1298 --
NM_001083621chr133233 1168 1058 21332 106 54153 3580 1713 795 620 --
NM_001094chr172760 703 1261 ----
NM_001099678chr3126105 5570 5552 5397 5198 4846 4643 2395 1518 1060 150 92 35453 5013 3930 12208 1100
NM_001100108chr1117849 6965 6792 6163 5363 5330 5069 3042 1846 1337 35 27957 5687 56355 5142 5105 2148 1712 37658 1297 162
NM_001106chr3179776 9566 8373 7825 7682 7547 7016 6789 6711 6481 3298 3134 2540 1762 1741 1599 384 18846 --28086 356
NM_001111chr1102379 2214 2109 1777 1689 1029 424 333 298 247 --1945 --
NM_001113490chrX63016 2384 1196 962 339 51 ----23239 620
NM_001116chr1673041 2887 2414 2159 1199 362 167 ----1125
NM_001121chr1041883 1661 535 175 --1169 --
NM_001122631chr113593 443 239 ------
NM_001123chr103333 276 90 1255 --1176
NM_001126chr15997 874 804 216 68 ------
NM_001128chr1663803 3153 2936 2911 2784 463 12531 --11040
NM_001144chr162530 192 ------
NM_001148chr472121 1978 1766 1685 1596 280 136 ------
NM_001149chr1041223 929 907 314 --1226 1296
NM_001152chrX1169 ------
NM_001153chr22626 60 2578 202 --187
NM_001159chr23744 202 63 ------
NM_001167chrX105915 5232 4730 4621 4496 4130 1825 1111 846 322 --25722 1362 --
NM_001173chr14114609 4257 3851 3834 3648 2918 1612 1583 1386 1358 557 24101 3223 2707 571 --
NM_001177chr1252356 1932 576 563 402 11688 11733 --
NM_001178chr11--1128 --1335
NM_001186chr2143214 1176 974 889 ----1841
NM_001199chr81229 ------
NM_001200chr2031110 961 908 11162 ----
NM_001201chr493936 3215 2481 2407 1470 1367 1351 1202 358 11386 1793 2789 364
NM_001204chr2277590 6904 6657 6607 6430 6283 5861 5787 5642 5557 5165 2597 2500 2274 2085 1849 1372 1320 1168 1058 936 889 766 606 485 472 44 25103 809 37129 4932 1730 26444 5924
NM_001206chr942779 2719 639 241 --12195 --
NM_001215chr11383 ------
NM_001222chr1031455 1442 763 ------
NM_001227chr1041262 1051 884 200 ------
NM_001233chr741967 785 612 321 21894 1668 186 --
NM_001237chr42938 408 --193 --
NM_001237chr42938 408 --193 --
NM_001241chr222466 673 --1280 --
NM_001241chr222466 673 --1280 --
NM_001256chr1752132 1956 1864 545 315 --2672 432 --
NM_001257chr162184 172 ------
NM_001259chr7145392 5279 4777 4575 4391 4102 2539 2284 1647 1125 1116 1064 613 209 24567 4192 34503 2472 800 --
NM_001260chr131111 ------
NM_001262chr12246 76 ------
NM_001268chr133718 250 37 21050 932 ----
NM_001270chr5----1452 --
NM_001271chr1553075 2454 2191 1103 80 1704 1663 --
NM_001273chr122448 112 ------
NM_001280chr19----1121 --
NM_001282chr173937 664 568 ----22056 340
NM_001283chr71706 ------
NM_001290chr41278 ------
NM_001300chr10----1444 --
NM_001304chr1782975 2944 2783 2367 2336 1457 1131 21 11360 22730 1265 23672 2606
NM_001310chr1283001 2795 2779 2660 2333 2088 1237 589 1801 1116 --
NM_001316chr201118 1462 ----
NM_001331chr1162200 1758 1743 1097 781 667 --32161 1143 629 --
NM_001332chr531074 575 59 --11086 --
NM_001333chr92243 58 ------
NM_001343chr531240 649 123 --1690 11733
NM_001351chr34603 531 249 147 1372 ----
NM_001356chrX32241 866 293 ------
NM_001364chr1164298 4281 3201 3152 1917 445 --24205 3336 11849
NM_001378chr22193 173 ------
NM_001380chr103998 113 45 ------
NM_001385chr82426 320 --1277 --
NM_001390chr1853372 3043 2807 2759 2395 --23180 975 --
NM_001391chr183428 226 200 --11014 --
NM_001396chr2142309 564 331 204 22338 875 12226 --
NM_001400chr141333 1048 350 308 ----1967
NM_001401chr931524 532 370 --21329 204 --
NM_001406chr1771349 530 505 463 421 396 91 --1145 --
NM_001408chr141446 1332 324 244 --11285 --
NM_001412chrX113536 3499 3397 2939 2830 2594 2557 684 330 176 29 ------
NM_001416chr173339 105 98 ------
NM_001417chr123699 444 104 ------
NM_001419chr1984227 3823 3611 1703 1612 1335 1035 82 13471 ----
NM_001421chrX11527 2342 94 11259 --
NM_001422chr11284 25 2967 138 ----
NM_001423chr1231907 1577 1539 21830 1455 ----
NM_001427chr721580 153 1395 11443 --
NM_001429chr221442 ------
NM_001431chr61978 1874 ----
NM_001438chr143302 1446 512 227 12905 22278 203 12976
NM_001440chr841981 815 771 161 --1558 --
NM_001447chr521438 235 ------
NM_001448chrX51146 662 525 499 457 21699 1344 1316 --
NM_001449chrX21284 301 1972 11256 --
NM_001457chr32425 66 1314 ----
NM_001460chr192429 2216 1130 918 783 658 221 108 50 ----23190 968
NM_001466chr17--1108 ----
NM_001482chr152827 818 1683 1114 2693 639
NM_001483chr74916 776 345 34 --1305 --
NM_001489chr91109 ------
NM_001490chr9123345 3101 2962 2866 2704 2251 1448 1302 1088 711 200 56 22272 1352 12276 2685 561
NM_001494chr102650 554 1660 ----
NM_001497chr942419 1843 661 89 11869 ----
NM_001527chr6104742 3957 3761 3581 1807 510 347 319 307 89 23273 3263 23201 405 13888
NM_001530chr1441161 733 254 207 ------
NM_001533chr19143 1305 1207 --
NM_001542chr152603 2474 2100 2026 296 ------
NM_001543chr554241 4214 3356 1663 446 1573 34652 4037 3420 --
NM_001546chr631116 263 238 1529 ----
NM_001552chr1731035 986 787 ------
NM_001554chr11251 ------
NM_001558chr1141701 1559 715 484 11608 --11372
NM_001560chrX62557 2448 1758 1744 377 68 ------
NM_001584chr11----11095 --
NM_001587chrX51810 1413 853 588 571 1697 22230 1631 --
NM_001604chr114854 732 246 222 ------
NM_001616chr273251 3236 2974 2565 1179 988 760 1854 1821 1404
NM_001617chr23457 419 63 11013 ----
NM_001621chr752655 2333 2247 946 541 32415 1061 255 --1467
NM_001621chr752655 2333 2247 946 541 32415 1061 255 --1467
NM_001634chr62590 148 ------
NM_001635chr741045 921 814 392 --1991 --
NM_001650chr1864119 3939 3676 3006 947 252 13714 11240 21383 600
NM_001655chr1141600 1517 1474 806 31592 1421 1399 11918 --
NM_001656chr532082 1773 745 181 ----
NM_001658chr111038 --11145 --
NM_001659chr1272488 2131 1977 1813 1011 898 582 --21994 782 --
NM_001663chr1442603 2555 479 377 ------
NM_001664chr33716 361 87 1789 1127 --
NM_001668chr121834 875 ------
NM_001677chr12710 366 ------
NM_001679chr3151 ------
NM_001681chr123645 525 290 ------
NM_001682chr1242926 2906 2263 2042 --12750 22659 312
NM_001683chr372747 2738 2705 2683 2309 2111 614 ------
NM_001688chr11311 ------
NM_001690chr321825 219 --1320 179
NM_001693chr821159 1009 ------
NM_001695chr873707 1696 1651 1270 901 833 447 43836 3216 1062 151 ----
NM_001701chr951338 477 470 424 218 ----11227
NM_001704chr62512 75 ------
NM_001709chr1142282 2185 194 47 22091 2013 ----
NM_001714chr122572 488 --1358 --
NM_001717chr1521169 90 ------
NM_001720chr131732 632 40 --1867 --
NM_001721chrX162 ------
NM_001723chr62347 209 --1313 --
NM_001729chr4156 ------
NM_001730chr1341300 1074 329 186 1265 11540 1245
NM_001730chr1341300 1074 329 186 1265 11540 1245
NM_001731chr122944 25 --1815 --
NM_001742chr731370 1203 105 --21862 43 --
NM_001745chr531136 799 402 ------
NM_001746chr541866 1115 498 282 ----12433
NM_001752chr113525 247 205 ------
NM_001753chr741666 389 181 112 ------
NM_001754chr2183459 2810 2784 2697 1464 1223 1173 728 ------
NM_001755chr1682044 1432 520 479 427 375 233 79 --22221 2206 --
NM_001759chr1255219 3491 1649 1251 883 --14299 14565
NM_001777chr374039 3369 2618 2562 1307 1169 555 23554 3102 ----
NM_001788chr74958 722 656 617 --1818 --
NM_001797chr162641 102 ----1577
NM_001798chr121840 ------
NM_001806chr1951151 1127 1054 996 95 1612 ----
NM_001812chr42321 272 ------
NM_001826chr1161 ------
NM_001830chrX93128 3080 2601 1214 1096 920 821 600 46 --1668 --
NM_001839chr12727 80 ------
NM_001845chr1321216 1097 11194 --11004
NM_001854chr131131 421 410 ------
NM_001855chr91883 ------
NM_001858chr6164427 4370 4336 4219 3579 3364 3282 2054 1961 808 572 443 402 308 81 37 15161 ----
NM_001859chr9103674 3292 3042 2977 2946 2881 2520 622 340 229 23842 790 12929 1279
NM_001873chr42208 117 ------
NM_001884chr51131 ------
NM_001892chr531473 1361 1084 --11404 1375
NM_001893chr171382 ------
NM_001895chr2031098 875 414 --1789 --
NM_001901chr6--2318 59 ----
NM_001918chr1208958 8948 8235 7725 7496 6988 5963 5915 5862 5735 5608 3664 3094 2923 2879 1725 1255 1049 818 721 78919 6790 6761 6281 1593 1312 573 49269 8534 2468 79 --
NM_001920chr124731 691 623 21 --1204 --
NM_001935chr241030 1011 933 44 --2885 244 2159 61
NM_001938chr161889 682 357 147 97 78 1704 ----
NM_001939chrX83585 3229 3075 2658 1541 1358 737 610 13337 ----
NM_001942chr1841874 792 270 109 --11496 11331
NM_001945chr531376 1117 302 ------
NM_001949chr632824 2095 1267 2862 413 --12109
NM_001950chr162655 645 --1632 --
NM_001955chr62227 181 1390 ----
NM_001962chr51546 ------
NM_001964chr5----1306 1296
NM_001966chr321164 354 11301 ----
NM_001968chr42350 178 2715 118 ----
NM_001977chr42647 478 1434 ----
NM_001981chr151936 1593 771 671 171 --11467 --
NM_001987chr1242959 2748 1138 367 23288 2887 --24330 3161
NM_001995chr431255 1004 358 11525 11149 --
NM_001998chr31392 1349 ----
NM_001999chr531195 1127 236 ------
NM_002006chr454963 4824 3831 2019 1075 1652 34186 3623 1225 129
NM_002009chr1542406 2059 1743 330 ----1741
NM_002010chr13----1390 --
NM_002015chr1353141 2059 1135 900 529 ------
NM_002017chr112985 243 1865 ----
NM_002024chrX72234 1931 1598 1417 840 516 38 ----1432
NM_002025chrX209041 8958 7931 7423 7334 7187 6083 6029 5820 3335 2542 2471 1456 1422 1379 1141 253 236 207 135 29112 6555 47438 2372 1770 1231 --
NM_002031chr63736 617 277 ------
NM_002033chr1164059 3815 3746 2907 1296 71 --21139 798 --
NM_002035chr1863568 3444 3236 2895 1259 917 --23720 772 --
NM_002040chr21112835 2536 2492 2236 2163 2140 2094 1171 1114 475 347 ------
NM_002044chr1511074 1187 1399 --
NM_002045chr32396 277 ------
NM_002048chr931240 831 264 ------
NM_002052chr831514 1401 243 ------
NM_002056chr23865 599 286 --1790 --
NM_002061chr121336 158 21529 1502 ----
NM_002063chrX1974 ------
NM_002069chr721599 501 --31456 1394 1219 --
NM_002072chr91220 --1671 --
NM_002076chr1243216 2571 2390 1031 1435 --13209
NM_002077chr952117 1759 1487 621 571 ------
NM_002080chr16----2765 108 1869
NM_002092chr4134690 4507 4388 3956 3682 2007 1854 1724 1685 1289 884 366 58 146 24063 3877 --
NM_002094chr161327 ------
NM_002106chr4184 ----127
NM_002107chr11188 127 ----
NM_002126chr1794141 3834 3026 2965 2940 2699 1200 577 248 22612 1325 --13573
NM_002129chr41338 ------
NM_002130chr531472 1328 440 ------
NM_002137chr722008 686 ----1115
NM_002139chrX1576 ------
NM_002140chr931076 103 90 ------
NM_002143chr11741 ----1779
NM_002146chr171397 1472 ----
NM_002149chr21760 ------
NM_002158chr263453 3192 1273 983 879 361 --12699 1641
NM_002160chr91570 1440 ----
NM_002182chr342757 2750 759 417 --11915 1620
NM_002192chr71555 --1497 --
NM_002202chr52935 732 ----1332
NM_002203chr574005 3569 2814 1510 1170 1102 630 23157 1260 --13290
NM_002210chr243104 2626 2481 28 12884 ----
NM_002214chr7125215 4851 4819 4657 4089 4072 3760 3677 3655 2240 1567 1038 34551 2118 908 13645 14484
NM_002221chr132107 1039 158 ------
NM_002222chr341301 1151 922 888 2998 205 ----
NM_002227chr1170 1290 ----
NM_002228chr11783 11058 ----
NM_002232chr12940 84 --1270 --
NM_002233chr113423 183 39 ------
NM_002239chr231092 799 354 ------
NM_002242chr24773 488 365 359 172 11381 --
NM_002245chr1172 --1251 --
NM_002247chr1061993 1687 924 748 686 158 --148 --
NM_002252chr22308 90 ------
NM_002253chr421434 239 --1111 --
NM_002254chr22812 404 --21511 879 168
NM_002264chr3165048 4567 4176 3868 3700 3628 3157 3072 1663 1459 1305 1224 1157 1139 403 125 23687 3355 21235 804 --
NM_002265chr172244 54 --1301 --
NM_002267chr1352278 2227 638 612 22 ------
NM_002268chr321404 171 --2517 377 --
NM_002270chr555006 4937 4464 3999 962 34096 3573 763 15220 23783 1581
NM_002271chr131833 ----1708
NM_002285chr274116 3878 3663 2565 1318 874 116 --11382 --
NM_002293chr172537 1703 1108 780 546 484 200 ----12243
NM_002310chr5116631 6347 5302 5278 5025 4355 2148 1709 1490 1080 823 66225 5744 4226 2096 280 34 36128 4293 1972 15777
NM_002312chr133780 406 200 1939 ----
NM_002313chr1021819 310 11432 13531 --
NM_002333chr1931003 320 283 --163 --
NM_002336chr1274806 3625 3332 3256 1593 1083 767 24228 410 13363 --
NM_002349chr231672 470 264 ------
NM_002351chrX21489 101 ------
NM_002355chr1241345 1107 1068 143 --11274 196
NM_002356chr682845 2039 1875 1842 1068 1014 655 324 1197 1897 1683
NM_002358chr4166 ----1493
NM_002360chr721891 895 12485 12025 --
NM_002373chr152501 487 ----1381
NM_002374chr233611 2897 1301 ----21153 362
NM_002375chr342232 366 30 22 --1486 --
NM_002376chr14199 ------
NM_002382chr141188 --11162 149
NM_002384chr182956 706 ------
NM_002387chr564975 4128 3573 1670 1571 702 --24494 397 --
NM_002395chr61281 --1977 --
NM_002397chr552050 1839 1728 1396 653 11765 11970 --
NM_002399chr1521462 452 ------
NM_002401chr1732525 1849 440 11539 11802 --
NM_002402chr7--11103 ----
NM_002408chr144701 299 224 190 ------
NM_002409chr2243154 2188 886 63 ----13182
NM_002430chr2212031 --12465 --
NM_002444chrX21593 560 ------
NM_002445chr82610 74 31556 474 41 11157 11342
NM_002448chr42746 274 ------
NM_002449chr5--1370 11254 --
NM_002460chr683225 2755 2718 2652 1258 958 592 404 ------
NM_002465chr121311 ------
NM_002480chr1271396 1172 1120 475 153 135 105 21275 1103 ----
NM_002486chr92736 519 1446 --1461
NM_002487chr153600 576 163 1310 ----
NM_002499chr1542043 1632 899 554 1302 ----
NM_002500chr22298 23 ------
NM_002505chr6--2332 245 ----
NM_002507chr171578 1267 11932 --
NM_002508chr131873 1252 1224 --1560 --
NM_002515chr1472038 1994 1846 1831 1791 1439 667 11481 11764 11674
NM_002519chr1121365 374 ------
NM_002520chr5----150 --
NM_002522chr1753918 3662 3044 1363 73 23757 1243 23513 382 --
NM_002526chr64577 382 308 101 ------
NM_002536chrX1644 ------
NM_002544chr171125 ------
NM_002545chr11134345 4134 4117 3908 1067 1056 1028 1011 872 595 504 447 351 --14336 1858
NM_002546chr85715 651 630 220 168 ------
NM_002547chrX144291 4126 3918 3901 3127 2782 1510 1448 1440 1309 1181 801 191 92 --21352 945 --
NM_002556chr1122011 125 --1680 --
NM_002576chr113327 207 110 159 ----
NM_002577chr363864 3452 2944 1315 1266 395 ------
NM_002581chr945481 5027 4648 1979 22169 2079 25450 4670 11741
NM_002586chr621160 228 ----1566
NM_002594chr2042374 2280 456 316 --11968 11766
NM_002595chr1251830 1647 1385 1316 517 ------
NM_002600chr121791 359 ------
NM_002601chr22420 194 123 ----
NM_002603chr81158 ------
NM_002605chr1531228 1057 47 ----11172
NM_002613chr1654613 3402 1289 1173 545 22165 1971 24683 4127 --
NM_002623chr202797 116 ------
NM_002628chr361181 1137 494 377 177 142 ------
NM_002629chr103857 150 106 ------
NM_002636chr62433 220 ------
NM_002639chr1851268 1011 908 882 80 ------
NM_002641chrX31695 1676 799 ------
NM_002645chr1132322 1980 793 1157 22967 2793 --
NM_002649chr771572 1236 1138 473 389 363 230 1110 11225 --
NM_002655chr8144402 4309 3540 3396 3330 3240 1668 1352 1230 1205 766 683 594 332 --11124 --
NM_002657chr2033259 849 784 1609 23001 2634 11521
NM_002663chr17--1545 ----
NM_002667chr64841 819 510 171 ----1997
NM_002677chr832084 1968 37 ------
NM_002687chr1431198 940 441 --1262 --
NM_002703chr44732 284 182 72 1372 --1597
NM_002706chr21524 ----1224
NM_002709chr243024 2883 517 252 22945 766 ----
NM_002710chr122351 58 ------
NM_002711chr74681 349 292 119 --1328 --
NM_002713chr131085 300 106 ------
NM_002716chr11113677 2875 2347 1460 1192 1142 974 645 395 190 140 11361 ----
NM_002718chr342577 2034 750 119 1493 --11690
NM_002719chr1452269 1990 1703 908 723 --1306 --
NM_002726chr62332 155 1502 ----
NM_002731chr152724 2659 1960 792 272 --12736 --
NM_002734chr1732050 1960 1947 ------
NM_002736chr742207 1763 1400 469 ------
NM_002737chr17155827 5164 4994 4450 4393 4258 2339 2327 2162 1122 794 722 658 404 192 ----1758
NM_002738chr1621119 169 1778 130 --
NM_002740chr352668 1815 1771 1721 271 22005 1800 --1390
NM_002742chr141659 ------
NM_002745chr2294446 4169 3971 2765 1652 1500 1074 676 569 34537 1065 415 11534 13797
NM_002747chr1831479 698 152 ------
NM_002748chr1591182 852 488 424 195 178 105 79 22 ------
NM_002752chr5----1427 1239
NM_002755chr152772 156 1101 ----
NM_002758chr171547 --191 --
NM_002763chr11160 ------
NM_002764chrX1666 --1885 1201
NM_002765chrX51336 1188 1096 565 250 11402 1171 --
NM_002776chr193637 380 157 11362 1694 --
NM_002806chr143337 324 301 ------
