TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-144-3p
miRNA Sequence: UACAGUAUAGAUGAUGUACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51335 ------
NM_000052chrX32749 2613 406 12986 23102 2380 185
NM_000055chr32384 128 ------
NM_000067chr81191 ----1668
NM_000074chrX--1889 ----
NM_000081chr131569 1366 740 ------
NM_000091chr292894 2801 2141 1904 1808 1113 312 200 101 --32816 778 67 1640
NM_000098chr11569 ------
NM_000109chrX42661 2652 2504 240 12641 12534 1210
NM_000112chr555282 3902 3875 1444 940 34911 383 273 15504 15341
NM_000138chr1532682 2601 288 --12617 1599
NM_000158chr31138 ----1483
NM_000161chr143621 588 40 11995 1382 --
NM_000163chr52602 203 --1267 --
NM_000168chr772146 1252 944 798 584 373 225 13181 ----
NM_000173chr17--1430 ----
NM_000176chr563847 3733 2750 1559 513 106 2595 56 23614 3190 --
NM_000194chrX----1383 --
NM_000210chr22659 125 --1337 179
NM_000214chr2051785 1711 1421 1177 388 ------
NM_000245chr761868 1843 1653 329 243 125 21914 1436 ----
NM_000248chr372965 2446 912 791 699 532 486 22941 215 ----
NM_000251chr2244 32 --164 --
NM_000259chr1586120 5676 4858 2547 919 852 192 103 15551 31840 647 488 36364 5917 2496
NM_000264chr93923 492 401 2648 139 --1369
NM_000267chr17113438 3374 3284 3201 2185 2174 1368 1264 326 182 97 13255 13247 33344 3121 3098
NM_000280chr111837 1143 137 --
NM_000297chr472045 1974 1691 1580 1426 376 220 21843 62 ----
NM_000303chr1611488 ----11442
NM_000314chr10103231 3122 2754 2198 1273 1087 1021 677 542 394 --32923 2150 957 --
NM_000325chr42694 635 ------
NM_000328chrX--139 ----
NM_000332chr6147176 6865 6482 6185 5458 5376 4868 4575 2371 1852 1541 1297 1005 793 42387 1181 65 60 36283 5444 1132 16927
NM_000345chr441029 412 322 226 1849 2977 391 11043
NM_000368chr984877 4806 4023 3482 1724 1205 765 755 --136 --
NM_000378chr1131214 1116 847 2365 283 ----
NM_000384chr22293 83 ------
NM_000393chr231694 827 764 --1543 11335
NM_000408chr263287 3029 2648 2567 2233 979 23416 174 12614 12791
NM_000428chr1432218 1802 1688 --12332 22494 2276
NM_000430chr1793689 3647 3466 2540 2481 1232 1074 1001 926 13779 2734 95 1187
NM_000436chr551494 1439 513 411 255 --1166 --
NM_000459chr92806 737 1118 1199 1884
NM_000461chr384464 4209 3958 3456 2939 2830 1492 1003 23964 3772 34044 1725 500 --
NM_000462chr152565 422 11475 11693 --
NM_000480chr1131620 1233 53 ------
NM_000489chrX52762 2583 2310 1042 532 22655 2457 12689 12319
NM_000492chr721228 350 11514 21018 510 11168
NM_000516chr20----1312 --
NM_000534chr21140 1161 ----
NM_000555chrX97741 6597 6373 2823 1902 1644 1587 1308 658 16912 11104 --
NM_000572chr1--1109 ----
NM_000586chr4173 1100 ----
NM_000600chr7------1370
NM_000609chr1022976 2473 1249 1809 12965
NM_000610chr1153005 2914 2670 2190 707 12895 12725 --
NM_000619chr12----1493 --
NM_000633chr1855279 4747 3947 2057 840 14569 25248 1781 --
NM_000693chr152658 144 11636 --11695
NM_000719chr1276490 6233 4266 2531 1959 1877 1115 16647 16057 --