NM_002822chr1221209 675 11174 11194 --
NM_002828chr182688 390 1160 ----
NM_002829chr951208 901 382 372 204 11138 ----
NM_002833chr1511198 ----11527
NM_002837chr1254166 2980 2964 1199 900 13849 ----
NM_002838chr11460 --1214 --
NM_002839chr963101 2752 1033 702 669 622 1311 1544 --
NM_002840chr121532 282 ------
NM_002841chr3------1193
NM_002843chr1153108 2883 664 653 208 --11139 --
NM_002844chr621033 541 1216 ----
NM_002846chr22542 62 ------
NM_002847chr751541 998 555 455 357 11353 11485 --
NM_002850chr1941264 971 810 137 1482 ----
NM_002851chr72720 87 ------
NM_002857chr182543 2534 2458 1964 1943 1689 824 200 --12388 --
NM_002858chr12429 394 --11014 --
NM_002860chr101254 --1512 162
NM_002863chr141110 ------
NM_002868chr1262322 2138 1979 834 534 475 ------
NM_002869chr111661 --1378 --
NM_002874chr932185 1985 1958 --22338 1918 --
NM_002882chr22197 ------
NM_002886chr3125162 4828 4476 4074 4030 3605 3243 2062 1468 1442 1270 1233 24906 3723 14197 13401
NM_002890chr52902 301 ------
NM_002892chr1421570 1222 11685 ----
NM_002893chrX1278 ------
NM_002894chr181183 ------
NM_002902chr152651 123 ------
NM_002906chr1152371 2049 1732 1665 447 1746 2708 677 --
NM_002911chr1931229 520 395 151 --1307
NM_002912chr65926 756 283 271 114 --1830 --
NM_002924chr13625 486 147 1167 --1446
NM_002927chr13616 576 503 ------
NM_002940chr42731 537 1241 --11558
NM_002941chr341490 1326 480 146 ----1637
NM_002948chr331017 825 212 ------
NM_002955chr641281 671 575 333 ------
NM_002956chr1251168 1162 872 466 458 ------
NM_002958chr32952 698 ------
NM_002959chr143791 3487 2911 1773 --12751 --
NM_002968chr161821 ------
NM_002970chrX1279 ------
NM_002973chr12189 ------
NM_002977chr233271 1354 389 12258 3655 632 313 --
NM_002988chr171173 ------
NM_002994chr481752 1336 707 680 653 585 455 255 ----11316
NM_002998chr841838 1715 388 331 1151 ----
NM_002999chr203760 706 113 ------
NM_003001chr12752 54 1907 32152 75 26 --
NM_003010chr172904 628 1303 31806 1784 313 --
NM_003011chr931108 1049 230 --11164 --
NM_003013chr45702 617 531 161 55 ------
NM_003016chr1731271 689 675 ------
NM_003017chr621216 45 ------
NM_003020chr151359 1449 ----
NM_003026chr971224 1130 1124 988 912 380 226 1311 ----
NM_003028chr962788 2499 2370 1137 683 354 ------
NM_003030chr322014 150 ----21897 1550
NM_003031chr163970 399 243 ------
NM_003032chr342595 1675 1656 297 11838 ----
NM_003036chr141166 952 877 461 ------
NM_003042chr352141 2053 1581 1539 288 190 1391 --
NM_003043chr354327 3907 3427 1043 403 21036 495 24274 1186 --
NM_003045chr1364182 1743 1537 799 420 345 11360 --15030
NM_003051chr161688 1610 1591 1541 614 348 11751 ----
NM_003068chr82309 38 ----1357
NM_003071chr311290 ------
NM_003074chr352312 1518 404 396 253 ------
NM_003076chr1221156 183 ------
NM_003077chr171290 --1621 --
NM_003081chr207975 450 262 255 219 139 75 --1821 --
NM_003099chr1596067 5721 2443 2075 1955 1905 1875 637 167 --15931 --
NM_003100chr5173 ------
NM_003107chr632326 2094 1616 11830 ----
NM_003108chr2127025 6366 5765 5401 4810 4414 2847 2150 1839 1825 1423 1264 26183 1316 ----
NM_003110chr17--1312 ----
NM_003111chr241307 1068 509 346 ------
NM_003112chr752925 2285 2239 852 281 53244 2746 2574 784 582 ----
NM_003118chr531547 1348 630 11793 12062 2394 389
NM_003128chr252715 2629 1751 906 143 12613 2877 181 22766 946
NM_003130chr721092 359 --21117 906 --
NM_003131chr622305 226 ------
NM_003133chr11124 --1351 --
NM_003135chr51101 --1134 --
NM_003137chr641986 1854 1564 144 --1482 --
NM_003140chrY----1133 --
NM_003142chr2127 ------
NM_003143chr7129 ------
NM_003144chr642156 1929 575 174 --12188 --
NM_003149chr321513 1143 1450 11419 162
NM_003155chr862471 1800 1007 650 615 43 1880 ----
NM_003157chr34701 124 111 82 --1721 --
NM_003161chr1743427 2522 1424 247 23047 864 23558 789 13387
NM_003162chr231019 951 821 --186 --
NM_003170chr171584 ------
NM_003178chr341917 1799 1653 293 ------
NM_003182chr72420 34 ----1497
NM_003182chr72420 34 ----1497
NM_003183chr21578 ------
NM_003185chr2021367 460 --2398 225 --
NM_003188chr61689 --1828 --
NM_003189chr162976 2305 2078 485 471 362 --22293 1308 --
NM_003193chr11161 ------
NM_003198chr11273 ------
NM_003199chr1854671 2041 1390 696 66 14339 43735 3480 2126 2082 24609 3767
NM_003201chr102674 254 ------
NM_003204chr1711354 --11761 1363
NM_003211chr1251733 1366 699 463 252 ------
NM_003216chr2242607 902 503 374 2694 143 1773 --
NM_003217chr1221729 1525 --31893 197 54 --
NM_003220chr631575 1126 682 ------
NM_003221chr674050 3607 2919 2764 1434 877 491 31663 979 478 ----
NM_003223chr162558 111 --1620 --
NM_003234chr372153 2134 1748 1500 631 398 236 --1121 --
NM_003238chr1--1226 ----
NM_003244chr181339 ------
NM_003246chr1571723 1527 1469 1327 538 339 218 21784 834 ----
NM_003248chr51139 ------
NM_003250chr17------1354
NM_003253chr211166 --11679 --
NM_003257chr1511136 ------
NM_003262chr384337 4125 3452 1353 1295 986 248 155 55215 1182 704 407 379 33800 1611 640 --
NM_003268chr1174 ----128
NM_003274chr2142925 2184 2117 1867 1864 ----
NM_003286chr2041104 1095 834 125 1451 ----
NM_003290chr1931245 1149 93 1993 11206 --
NM_003292chr151904 1690 909 503 393 2664 496 1160 --
NM_003298chr3135727 5181 4680 4401 4348 1926 1260 814 642 554 458 133 112 --12113 --
NM_003299chr12----159 --
NM_003304chr331214 479 417 --21361 1012 --
NM_003305chr41279 --1347 --
NM_003314chr51440 1101 ----
NM_003319chr23701 683 630 ----1149
NM_003320chr1164421 4306 3486 1666 1659 1285 --13520 23830 2965
NM_003336chrX2823 126 --1260 --
NM_003337chr51506 11068 ----
NM_003338chr1071922 1494 1451 1390 1222 260 201 ------
NM_003339chr541580 1088 624 459 11176 1108 --
NM_003340chr431315 360 158 --1107 11399
NM_003342chr1753132 2749 2580 2558 2465 --1573 13162
NM_003348chr1251179 1137 1124 212 120 --1266 --
NM_003349chr2031128 144 62 ------
NM_003350chr83907 757 227 1372 ----
NM_003359chr441343 982 907 346 ------
NM_003363chr32519 60 --1535 --
NM_003367chr191153 ------
NM_003368chr12183 88 ------
NM_003369chr1152292 2228 1119 661 579 21970 796 12387 --
NM_003372chrX3721 194 45 --1900 --
NM_003376chr631735 1444 399 ------
NM_003376chr631735 1444 399 ------
NM_003379chr61436 ------
NM_003385chr22347 181 ----21039 256
NM_003387chr262937 2031 2012 1892 711 565 12082 11874 --
NM_003390chr112994 182 1430 ----
NM_003392chr344366 3534 3258 1743 34268 1474 1408 14121 --
NM_003400chr22757 690 --1197 --
NM_003404chr202822 469 ------
NM_003406chr82650 199 --21676 210 --
NM_003409chr1821432 1318 ------
NM_003410chrX62526 648 494 409 392 56 --22073 740 --
NM_003411chrY5662 611 556 364 53 ------
NM_003412chr332670 672 418 --22837 2305 --
NM_003413chrX51959 1697 1275 298 119 12018 ----
NM_003418chr31773 ------
NM_003420chr31708 1161 ----
NM_003421chr1013820 54427 4406 4273 3401 1050 --13092
NM_003439chr7103207 2765 2354 1318 1241 1224 767 719 593 27 23374 2519 11191 --
NM_003445chr192801 108 ------
NM_003453chr132685 567 181 ----
NM_003454chr1631025 574 411 2189 141 --11477
NM_003458chr363548 3154 2508 2491 1323 836 1765 11348 --
NM_003463chr652835 2561 2256 512 240 22350 613 11363 1455
NM_003469chr22173 60 --1157 --
NM_003471chr372109 1966 1873 1724 1478 876 210 1489 ----
NM_003473chr1021036 833 1775 ----
NM_003474chr10--21633 474 12164 --
NM_003478chr1153129 2597 2541 2222 415 ------
NM_003482chr124975 832 684 227 1277 ----
NM_003483chr1272713 2550 2469 2188 777 659 109 ------
NM_003489chr2163073 2568 2125 867 779 118 42641 1314 1063 1006 ----
NM_003505chr731809 1731 92 ------
NM_003506chr811346 --1974 1165
NM_003507chr231866 1456 753 11824 ----
NM_003558chr92479 208 ------
NM_003566chr1293491 3244 2696 2632 2136 2130 930 698 579 21359 1039 22294 195 12148
NM_003567chr11441 1368 154 --
NM_003574chr1874214 4157 3733 2320 1913 1242 359 33912 1831 76 35143 4856 3920 24824 1497
NM_003575chr721445 188 21266 497 ----
NM_003576chr1352220 1830 858 449 226 12339 1961 --
NM_003583chr1283570 3412 2905 2681 2521 1298 157 112 22446 898 12975 --
NM_003589chr1331319 1107 75 --21298 144 --
NM_003590chr2123872 3395 3234 2942 2913 2813 1264 1237 803 470 453 93 13113 53138 1606 571 340 217 12842
NM_003591chr101101 ------
NM_003592chr71411 1184 ----
NM_003593chr173556 518 193 ------
NM_003601chr41226 ------
NM_003603chr452132 1464 852 369 122 1362 11421 11634
NM_003607chr184123 4059 3788 3489 3114 3058 1409 961 43824 3549 3388 1538 2894 66 21688 1490
NM_003613chr153644 597 273 ----137
NM_003615chr383904 3769 3542 3309 1185 1158 1145 975 1466 21328 492 --
NM_003617chr174918 4044 3104 1536 994 174 62 44415 3409 3186 1677 24814 3806 --
NM_003618chr231267 1122 331 1906 ----
NM_003620chr1731104 902 847 ------
NM_003626chr111235 --11019 --
NM_003628chr22492 69 ------
NM_003629chr142350 2295 2231 529 22587 615 11099 --
NM_003630chr62703 36 1163 --1135
NM_003632chr173783 297 246 ------
NM_003651chr121426 ------
NM_003654chr112779 497 --1105 --
NM_003659chr22982 215 ----1238
NM_003663chr3123347 3293 3119 3030 2484 1386 1360 983 743 251 91 74 12833 43248 2738 2670 756 --
NM_003664chr5174 --1539 --
NM_003668chr12----196 --
NM_003671chr913319 --1490 --
NM_003672chr141920 1349 102 54 --1631 --
NM_003676chr13864 270 254 1582 --1777
NM_003677chr1222000 405 ------
NM_003679chr1103257 2420 2255 647 606 587 572 557 522 139 22762 2455 ----
NM_003688chrX143 ------
NM_003692chr91707 ------
NM_003702chr8189 --1843 --
NM_003705chr25765 716 320 304 163 ------
NM_003711chr5178 ------
NM_003714chr572482 2401 2343 2265 2221 760 53 12743 22357 611 11021
NM_003718chr73213 35 29 ----1525
NM_003725chr121121 --1306 --
NM_003728chr41434 ------
NM_003737chr111416 ------
NM_003741chr32397 302 ------
NM_003743chr232218 1598 310 21623 89 31860 1800 1758 --
NM_003744chr14------11257
NM_003749chr1332300 802 651 12032 ----
NM_003750chr102314 242 ------
NM_003756chr81188 ------
NM_003758chr1511425 --127 1510
NM_003758chr1511425 --127 1510
NM_003759chr444088 1272 786 187 14151 13069 23810 234
NM_003762chr12948 164 ----11457
NM_003763chr2032187 1127 702 22349 1028 21975 480 --
NM_003772chr114879 807 377 159 1398 ----
NM_003774chr1262948 1308 998 855 143 114 12137 ----
NM_003787chr1831630 1390 530 ------
NM_003790chr11211 ------
NM_003794chr31959 2808 786 ----
NM_003795chr62627 581 ------
NM_003800chr662146 662 568 487 466 223 21975 216 ----
NM_003816chr82942 216 ----21408 1092
NM_003821chr8151 ------
NM_003825chr1531253 981 27 ------
NM_003829chr92184 148 11022 --11001
NM_003831chr1841853 1496 1230 245 11601 --1204
NM_003838chr131602 318 156 1572 ----
NM_003840chr84779 576 482 36 21757 382 --11554
NM_003846chr14706 580 511 302 ------
NM_003850chr132438 207 ------
NM_003858chr143682 611 487 ------
NM_003861chr1452307 2244 1938 1048 1002 21116 418 22706 2443 --
NM_003870chr1572126 2104 604 537 467 376 233 ------
NM_003872chr252662 2637 2631 597 483 11217 1268 --
NM_003873chr1032314 2007 223 21856 444 1278 11916
NM_003885chr1732561 1951 503 ------
NM_003887chr232319 1622 701 ------
NM_003888chr1561500 1379 1331 521 376 274 ----1508
NM_003899chr1312305 1245 12472 --
NM_003901chr1052300 1002 850 265 165 22707 1845 --1388
NM_003902chr11584 ------
NM_003905chr161127 ------
NM_003909chr883024 2422 1965 1072 1043 1014 185 46 ------
NM_003913chr694079 3947 3930 3769 993 954 862 554 343 23546 3485 --13551
NM_003916chrX21331 1009 2415 37 11277 --
NM_003919chr7164 ------
NM_003924chr421227 1138 ----1178
NM_003930chr742260 2247 1747 118 1983 ----
NM_003931chr62695 195 1168 ----
NM_003934chr951318 1282 1103 455 189 1296 ----
NM_003938chr193982 172 155 ------
NM_003939chr1063541 3503 3326 1185 1050 986 --11335 11099
NM_003941chr742331 1728 1622 158 ----12452
NM_003947chr32997 430 21149 982 1402 --
NM_003948chr462429 2281 2084 1051 1031 53 11001 1109 --
NM_003953chr172888 2788 2715 2230 1913 318 277 ------
NM_003958chr6103877 3812 3793 3404 3068 3022 2829 2668 1581 782 1446 43276 2511 1319 450 --
NM_003966chr5147714 7263 7071 6745 6085 6011 5398 5133 4872 4852 2655 1646 1503 1023 47616 1284 118 107 67630 6609 6213 2329 1036 550 26094 1985
NM_003968chr34570 500 459 77 ------
NM_003972chr10146 11316 ----
NM_003980chr631287 1106 121 1210 ----
NM_003983chr1654258 890 555 449 241 22895 1010 14454 11110
NM_003993chr12342 29 ------
NM_003994chr12103932 3829 3732 3661 3510 3119 1098 274 211 120 22802 941 --22941 1553
NM_004006chrX3917 630 340 12669 --1673
NM_004007chrX3917 630 340 12669 --1673
NM_004009chrX3917 630 340 12669 --1673
NM_004010chrX3917 630 340 12669 --1673
NM_004011chrX3917 630 340 12669 --1673
NM_004012chrX3917 630 340 12669 --1673
NM_004013chrX3917 630 340 12669 --1673
NM_004014chrX3917 630 340 12669 --1673
NM_004015chrX3917 630 340 12669 --1673
NM_004016chrX3831 544 254 12583 --1587
NM_004017chrX3917 630 340 12669 --1673
NM_004018chrX3831 544 254 12583 --1587
NM_004019chrX1320 1369 ----
NM_004020chrX3917 630 340 12669 --1673
NM_004021chrX3831 544 254 12583 --1587
NM_004022chrX3831 544 254 12583 --1587
NM_004023chrX3831 544 254 12583 --1587
NM_004024chr14565 408 126 119 1994 ----
NM_004028chr1864119 3939 3676 3006 947 252 13714 11240 21383 600
NM_004036chr21133 --1487 --
NM_004040chr22951 902 ------
NM_004050chr1412714 22390 1060 ----
NM_004067chr761494 1140 562 517 272 72 ------
NM_004068chr31422 ------
NM_004077chr1241229 1093 874 291 ------
NM_004079chr142719 901 459 253 1658 ----
NM_004080chr741207 1037 272 193 41407 1219 559 83 ----
NM_004081chrY61336 706 699 538 345 235 1471 ----
NM_004087chr33721 567 54 ------
NM_004089chrX31017 789 379 --1367 189
NM_004093chr1342038 1271 413 265 ------
NM_004094chr1472968 2591 2152 2071 671 488 284 --1958 1230
NM_004096chr1072165 1501 1441 1346 805 182 173 --1692 --
NM_004097chr21302 ------
NM_004100chr642382 2190 1939 870 --11832 --
NM_004113chr341790 1597 534 67 ------
NM_004117chr632197 2112 1699 11478 --1274
NM_004124chr1473127 2235 2184 1047 577 429 135 33248 1101 643 32738 700 167 11334
NM_004132chr1031128 908 369 ----11142
NM_004133chr852581 2315 1653 834 293 164 ----
NM_004136chr1531018 1008 453 13095 12672 1113
NM_004156chr82609 508 ------
NM_004162chr321140 323 --1464 --
NM_004170chr941811 1724 231 42 11882 21408 506 158
NM_004171chr11239662 8288 8202 8161 7384 6638 6609 6413 6050 5959 3795 3739 3360 3281 2897 2797 2667 1828 1687 1108 994 644 553 19571 48238 7308 3711 1052 38410 3139 970
NM_004172chr531928 773 611 2586 67 1102 1217
NM_004177chr112693 553 ------
NM_004178chr122201 103 ------
NM_004180chr23530 504 95 ------
NM_004215chr8------1564
NM_004226chr2122 ------
NM_004229chrX61780 1495 851 666 386 175 31444 580 220 31924 1554 597 --
NM_004232chr1853303 3035 2588 901 22 33247 1482 345 21315 673 11394
NM_004233chr641062 596 400 389 ------
NM_004235chr91896 --1138 --
NM_004237chr54746 216 209 78 ----1833
NM_004238chr21245 ------
NM_004253chr95743 701 364 270 121 --1949 --
NM_004261chr13985 944 715 1887 ----
NM_004267chr3--1171 ----
NM_004272chr521260 373 ------
NM_004274chr1482972 2885 2666 2169 2154 692 592 230 1617 13031 135
NM_004279chr752117 941 742 498 363 1923 2534 304 --
NM_004280chr61369 ----1313
NM_004281chr10--170 --1414
NM_004282chr61190 --1648 --
NM_004293chr963674 3143 2597 2457 219 52 1594 ----
NM_004301chr3183 ------
NM_004311chr1052747 1254 574 397 195 1568 22907 2133 --
NM_004326chr11185 ------
NM_004329chr1011331 ----11232
NM_004330chr1531163 773 304 ------
NM_004331chr842618 2386 1732 388 1767 1315 --
NM_004337chr862057 1854 370 288 242 133 21542 430 11837 --
NM_004338chr18116612 6241 5955 5907 5466 5376 5289 4590 4405 1710 869 --12644 26649 2433
NM_004341chr22231 199 ------
NM_004342chr742139 1623 442 110 1483 ----
NM_004346chr431019 508 83 11382 ----
NM_004349chr81970 ------
NM_004356chr111504 ------
NM_004363chr1921105 171 1337 --127
NM_004365chr5--2126 45 ----
NM_004370chr661876 1838 1824 1722 1413 597 1224 2818 525 --
NM_004379chr271779 1622 1504 1392 1307 148 95 ------
NM_004384chr52140 45 --170 --
NM_004385chr53276 224 125 1577 --136
NM_004392chr1312466 --22431 1703 --
NM_004393chr331813 1501 264 --1841 --
NM_004397chr1173704 3593 3220 2918 2864 1702 1257 33320 1488 392 43775 1556 491 93 14318
NM_004404chr241534 585 573 375 11281 11422 --
NM_004405chr23737 677 231 2943 138 1847 --
NM_004408chr92516 106 ------
NM_004411chr71202 ------
NM_004414chr2121303 581 ------
NM_004419chr101387 173 --1301
NM_004423chr372421 2389 2228 1089 765 664 504 12556 --1744
NM_004426chr1231813 707 589 1242 ----
NM_004429chrX4541 414 408 389 ------
NM_004432chr931885 889 304 ------
NM_004436chr11560 ------
NM_004437chr163327 3053 2559 2424 1243 432 1806 ----
NM_004438chr243239 408 197 89 --12544 --
NM_004440chr641869 1618 571 425 ------
NM_004441chr331304 168 118 11040 ----
NM_004442chr111115 ------
NM_004447chr1241075 1062 856 91 ------
NM_004454chr31119 1490 ----
NM_004458chrX42228 1057 935 482 11042 --11868
NM_004459chr1761943 1642 1485 491 437 207 22055 1880 ----
NM_004464chr4114204 3996 3844 3015 2893 2827 1398 1367 541 501 130 13763 2901 889 --
NM_004469chrX133 ------
NM_004480chr14--163 ----
NM_004482chr22938 844 ------
NM_004492chr152255 32 ------
NM_004496chr1421343 133 ------
NM_004499chr51392 1119 ----
NM_004500chr1431583 1401 390 --12048 --
NM_004501chr1113583 3503 3151 3010 2800 1060 973 898 769 355 261 --11337 --
NM_004504chr293049 2985 2667 2437 1857 1085 705 431 53 ------
NM_004505chr1731970 1487 1337 1747 ----
NM_004506chr63518 490 71 ------
NM_004514chr1782857 2262 1132 935 925 638 529 482 2683 468 ----
NM_004520chr51228 2684 138 ----
NM_004529chr931411 937 338 --31452 1058 184 --
NM_004535chr202487 408 ------
NM_004537chr122390 80 --11351 --
NM_004540chr212862 701 ----1570
NM_004561chr1131772 1746 190 --1646 --
NM_004565chr11694 ------
NM_004571chr2163205 2500 2234 2142 2097 544 ------
NM_004575chr421388 481 ------
NM_004576chr5181 ------
NM_004578chr13932 915 85 ------
NM_004586chrX114979 4724 3383 3376 1988 1909 1593 1309 918 699 486 23635 3334 ----
NM_004588chr1194072 3055 2888 2687 2615 2594 1226 149 37 23755 1399 ----
NM_004593chr32871 289 ------
NM_004598chr583323 3257 2682 2230 2117 1096 990 604 --1999 --
NM_004600chr131260 1023 462 ------
NM_004603chr7------1807
NM_004612chr964033 3494 1095 800 743 515 --21792 327 --
NM_004614chr1641701 742 649 163 --1135 1348
NM_004615chrX1668 ------
NM_004631chr131253 1219 336 ------
NM_004634chr33564 518 484 --199 --
NM_004637chr341172 983 399 162 --1861 --
NM_004640chr61150 ------
NM_004642chr123686 265 32 --162 --
NM_004654chrY2548 437 ------
NM_004655chr1731338 1118 1008 ------
NM_004657chr241309 1274 219 76 ------
NM_004660chrY21490 1442 1556 11590 --
NM_004663chr1541506 1445 431 43 ------
NM_004666chr641282 1125 1110 167 ------
NM_004670chr1031263 600 388 1235 ----
NM_004673chr151366 1325 1066 606 167 11377 11112 11462
NM_004681chrY3675 319 92 ------
NM_004685chr1352609 2213 1193 182 170 --11085 12921
NM_004686chr841604 1338 536 327 1669 --1189
NM_004687chr1731661 386 118 11498 21454 740 --
NM_004703chr1742235 542 397 320 --150 --
NM_004709chrX31563 458 362 11523 21307 447 --
NM_004713chr14------2587 296
NM_004717chr721370 531 --1428 --
NM_004723chr13824 778 770 --1921 --
NM_004725chr1011186 --1519 1940
NM_004726chrX35582 4940 2309 14028 12260 12214
NM_004730chr53525 446 109 ------
NM_004731chr1231844 60 41 1391 ----
NM_004734chr1343237 3139 2275 193 --23078 3013 --
NM_004736chr182245 2053 1862 1510 862 366 231 27 11504 11413 --
NM_004737chr22----1120 1292
NM_004738chr201295 1108 11959 1736
NM_004742chr321397 1287 1121 ----
NM_004745chr856042 4641 4314 2783 1881 25082 1057 35885 4280 2241 14844
NM_004748chr15104058 3932 2852 2837 1439 1150 962 605 465 199 22817 152 24081 555 --
NM_004757chr43196 130 95 ------
NM_004760chr732191 1895 796 --11792 --
NM_004764chr122201 89 ------
NM_004768chr1----1829 186
NM_004772chr52446 397 ------
NM_004774chr1783090 2878 2837 2320 892 611 513 376 12924 ----
NM_004775chr1872391 2119 2018 2002 1785 963 697 ----11755
NM_004776chr2063038 2490 2312 1022 506 279 12264 1757 --
NM_004779chr53871 280 69 ----11099
NM_004781chr121490 326 --195 --
NM_004781chr121490 326 --195 --
NM_004788chr1142109 1723 1691 797 1826 ----
NM_004789chr92355 48 --1330 --
NM_004796chr1452211 2140 2013 551 182 ------
NM_004798chr2093214 2530 2395 1321 1289 816 805 427 201 1216 13615 --
NM_004799chr1164 ------
NM_004801chr241592 276 243 45 1161 ----
NM_004805chr221155 967 --21001 317 --
NM_004808chr1093278 3182 3017 2851 2392 2254 824 389 39 1992 ----
NM_004814chr12494 364 1167 ----
NM_004815chr1114641 4365 3448 3422 3168 1133 1074 918 854 485 210 --11977 14088
NM_004824chr611335 --1389 --
NM_004834chr243219 2070 697 498 ------
NM_004835chr31818 ------
NM_004835chr31818 ------
NM_004840chrX42119 1574 226 43 ------
NM_004841chr141129 850 201 53 --21123 856 --
NM_004842chr631571 446 377 --11453 11684
NM_004844chr331119 1053 76 ------
NM_004849chr641667 1382 619 504 11163 11167 --
NM_004857chr1484691 4119 4055 3877 1071 1056 745 70 --21184 103 --
NM_004859chr1732922 190 50 11200 ----
NM_004863chr1421626 932 34562 3472 98 25104 4768 --
NM_004866chr574893 4649 4206 3528 3323 1647 608 24378 3519 21023 538 23770 3577
NM_004867chrX4572 503 469 227 ------
NM_004871chr1784364 3702 3133 1481 997 901 881 517 ----13955
NM_004879chr111915 ------
NM_004883chr51152 ------
NM_004888chr93687 408 184 11018 1198 --
NM_004893chr52119 103 ------
NM_004896chr1051485 1287 1058 1021 134 1495 ----
NM_004898chr422553 2337 11067 32847 2621 623 1881
NM_004902chr203623 108 65 --156 --
NM_004904chr7136524 4807 4355 4334 4210 4177 2406 2271 2054 652 617 562 127 34251 1764 430 24437 1824 --
NM_004906chr6134 ------
NM_004912chr721490 1220 1364 ----
NM_004922chr1021031 898 --11001 --
NM_004926chr14--11635 --1524
NM_004930chr12228 143 1687 ----
NM_004932chr5--1361 11714 --
NM_004937chr1732669 1775 236 21943 285 ----
NM_004938chr93927 445 283 1176 1458 1854
NM_004947chr362383 2044 1834 664 233 227 --2786 703 --
NM_004949chr1852107 1741 1651 756 421 --1596 --
NM_004956chr783951 3808 3720 3680 2941 1754 829 450 33219 1196 788 21836 1429 --
NM_004964chr12578 544 ------
NM_004965chr212481 188 ------
NM_004966chr103675 254 35 ------
NM_004969chr10----2511 71 --
NM_004972chr92788 407 11190 ----
NM_004976chr1175192 5106 4594 3958 3261 1453 664 54250 4096 3985 3941 1020 1633 13931
NM_004979chrX137 --1475 11111
NM_004985chr1294366 4097 4073 3477 3007 1722 1582 662 371 --11818 23658 1606
NM_004992chrX107908 7775 5516 3093 2833 2453 2014 1985 1535 1232 38453 2935 1890 16265 11250
NM_004992chrX107908 7775 5516 3093 2833 2453 2014 1985 1535 1232 38453 2935 1890 16265 11250
NM_004993chr1441365 1297 1058 451 --1416 --
NM_004996chr1641628 1497 1308 537 1627 1491 --
NM_004999chr644410 1605 1490 920 24352 4108 11538 24443 847
NM_005010chr752062 1898 1458 741 30 --1692 --
NM_005014chr9--1705 1307 1160
NM_005016chr12--1300 ----
NM_005028chr1052111 1794 671 595 127 --32164 1861 97 --
NM_005032chrX4718 316 282 118 ------
NM_005044chrX73414 3340 3290 1274 786 247 113 --1903 1567
NM_005045chr72726 705 ------
NM_005052chr171349 ------
NM_005056chr1285438 4939 4778 4645 4211 910 888 104 --15138 --
NM_005057chr1111809 1708 1212 732 467 416 368 347 322 266 71 11573 1361 --
NM_005063chr1062947 1449 1022 973 511 466 ------
NM_005065chr14145320 5260 4837 4351 4264 4187 4180 2065 1995 1464 1330 942 366 47 23280 3267 --13709
NM_005066chr13770 762 751 ------
NM_005079chr832801 1046 62 23103 694 ----
NM_005080chr222633 228 1191 1734 --
NM_005093chr20105252 4178 4055 1710 1177 1060 955 715 455 322 23311 1907 44770 919 899 849 --
NM_005095chr151969 1603 887 646 227 11465 11680 --
NM_005096chrX51025 1009 475 164 26 ------
NM_005099chr111315 --11025 --
NM_005103chr111337 ------
NM_005109chr352569 1783 416 406 51 ------
NM_005112chr41410 --2147 72 --
NM_005114chr42645 534 --1513 --
NM_005116chr2074276 4258 3361 1568 424 413 186 14206 13584 1741
NM_005119chr131225 863 259 ----1357
NM_005121chr17103510 3001 2674 2614 945 818 569 434 96 78 ------
NM_005126chr372260 2149 1905 1443 281 195 129 ----1704
NM_005128chr212549 507 ------
NM_005151chr1871894 895 435 310 295 186 114 11569 158 22432 2305
NM_005153chr161200 ------
NM_005154chr152655 28 ------
NM_005155chr62721 229 1580 ----
NM_005156chr985340 5143 4983 3933 3332 1673 362 351 --11374 11723
NM_005157chr981801 1787 1327 600 519 362 235 217 ------
NM_005159chr1511509 --22140 84 --
NM_005168chr211172 --21520 140 --
NM_005171chr1221195 1130 11119 ----
NM_005180chr1041711 1674 1137 423 11449 ----
NM_005184chr1911268 --1209 21297 364
NM_005188chr11138199 8193 7856 7693 7417 6111 5948 5205 2170 2060 1356 1180 1126 27849 6843 58279 3092 2272 1797 1768 36040 3017 2449
NM_005190chr611007 1251 ----
NM_005197chr1496136 5832 5743 5560 5353 5159 4931 1185 265 1651 25241 4481 --
NM_005202chr111825 ----12154
NM_005203chr10--1102 ----
NM_005204chr101383 --1209 --
NM_005206chr1721294 979 ------
NM_005208chr171133 ------
NM_005215chr181730 --1583 --
NM_005220chr1721430 572 --31479 1456 313 --
NM_005222chr72906 262 1305 ----
NM_005233chr352295 2168 1722 517 180 12065 ----
NM_005235chr2137380 7293 6461 2725 2173 2159 1962 1768 1632 1522 1289 854 654 --46812 6407 5624 221 36920 6895 5927
NM_005238chr1163509 3035 837 617 306 111 22356 1349 ----
NM_005239chr2141915 1831 1302 592 11330 --1441
NM_005241chr331284 294 117 ------
NM_005245chr42206 156 1526 1543 --
NM_005249chr142288 109 1265 ----
NM_005254chr1511293 11410 ----
NM_005259chr221338 1170 21367 1033 ----
NM_005264chr102909 54 ------
NM_005277chr471623 1593 1434 1193 617 478 250 ------
NM_005292chr132128 122 ----122
NM_005296chrX2806 800 ------
NM_005312chr942656 2577 2398 294 22671 937 --11838
NM_005318chr221165 ------
NM_005324chr1721976 122 ----1801
NM_005327chr42576 289 --1219 --
NM_005336chr232332 2178 1964 11447 11522 --
NM_005339chr463633 2903 1510 1445 716 121 11205 ----
NM_005342chrX22821 65 22295 605 ----
NM_005358chr1331510 748 245 --11668 11815
NM_005359chr18155352 5256 5227 4160 4023 4014 2461 2422 1948 1846 1834 1613 1552 324 104 --25053 4387 --
NM_005369chrX2162 57 ----1248
NM_005370chr191842 ----11323
NM_005373chr131435 1401 1251 --11503 1212
NM_005376chr121197 1105 1866 ----
NM_005378chr2--1856 ----
NM_005384chr9143 ----1104
NM_005385chr342165 267 237 141 12362 12414 12272
NM_005387chr113712 243 218 ------
NM_005389chr6------1100
NM_005392chr951778 1477 713 616 127 ------
NM_005397chr753608 2895 1564 927 583 43259 1457 1157 834 12517 11257
NM_005398chr1011027 --11145 --
NM_005399chr184166 2763 1308 1213 1187 1178 53 42 --12776 1568
NM_005400chr252589 2583 2169 2104 2003 ----12187
NM_005402chr741586 520 369 26 --11593 --
NM_005406chr1811478 1420 11376 --
NM_005407chr1421438 1280 ------
NM_005409chr441069 431 413 349 ------
NM_005415chr21756 145 ----
NM_005417chr2011483 21601 662 ----
NM_005426chr11312 1675 ----
NM_005431chr722137 1981 11533 --1695
NM_005433chr1822507 2429 --1305 --
NM_005436chr1093732 3713 2663 1418 1147 1129 971 879 117 11205 --11066
NM_005437chr1031350 1292 270 ------
NM_005443chr4176 ------
NM_005455chr131762 345 60 2357 126 1407 11792
NM_005458chr922498 2314 11757 ----
NM_005460chr5----1519 --
NM_005465chr151594 1427 1321 791 317 1215 31629 336 33 --
NM_005475chr1263073 2860 2760 2285 1200 187 --33179 2889 2260 --
NM_005479chr1031586 509 300 ------
NM_005493chr61197 ------
NM_005494chr72609 471 ------
NM_005497chr1784559 4333 4057 3757 1949 1934 1284 99 45768 3798 2025 1420 22460 2288 --
NM_005499chr192140 45 ------
NM_005502chr993181 2906 2704 2565 2375 2183 2146 1251 952 1940 ----
NM_005503chr151162 --11003 --
NM_005504chr12135956 5714 4351 4217 4039 2437 2365 2181 1589 1048 947 601 416 --25601 2245 25025 4248
NM_005509chr551471 1393 734 481 308 2625 420 ----
NM_005511chr91117 1898 ----
NM_005513chr331547 1494 525 --160 --
NM_005517chr11508 ----1550
NM_005520chr52570 299 ------
NM_005521chr102748 267 ------
NM_005522chr761031 541 489 358 80 36 11203 1352 --
NM_005524chr31256 ------
NM_005530chr1521166 270 ------
NM_005542chr741938 1243 763 78 ------
NM_005544chr21720 2372 150 1273 --
NM_005545chr152719 546 ------
NM_005563chr12245 72 ------
NM_005566chr11182 ----125
NM_005574chr115630 546 62 51 21 ------
NM_005575chr52163 22 --1712 --
NM_005578chr385091 4107 3909 3345 1957 1857 313 107 24386 180 1421 24339 894
NM_005584chr133587 556 249 ----1151
NM_005593chr12------1565
NM_005596chr945496 4661 4550 1586 34321 2535 40 11798 32540 1683 509
NM_005598chr141640 1229 1156 619 ------
NM_005602chr351180 941 913 173 164 ------
NM_005604chr662562 2334 1899 1007 930 681 --11964 --
NM_005607chr81184 1350 ----
NM_005610chr12855 320 ------
NM_005613chr131855 1485 1360 12207 ----
NM_005614chr72951 119 ------
NM_005627chr63232 202 114 194 ----
NM_005629chrX11368 ------
NM_005637chr184813 733 634 209 ------
NM_005638chrX81766 1488 1441 1195 1183 270 170 159 1403 --1408
NM_005639chr1241729 542 447 88 1504 ----
NM_005644chr11410 170 ----
NM_005647chrX43428 2324 2224 1277 --22355 130 --
NM_005650chr2231382 1272 1103 --1426 1502
NM_005651chr41321 1287 1299 --
NM_005655chr81484 --2469 204 --
NM_005659chr223377 53 43 ------
NM_005665chr1114864 4462 3464 3041 1940 1619 1497 1084 930 172 160 14596 ----
NM_005668chr544609 4358 4097 1274 13005 13828 12927
NM_005669chr562399 2254 922 911 856 525 ------
NM_005684chr12318 65 1275 ----
NM_005686chr131544 555 429 --1492 11606
NM_005688chr33957 412 110 1476 ----
NM_005707chr1551328 1255 809 489 71 11169 ----
NM_005711chr531044 899 50 11063 11024 --
NM_005715chr672348 2315 1832 1001 426 327 247 1846 32158 742 31 --
NM_005717chr121278 22 1236 ----
NM_005721chr231012 999 966 --1714 --
NM_005722chr222482 454 ------
NM_005724chr15190 --1556 --
NM_005725chr141804 1582 810 74 --21889 1824 --
NM_005730chr1243445 3119 1051 539 --1953 --
NM_005734chr112664 200 ------
NM_005737chr272805 2250 2210 1851 785 592 464 --12589 --
NM_005738chr742007 1303 1292 347 ------
NM_005739chr1552283 2231 1513 863 300 22201 728 2282 50 --
NM_005746chr772255 2143 1952 1760 1701 1052 131 ------
NM_005748chr1262318 2120 1070 654 608 184 12417 12774 --
NM_005749chr172154 147 1471 ----
NM_005754chr52812 321 ------
NM_005756chrX61437 324 220 213 195 96 11342 ----
NM_005766chr1351355 1012 490 477 279 ------
NM_005775chr81273 --1219 --
NM_005778chr32377 50 ------
NM_005779chr543033 391 266 67 11306 ----
NM_005786chr1831117 1013 415 1470 ----
NM_005788chr117805 734 585 563 288 272 214 ------
NM_005789chr1762145 2040 1859 1374 762 149 --12171 --
NM_005795chr2112846 2781 2580 2150 2034 1920 1864 851 823 623 470 1726 ----
NM_005798chr1374847 4620 3981 3920 3690 2116 2101 13404 14809 13989
NM_005801chr171201 ------
NM_005808chr342463 1334 682 463 ------
NM_005813chr262658 891 830 309 85 36 ----11751
NM_005819chr172833 2602 1117 606 562 484 357 ------
NM_005822chr652352 2255 1864 1853 32 ------
NM_005826chr11261 --193 --
NM_005828chr1754691 4248 4109 1555 492 13233 1541 --
NM_005832chr361345 1276 1230 1224 972 290 ------
NM_005836chr8--167 ----
NM_005839chr11393 ------
NM_005840chrX117564 6902 6864 5950 5810 5766 5654 2917 2484 2379 879 1639 35697 1944 69 --
NM_005842chr13--1677 ----
NM_005843chr211558 31743 1526 395 ----
NM_005845chr1331078 294 125 --11738 --
NM_005857chr181408 1143 999 979 953 225 144 31 --1170 --
NM_005859chr51527 ------
NM_005862chr32749 224 ------
NM_005863chr101576 11034 11282 --
NM_005870chr1331192 1061 123 ------
NM_005871chr103900 429 175 --126 --
NM_005875chr31103 ------
NM_005880chr1641239 599 448 189 11255 ----
NM_005884chr191655 ------
NM_005885chr531070 605 272 ------
NM_005896chr24805 531 260 130 ------
NM_005898chr1152976 1263 1240 585 81 1471 33154 1228 223 12562
NM_005899chr1711282 1636 ----
NM_005900chr41795 ----11076
NM_005901chr18188612 8038 7731 7696 7535 6840 5393 2988 2843 2779 2611 2376 2252 2220 1865 1630 1547 1497 26114 1514 ----
NM_005903chr554299 4165 1631 717 667 ------
NM_005904chr18----11050 1324
NM_005906chr61352 --11499 --
NM_005907chr611646 --1248 1614
NM_005909chr573775 3726 3523 3494 3475 1424 90 1679 1246 --
NM_005910chr1732980 1075 281 --23785 206 14050