NM_000724chr1051412 1269 545 237 134 21657 554 --1775
NM_000793chr1475090 4734 3421 2042 1151 372 27 --11907 --
NM_000806chr5------21483 374
NM_000808chrX2936 194 ------
NM_000810chr154532 511 418 144 ------
NM_000813chr564813 4636 3595 3573 2227 1487 13672 35270 842 390 14084
NM_000814chr1524057 1159 14093 13335 --
NM_000816chr52629 205 --1153 --
NM_000824chr42663 219 ------
NM_000826chr492510 2448 2248 1875 852 610 451 222 61 22410 2009 2756 113 11946
NM_000831chr154044 2228 1643 1424 363 16274 11909 24552 2443
NM_000838chr632015 1914 1830 11025 --12780
NM_000844chr31975 --11087 --
NM_000859chr521516 1073 --1216 2409 249
NM_000899chr1264398 3270 919 691 360 186 --11697 14308
NM_000902chr3103043 3037 2891 2852 2673 903 809 646 259 102 ------
NM_000917chr104815 758 198 29 --1835 --
NM_000919chr51493 ------
NM_000922chr112290 31 1881 1132 1416
NM_000926chr1178003 6368 6237 3734 1691 802 674 47754 6243 1640 1315 19435 16350
NM_000935chr311169 11161 ----
NM_000944chr41290 1410 ----
NM_000950chrX52752 2740 2556 1064 975 1895 --1434
NM_000958chr571288 967 831 500 443 303 26 ----11186
NM_000959chr173970 3805 3426 2770 1524 871 132 ------
NM_000961chr2054016 3638 3137 2520 411 --13166 --
NM_000965chr31973 1441 11263 1368
NM_000990chr1163674 2761 2741 1529 754 639 1263 ----
NM_001001323chr1222242 684 1832 33206 359 192 22218 915
NM_001001389chr1153005 2914 2670 2190 707 12895 12725 --
NM_001001390chr1153005 2914 2670 2190 707 12895 12725 --
NM_001001391chr1153005 2914 2670 2190 707 12895 12725 --
NM_001001392chr1153051 2960 2716 2236 753 12941 12771 --
NM_001001394chr21637 ------
NM_001001396chr184473 4161 3904 3892 3804 1764 1260 386 ------
NM_001001419chr524291 3227 23606 543 65217 5171 4624 3911 76 29 --
NM_001001420chr524291 3227 23606 543 65217 5171 4624 3911 76 29 --
NM_001001436chr163901 280 211 ------
NM_001001481chr853447 3377 2140 621 308 ------
NM_001001483chr111314 ------
NM_001001484chr104655 510 414 389 11722 22007 572 --
NM_001001485chr33508 324 318 ------
NM_001001521chr2--1100 1232 --
NM_001001664chr2114020 3727 1465 1263 868 851 746 716 326 265 134 11242 --13871
NM_001001665chr263274 3117 3082 2940 439 383 ----1485
NM_001001668chr1954198 3981 3889 3700 3675 13060 34175 3794 1665 --
NM_001001706chr62490 206 1902 --1237
NM_001001890chr2154224 3043 3029 1559 957 1740 33551 1243 351 13626
NM_001001928chr2277794 5507 2901 1270 546 387 201 18294 27154 5209 --
NM_001001933chr13539 238 83 1390 ----
NM_001001974chr1052339 1584 1552 442 111 1484 11978 --
NM_001002233chr852136 2018 1485 441 354 1188 --12064
NM_001002243chr21174 1732 ----
NM_001002257chr253307 2975 1320 584 160 22624 2179 2377 201 13344
NM_001002259chr12----1242 --
NM_001002295chr102270 254 ----2307 295
NM_001002814chr883767 3396 3127 3105 2617 1485 441 354 1188 --13573
NM_001002843chr152501 79 11272 1831 1911
NM_001002860chr1454652 4366 4294 3902 3073 --24072 3049 --