NM_005911chr21512 ------
NM_005924chr72977 126 ------
NM_005927chr541076 864 337 196 --1453 --
NM_005930chr143798 632 45 ------
NM_005933chr1122951 1852 --11861 22974 660
NM_005935chr452087 1900 813 797 296 23758 3600 65265 4160 3411 3349 1721 1513 1385
NM_005938chrX1392 --11345 --
NM_005941chr853618 3389 2880 1603 373 34165 3201 1563 13604 13822
NM_005943chr621127 598 --11315 --
NM_005955chr185446 4647 4369 4231 3980 3600 1043 553 ----11236
NM_005962chr1021734 943 ----1570
NM_005962chr1021734 943 ----1570
NM_005964chr1721036 996 --1492 --
NM_005966chr252313 2236 2023 1583 250 11849 ----
NM_005968chr191214 ------
NM_005986chr1331935 887 609 12491 --12666
NM_005999chr131475 256 79 --1174 --
NM_006007chr941256 1090 871 570 13515 23094 2902 --
NM_006011chr1584266 3663 3576 2902 1589 275 201 36 --23759 1264 --
NM_006015chr111280 1386 ----
NM_006016chr642252 2159 1876 38 1627 --21525 434
NM_006017chr431141 989 329 ------
NM_006022chr13--195 1141 --
NM_006037chr274892 4325 3948 3436 1465 1433 1021 --34103 855 471 --
NM_006038chr2021893 238 32087 1837 178 21812 616 --
NM_006040chr1641276 1102 919 262 --11390 --
NM_006047chr2082778 2578 2439 2267 1018 754 597 467 12228 ----
NM_006055chr2123149 2976 2818 2556 2052 1159 980 561 476 219 168 140 11981 43016 2722 2493 2486 --
NM_006058chr51201 --135 --
NM_006076chr722054 87 ------
NM_006079chr6--2677 87 ----
NM_006080chr743019 2625 943 315 22924 2767 ----
NM_006095chr4104372 4161 3655 3482 3356 3170 1405 895 846 193 --21652 123 --
NM_006106chr1151337 1200 910 339 262 --1871 --
NM_006107chr172461 407 ------
NM_006108chr1152094 1650 1593 455 106 --1420 --
NM_006113chr141968 1728 1529 105 11902 11415 --
NM_006122chr1532786 2707 135 ----11066
NM_006134chr2131545 1014 297 11156 2290 63 --
NM_006135chr131261 1180 517 1528 ----
NM_006136chr72174 27 ------
NM_006139chr262770 2170 2145 616 164 85 21096 340 ----
NM_006141chr1652639 2281 1964 620 569 ------
NM_006143chr121130 ------
NM_006145chr191730 ------
NM_006148chr1722849 2473 12774 12824 --
NM_006154chr1582922 2817 2617 2411 2221 2147 2103 1924 22724 1866 12504 --
NM_006155chr241534 585 573 375 11281 11422 --
NM_006157chr111287 ------
NM_006162chr1821559 1191 1497 --2655 267
NM_006166chr12102147 1750 1715 1670 1638 1059 887 793 561 417 ------
NM_006177chr143761 709 187 ------
NM_006180chr951833 630 280 225 66 --1207 11878
NM_006186chr22802 119 1432 ----
NM_006190chr2--1810 ----
NM_006194chr14--1868 11324 --
NM_006195chr93969 958 165 ----11151
NM_006197chr85698 661 305 239 21 --1135 --
NM_006203chr595429 4633 3904 2001 1227 1121 654 208 100 32195 1218 1194 --21406 1159
NM_006206chr42635 615 1221 ----
NM_006207chr8----1284 --
NM_006211chr82240 210 ------
NM_006216chr2171 ------
NM_006224chr1751838 1693 392 296 271 11673 ----
NM_006226chr251358 884 365 342 165 133 ----
NM_006237chr1321453 543 ------
NM_006241chr352291 1994 1522 920 776 11680 ----
NM_006243chr12969 258 ------
NM_006245chr62372 356 ------
NM_006246chr142516 499 11083 1443 --
NM_006251chr573395 2684 2442 1275 1132 861 190 --13192 --
NM_006252chr1197614 6584 5408 5257 5212 4839 4708 2858 2749 2559 1766 1379 1360 1167 898 763 681 652 65 57479 2407 827 317 170 24972 3007 --
NM_006256chr142586 1992 1700 67 ------
NM_006264chr44548 529 33 27 ----1567
NM_006265chr82326 136 --1170 --
NM_006267chr241213 692 451 30 11767 ----
NM_006279chr11327 ------
NM_006281chr831130 1061 434 --31108 939 886 --
NM_006281chr831130 1061 434 --31108 939 886 --
NM_006282chr20114339 4323 4129 3864 3544 3098 1516 1118 752 422 174 14040 21897 101 1211
NM_006283chr8144861 4800 4635 4152 3668 3408 1786 1763 1756 1375 939 884 290 64 13600 23856 313 --
NM_006287chr252259 2163 2089 1035 255 21785 1066 1353 --
NM_006293chr1511008 ------
NM_006298chr642751 2700 1067 369 --21280 966 --
NM_006301chr122503 483 ------
NM_006306chrX104629 4374 2029 1777 1720 1292 913 885 550 534 --24793 4358 --
NM_006313chr123686 633 352 11306 ----
NM_006321chr312217 11503 ----
NM_006323chr41246 ------
NM_006327chr102343 44 ------
NM_006330chr871528 1516 1405 1201 1115 313 150 --11024 --
NM_006333chr24446 231 168 41 ------
NM_006346chr131374 ------
NM_006350chr51269 1132 ----
NM_006357chr22371 43 ----1510
NM_006359chrX52465 2219 2050 1898 913 ------
NM_006364chr143307 76 56 ------
NM_006366chr631289 1043 956 ------
NM_006367chr111041 ------
NM_006371chr365070 4818 4612 2037 934 134 --15142 --
NM_006375chrX11652 ----11471
NM_006377chr961295 1227 965 884 333 271 ------
NM_006378chr941336 1240 1022 520 ------
NM_006380chr1753373 972 817 588 288 --13961 11161
NM_006386chr2232272 1635 329 21696 758 12454 --
NM_006387chr1921054 108 ----2935 930
NM_006389chr1111206 --129 --
NM_006393chr1053333 1755 1268 626 611 1962 13622 --
NM_006403chr621336 83 41766 1173 557 311 ----
NM_006411chr631024 659 39 1738 2898 277 --
NM_006413chr103312 180 99 ------
NM_006416chr62669 632 ------
NM_006420chr2083197 2669 2336 2151 889 104 70 55 32905 2624 822 1235 --
NM_006421chr81920 ------
NM_006431chr121173 --1209 --
NM_006434chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_006449chr242178 2166 1633 797 22086 1561 ----
NM_006451chr52804 411 ------
NM_006454chr433111 1939 769 12724 22190 943 12022
NM_006457chr484000 3636 2773 2701 2650 2631 636 446 --23946 928 1277
NM_006459chr1031598 1588 106 ------
NM_006460chr1731321 598 348 ------
NM_006465chr1531766 889 354 12193 --179
NM_006467chr552071 1707 917 715 221 1611 ----
NM_006469chr121447 991 11254 --1275
NM_006471chr18196 ------
NM_006476chr112696 567 --1505 --
NM_006482chr1283570 3412 2905 2681 2521 1298 157 112 22446 898 12975 --
NM_006489chr1472038 1994 1846 1831 1791 1439 667 11481 11764 11674
NM_006496chr142030 1874 1399 358 11542 21606 476 --
NM_006497chr171526 ------
NM_006510chr62864 62 --1394 --
NM_006513chr11223 --136 --
NM_006516chr141506 1101 1083 528 --11453 11406
NM_006517chrX11967 2772 117 11548 1755
NM_006519chr6------1236
NM_006526chr2051903 1525 1396 514 348 1694 ----
NM_006534chr2093350 2675 2565 2490 2327 1042 579 148 94 ------
NM_006536chr131016 402 367 --2960 953 --
NM_006537chr15147 ------
NM_006540chr831474 595 442 ------
NM_006541chr101202 ------
NM_006544chr14105315 5135 5054 4814 4632 4193 2138 1617 1463 1071 --14276 --
NM_006546chr17106655 6104 5569 4593 4555 2639 2392 1158 722 493 25555 2172 1391 12418
NM_006547chr742146 2107 1406 857 ------
NM_006549chr1252439 2355 2019 1055 696 --1123 --
NM_006557chr921475 1442 11739 ----
NM_006558chr82360 327 ------
NM_006559chr1161 1462 ----
NM_006561chr1095959 4672 4516 1947 1673 996 218 51 31 22045 99 35885 5352 4914 --
NM_006565chr161108 161 ----
NM_006566chr182356 157 --1872 --
NM_006575chr1461131 1018 578 357 330 181 11309 11347 --
NM_006582chr1----182 --
NM_006595chr1121395 333 11738 12019 --
NM_006599chr16198167 7587 7061 6461 6031 5293 5147 5060 5048 2571 2510 2212 1948 1883 1532 1431 936 723 196 --13221 37130 5882 5269
NM_006601chr121233 1303 ----
NM_006602chr201171 1230 ----
NM_006603chrX41981 1286 585 36 --11369 --
NM_006608chr1----1433 --
NM_006609chr262309 2289 1180 963 447 309 ------
NM_006614chr353401 2785 2583 1275 54 --1822 --
NM_006618chr13550 416 142 --11327 --
NM_006620chr694469 4292 3819 3764 3388 3211 1142 881 812 13791 23146 1504 1805
NM_006621chr151976 1352 625 381 276 ----1136
NM_006624chr1032125 1857 486 21555 734 1738 --
NM_006625chr12841 458 ------
NM_006625chr12841 458 ------
NM_006625chr12841 458 ------
NM_006626chr942607 2533 1839 518 --11852 1205
NM_006628chr1594004 3199 1856 1682 1026 937 495 96 64 24282 2854 11815 1330
NM_006629chr1852844 2578 1801 1793 130 ------
NM_006636chr24847 645 366 331 ------
NM_006644chr131460 --1689 1677
NM_006646chr1323017 2420 12474 22945 2478 12768
NM_006650chr543063 1373 669 557 ----11011
NM_006654chr1274430 3557 1001 843 667 137 69 13330 23030 76 1656
NM_006667chrX3800 443 47 ------
NM_006675chr1242949 2364 1361 474 --1549 --
NM_006690chr2032213 1667 897 12312 12368 --
NM_006698chr2021313 495 --1508 --
NM_006699chr1--1606 --11684
NM_006710chr24962 910 383 207 --129 --
NM_006714chr61282 --1308 --
NM_006717chr973256 2538 2376 2229 2088 800 275 --23238 2916 --
NM_006720chr1021819 310 11432 13531 --
NM_006721chr103333 276 90 1255 --1176
NM_006722chr332330 918 601 1991 --12506
NM_006726chr41324 --1906 --
NM_006727chr51120 ----1486
NM_006729chrX165602 4868 4729 4361 4311 4194 3830 3784 3682 3531 3441 1131 592 465 247 106 1637 24467 1035 25580 569
NM_006731chr9185739 5120 4741 4733 4510 2328 2079 1966 1956 1839 1437 1319 1021 999 993 829 535 140 24831 4038 14797 12266
NM_006734chr611534 11330 127 --
NM_006738chr1584599 4497 4020 4005 3424 3204 2977 1555 24069 762 11311 22920 635
NM_006750chr16117740 6345 6159 5845 4888 2964 2582 1846 985 921 326 26692 587 57053 6666 6012 5445 2954 22262 241
NM_006751chr22299 163 1251 ----
NM_006754chr711200 ------
NM_006756chr821328 492 --1604 --
NM_006759chr2------1218
NM_006763chr121865 510 ------
NM_006766chr8112584 2357 2342 2208 1912 1873 1793 402 347 236 180 1423 1466 12333
NM_006769chr12525 262 ----137
NM_006772chr641717 1673 1475 161 ------
NM_006775chr632685 2077 134 --1288 12329
NM_006777chrX42405 582 232 111 1344 ----
NM_006788chr18--22034 54 ----
NM_006791chr152496 63 ----1196
NM_006802chr131109 177 127 1784 ----
NM_006803chr851716 1559 1382 757 327 --145 --
NM_006807chr172481 339 ------
NM_006808chr9253 25 ------
NM_006815chr121423 ----1855
NM_006818chr14918 624 174 156 ------
NM_006823chr841364 1037 398 236 ------
NM_006825chr122952 611 ------
NM_006826chr241245 1205 522 53 ----1231
NM_006827chr1483309 3117 2787 1219 831 606 530 421 12549 --1849
NM_006831chr114404 341 267 43 ------
NM_006832chr141103 ------
NM_006838chr1241834 1321 1182 524 1452 ----
NM_006851chr1232450 1945 861 3873 782 101 1176 12595
NM_006852chr1752515 2222 1064 916 449 ----1731
NM_006854chr771598 1547 1493 1467 795 192 183 11913 ----
NM_006856chr1251154 1017 796 728 699 --11008 169
NM_006870chr203809 654 318 --2554 116 --
NM_006873chr253580 2864 2690 617 369 12303 1359 --
NM_006874chr421208 1124 ------
NM_006875chrX1265 ------
NM_006884chr322014 150 ----21897 1550
NM_006885chr1633506 2585 974 --11151 13327
NM_006886chr20134 ------
NM_006888chr1433532 711 98 --13548 --
NM_006892chr2021020 242 11157 2970 963 --
NM_006892chr2021020 242 11157 2970 963 --
NM_006896chr71956 --21079 936 --
NM_006898chr2--1571 1734 --
NM_006901chr15----1364 --
NM_006912chr122285 24 ----1724
NM_006915chrX52543 2273 2191 179 153 22371 2041 12375 --
NM_006920chr221492 1258 1364 21812 413 --
NM_006922chr252358 2001 1645 863 385 12015 12333 --
NM_006924chr17104196 3389 3190 2962 1248 901 430 340 313 73 1423 12705 --
NM_006930chr531988 1711 653 --11403 11978
NM_006931chr1212094 21974 1602 --1243
NM_006937chr171438 --1132 --
NM_006940chr1261850 752 707 685 569 493 21860 1483 --11754
NM_006943chr2033342 2854 99 ----23185 2206
NM_006948chr2112176 ----21957 1819
NM_006951chr10--1693 ----
NM_006981chr912181 12321 187 12679
NM_006996chr171768 1532 1437 1384 1272 712 105 --1578 --
NM_006999chr541921 1375 190 165 --1347 --
NM_007005chr931141 616 554 ------
NM_007006chr1653416 2191 658 471 307 --1103 33557 3099 2302
NM_007007chr1254818 4446 3954 3219 1405 --21799 1556 --
NM_007008chr22317 51 --133 1193
NM_007010chr1721490 369 --11294 --
NM_007011chr15126801 6466 5992 5735 5659 4702 4370 2064 780 576 385 81 --55844 5807 2694 2644 1568 11809
NM_007017chr52854 298 --1830 1620
NM_007023chr22420 261 1730 1246 --
NM_007034chr121026 742 --1217 --
NM_007035chr123684 608 122 ------
NM_007038chr21106051 4920 4384 4215 4165 4125 3861 926 707 349 35299 4078 935 15486 11729
NM_007039chr1442032 1647 686 506 --11471 --
NM_007042chr352657 2488 1941 995 835 32558 1751 735 11652 1396
NM_007043chr1251769 1372 669 569 32 ----11987
NM_007045chr62228 156 1118 ----
NM_007054chr553383 3118 2995 782 630 23426 2599 13430 --
NM_007064chr311371 11341 11709 192
NM_007067chr1741348 1127 537 518 11004 21369 72 --
NM_007078chr1042637 2484 1970 934 42976 2222 2172 954 ----
NM_007084chr1351549 1402 1275 1194 1180 ----1222
NM_007106chr1372841 2739 2456 1874 1746 751 281 --32546 1725 145 --
NM_007111chr134872 828 281 251 ------
NM_007114chr3143169 3105 3000 2823 2814 2745 2592 2416 2280 1312 1191 1002 712 240 ------
NM_007124chr651984 1617 1263 733 445 ------
NM_007125chrY31448 441 320 --1378 --
NM_007126chr91208 ------
NM_007129chr13----11026 --
NM_007137chrX75521 5253 4033 3905 3545 2062 773 43645 2086 1748 133 14268 --
NM_007144chr1731295 490 263 ------
NM_007145chr191377 --11325 --
NM_007146chr1712082 1507 12138 --
NM_007157chrX62764 1991 991 575 548 298 12060 31095 781 92 --
NM_007158chr151161 1110 496 333 75 ------
NM_007159chr321529 365 ----11523
NM_007166chr1141436 1402 1185 435 ------
NM_007173chr1182427 2223 2062 1763 937 793 331 210 1924 1425 --
NM_007174chr1232194 2016 495 11953 3804 234 31 --
NM_007175chr863281 3106 2506 700 655 348 --22443 834 --
NM_007185chr13884 749 217 ------
NM_007187chr132989 66 ------
NM_007192chr144990 461 449 96 1321 ----
NM_007200chr1584599 4497 4020 4005 3424 3204 2977 1555 24069 762 11311 22920 635
NM_007204chr14608 190 184 100 ------
NM_007212chr132290 1838 1407 22056 553 1805 --
NM_007214chr651350 899 528 293 232 ------
NM_007217chr3157 1144 ----
NM_007222chr811337 --11736 --
NM_007235chr12--1439 1443 --
NM_007236chr152795 237 --1251 --
NM_007249chr13269355 8955 8902 8601 8326 8268 8128 7877 7768 7726 7403 6599 6496 5878 5791 5741 5700 3635 2907 2668 2359 2118 1819 1412 694 645 26036 2892 78578 7638 7357 5818 5733 1882 845 25781 2897
NM_007269chr12166 127 ------
NM_007271chr621378 195 --1635 --
NM_007276chr7----1258 --
NM_007281chr4174 ------
NM_007282chr31162 1782 ----
NM_007286chr542141 1939 1927 848 1778 ----
NM_007287chr362511 1176 1066 696 573 538 --21273 215 --
NM_007288chr362511 1176 1066 696 573 538 --21273 215 --
NM_007289chr362511 1176 1066 696 573 538 --21273 215 --
NM_007308chr43172 116 93 1596 --1564
NM_007313chr981801 1787 1327 600 519 362 235 217 ------
NM_007320chr191234 ------
NM_007324chr1164 ------
NM_007331chr442693 2679 2498 1983 1481 ----
NM_007345chr1841924 1448 132 120 12336 --11915
NM_007346chr201343 ------
NM_007347chr1553193 3012 2929 2651 961 ----11246
NM_007349chr72338 164 ------
NM_007350chr1294658 4178 3461 2885 1488 802 356 247 63 14640 --24645 879
NM_007358chr151815 1498 1318 724 565 ------
NM_007361chr141515 ------
NM_007362chr361465 1225 1082 1076 973 551 ------
NM_007363chrX4814 768 343 334 ------
NM_007373chr10160 --11215 --
NM_007375chr142282 2194 1947 527 ----2552 547
NM_009585chr31818 ------
NM_009585chr31818 ------
NM_012062chr123847 741 254 1400 ----
NM_012064chr1211042 --21126 1103 --
NM_012069chrX2913 56 --1127 147
NM_012081chr572964 2734 2638 2381 1242 938 168 22822 945 --23596 1230
NM_012082chr82791 271 ------
NM_012089chr141551 1384 555 291 11508 ----
NM_012090chr141234 982 365 339 1391 --11098
NM_012092chr221608 114 1410 ----
NM_012093chr151248 1218 1130 460 357 ------
NM_012096chr353679 2618 1232 602 344 1890 1237 --
NM_012097chr222251 1808 ------
NM_012102chr141883 1866 1778 1062 --12152 --
NM_012104chr1143463 2962 2530 784 22728 707 21421 687 --
NM_012104chr1143463 2962 2530 784 22728 707 21421 687 --
NM_012117chr12----125 --
NM_012124chr11--1116 2209 175 --
NM_012129chr711866 --1979 --
NM_012134chr121464 1330 --21226 169 --
NM_012137chr132647 2382 284 21951 1793 32655 1024 948 --
NM_012141chr13113831 3332 2789 2720 2568 1090 744 569 172 150 84 --12714 --
NM_012154chr81648 ------
NM_012156chr2073142 2171 1023 704 471 269 26 13129 12579 --
NM_012158chr1321563 212 ------
NM_012161chr44293 125 77 32 ----11065
NM_012164chr9177471 7451 7371 7306 7065 6410 5778 5728 5553 5521 5352 5256 2621 1892 1208 230 131 27349 2073 21218 280 --
NM_012183chr12458 426 ------
NM_012193chr1194896 3473 1863 1813 1762 733 703 521 30 ----14515
NM_012199chr131814 1517 232 ----13853
NM_012210chr961009 627 556 531 409 143 --11050 11137
NM_012214chr276049 5500 4937 2536 1734 962 931 24662 1536 34291 1779 132 15982
NM_012215chr1041776 1678 1326 1272 --1372 --
NM_012218chr191345 ------
NM_012219chr363235 2527 2510 1140 886 83 --22391 2376 --
NM_012223chr241332 1205 1094 831 11234 11271 --
NM_012224chr431230 1110 187 ------
NM_012234chr3103706 3442 3398 2994 2576 2543 1273 890 679 237 ------
NM_012238chr1041777 1470 1192 280 ------
NM_012243chr12870 373 1765 1769 --
NM_012247chr103779 364 257 --1279 --
NM_012249chr283378 2986 2270 1276 1162 382 344 36 11332 12901 --
NM_012250chr1131073 216 73 2499 439 2171 47 --
NM_012252chr7185254 5037 4646 4574 4341 4238 3830 3738 3418 3309 2117 2080 1979 1192 688 631 526 394 --21205 388 11960
NM_012255chr201313 1418 ----
NM_012257chr71770 --11095 --
NM_012259chr621001 947 147 11292 --
NM_012262chr1114862 4657 4332 4157 3966 3597 1712 1546 1448 1421 1078 14103 11291 25265 1926
NM_012281chr761991 1887 1853 1767 954 177 ------
NM_012286chrX------1183
NM_012287chr384487 4013 2898 1689 1192 353 268 166 ----13548
NM_012288chr6115671 5430 3665 3634 2015 1725 1469 1107 589 521 371 1107 21742 1019 15137
NM_012290chr231234 578 166 ------
NM_012293chr241824 1661 350 313 31624 645 113 ----
NM_012294chr774042 2962 2647 1539 1395 798 472 --23051 1447 --
NM_012297chr462511 2473 2380 663 591 129 --2544 109 --
NM_012300chr552325 699 641 459 165 ------
NM_012302chr11788 ------
NM_012304chr582454 2023 1880 1796 1747 1608 1574 220 --2969 151 --
NM_012308chr1172490 906 793 755 452 325 180 12135 ----
NM_012309chr1163627 3289 1571 1108 1047 604 ----13525
NM_012311chr102654 456 ------
NM_012316chr1135434 5223 4920 4721 4176 3933 3745 3537 1961 1575 883 435 387 14889 23721 1232 --
NM_012319chr182935 905 ------
NM_012322chr71328 ------
NM_012323chr2241573 1330 1173 93 1560 1330 --
NM_012325chr2011265 1431 ----
NM_012327chr1831577 250 153 --1643 --
NM_012329chr1731626 1054 531 --1451 --
NM_012330chr1051755 1600 1152 525 342 1414 1219 --
NM_012334chr543526 3492 2880 949 13828 22902 571 --
NM_012341chr101475 ------
NM_012342chr10292 76 --1101 --
NM_012343chr531056 719 278 --1849 --
NM_012382chr573198 3009 1406 1280 741 502 483 --12872 --
NM_012397chr1871830 1752 1719 1711 1625 1207 109 21603 1130 21396 561 --
NM_012399chr221651 11648 ----
NM_012406chr122904 65 ------
NM_012416chr941001 396 180 29 --1167 --
NM_012417chr172594 39 ------
NM_012419chr6123 --1575 --
NM_012420chr1021749 43 11544 2549 292 --
NM_012421chr1--1431 ----
NM_012425chr1042298 1686 548 202 --12661 1573
NM_012433chr21238 --1250 --
NM_012434chr621369 439 --11441 --
NM_012454chr62453 37 ------
NM_012465chr103839 622 468 23389 1230 12170 --
NM_012467chr16123 ------
NM_012471chrX31645 465 136 1228 ----
NM_012481chr174638 600 570 274 ------
NM_012482chr14566 530 523 469 3554 493 463 ----
NM_013230chrY31619 379 41 ------
NM_013231chr1443458 3378 3268 3052 11729 21152 752 13415
NM_013233chr24954 266 108 84 ------
NM_013236chr223919 903 782 --2502 57 --
NM_013242chr162362 92 ------
NM_013254chr122602 193 ----1655
NM_013255chr7238875 8684 7815 7744 7622 7246 6311 5832 5815 5554 5491 3486 3363 2901 2882 2606 2579 981 942 926 915 416 271 25977 1083 45699 2589 2156 2116 16362
NM_013257chr852068 873 707 580 104 1173 11860 --
NM_013261chr443020 2517 2357 1392 1419 ----
NM_013262chr6----1503 --
NM_013269chr1274288 4034 3501 3347 637 474 464 23325 1397 11406 13333
NM_013272chr152354 47 ------
NM_013280chr113855 601 571 ------
NM_013281chr2021185 590 ------
NM_013283chr51209 ------
NM_013286chr33496 490 120 --199 --
NM_013293chr72221 203 ------
NM_013302chr1683417 3329 3269 1518 1376 1001 607 138 11185 --13488
NM_013309chr1582656 2640 2596 2409 1926 1742 1716 973 12354 ----
NM_013313chr22103550 3350 3031 2935 2508 2169 1362 1160 470 148 1799 --1638
NM_013316chr72417 175 --2785 90 --
NM_013322chr721731 1251 1625 ----
NM_013323chr175867 770 406 309 286 --11010 --
NM_013341chr242790 2759 2514 1949 12097 12241 12922
NM_013364chrX2550 25 ------
NM_013368chr191215 1129 140 --
NM_013372chr1553229 2978 2876 586 492 --11065 --
NM_013374chr363101 2913 2758 2213 659 551 12792 11249 --
NM_013377chr122467 157 ------
NM_013381chr1252400 2175 2071 874 619 --1768 1818
NM_013391chr51383 ----1104
NM_013411chr151991 1768 705 487 299 ----22558 360
NM_013433chr191474 --1278 --
NM_013436chr21239 --1566 --
NM_013437chr871312 476 401 322 316 305 240 ------
NM_013438chr95639 626 510 369 81 --1705 --
NM_013444chrX3842 766 96 ------
NM_013449chr1262558 2246 2127 1918 707 35 --22714 2267 --
NM_013450chr261108 1045 979 863 801 381 ------
NM_013451chr10----1198 122
NM_013943chr1113262 2997 2753 2503 2390 2130 2108 808 729 288 155 ----11110
NM_013975chr171433 ------
NM_013981chr51152 ------
NM_013982chr51152 ------
NM_013983chr51152 ------
NM_013995chrX2889 290 1754 ----
NM_013996chr72420 34 ----1497
NM_013996chr72420 34 ----1497
NM_013997chr72420 34 ----1497
NM_013997chr72420 34 ----1497
NM_013998chr72420 34 ----1497
NM_013998chr72420 34 ----1497
NM_014011chr2--21901 1642 1949 --
NM_014016chr33677 445 123 11545 ----
NM_014021chr133371 2385 2226 --188 11085
NM_014023chr1042654 2484 2421 2272 ----1648
NM_014028chr663159 1217 841 592 526 220 2656 338 13345 --
NM_014034chr631488 976 428 ------
NM_014039chr111916 ----1250
NM_014043chr321046 632 11354 ----
NM_014044chr21186 --158 --
NM_014048chr1665062 2025 1832 1144 1037 248 65284 4960 4013 3627 951 168 24022 1271 --
NM_014055chr123521 417 394 ------
NM_014057chr9--1106 21521 1352 --
NM_014089chr1351854 1726 617 437 168 22084 785 11932 --
NM_014106chr1562845 2517 1983 1099 348 314 1438 11160 --
NM_014109chr8101235 1215 1176 1035 969 840 478 417 96 52 --1429 --
NM_014110chr131085 300 106 ------
NM_014112chr895005 4124 3948 2196 2190 974 795 733 256 45213 3401 1938 1515 15419 --
NM_014117chr1672514 1734 1688 990 912 372 91 ------
NM_014141chr745315 4987 4757 830 --14846 --
NM_014154chr321098 459 11372 ----
NM_014155chr11117203 5967 5123 5025 4881 4714 2084 1874 1855 1699 1417 26009 1274 35902 5654 819 26945 104
NM_014157chr1663907 3701 3307 1491 1235 646 23814 900 23267 135 --
NM_014175chr82144 138 ------
NM_014176chr12170 119 ----123
NM_014181chr222522 364 12643 1278 12723
NM_014191chr124952 355 159 132 ------
NM_014217chr131854 483 138 --11320 --
NM_014223chr11768 ------
NM_014231chr122804 152 11562 ----
NM_014232chr173631 510 317 ------
NM_014232chr173631 510 317 ------
NM_014233chr1731859 1370 665 --21427 677 --
NM_014243chr451497 551 434 192 111 11983 ----
NM_014245chr32318 175 ------
NM_014251chr73858 150 101 --1816 --
NM_014252chr13--1143 1410 156
NM_014253chrX52370 2291 816 510 336 11847 11921 --
NM_014263chr1031508 1255 137 ------
NM_014264chr42550 538 ------
NM_014267chr113875 819 684 --1321 --
NM_014268chr181559 --1284 11352
NM_014278chr43383 113 58 --1169 --
NM_014279chr92975 355 ------
NM_014288chr11210 ------
NM_014289chrX51381 1366 1126 1012 352 21190 459 ----
NM_014293chr2283597 3476 3458 3364 3023 1531 1081 130 2362 213 ----
NM_014294chr861235 1223 1083 1035 1015 398 ------
NM_014299chr1942237 710 680 299 --1661 --
NM_014302chr7------130
NM_014309chr2244665 4609 1550 275 --21208 774 1632
NM_014316chr1642189 1409 727 130 1766 ----
NM_014317chr101104 ------
NM_014319chr1261768 1693 1672 1549 485 117 ------
NM_014322chr11971 11099 21021 256 1282
NM_014323chr222190 111 ------
NM_014325chr1231384 631 569 1123 --1697
NM_014331chr4197437 7402 7031 6828 6608 6432 5609 5549 2471 2173 2162 2044 1982 1621 1456 1075 727 720 68 22524 773 16343 37644 6719 4790
NM_014333chr1142258 2128 1051 731 22365 2238 ----
NM_014342chr113949 106 28 1495 ----
NM_014344chr112798 635 ------
NM_014345chr61357 1124 --187
NM_014351chr2251471 1396 1171 462 74 --1381 --
NM_014352chr112960 485 --11393 1544
NM_014363chr132965 436 ------
NM_014372chr11778 --11938 --
NM_014376chr572563 2557 1945 911 361 180 26 1742 32194 516 478 --
NM_014379chr82685 142 ----1112
NM_014382chr361761 1360 1239 1117 530 54 ----1421
NM_014388chr1125273 4865 4618 4526 4226 2225 1480 722 689 205 142 134 11001 55725 5524 4708 3703 2269 1445
NM_014392chr461573 1170 629 436 242 104 31595 192 66 ----
NM_014393chr851988 1489 298 169 54 ------
NM_014396chr762130 2032 1824 1470 538 137 11636 11975 12183
NM_014397chr951164 899 538 500 58 ------
NM_014405chr1731731 1588 533 12211 1335 --
NM_014415chr351554 1215 638 331 34 21587 480 ----
NM_014421chr431909 1611 765 11897 ----
NM_014423chr555215 1539 969 878 490 45552 5360 3956 795 --14020
NM_014429chr32720 205 ------
NM_014431chr1021661 590 ------
NM_014445chr332234 1986 1796 12316 ----
NM_014447chr431626 436 422 --31381 1083 633 --
NM_014452chr61432 ------
NM_014456chr1031343 277 119 --1512 --
NM_014458chr141385 1329 1072 323 1540 ----
NM_014491chr72969 706 ------
NM_014494chr1641867 1783 865 805 21930 420 11907 --
NM_014497chr2172 ------
NM_014502chr11------2128 37
NM_014504chr72622 213 11975 --11336
NM_014515chr122797 246 ------
NM_014516chr191240 ------
NM_014517chr331771 1243 765 11963 11693 --
NM_014547chr155711 572 527 288 189 ------
NM_014547chr155711 572 527 288 189 ------
NM_014548chr1541655 1555 387 162 11549 31648 576 103 11065
NM_014554chr1231691 622 277 22199 175 ----
NM_014570chr222641 234 166 --1720
NM_014571chr162385 2255 2168 2088 235 158 11159 42686 2631 2619 2552 --
NM_014573chr1721176 281 --11865 --
NM_014574chr1411551 1152 1441 --
NM_014577chr222587 164 ------
NM_014584chr1431415 1325 600 --11352 --
NM_014585chr22342 327 1421 11207 --
NM_014586chr2194848 4447 4240 4184 3378 1921 1617 682 28 24672 3021 34585 1021 616 11474
NM_014592chr52702 594 --1260 --
NM_014602chr3285 67 ------
NM_014607chr22565 557 11741 11764 --
NM_014612chr921260 1029 ------
NM_014614chr231201 1108 116 --11296 2386 377
NM_014615chr1652804 2734 1077 518 47 ------
NM_014616chr373209 2930 2528 2449 2245 1358 1129 1285 32898 577 237 --
NM_014618chr91139 ------
NM_014620chr121502 ------
NM_014623chr6292 86 ------
NM_014630chr15103482 3012 2972 2924 2852 2799 2784 1464 998 253 12445 33146 1556 1214 --
NM_014633chr111159 --128 --
NM_014636chr994362 3874 3435 3326 3235 3002 1662 1260 740 --11698 24199 1012
NM_014637chr841008 456 433 346 ------
NM_014647chr1632161 2113 1568 ----1124
NM_014666chr52835 213 ------
NM_014667chr342435 1918 744 581 22263 1697 ----
NM_014670chr261424 1412 1206 508 249 82 --11213 --
NM_014671chr721177 575 1290 11182 --
NM_014676chr141527 1222 454 407 ------
NM_014677chr821006 353 ------
NM_014682chr831718 1700 340 11455 1438 --
NM_014683chr1751904 1486 1398 789 472 ----11862
NM_014686chr1932295 991 502 11717 ----
NM_014689chr2--1458 ----
NM_014690chr783066 2824 2695 2500 1996 879 585 373 22451 421 11937 12110
NM_014701chr1563235 3186 3172 3007 643 26 1619 11202 171
NM_014702chr6113202 3112 2853 2815 2787 2521 2125 1398 978 858 158 ------
NM_014705chr732031 1307 227 ------
NM_014707chr752033 1921 1874 810 650 11861 ----
NM_014709chr22642 182 ------
NM_014711chr1651352 746 435 118 109 --2370 212 12130
NM_014717chr193857 810 66 ------
NM_014720chr102694 219 --161 1251
NM_014721chr6146842 6502 6162 5345 5312 4970 4926 4764 4558 2835 2267 1657 1560 660 11419 32047 1185 40 11804
NM_014726chr1741005 553 408 151 ------
NM_014729chr82764 552 ------
NM_014730chr1284369 4226 1509 1177 799 723 556 294 1382 23384 1326 --
NM_014730chr1284369 4226 1509 1177 799 723 556 294 1382 23384 1326 --
NM_014731chr2041763 1332 1249 77 ------
NM_014735chrX42067 1552 782 379 1486 ----
NM_014742chr20----1633 1191
NM_014743chr462526 2255 1143 984 536 135 22623 299 ----
NM_014746chr273685 3586 3561 1200 1057 713 90 21139 748 1752 11451
NM_014747chr1125671 5186 5058 4891 3730 1942 1176 1106 1082 881 272 218 14277 25291 795 25449 1766
NM_014749chr142294 52 ------
NM_014751chr821412 494 ------
NM_014755chr223238 1329 --11562 --
NM_014761chr162904 107 ------
NM_014764chr1241153 1135 511 491 1872 ----
NM_014765chr141954 1085 1046 805 12115 1612 --
NM_014766chr743554 3325 2578 1170 ----11009
NM_014773chr5--11086 21392 215 --
NM_014774chr162731 2286 2132 925 778 307 12465 12469 1966
NM_014776chr12122743 2511 2460 2447 2315 2134 1973 1044 845 636 483 411 22816 707 31000 657 572 1624
NM_014779chr34831 779 426 371 ------
NM_014781chr85827 501 270 160 90 ------
NM_014787chr112018 ----12059
NM_014790chr53515 416 363 ------
NM_014795chr231093 990 950 --11282 --
NM_014800chr731137 814 175 --1749 --
NM_014802chr12170 --11098 --
NM_014803chr1042761 2691 1948 1025 12334 --1820
NM_014810chr183361 3153 2957 2394 1170 1092 884 856 1820 33269 1070 519 --
NM_014812chr13787 409 355 ------
NM_014819chr542469 2202 1842 290 --22517 905 --
NM_014822chr43502 105 32 1258 ----
NM_014824chr115703 655 593 426 196 --2402 209 1815
NM_014826chr184123 4059 3788 3489 3114 3058 1409 961 43824 3549 3388 1538 2894 66 21688 1490
NM_014827chr131441 138 60 --31041 223 90 --
NM_014828chr1452494 2307 1961 567 35 ------
NM_014829chr522210 610 11647 22094 383 1930
NM_014830chr1262917 2785 2746 1537 832 554 --1741 --
NM_014836chr1031955 149 84 21696 1357 ----
NM_014838chr2262522 2451 1128 1087 1079 810 1630 12475 12458
NM_014839chr142376 2291 2270 419 11951 ----
NM_014840chr1243404 3306 1344 326 13223 1629 --
NM_014841chr62428 413 ------
NM_014844chr1423706 143 32910 775 686 --11104
NM_014850chr353352 1160 1059 542 487 34269 1957 1892 ----
NM_014859chr1711410 --1985 --
NM_014860chr281644 1638 799 656 521 451 437 308 1621 ----
NM_014862chr1564119 4075 3987 3846 245 123 ------
NM_014864chr184225 3601 3585 3250 2881 1755 1262 1114 ------
NM_014870chr133233 1168 1058 21332 106 54153 3580 1713 795 620 --
NM_014871chr121537 --1672 --
NM_014872chr942073 1622 950 167 --12015 --
NM_014873chr174677 4625 4572 4191 683 671 417 --11896 --
NM_014874chr131815 501 294 --11374 --
NM_014876chr2221912 635 22037 102 ----
NM_014877chr17197617 7501 7294 7109 6597 6585 6125 5329 5295 4716 2947 2887 2577 1727 1561 1367 498 466 78 11207 17408 --
NM_014883chr432374 700 332 --1632 --
NM_014888chr73427 223 103 11172 ----
NM_014890chr32262 248 ------
NM_014891chr741347 1297 446 325 21514 234 1145 1605
NM_014893chrY42092 2045 1605 824 32385 2305 297 ----
NM_014897chr1753289 1157 879 194 78 12838 12885 21077 1072
NM_014900chr23756 259 106 ------
NM_014901chr542022 802 468 120 ------
NM_014902chr2011464 ------
NM_014903chr1252298 1534 901 803 410 --1940 --
NM_014904chr1043909 2989 2845 194 --11488 12696
NM_014905chr211536 --11966 1113
NM_014906chr1774121 3935 3745 998 905 406 77 14027 --21198 816
NM_014909chr1433722 3712 1012 23397 395 --33923 3886 2894
NM_014912chr1043381 3221 3075 977 ----11384
NM_014914chr23931 436 402 11310 ----
NM_014918chr1551542 1460 1190 186 37 1444 1526 --
NM_014920chr693376 3238 3071 2968 2783 2654 2608 1237 1056 13306 23119 2839 --
NM_014921chr1932501 1893 1176 ------
NM_014923chr1331924 478 124 ------
NM_014924chr1432507 1948 156 22729 1975 ----
NM_014925chr122769 615 ------
NM_014926chr32794 441 ------
NM_014932chr321975 1690 ------
NM_014934chr1383252 2807 2506 1595 1528 1256 1084 783 23259 1344 22769 2527 --
NM_014936chr662259 1898 1089 970 336 226 1497 ----
NM_014938chr1232409 1959 711 --1931 --
NM_014939chr182958 136 21435 272 11349 1623
NM_014945chr5------12027
NM_014946chr232159 998 933 12127 ----
NM_014947chr132412 823 174 ------
NM_014949chr11964 ----1229
NM_014950chr1451742 1207 640 319 99 ------
NM_014953chr1354168 1088 469 368 281 --22849 1011 1300
NM_014961chr432215 1884 1397 --1746 --
NM_014962chr2021044 74 22002 1158 ----
NM_014964chr1762452 2226 1991 759 650 64 ------
NM_014970chr12233 215 ------
NM_014974chr1031372 1223 659 1255 11239 --
NM_014977chr142404 184 --1216 --
NM_014978chr102727 231 --1410 --
NM_014982chr14195444 4973 4823 4633 4562 4534 4331 3867 3748 1992 1844 1758 1437 1410 804 706 516 408 26 1869 1329 --
NM_014988chr462743 2626 2582 2281 502 35 21029 472 1775 --
NM_014989chr661856 1268 730 678 617 366 ------
NM_014990chr1431182 464 366 1861 ----
NM_014991chr492842 2686 2661 2009 1142 963 659 587 101 1319 1636 13296
NM_014992chr144608 328 283 111 1850 1702 --
NM_014996chr32355 183 ------