NM_001002919chr21531 ------
NM_001003652chr18128482 6048 3376 3098 2784 2561 2346 1757 1189 814 715 342 22240 1900 36229 2931 2590 --
NM_001003674chr1897007 6604 6593 6281 5295 4645 1449 775 417 45474 4993 1890 1343 47052 5899 1564 1098 26401 5059
NM_001003675chr1897007 6604 6593 6281 5295 4645 1449 775 417 45474 4993 1890 1343 47052 5899 1564 1098 26401 5059
NM_001003681chr22--31930 615 586 ----
NM_001003694chr32636 441 ----1454
NM_001003712chr1253247 3008 1174 782 500 --13489 11612
NM_001003810chr41650 1267 ----
NM_001004196chr321237 1212 --11029 --
NM_001004317chr663504 3038 1808 1682 1520 1089 14011 ----
NM_001004360chr252014 1493 1300 175 35 1428 --174
NM_001004720chr2------11074
NM_001004722chr2------11243
NM_001005335chr19--1242 ----
NM_001005404chr1743183 1525 919 790 11160 ----
NM_001005463chr1052533 806 693 644 81 1619 ----
NM_001005474chr321074 88 ----1551
NM_001005609chrX73727 3536 2359 1317 658 309 80 13530 23761 573 11245
NM_001005743chr1461314 1066 982 889 474 147 ------
NM_001005744chr1461314 1066 982 889 474 147 ------
NM_001005745chr1461314 1066 982 889 474 147 ------
NM_001005753chr242083 2048 572 224 ------
NM_001005782chr22845 156 1884 ----
NM_001005849chr171191 1156 ----
NM_001006600chr521742 494 62449 1933 1909 1782 1777 800 ----
NM_001006610chr162837 312 ------
NM_001006623chr272387 2005 1891 934 761 534 425 --2557 105 22433 1029
NM_001006657chr253074 2982 2929 2316 768 1506 --164
NM_001006933chrX142 ------
NM_001007023chr1475090 4734 3421 2042 1151 372 27 --11907 --
NM_001007024chr1764275 3892 3747 1571 507 185 14338 12832 --
NM_001007025chr1764275 3892 3747 1571 507 185 14338 12832 --
NM_001007075chr421086 849 ------
NM_001007097chr975045 1671 1511 1073 1016 85 55 24903 4795 31066 950 178 --
NM_001007102chr651598 1049 544 479 194 --11399 --
NM_001007226chr1741488 1097 583 473 --2933 249 --
NM_001007227chr1741488 1097 583 473 --2933 249 --
NM_001007228chr1741488 1097 583 473 --2933 249 --
NM_001007229chr1741488 1097 583 473 --2933 249 --
NM_001007230chr1741488 1097 583 473 --2933 249 --
NM_001007257chr121235 205 11529 1941 11088
NM_001007278chr1355260 3563 3458 3351 2068 --33602 1455 256 2736 295
NM_001007466chr684701 4088 3995 1862 1642 1034 357 292 34740 4615 1093 ----
NM_001007559chr1811994 --31494 743 48 11509
NM_001008225chr7--1651 1503 --
NM_001008239chr1833583 2574 1290 --23348 3141 1990
NM_001008391chr112703 505 1238 ----
NM_001008392chr393545 3434 3240 3059 2954 2556 870 625 478 23344 3339 ----
NM_001008401chr1941349 226 144 62 ----11391
NM_001008405chr751714 1184 424 354 332 --11785 --
NM_001008408chr786341 6279 5441 4622 4591 2496 2048 1552 24996 1122 13874 16398
NM_001008495chr81481 11684 1573 --
NM_001008539chr8135045 5000 4527 4493 4400 4067 2075 1842 771 374 365 322 84 15136 ----
NM_001008540chr22431 185 1385 --189
NM_001008564chr1362268 2092 2036 1971 426 160 ------
NM_001008660chr11185 1379 11431 1584