NM_014997chr752715 1880 1028 849 569 1172 22902 1019 --
NM_014999chr1241459 1265 1119 628 ------
NM_015000chr1242858 2277 458 367 ------
NM_015001chr11812 ------
NM_015002chr1271808 785 694 619 569 372 75 1527 ----
NM_015008chr332768 1363 218 ------
NM_015017chr12113 37 ------
NM_015020chr1653646 3156 621 417 82 ----1741
NM_015023chr121670 261 11387 1113 --
NM_015025chr272652 2505 2371 2336 2195 895 461 12705 12482 --
NM_015026chr12124527 4025 3999 3852 3109 3078 2923 1586 1058 457 268 82 24098 1690 24204 849 --
NM_015027chr1641796 1630 1616 628 11359 1742 --
NM_015032chr1372856 2601 2511 2383 1841 474 315 22405 2372 --12154
NM_015035chr2056611 6367 4270 2171 2039 25544 1798 56275 2386 1764 1465 422 1987
NM_015039chr193425 2974 2794 968 899 280 92 85 41 24301 4008 2948 180 --
NM_015042chr1552809 1332 1086 1062 487 1156 ----
NM_015044chr1673213 2954 2926 2794 2593 2004 265 --2787 281 128
NM_015045chr1021838 473 ------
NM_015051chr963149 2860 1261 1158 234 167 43112 2835 2790 406 1410 --
NM_015052chr72354 269 11323 ----
NM_015057chr133649 582 201 ------
NM_015059chr15103966 3840 3641 3583 3548 2553 2468 1090 617 146 --2880 822 --
NM_015064chr1252805 2788 2480 1440 1148 23313 532 13261 12709
NM_015068chr763338 1582 1516 1192 599 240 33235 1090 683 11094 --
NM_015069chr162260 94 ------
NM_015071chr5115687 5495 4998 4879 2174 1988 1873 1093 573 297 76 14035 34887 4318 163 1176
NM_015073chr1952020 1847 1828 1721 1582 ------
NM_015074chr1114831 4804 4616 4542 4398 3952 3712 1763 1183 597 162 14119 162 13478
NM_015076chr694302 3483 3148 1578 1335 1327 559 346 289 --14076 1726
NM_015085chr1743984 3966 2636 222 12877 23391 1013 12845
NM_015087chr1342480 2324 2262 2087 22718 1709 ----
NM_015090chr195919 5452 5197 4608 1973 1419 1134 565 382 --11150 15118
NM_015091chr143825 561 276 ------
NM_015092chr1694606 4342 3771 3722 3346 1270 1169 755 707 11396 1854 --
NM_015093chr631733 1343 1217 ------
NM_015094chr2211026 --34372 1783 1645 --
NM_015097chr352338 1830 1749 722 667 --11907 1271
NM_015100chr131562 1398 470 ------
NM_015107chrX52472 1949 870 599 461 ------
NM_015110chr931825 1003 811 21702 805 2520 492 11621
NM_015115chr442534 1973 537 354 1413 1622 --
NM_015125chr19198 --178 --
NM_015129chrX11758 ------
NM_015130chr43968 914 371 --11227 --
NM_015132chr761977 797 771 506 163 30 41893 1260 282 251 ----
NM_015135chr71129 ------
NM_015137chr842482 2013 1894 1814 --2559 363 --
NM_015138chr1542234 632 184 134 --1487 --
NM_015141chr392702 2598 2408 2395 2361 2169 770 674 385 1479 ----
NM_015143chr421272 242 124 ----
NM_015144chr16103514 3407 3339 3240 2972 2561 2518 2455 1050 224 11027 22980 955 --
NM_015149chr152170 2162 2070 886 225 ----1762
NM_015153chr66617 611 567 488 120 96 ------
NM_015155chr1062860 2230 902 882 838 412 12785 ----
NM_015156chr14103995 3143 1457 1320 768 661 574 414 259 94 1215 ----
NM_015157chr111413 11175 ----
NM_015172chr121617 241 ------
NM_015173chr411460 21758 1526 11384 --
NM_015176chr1----21116 445 --
NM_015186chr91454 ------
NM_015192chr2092675 2397 2362 2261 2243 960 924 469 90 12918 11002 --
NM_015197chr14159 172 ----
NM_015198chr711071 ------
NM_015199chr322342 1113 ----12926
NM_015200chr432431 1031 716 12317 ----
NM_015206chr1582797 2710 2642 1150 1134 845 119 50 11515 22996 2975 22992 2971
NM_015208chr1854082 3912 3196 460 148 33175 2843 830 --1923
NM_015209chr152091 2018 1833 795 255 ----12161
NM_015213chr111601 ------
NM_015215chr142850 2711 329 241 1992 3774 547 58 --
NM_015225chr962956 2647 2437 2292 813 657 1258 12335 --
NM_015230chr431753 1457 1344 11864 ----
NM_015233chr1352304 1871 1799 493 403 1848 1799 --
NM_015235chr1042087 1872 1580 644 ----22111 1506
NM_015245chr62952 666 --11907 --
NM_015247chr1685195 5182 4876 3278 2017 1556 1422 394 157 11407 14638
NM_015250chr921753 1664 ------
NM_015251chr1632155 1455 43 ------
NM_015252chr24903 731 342 197 ------
NM_015263chr151143 2823 31 ----
NM_015265chr262227 1998 885 424 267 166 --158 --
NM_015271chr4104301 4119 4036 3497 3455 2919 1678 1522 1043 416 ------
NM_015272chr1661782 1625 1485 863 167 24 12096 ----
NM_015277chr1811144 1237 ----
NM_015278chr683447 3381 3145 661 621 475 357 297 12163 2390 81 22376 728
NM_015282chr22997 768 11007 2887 828 --
NM_015286chr1532448 2123 1619 1737 1535 1576
NM_015288chr563197 3071 2463 1426 606 74 ------
NM_015296chr134860 164 110 52 1132 ----
NM_015310chr8188199 7769 7596 6868 6638 6595 5972 5807 5229 3306 3097 3069 2462 2391 2076 1978 1249 700 27577 667 27135 862 17803
NM_015313chr11154636 4447 4073 3881 3550 3413 3377 3112 1914 1791 1715 1568 1049 801 250 ----1888
NM_015314chr742496 1876 1625 655 1481 22427 637 --
NM_015315chr5103288 3243 3217 3089 2512 2331 1330 580 521 320 ----12391
NM_015317chr212192 12655 12406 --
NM_015326chr162807 2304 853 443 395 139 ------
NM_015327chr1--1316 ----
NM_015328chr773049 2999 2648 2356 1923 786 270 1832 12386 13014
NM_015335chr1252523 2410 2016 1780 594 1864 ----
NM_015336chr1232213 2090 192 1472 ----
NM_015338chr2081717 1691 1666 1259 1245 633 537 412 ------
NM_015339chr2051022 948 917 294 278 ------
NM_015344chr84397 342 226 43 ------
NM_015346chr1421592 319 ------
NM_015347chr1252663 2489 2102 1112 1076 --2242 229 --
NM_015349chr662878 2622 1047 989 559 377 12893 --1256
NM_015353chr171232 ------
NM_015355chr171536 --21695 1596 1620
NM_015358chr2121125 169 ------
NM_015361chr22716 52 1175 ----
NM_015365chrX114311 3409 3392 3355 3078 2937 1488 1371 700 452 82 ------
NM_015367chr2231531 1260 182 --1553 11522
NM_015385chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_015387chr251961 1423 732 224 62 --1718 21918 1383
NM_015393chr463752 3490 3315 2585 766 502 23655 362 23506 2993 --
NM_015396chr32264 71 --1159 --
NM_015429chr36975 756 446 270 187 73 ------
NM_015435chr83543 494 468 ------
NM_015436chr452740 2224 913 771 86 12859 32924 1144 344 --
NM_015446chr161380 1107 609 533 524 339 ------
NM_015447chr93783 532 104 ----1193
NM_015455chr583536 2957 1517 1398 1378 932 506 238 ----12687
NM_015457chr112299 214 ------
NM_015458chr8124706 4424 4348 4317 4209 1348 1323 1255 1233 817 487 240 24182 1713 23887 1501 --
NM_015460chr342144 1568 1466 469 1172 ----
NM_015472chr33397 208 43 ------
NM_015472chr33397 208 43 ------
NM_015483chr74808 308 265 47 1846 ----
NM_015484chr13868 845 606 --1781 --
NM_015488chr231732 397 263 --11544 1368
NM_015493chr1942087 820 442 58 11628 ----
NM_015497chr1531067 462 312 1172 ----
NM_015503chr162613 482 --1735 --
NM_015508chr311268 ------
NM_015509chr1221041 89 --2334 207 1367
NM_015516chr1141426 1253 1167 986 11130 ----
NM_015520chr332545 1058 358 --12480 --
NM_015523chr113251 107 34 ------
NM_015530chr23888 391 288 1674 ----
NM_015534chr131084 1050 1022 ------
NM_015535chr294050 3036 2823 2765 1485 1193 1183 860 133 14073 --1710
NM_015541chr331456 1118 94 11098 ----
NM_015542chr1011103 21199 94 --122
NM_015548chr64883 708 237 155 ------
NM_015549chr14--1602 ----
NM_015550chr7103339 3285 2981 2945 2893 2341 2271 1231 537 220 ------
NM_015553chr655164 4409 3402 1283 1234 24731 708 45049 4649 4016 1413 21324 180
NM_015555chr6----11323 11726
NM_015557chr151252 756 653 322 309 --22372 38 --
NM_015564chr563319 2761 2704 2648 1177 737 13383 13038 12350
NM_015565chr2121801 1644 ------
NM_015567chr1331085 822 304 ------
NM_015571chr642515 2256 902 486 --123 --
NM_015575chr252313 1095 975 926 300 1191 12945 1127
NM_015576chr362581 2265 2155 860 809 415 1972 41032 452 332 230 --
NM_015577chr541843 1718 723 37 1570 ----
NM_015578chr1921461 1341 ----1198
NM_015584chr172480 342 ------
NM_015602chr171608 1488 1366 1168 684 495 167 ----1189
NM_015605chr1051508 1479 978 592 196 ------
NM_015608chr10------1606
NM_015609chr132422 1172 1131 ------
NM_015610chr742510 1866 1760 178 12295 --11019
NM_015622chr7------1220
NM_015635chr951840 1376 1366 468 178 1778 ----
NM_015640chr1105147 4622 3407 1507 1491 1434 553 359 302 144 1781 33505 1855 1243 --
NM_015641chr73442 256 54 ------
NM_015642chr31105 ------
NM_015652chr102651 538 1151 ----
NM_015660chr73267 225 36 ------
NM_015676chr142358 149 ------
NM_015678chr1341323 378 88 69 21110 447 21608 1114 11604
NM_015686chrX42186 1780 992 986 ------
NM_015687chr62445 64 ------
NM_015691chrX42920 2793 683 213 --22880 660 --
NM_015695chr631901 1819 502 ------
NM_015713chr8113567 3557 3337 3113 2906 2849 2744 2407 2303 588 340 11046 2990 503 11166
NM_015716chr172486 479 ------
NM_015831chr72323 235 ------
NM_015840chr1102379 2214 2109 1777 1689 1029 424 333 298 247 --1945 --
NM_015841chr1102379 2214 2109 1777 1689 1029 424 333 298 247 --1945 --
NM_015844chr182956 706 ------
NM_015846chr182956 706 ------
NM_015847chr182956 706 ------
NM_015866chr121057 427 11180 ----
NM_015872chr111555 11630 --11622
NM_015878chr831360 705 163 ------
NM_015879chr18198638 7678 6945 6856 6505 6230 5964 5351 2364 2124 2039 1557 1348 822 777 480 474 466 304 58006 2318 1261 493 451 45262 3111 2445 455 37739 5753 2238
NM_015885chr113584 166 134 ------
NM_015886chr8105422 4812 4711 4399 3725 2045 1244 1176 686 510 21581 1553 11287 --
NM_015891chr651797 285 172 160 33 --11980 --
NM_015902chr82617 276 ------
NM_015905chr71158 --1112 --
NM_015906chr1104015 3347 3091 1619 1595 1423 1408 1233 652 546 13949 13415 14025
NM_015912chr842315 2269 1766 776 31986 413 87 22093 388 --
NM_015920chr151470 1610 ----
NM_015933chr3280 44 --1181 --
NM_015934chr2----1182 --
NM_015975chrX41662 672 565 334 129 --11413
NM_015981chr521046 199 1718 1968 11237
NM_015984chr13509 463 27 1576 ----
NM_015986chr171135 11009 197 21282 357
NM_015995chr1545294 5252 4157 4066 --15376 --
NM_015999chr12471 178 ------
NM_016003chr742510 1866 1760 178 12295 --11019
NM_016009chr184848 3767 3711 3416 3119 2994 1416 368 ----14205
NM_016018chr812385 --11028 12790
NM_016019chr71879 ------
NM_016021chr652815 2717 2302 2069 590 --1271 --
NM_016022chr111044 --1761 --
NM_016023chr831918 1726 268 1371 1796 --
NM_016025chr1621895 1276 ------
NM_016032chrX11401 --1882 --
NM_016038chr71492 --1417 --
NM_016040chr182701 2656 2366 2312 2275 1951 969 506 22764 581 ----
NM_016045chr2021696 186 11529 ----
NM_016047chr2121 ------
NM_016059chr62131 91 --1327 --
NM_016061chr23388 248 23 --21593 1583 --
NM_016072chr1262390 1513 468 430 55 26 ------
NM_016073chr151997 ------
NM_016075chr1373046 2698 2213 2003 832 623 296 --12640 11066
NM_016076chr173037 2960 2863 2072 803 695 619 ----11052
NM_016079chr262340 2302 856 552 425 194 ----22163 891
NM_016083chr682921 2875 2578 2401 1018 848 769 621 33925 3509 3204 12629 --
NM_016087chr751596 1383 454 403 168 ------
NM_016090chr1151029 313 251 115 37 ----11001
NM_016094chr32269 27 --1733 --
NM_016096chr83536 289 131 11818 1587 --
NM_016097chr1851089 974 858 329 150 1996 ----
NM_016100chr201101 ------
NM_016101chr162563 313 ------
NM_016106chr14--1181 ----
NM_016107chr521270 1127 21231 1166 ----
NM_016125chr17141 ------
NM_016129chr4266 33 199 ----
NM_016131chr271982 1483 767 737 471 227 150 1260 11626 2313 113
NM_016132chr1532803 873 63 11183 12680 23258 2101
NM_016133chr221566 189 ----11028
NM_016147chr1131183 1038 1001 ------
NM_016152chr311145 1219 ----
NM_016156chr1142231 1605 1590 448 --12212 --
NM_016162chr123857 839 660 ------
NM_016169chr1063292 2313 1265 1076 999 639 12277 31301 877 426 --
NM_016205chr411253 --2121 79 --
NM_016206chr3208742 8133 8036 7892 7805 7700 7607 7216 7145 7074 6434 6356 6158 5711 2276 2010 1770 293 255 215 38161 6513 6485 21502 544 17351
NM_016218chr53825 514 439 ------
NM_016221chr541662 614 561 469 --21571 919 --
NM_016226chr122380 128 ------
NM_016230chr62427 39 ------
NM_016231chr1731374 1302 1269 11576 ----
NM_016248chr13103967 3482 3450 3109 2949 1478 1166 905 510 205 --11342 --
NM_016252chr21928 ------
NM_016257chr162753 2342 1366 821 566 552 23112 2158 33123 2593 676 --
NM_016258chr11548 ------
NM_016260chr2177038 6872 6848 6837 5635 5609 4994 2938 2862 2338 1872 1696 1620 1542 1253 267 158 12079 25590 2478 --
NM_016269chr431213 354 212 --1942 --
NM_016270chr191493 ------
NM_016271chr1862077 1648 268 118 45 24 11620 21968 168 1858
NM_016275chr352017 1783 891 883 488 12235 32083 1857 1751 1914
NM_016277chr631538 1487 1199 --11260 --
NM_016287chr131850 333 205 1614 11795 --
NM_016289chr262134 1721 1449 465 353 127 1742 1796 2747 224
NM_016302chr32304 27 --1611 --
NM_016303chrX3135 126 61 1143 ----
NM_016306chr32124 56 ------
NM_016308chr141566 1530 1410 1294 1105 ----
NM_016312chr12----2471 383 --
NM_016315chr261471 1329 473 325 308 57 ------
NM_016316chr21135 1473 ----
NM_016329chr31516 ------
NM_016338chr521117 302 ------
NM_016353chr872123 1652 1631 1577 709 358 267 12098 1737 1943
NM_016357chr122825 219 ------
NM_016374chr11428 ------
NM_016374chr11428 ------
NM_016376chr1753136 1019 946 715 321 2704 157 22927 2735 --
NM_016377chr631571 446 377 --11453 11684
NM_016396chr15102976 2540 2431 2046 1952 1932 1903 676 168 123 1174 12258 1425
NM_016410chr93572 411 65 ------
NM_016413chr13--2320 289 --1346
NM_016422chr1172193 1006 896 850 778 229 138 ----13121
NM_016424chr1741966 1912 1516 396 --1332 --
NM_016436chr2052548 2259 999 567 449 12427 ----
NM_016441chr252389 1996 1511 833 632 --1753 --
NM_016442chr582145 2134 2073 1864 919 747 673 643 --2805 98 31731 1550 653
NM_016447chr72200 99 ------
NM_016448chr141707 1284 698 129 --2603 292 11618
NM_016451chr11168 ------
NM_016472chr1441528 1255 249 92 ----1258
NM_016475chr143783 488 216 1802 ----
NM_016486chr13507 457 337 1491 1358 1429
NM_016507chr1762771 2560 2035 609 102 81 22404 566 ----
NM_016513chr693376 3238 3071 2968 2783 2654 2608 1237 1056 13306 23119 2839 --
NM_016516chr22185 30 ------
NM_016519chr42488 406 ------
NM_016522chr1121282 604 ------
NM_016530chr1594127 3726 3568 2920 1290 798 714 555 277 13328 33693 3368 3097 --
NM_016531chr473412 3300 2610 1154 897 564 72 ------
NM_016536chr19273 41 1226 1219 --
NM_016542chrX31550 1277 166 ------
NM_016544chr21125 42881 2789 297 154 22799 1213 1226
NM_016546chr1241628 597 422 330 1281 11416 --
NM_016548chr91639 ----11617
NM_016562chrX31275 1049 344 --1203 --
NM_016575chr1294366 4331 4114 2097 1793 872 831 522 363 --35353 1560 1245 --
NM_016577chr374347 3999 3397 2881 1729 1277 323 --11712 --
NM_016578chr112680 538 ------
NM_016587chr7----1258 --
NM_016591chr521024 401 1424 ----
NM_016603chr541975 1730 567 115 21762 1541 ----
NM_016604chr531232 1152 447 1846 ----
NM_016605chr532220 1752 651 --22164 1687 --
NM_016607chrX51682 1350 1281 305 50 --21333 219 --
NM_016620chr141452 970 961 81 ------
NM_016623chr81666 191 ----
NM_016625chr31318 --1390 1128
NM_016626chr1821277 30 --1617 --
NM_016628chr101585 --2634 568 --
NM_016631chr211249 ------
NM_016645chr15----1337 --
NM_016649chr20135 ------
NM_016654chr1511293 11410 ----
NM_016821chr31508 --158 --
NM_016823chr1721164 849 1516 ----
NM_016824chr1041883 1661 535 175 --1169 --
NM_016834chr1732980 1075 281 --23785 206 14050
NM_016835chr1732980 1075 281 --23785 206 14050
NM_016841chr1732980 1075 281 --23785 206 14050
NM_016929chr684411 4222 4078 4011 3936 3243 2846 422 23691 3442 53075 1823 1583 1377 122 --
NM_016936chr1621865 887 ------
NM_016946chr142870 501 245 27 --13447 11325
NM_016950chr45458 444 179 73 35 ------
NM_016952chr11114093 3950 3233 3003 2900 2882 2685 2615 2597 1240 333 ----13059
NM_016953chr275735 5635 5607 5246 4858 4779 4661 36077 2355 107 45042 4823 4196 1403 --
NM_017412chr841216 1183 283 223 ------
NM_017413chrX62489 2383 945 342 322 226 ------
NM_017416chrX1154 ------
NM_017420chr1443713 955 555 274 23381 3056 --13335
NM_017423chr442079 451 232 176 --21703 554 --
NM_017425chr11----172 --
NM_017449chr111115 ------
NM_017451chr1711115 --11013 --
NM_017483chr23457 419 63 11013 ----
NM_017488chr21398 21348 1085 ----
NM_017491chr41410 --2147 72 --
NM_017510chr51644 ------
NM_017519chr631305 951 431 ------
NM_017522chr131253 1219 336 ------
NM_017540chr563113 2068 876 702 673 460 23026 2730 --12180
NM_017544chrX2400 297 ----1114
NM_017545chr201533 ------
NM_017548chr351688 1498 1375 632 72 ----1288
NM_017549chr771409 1337 1325 1090 1031 1018 955 ------
NM_017551chr1062388 2141 1994 761 438 126 ----12183
NM_017553chr1541283 1132 168 92 1242 ----
NM_017554chr332208 575 181 --11501 --
NM_017558chr163475 440 79 1431 ----
NM_017563chr3126070 5665 5208 5070 4512 4272 4100 1864 1622 1522 1210 493 35971 1691 803 26210 66 12525
NM_017569chr131309 ------
NM_017580chr1042071 1681 1542 332 ------
NM_017582chr131827 1291 104 --1477 --
NM_017590chr2222506 145 --12216 --
NM_017594chr9102907 2536 2479 2280 1218 1189 649 627 415 346 ----12527
NM_017595chr1731701 1055 501 140 ----
NM_017596chr124644 3265 13226 --13200
NM_017599chr1251912 1873 1510 1340 561 --1302 --
NM_017610chr1551581 732 716 264 228 11835 ----
NM_017628chr4155189 4788 4737 3768 3640 3280 3233 1562 1236 1228 1189 1089 750 488 382 23203 1112 55283 4752 4421 517 229 23894 1072
NM_017629chr131840 570 214 ------
NM_017633chr643166 2987 2539 1564 137 ----
NM_017634chr841890 571 338 211 ----11653
NM_017635chr11----11361 --
NM_017637chr9149082 8704 7864 6706 6653 6490 5773 3645 3431 3102 2307 2258 1958 662 37438 7160 7121 58323 7211 3412 2808 1307 --
NM_017640chr63322 199 74 1866 ----
NM_017643chr1763030 2789 2150 982 847 453 --12873 --
NM_017644chr3125019 4855 4767 3414 3386 1675 1276 1257 1229 409 347 83 34103 2074 1196 1769 --
NM_017645chr972964 2914 2357 2345 1960 1271 1218 11114 12523 1419
NM_017650chr7125832 5272 4001 2355 2140 2066 1657 1632 1599 1509 278 237 1827 ----
NM_017651chr631137 592 376 ------
NM_017658chr14124669 4575 4207 4159 3796 1808 1690 1525 1260 1039 553 474 --13503 --
NM_017660chr1921217 430 --22338 952 --
NM_017661chr1541185 1097 1053 264 ------
NM_017666chrX32004 1806 181 --1314 --
NM_017672chr1521105 278 11227 ----
NM_017686chr13878 767 238 1866 1344 --
NM_017693chr1351541 1460 1040 651 540 ------
NM_017694chr221618 436 --11985 --
NM_017709chr134338 812 251 13146 ----
NM_017714chr203955 852 86 239 28 1312 --
NM_017730chr31171 1464 ----
NM_017736chr1622343 603 ----1942
NM_017737chr152181 749 697 565 160 1587 ----
NM_017740chr1641675 1417 1383 80 ----1382
NM_017741chr432178 709 26 12343 ----
NM_017742chr1831361 1264 101 --1134 --
NM_017744chr132479 2116 909 2902 472 11773 --
NM_017745chrX1111 ------
NM_017753chr91108 2913 762 140 --
NM_017754chr694513 4180 3822 3612 3595 3062 1643 1482 709 1317 ----
NM_017769chr1473065 2260 2052 1044 931 408 219 22596 722 13134 --
NM_017770chr642986 2961 732 122 ------
NM_017774chr63344 78 41 ------
NM_017778chr82991 452 11033 ----
NM_017787chr1052856 1132 442 261 157 1419 ----
NM_017798chr206484 476 398 390 317 113 ------
NM_017799chr14--1223 21732 112 --
NM_017811chr923056 509 22162 39 1294 --
NM_017812chr71726 ----1153
NM_017822chr122766 265 --172 --
NM_017824chr103771 531 240 22717 662 22565 158 12242
NM_017830chr42212 48 ------
NM_017842chr122681 509 1220 ----
NM_017845chr41257 ------
NM_017847chr132158 258 202 1705 ----
NM_017848chrX154396 4150 3928 3879 3350 3258 3050 3014 2863 1803 1652 1616 1392 984 141 23997 3780 23944 277 13747
NM_017849chr243226 2189 714 114 --11944 --
NM_017869chr161628 ------
NM_017880chr21406 --1291 --
NM_017896chr2083390 2733 2520 1365 983 675 196 136 22167 995 --1760
NM_017918chr4183 ------
NM_017922chr142658 637 ------
NM_017925chr9153 31709 686 398 ----
NM_017933chr231430 642 462 --1267 11087
NM_017935chr41244 1579 ----
NM_017938chrX41807 650 541 314 --11837 --
NM_017943chr141791 21078 202 ----
NM_017944chr1153148 2982 2383 728 580 --12700 --
NM_017945chr341351 1285 460 70 1232 ----
NM_017952chr213917 34407 3346 499 34478 4337 948 1412
NM_017958chr262968 2739 1853 1226 857 71 --21976 1969 --
NM_017964chr2190 1130 ----
NM_017974chr241243 962 917 436 ------
NM_017975chr1531068 831 329 1927 ----
NM_017987chr1052088 686 445 267 123 ------
NM_017988chr124374 280 131 65 1628 --2827 599
NM_017990chr1664186 4025 1629 1373 555 115 32792 1535 341 63989 3747 2987 700 122 37 --
NM_017994chr742656 718 443 97 22915 132 ----
NM_017996chr15125 ----158
NM_018004chr33380 259 127 ------
NM_018010chr31262 11473 ----
NM_018011chr131582 ------
NM_018015chrX41010 826 262 64 2752 739 --1177
NM_018018chr1261855 1645 1617 341 222 73 1559 ----
NM_018027chr1031232 1162 168 ------
NM_018030chr18189 2883 135 --1971
NM_018034chr5192 ------
NM_018043chr1131504 1315 1198 ------
NM_018060chr11246 --1351 --
NM_018061chr121402 531 --1126 11627
NM_018064chr61232 ------
NM_018078chr41903 2674 367 ----
NM_018084chr283268 3129 2427 2393 971 952 368 117 12239 1818 --
NM_018086chr251511 1424 1368 1317 137 --1597 --
NM_018092chr1621497 239 1458 1221 --
NM_018094chrX1308 ------
NM_018098chr31950 --1226 --
NM_018103chr11106 ------
NM_018105chr831169 499 75 ------
NM_018112chr941036 999 778 46 ------
NM_018117chr101674 ------
NM_018120chr84575 483 344 239 1137 ----
NM_018121chr1053161 3044 2613 326 166 ------
NM_018126chr431382 148 129 11089 11375 --
NM_018128chr1741494 1013 402 310 11088 ----
NM_018131chr103744 652 165 ------
NM_018133chr321490 504 --1653 --
NM_018142chr81196 ------
NM_018151chr23679 609 248 1122 ----
NM_018155chr393430 2925 2759 2498 1392 1161 829 766 457 12845 --11353
NM_018157chr1252307 2236 2228 618 44 22142 245 --12378
NM_018159chrX51585 1516 1088 134 116 ------
NM_018181chr1821981 1528 11453 ----
NM_018182chr1772211 1922 678 639 620 295 274 11708 ----
NM_018184chr311412 31860 554 295 --1522
NM_018195chr1121824 1741 --21905 851 --
NM_018200chr1582140 1966 1800 1737 1586 480 276 270 ------
NM_018201chr932481 1813 525 ------
NM_018202chr14845 758 124 62 1710 ----
NM_018206chr162304 116 ------
NM_018208chr111157 --11200 --
NM_018211chr151567 1422 1387 876 46 2396 218 ----
NM_018214chr62516 114 ------
NM_018221chr22310 39 157 1323 --
NM_018222chr1161688 1670 1560 1324 1262 1191 ------
NM_018224chr71201 184 150 --
NM_018227chr422895 2468 ------
NM_018229chr144943 910 779 262 --11012 --
NM_018241chr41786 ------
NM_018243chr4133958 3809 3462 3414 3363 3164 2972 2683 1497 1421 1347 557 59 23317 1085 1427 --
NM_018246chr841900 784 535 72 1618 11780 --
NM_018247chr693143 2714 2106 1969 1927 513 482 95 26 --2815 740 --
NM_018254chr162393 948 735 513 491 60 12466 193 11697
NM_018257chr2042141 1931 1659 726 ------
NM_018263chr242431 1923 929 397 --22379 1708 22626 595
NM_018269chr22201 115 11016 1285 --
NM_018286chr172825 811 1720 ----
NM_018287chr102866 222 1244 ----
NM_018293chr362579 2260 2221 1865 1024 955 ----12954
NM_018299chr853010 2985 2625 2487 940 12312 11084 --
NM_018312chr1172097 1993 1510 1346 845 833 446 ------
NM_018313chr362655 2596 2195 1879 931 284 1476 ----
NM_018315chr421037 474 ------
NM_018325chr931470 1134 1018 ------
NM_018327chr2041885 1756 1202 471 ------
NM_018332chr1641389 1080 906 251 ------
NM_018340chr16114545 4442 3750 3447 3413 1641 1040 841 673 244 188 --24817 465 24706 3441
NM_018351chr12154421 4401 4257 4094 3525 2951 1806 1384 1264 995 900 787 572 261 181 23652 1552 ----
NM_018361chr864110 3609 3538 1448 590 253 --32640 1619 443 --
NM_018362chr11134021 3088 2886 2631 1270 1179 836 630 476 361 156 130 27 --1807 --
NM_018364chr163861 3633 3361 1416 1273 341 ------
NM_018371chr81579 11333 11429 --
NM_018372chr11546 ------
NM_018373chr1476089 5870 5661 5616 4649 4064 702 33959 1561 43 44363 1939 1848 829 11307
NM_018374chr7134082 4016 2111 1816 1808 1727 1721 1263 1256 715 659 543 524 13381 14756 14871
NM_018375chr1431881 225 107 11546 ----
NM_018383chr252061 2007 733 522 293 11968 ----
NM_018387chr92500 126 --1219 --
NM_018388chrX3951 463 376 --1989 --
NM_018401chr451880 1193 649 331 161 --21528 40 --
NM_018403chr383807 3738 3645 2859 1576 1399 1250 760 12737 23267 129 14087
NM_018409chr4143220 2980 2944 2574 2413 2338 1288 1033 901 855 569 484 461 383 12210 ----
NM_018424chr961869 1714 1565 1520 445 277 2688 529 1426 11450
NM_018429chr552938 2862 2658 448 170 1755 ----
NM_018433chr21516 --192 --
NM_018434chr5170 ------
NM_018439chr1862293 2148 508 446 243 157 1299 ----
NM_018440chr8167935 7544 7113 6854 6757 6129 5838 5436 3427 3004 2427 2122 1680 1353 1222 240 36418 3032 1001 22852 1632 47739 2322 2247 295
NM_018441chr2146 1647 ----
NM_018445chr151514 ------
NM_018446chr3130 ------
NM_018448chr1231308 1089 380 1508 --11234
NM_018452chr6_random73596 3013 2639 2633 2440 1366 743 23403 2581 33349 2561 2476 13332
NM_018460chr22116 62 ------
NM_018462chr32818 627 --1807 --
NM_018469chr17--21521 991 1501 --
NM_018471chr23524 157 144 1182 ----
NM_018482chr852485 1895 981 478 253 ----12523
NM_018488chr175754 275 267 225 175 ------
NM_018489chr121950 837 12350 ----
NM_018490chr1151800 1791 1403 157 78 --21456 72 --
NM_018534chr24629 244 174 112 ------
NM_018553chr1731208 1151 180 1151 ----
NM_018557chr241680 1660 1224 111 ------
NM_018561chr62625 217 ----1387
NM_018566chr1115041 4337 4066 3912 3358 3232 1912 1718 1152 1128 935 23999 1511 --24528 1447
NM_018569chr43498 274 193 1651 11325 --
NM_018584chr11325 ------
NM_018602chr151481 --3623 404 243 --
NM_018638chr1274899 4565 3789 585 475 446 110 24530 983 24217 3817 23598 1559
NM_018640chr1262674 2587 2402 2196 698 50 --12769 1684
NM_018649chr101535 1431 ----
NM_018650chr142118 806 563 246 --1914 --
NM_018652chr152760 159 --2144 83 --
NM_018653chr171390 ------
NM_018657chr36718 667 612 308 90 50 ------
NM_018660chr862863 2649 2538 2438 2037 1033 ------
NM_018667chr1652540 2534 2184 577 326 --1379 --
NM_018682chr75582 546 459 295 143 ------
NM_018684chrX31401 553 308 1247 --1502
NM_018685chr741092 1059 418 248 ----145
NM_018686chr122347 295 ------
NM_018689chr1542633 2328 2072 1026 2866 661 ----
NM_018691chr531227 1076 914 --11175 --
NM_018695chr542058 1841 1540 376 ------
NM_018704chr171787 1662 1393 740 448 327 194 ------
NM_018710chr841204 1123 237 69 ------
NM_018712chr1141372 986 597 231 11439 1135 --
NM_018715chr131699 1597 1565 --151 --
NM_018717chr442888 2874 2563 2080 ----1180
NM_018718chr7161 11449 178 --
NM_018723chr16189 ------
NM_018834chr55818 787 744 678 402 ------
NM_018837chr203950 740 717 ------
NM_018840chr20--1383 ----
NM_018847chr941917 1660 541 120 --1316 --
NM_018898chr542349 2161 1961 1695 ------
NM_018899chr542349 2161 1961 1695 ------
NM_018900chr542349 2161 1961 1695 ------
NM_018901chr542349 2161 1961 1695 ------
NM_018902chr542349 2161 1961 1695 ------
NM_018903chr542349 2161 1961 1695 ------
NM_018904chr542349 2161 1961 1695 ------
NM_018905chr542349 2161 1961 1695 ------
NM_018906chr542349 2161 1961 1695 ------
NM_018907chr542349 2161 1961 1695 ------
NM_018908chr542349 2161 1961 1695 ------
NM_018909chr542349 2161 1961 1695 ------
NM_018910chr542349 2161 1961 1695 ------
NM_018911chr542349 2161 1961 1695 ------
NM_018931chr52818 317 ------
NM_018945chr693594 2884 2667 1442 1349 1049 979 661 132 23541 3050 1986 --
NM_018948chr141456 1423 1193 1095 ------
NM_018963chr2131470 1149 105 ------
NM_018970chr7123087 2992 2894 2874 2865 2634 2111 2011 933 833 718 643 2433 358 --1849
NM_018976chr1232265 1859 185 ------
NM_018977chrX----1945 --
NM_018983chr42262 113 ------
NM_018992chr161108 ------
NM_018999chr1094600 3865 3811 1862 1531 1400 884 702 198 34425 4408 959 21334 401 23482 928
NM_019000chr531554 1313 664 ------
NM_019001chr3124661 4514 4454 3656 3649 3158 1868 1568 1479 1472 654 130 14059 ----
NM_019003chrX1117 ------
NM_019004chr732014 1864 159 ------
NM_019006chr152531 229 1620 ----
NM_019008chr22113799 2926 2834 2661 2544 2508 2465 1446 1280 805 154 --21389 163 --
NM_019010chr172257 60 1341 ----
NM_019016chr172152 88 ------
NM_019027chr452366 1057 766 246 208 12392 11804 --
NM_019049chr1----2560 140 --
NM_019050chr432102 1559 350 --1852 --
NM_019053chr1021088 157 ------
NM_019063chr261955 1784 1635 1519 392 338 ------
NM_019066chr15--1317 1321 --
NM_019071chr7197 ------
NM_019072chr594267 4155 4141 4031 3861 3537 3321 548 487 24215 3461 ----
NM_019080chr13121483 1364 1300 1288 1277 1153 973 469 444 199 168 57 ------
NM_019083chr141202 347 213 25 --11453 --
NM_019084chr10--1910 --2578 382
NM_019087chr55471 375 279 240 61 --21751 135 1123
NM_019091chr231058 228 168 ------
NM_019094chr1293832 3785 3555 3488 2829 2539 1538 1157 584 22502 739 11017 --
NM_019106chr2283256 2573 2538 2443 808 348 279 124 12222 ----
NM_019114chr952155 1719 489 444 405 --11561 --
NM_019116chr1652703 2457 802 757 403 --33407 1318 1265 --
NM_019555chr321383 441 139 ----
NM_019556chrX11009 11426 21133 69 --
NM_019593chr2073159 2357 2310 481 348 57 23 --22765 2162 12881
NM_019594chr91365 --11004 --
NM_019596chr2131123 536 344 31104 988 748 11130 --
NM_019600chr151526 1569 ----
NM_019606chr71356 1399 1220 --
NM_019610chr121748 585 --1809 --
NM_019842chr62358 296 ------
NM_019859chr10164 ----1235
NM_019860chr101112 ----1283
NM_019862chr1641628 1497 1308 537 1627 1491 --
NM_019885chr252257 2030 1842 818 417 ------
NM_019891chr111178 ------
NM_019895chr321022 204 ------
NM_019898chr1641628 1497 1308 537 1627 1491 --
NM_019899chr1641628 1497 1308 537 1627 1491 --
NM_019900chr1641628 1497 1308 537 1627 1491 --
NM_019903chr1041883 1661 535 175 --1169 --
NM_020116chr451190 1168 560 339 288 ------
NM_020122chr2126030 5458 4807 4291 3863 2047 1899 1736 1726 1453 852 685 22154 1813 2648 163 44428 3986 3981 3976
NM_020123chr1011061 ----1619
NM_020132chr2185128 4462 4038 1931 1163 353 266 209 --34032 1448 1411 --
NM_020135chr6------1305
NM_020141chr142035 960 663 521 --32151 1755 1696 11677
NM_020143chr251110 379 245 98 24 11152 1842 1410
NM_020144chr741902 1793 352 122 11422 11365 --
NM_020147chr151736 --164 --
NM_020148chr1832163 939 413 ----12464
NM_020150chr1052219 1704 1473 888 499 1302 ----
NM_020152chr212952 703 ------
NM_020159chr45700 492 434 237 126 11596 11683 --
NM_020168chr1511326 ----1985
NM_020177chr5103199 2824 2763 2683 2385 2367 524 435 308 91 12224 12743 1838
NM_020178chr174923 906 819 178 ------
NM_020180chr182481 192 ------
NM_020182chr2033451 2805 1422 --13023 --
NM_020184chr23604 518 296 ------
NM_020185chr61117 --1410 --
NM_020186chr71523 ------
NM_020189chr8--1176 ----
NM_020193chr1121166 993 ------
NM_020194chr21598 ------
NM_020198chr1731511 136 80 ------
NM_020200chr1021035 94 ------
NM_020205chr143385 2291 736 686 --13225 --
NM_020210chr152987 816 ------
NM_020225chr4176 195 ----
NM_020226chr41498 ------
NM_020228chr1151856 1794 1038 563 458 12313 1169 --
NM_020239chr13817 569 29 1918 ----
NM_020240chr582485 2221 810 568 500 397 351 114 12244 --1817
NM_020245chr654238 2033 1824 1377 168 --13618 1225
NM_020336chr2043889 3547 1494 1236 2607 311 43765 3526 3007 2796 --
NM_020337chr433125 546 206 11952 2761 676 --
NM_020338chr1093696 3601 3479 2830 2365 996 734 577 383 13726 13066 13511
NM_020340chr64886 372 337 320 --12147 --
NM_020342chr262599 2528 2204 2075 1944 356 ----11763
NM_020346chr1141710 1468 1364 471 1321 21275 193 --
NM_020347chr352269 2027 1925 629 485 1619 ----
NM_020348chr1041778 370 128 73 21786 425 ----
NM_020353chr331562 463 193 --11518 --
NM_020357chr331227 1107 114 ------
NM_020360chr171612 ------
NM_020390chr364379 3800 3489 1961 1526 1231 24790 1655 21537 105 13517
NM_020416chr442422 2132 2046 707 --1909 --
NM_020420chrY61336 706 699 538 345 235 1471 ----
NM_020425chr621662 729 ----1181
NM_020426chr17----167 --
NM_020432chr7--21906 1590 --1820
NM_020440chr151198 727 647 379 268 12574 ----
NM_020443chr1116992 6859 6370 6339 1869 1710 1692 1522 1191 915 848 12464 17027 --
NM_020449chrX4735 690 513 113 ------
NM_020452chr142139 2114 1649 74 ------
NM_020455chr662729 2031 1085 624 532 485 1638 ----
NM_020463chr221152 518 ------
NM_020473chrX31695 1676 799 ------
NM_020474chr1851792 1293 653 642 62 ------
NM_020532chr22317 51 --133 1193
NM_020546chr553041 911 600 382 324 --12886 --
NM_020640chr32831 148 12205 --1249
NM_020644chr113860 271 81 --1749 --
NM_020645chr112654 542 ------
NM_020647chr881954 1769 833 800 789 682 648 593 2727 528 ----
NM_020651chr241764 1580 418 101 ------
NM_020654chr331597 1512 1208 --1648 --
NM_020661chr1251945 1779 540 396 39 ------
NM_020666chr51673 ------
NM_020673chr20166468 6423 5724 4894 2949 2605 2407 2387 1985 1719 1403 1316 1228 960 539 436 35517 2659 2262 25574 530 26353 2187
NM_020698chr1253068 2951 2937 2354 1257 ----11030
NM_020699chr184924 4861 4717 4694 4469 4445 3623 2136 25334 4750 1924 --
NM_020704chr742518 2162 818 809 12329 --11627
NM_020711chr242572 1791 966 219 22140 885 ----
NM_020713chr2011088 ------
NM_020715chr1461899 1873 1774 1726 1589 803 ------
NM_020718chr16116341 2303 2159 2135 2097 1947 1651 1264 1163 941 27 14791 42544 2065 1024 655 24053 1197
NM_020727chr2153892 3718 3452 1607 307 13528 1841 12451
NM_020728chr732716 2427 462 22888 148 1469 --
NM_020732chr631305 951 431 ------
NM_020734chr1262520 2078 847 827 476 181 --23090 2928 --
NM_020739chr15104058 3932 2852 2837 1439 1150 962 605 465 199 22817 152 24081 555 --
NM_020742chrX82283 2188 2113 2030 1680 888 416 244 22459 315 11669 12087
NM_020747chr51707 ----1120
NM_020748chr173770 739 191 11576 ----
NM_020749chr871921 1769 1603 1289 804 597 282 21402 548 11480 --
NM_020750chr61947 --143 --
NM_020752chr1042848 2177 1037 501 1244 12080 --
NM_020755chr621142 146 ------
NM_020760chr261659 1539 1510 1447 452 23 --1483 --
NM_020761chr1731935 1366 514 ------
NM_020762chr123868 687 214 ------
NM_020765chr11287 ------
NM_020766chrX124544 4522 3388 3040 1638 1629 1475 1063 1016 935 866 445 --23145 1302 13565
NM_020768chr553213 1240 319 107 40 ------
NM_020769chrX11002 2943 637 ----
NM_020772chr17108519 8182 7273 6753 5576 5248 3478 2491 1008 786 35621 2632 2349 27853 6245 11877
NM_020774chr18146048 5909 5664 5024 4011 3827 2390 2049 1886 1719 1661 1275 866 613 15756 21293 1065 22282 369
NM_020776chr1821026 483 12484 23090 453 1308
NM_020777chr432525 2231 1015 --21691 1556 --
NM_020779chr292646 2563 2340 2245 2069 2051 809 610 257 --22419 857 --
NM_020782chr1284776 4646 4571 4018 3953 1315 1268 239 11345 ----
NM_020783chr1851705 1688 949 403 230 --12134 2586 528
NM_020791chr172564 134 1960 11133 --
NM_020794chr121393 1312 1506 ----
NM_020796chr522920 2013 21161 1085 ----
NM_020800chr321153 31 ------
NM_020801chr532035 1692 48 ------
NM_020803chr432457 2058 880 11481 42032 907 703 465 --
NM_020805chr182700 385 1229 21600 681 1569
NM_020806chr141123 --1327 --
NM_020809chr1152133 2087 1758 775 287 1754 ----
NM_020810chr14103357 3215 3072 3041 2409 1246 657 642 186 22 ----13399
NM_020824chr102124 106 ------
NM_020834chr1411366 1429 21285 526 --
NM_020839chr371510 1333 1140 1056 322 132 31 2596 552 ----
NM_020841chr12113970 3641 3426 3168 2813 2768 1583 535 511 226 157 13349 12877 --
NM_020850chr1622036 1086 13275 1340 12412
NM_020854chr1811445 --11352 1627
NM_020856chr1921343 364 --1379 --
NM_020858chr1551826 1595 647 538 228 1448 ----
NM_020860chr42395 388 --1253 --
NM_020861chr6132 ----1937
NM_020866chr132425 367 ------
NM_020868chr231991 374 323 --1348 --
NM_020870chr422064 1868 --21594 423 1894
NM_020871chrX42430 2206 2064 37 11936 1852 --
NM_020872chr361790 1757 1710 1662 1339 354 ------
NM_020873chr33850 716 702 ------
NM_020888chr122054 349 --2775 256 --
NM_020897chr13858 836 465 ------
NM_020918chr1052724 2375 2238 483 417 11470 11342 --
NM_020919chr22266 31 21001 974 21296 1109 11105
NM_020920chr14148 ------
NM_020921chr1463515 3504 3296 2271 984 710 23140 57 --23581 2593
NM_020922chrX2308 107 --11700 --
NM_020925chr1--1516 1136 --
NM_020935chr274561 3791 3418 3370 1714 1221 979 11650 ----
NM_020937chr142868 188 --1606 --
NM_020940chr1022060 275 149 ----
NM_020948chr1103712 2950 2527 2521 1137 813 629 333 255 242 12420 ----
NM_020951chr1942082 1519 448 91 ----11698
NM_020956chr1933657 391 309 13100 ----
NM_020962chr1562374 2160 1992 1886 1778 768 1504 1796 --
NM_020977chr472121 1978 1766 1685 1596 280 136 ------
NM_020981chr2--1815 --1243
NM_020987chr1041223 929 907 314 --1226 1296
NM_020988chr161238 21158 281 11067 --
NM_020993chr1231983 1915 762 ----12856
NM_021005chr1521082 252 ------
NM_021007chr221566 519 11759 12346 --
NM_021032chr341790 1597 534 67 ------
NM_021033chr1373269 2816 2736 1317 548 267 157 13457 ----
NM_021035chr2021304 214 11266 1495 --
NM_021038chr343218 993 511 340 12229 ----
NM_021064chr651485 1218 705 604 156 ------
NM_021069chr452132 1464 852 369 122 1362 11421 11634
NM_021072chr521697 77 ------
NM_021079chr1753291 2322 2216 1180 1085 13344 --1964
NM_021083chrX103493 3371 3335 2828 2464 1421 1392 1187 918 530 1791 --1538
NM_021088chr221417 595 1816 ----
NM_021090chr2284860 4696 4239 3875 1978 1763 1714 1642 13052 1529 13447
NM_021097chr2103067 3058 2691 2505 2499 2427 2399 2254 2061 218 --2758 571 --
NM_021110chr81720 ----1111
NM_021116chr7149033 8760 8595 8538 7969 7543 6619 6349 6217 5908 5723 3309 2798 2438 15884 37624 2066 877 --
NM_021120chrX43093 2813 677 420 1214 23147 2880 --
NM_021129chr103231 107 48 ------
NM_021132chr104989 844 446 30 ------
NM_021140chrX3902 335 85 1265 1394 --
NM_021144chr92372 351 ------
NM_021145chr71176 ----1871
NM_021148chr732347 2166 1932 ------
NM_021149chr1641199 336 268 39 2419 191 11151 --
NM_021155chr1982585 2189 2169 2049 1133 503 404 314 ------
NM_021156chr2031103 254 131 1756 --1965
NM_021167chr752841 2807 2661 2492 2301 1903 12179 --
NM_021174chr82251 229 ------
NM_021176chr221309 395 --11293 11584
NM_021180chr13738 640 621 ----1716
NM_021183chrX32531 1911 754 --1894 --
NM_021190chr131326 1274 206 ------
NM_021222chr121317 400 ------
NM_021227chr41356 ------
NM_021229chr122885 138 --21083 148 --
NM_021239chr1421123 184 128 ----
NM_021245chr10----130 --
NM_021252chr1061873 1808 1387 811 356 49 ------
NM_021253chr641273 1149 1068 377 11338 1114 --
NM_021255chr1433694 3592 2848 --1744 11233
NM_021260chr1421137 278 --11076 --
NM_021572chr62976 505 1845 ----
NM_021619chr941320 1203 1072 487 ------
NM_021622chr1052354 1890 1632 362 230 1221 1910 12152
NM_021627chr341014 851 393 52 ------
NM_021629chr3134785 4348 4252 4081 3691 3525 3498 3298 1826 888 573 480 118 44709 4317 3655 1993 1841 1806
NM_021637chrX41119 226 94 81 11165 ----
NM_021638chr464529 4192 3507 3423 288 60 ------
NM_021643chr21299 --1584 --
NM_021647chr494281 4122 3902 3457 3435 3146 2971 1785 1288 34487 3935 3396 23169 1414 --
NM_021648chr662706 2330 1722 979 586 115 --11706 --
NM_021705chr6--2332 245 ----
NM_021803chr4----161 --
NM_021809chr2042346 1678 1580 652 --1114 --
NM_021813chr685838 5751 5578 3577 750 614 538 77 34483 1182 346 --24930 1300
NM_021814chr631284 198 36 11234 ----
NM_021871chr4148 --1152 --
NM_021911chr565164 3603 2143 631 422 341 1145 22052 367 --
NM_021912chr1584086 3513 3251 1124 863 724 347 33 32676 910 837 --13443
NM_021914chr1472292 2276 2192 1885 951 146 44 --12179 --
NM_021931chr2011089 1952 ----
NM_021935chr321035 134 141 ----
NM_021940chr631545 613 193 ------
NM_021945chr633308 2972 249 1693 1628 --
NM_021947chr1721386 1012 2853 486 ----
NM_021949chrX32782 1044 773 ------
NM_021951chr93790 326 238 ------
NM_021954chr1383601 2965 2957 2817 929 545 486 452 ------
NM_021959chr64985 918 299 192 ------
NM_021960chr142212 2011 1113 941 12124 12142 --
NM_021961chr11207527 7194 6916 6613 5825 5433 4767 4717 4589 2829 2505 2117 1807 1442 1418 1362 1351 1092 507 169 11305 12921 15274
NM_021964chr3136548 5816 4778 4702 4524 4015 2330 1779 1513 1252 1173 554 157 44631 4271 2508 1296 22655 1010 --
NM_021967chr551019 986 112 50 30 1252 ----
NM_021976chr62803 346 --1337 --
NM_021988chr2031128 144 62 ------
NM_021999chr133812 330 282 ----1135
NM_022036chr171390 ------
NM_022037chr23747 638 133 --2945 683 --
NM_022041chr1632307 1807 629 --12632 12584
NM_022048chr15166257 6075 5687 5405 5311 4159 4090 2514 2068 1992 1816 1750 1568 1041 189 70 25417 4204 34455 2152 1005 12103
NM_022049chr161857 1835 1801 384 202 176 --11481 11226
NM_022054chr142844 132 1767 ----
NM_022059chr173685 370 199 ------
NM_022062chr1151883 1762 1673 1419 552 ------
NM_022067chr142799 180 --2659 34 1752
NM_022068chr183608 207 83 ------
NM_022093chr12644 259 ----1699
NM_022095chr20186 ------
NM_022100chr13493 188 135 ------
NM_022104chr201237 ------
NM_022114chr174673 1893 1863 967 660 578 201 --11440 --
NM_022116chr741025 985 250 27 --1335 --
NM_022130chr531458 1020 915 ------
NM_022133chr851891 1648 1170 509 414 --1723 --
NM_022137chr1431996 1404 173 --11615 11790
NM_022140chr552279 1983 1916 1571 133 12017 2545 518 12236
NM_022143chr74474 440 428 389 ------
NM_022154chr421112 55 ------
NM_022166chr16106068 5346 5287 5176 5024 4512 1828 1701 583 478 22178 1134 15522 --
NM_022167chr172856 850 1113 ----
NM_022170chr731607 1152 355 ------
NM_022171chr331463 487 214 11569 11154 --
NM_022173chr23747 638 133 --2945 683 --
NM_022351chr883712 3482 3456 3365 3174 673 78 54 ------
NM_022361chr61409 ------
NM_022365chr10131 ------
NM_022366chr12302 36 --1133 --
NM_022373chr72787 711 ----1256
NM_022374chr21358 1150 1500 --
NM_022442chr2031128 144 62 ------
NM_022444chr791890 1830 1746 1712 1597 731 537 530 487 --1437 1321
NM_022459chr13125609 5540 5533 5351 5337 5171 4469 4156 3885 1728 1677 95 1887 16056 15122
NM_022461chr331288 507 440 21208 493 142 --
NM_022465chr1261212 625 524 459 224 75 ------
NM_022473chr1564166 3471 3410 1388 901 823 11548 --12845
NM_022474chr1452626 2394 578 320 225 11890 --1756
NM_022475chr41527 ----1602
NM_022476chr164800 439 301 215 ------
NM_022477chr2021088 222 169 ----
NM_022482chr2032142 1720 844 --2957 491 --
NM_022490chr9--1444 164 --
NM_022496chr121197 ------
NM_022550chr51362 --152 --
NM_022557chr171245 ------
NM_022572chr231732 397 263 --11544 1368
NM_022640chr17----1244 --
NM_022650chr52902 301 ------
NM_022658chr1221273 91 ------
NM_022716chr182820 2766 2594 2568 2254 908 555 79 --11073 22196 771
NM_022719chr2253538 2870 2619 2454 283 2726 332 13868 --
NM_022726chr62488 399 11474 ----
NM_022728chr7------1652
NM_022730chr22329 69 11064 ----
NM_022737chr19----21294 1269 --
NM_022739chr1741202 916 796 281 1414 ----
NM_022748chr752864 2132 1977 212 202 --32888 1840 1135 --
NM_022753chr162495 2424 2280 1788 1717 984 31109 716 62 12475 --
NM_022756chr141409 469 326 205 1394 2541 173 --
NM_022763chr332441 1087 560 --11981 --
NM_022776chr311565 1230 ----
NM_022780chr221154 362 155 1214 --
NM_022781chr973194 3115 3103 3054 2990 2202 953 32695 2132 910 12753 --
NM_022783chr83732 705 288 ------
NM_022817chr251957 1868 926 458 446 11689 22027 799 --
NM_022824chr551812 1375 1271 1190 171 ------
NM_022826chr22478 466 ------
NM_022828chr521124 141 21115 287 ----
NM_022836chr121403 1156 11747 --1344
NM_022841chr1552644 2264 2020 1114 386 22730 1078 --1313
NM_022843chr1351454 1308 1077 1042 331 ------
NM_022845chr1681998 1386 474 433 381 329 187 33 --22175 2160 --
NM_022875chr5----183 --
NM_022877chr5----183 --
NM_022893chr252936 2267 1092 903 708 12680 ----
NM_022894chr241283 1136 537 39 ------
NM_022897chr51245 11037 ----
NM_022898chr1453584 3513 3161 3119 1169 24785 1314 11121 14676
NM_022912chr243075 2936 2820 414 1627 1834 --
NM_022913chr53302 257 43 ------
NM_022918chr1161912 1893 1704 1500 837 125 --31575 641 41 --
NM_022965chr42607 191 ------
NM_022977chrX42228 1057 935 482 11042 --11868
NM_022978chr551019 986 112 50 30 1252 ----
NM_023000chr1421570 1222 11685 ----
NM_023001chr1421570 1222 11685 ----
NM_023003chr151225 2251 75 ----
NM_023010chrX1660 ------
NM_023015chr11706 ------
NM_023034chr81403 ------
NM_023071chr12----1238 --
NM_023072chr1931144 1028 988 187 --1838
NM_023073chr551371 1247 1069 1053 169 ------
NM_023074chr1961026 891 416 318 257 177 ------
NM_023923chr153178 3145 2572 1109 837 21447 152 13523 13531
NM_023927chr51251 --11066 11331
NM_023929chr832642 2174 1714 ------
NM_023948chr71159 ------
NM_024007chr552594 2535 2294 1224 311 --23005 630 12126
NM_024016chr171172 --1522 --
NM_024019chr421082 164 1112 ----
NM_024050chr191575 ------
NM_024054chr72336 143 1312 ----
NM_024060chr111222 ------
NM_024076chr1931632 290 39 ------
NM_024089chr131134 ------
NM_024090chr451906 760 368 253 214 --1630 --
NM_024094chr8----1299 1129
NM_024106chr192373 42 ------
NM_024165chr61209 ------
NM_024295chr851803 1626 1530 1338 41 --1366 --
NM_024321chr19----1129 --
NM_024345chr9155915 5851 4934 4676 4409 2377 2286 1961 1651 991 901 725 536 269 180 45701 3946 3933 3925 1208 --
NM_024416chr9--1106 21521 1352 --
NM_024422chr1861899 1533 1443 711 548 213 --1388 --
NM_024424chr111807 ------
NM_024425chr111807 ------
NM_024426chr111807 ------
NM_024482chr1----182 --
NM_024490chr15--1541 ----
NM_024491chr32585 145 --2525 227 --
NM_024496chr143791 260 210 ------
NM_024511chr453558 2663 2472 1093 833 --1284 --
NM_024523chr721313 95 ------
NM_024524chr363094 2041 1958 611 490 248 --2824 797 --
NM_024529chr13896 340 21 ------
NM_024539chrX1282 ------
NM_024545chr24749 699 599 558 1521 ----
NM_024546chr134316 195 170 21 ------
NM_024548chr331260 296 174 ------
NM_024554chr131387 1269 180 ------
NM_024556chr111512 ------
NM_024563chr531841 1823 634 21393 257 ----
NM_024569chr172965 2865 2792 2307 1990 395 354 ------
NM_024582chr431091 937 925 ------
NM_024594chr531944 1814 456 11780 11396 --
NM_024598chr1631046 483 466 ------
NM_024613chr831645 1191 627 --1322 --
NM_024617chr92915 185 --1787 172
NM_024624chr221503 1280 --1335 --
NM_024631chr112540 197 ------
NM_024635chr91274 ------
NM_024638chr34781 620 596 267 12012 ----
NM_024639chr61979 21954 414 ----
NM_024645chr831223 107 43 --1605 --
NM_024646chr153891 1266 903 815 242 23010 1057 23276 500 14012
NM_024665chr354639 3637 3618 3063 1616 14222 24405 1586 --
NM_024670chr10----1592 --
NM_024674chr173181 2540 2388 2078 1176 915 457 21969 113 1770 --
NM_024686chr1147 ------
NM_024692chr261864 1839 540 415 294 112 --11282 --
NM_024699chr8----2694 321 --
NM_024700chr111166 1927 1814 --
NM_024715chr51127 11679 ----
NM_024721chr83840 443 437 11794 ----
NM_024725chr114207 185 139 97 ------
NM_024740chr11113693 3676 3573 3560 3423 3324 1665 1659 1285 1102 34 2600 272 1668 --
NM_024742chr1651300 777 398 325 217 ----1571
NM_024744chr232583 653 226 22125 508 ----
NM_024749chr141775 1678 1436 65 ----11845
NM_024757chr911127 ------
NM_024761chr9125118 4911 4876 4822 4665 4545 4535 4088 3967 1758 618 384 21979 948 23892 3843 11635
NM_024769chr1161147 860 726 408 198 107 1214 ----
NM_024770chr276659 6009 5895 5213 4349 4336 409 --44286 4220 2664 1004 16297
NM_024779chr1231599 1557 299 --21493 1159 --
NM_024786chr54934 845 260 202 --1214 1145
NM_024817chr1575438 4459 4127 2058 1844 1407 750 --21825 804 25418 4862
NM_024824chr1431647 1588 695 ------
NM_024828chr92123 53 ------
NM_024834chr1061441 752 460 298 118 69 --1524 --
NM_024837chr1551622 1502 636 599 31 ------
NM_024841chr1182329 1720 1628 960 713 349 62 27 --1279 1789
NM_024847chr1631121 939 805 ------
NM_024852chr1----1266 --
NM_024874chr111290 --21231 106 --
NM_024893chr201945 ------
NM_024896chr952198 2080 1849 1726 263 1724 ----
NM_024913chr741547 1266 693 523 21460 221 21719 1098 --
NM_024920chr431034 346 221 ------
NM_024921chrX21340 587 ------
NM_024944chr212350 169 1462 11218 --
NM_024947chr3199563 9067 8852 8447 7887 7662 6802 6647 6624 3592 3455 3294 2034 1728 1644 1121 520 357 146 38822 7062 806 39618 6533 1533 26045 2597
NM_024949chr483797 3467 3095 1920 1055 937 282 31 34956 4367 1854 24937 3856 --
NM_024953chr1272832 2660 2489 2146 295 206 54 12075 ----
NM_024969chr2--1251 1821 --
NM_024989chr2147769 7472 7286 6972 6758 5875 5616 5252 2943 2589 2147 1877 1440 214 11958 26417 1600 21157 373
NM_024991chr1063184 3020 2656 2375 940 425 22171 366 --12246
NM_024993chr221528 25 ------
NM_025054chr863285 2736 1610 1465 835 448 33370 1177 406 11449 --
NM_025057chr141555 ------
NM_025073chr184704 4470 4222 3642 1441 1404 972 299 21761 1142 43807 3573 1528 243 --
NM_025074chr432590 984 38 12078 ----
NM_025106chr121804 1371 --11418 --
NM_025112chr3189 ------
NM_025114chr12127 ------
NM_025133chr211170 ------
NM_025134chr1632517 1921 1882 1111 ----
NM_025138chr13--11062 ----
NM_025146chr342527 2339 1787 1002 11961 ----
NM_025151chr862096 2077 1860 1846 1817 112 ------
NM_025152chr1421277 477 21249 1233 2<