NM_001008738chr552335 2247 2066 670 659 12123 ----
NM_001008783chr63732 579 137 1569 ----
NM_001008860chr152669 225 --1787 --
NM_001008892chr152669 225 --1787 --
NM_001008894chr152669 225 --1787 --
NM_001008895chr131384 ----11414
NM_001009554chr474115 3446 3309 1552 972 923 709 --11006 --
NM_001009554chr474115 3446 3309 1552 972 923 709 --11006 --
NM_001009555chr431677 1318 1295 ----1406
NM_001009571chr731663 1208 508 ------
NM_001009881chr12572 60 --1416 --
NM_001009882chr12572 60 --1416 --
NM_001009899chr3106463 5997 5982 5898 5152 4171 2239 805 306 165 36259 6154 4009 ----
NM_001009909chr1163939 3552 3491 2735 2647 40 23719 701 43824 3396 360 82 --
NM_001009958chr73607 457 190 ------
NM_001009959chr242623 2437 2427 1784 ------
NM_001009993chr274558 4212 3805 1630 1404 1027 934 14532 ----
NM_001010844chr61259 ----123
NM_001010862chrX32392 1311 980 --33284 3216 2484 12232
NM_001010888chrX74323 4050 3175 3002 1754 1691 969 24268 3945 14372 14615
NM_001010891chr5106608 5443 4977 2294 1698 1676 1649 1245 1115 798 1255 34907 1742 898 26877 2163
NM_001011515chr42873 142 11025 ----
NM_001011516chr42873 142 11025 ----
NM_001011537chr351960 1838 1619 821 411 11906 --12096
NM_001011553chr73952 694 284 1980 ----
NM_001011666chr766467 6269 2290 1739 1176 452 --16190 --
NM_001011708chr252812 2370 2033 768 752 --1156 --
NM_001011713chr141487 11482 ----
NM_001011885chr1521732 1487 ----11469
NM_001012393chr1154721 3925 3719 1807 909 ----11007
NM_001012418chr674264 4073 4035 3836 1606 1001 37 11177 ----
NM_001012420chr1562878 2153 769 526 421 262 32930 725 717 --12741
NM_001012423chr1562878 2153 769 526 424 262 32930 725 717 --12741
NM_001012751chr1021405 393 --41691 444 117 47 --
NM_001012755chrX74822 4791 4623 1838 1721 1522 978 --35114 931 471 24332 3763
NM_001012761chr532737 2388 75 --2154 63 --
NM_001012958chr151290 999 587 289 187 ----11425
NM_001012958chr151290 999 587 289 187 ----11425
NM_001012968chrX72732 1959 1951 923 705 193 125 1695 ----
NM_001012979chrX142 ------
NM_001013031chr1042903 1319 915 875 --1472 11125
NM_001013399chr651059 979 913 791 117 ------
NM_001013406chr731213 1172 677 ----11136
NM_001013620chr1277841 7379 6540 5188 3155 1837 618 --57309 7037 6239 5698 1711 1743
NM_001013699chr12------1536
NM_001013717chr521258 469 ----11464
NM_001013746chr7142219 1864 1826 1641 862 789 624 540 456 376 292 209 125 41 12046 ----
NM_001014380chr1385250 4934 4544 4306 4182 1094 511 238 24600 1664 --11597
NM_001014434chr11183 ------
NM_001014797chr10108120 6317 6242 5274 2966 1920 973 945 294 209 --36075 5737 2579 --
NM_001014831chr19----1650 --
NM_001014832chr19----1650 --
NM_001014834chr19----1650 --
NM_001014835chr19----1650 --
NM_001015048chr1443085 2648 984 857 12614 129 --
NM_001015049chr1443085 2648 984 857 12614 129 --
NM_001015508chr83672 525 477 2494 489 ----
NM_001015877chrX73036 2522 2406 2396 2179 849 322 22310 883 ----
NM_001015881chrX21091 1051 ------
NM_001015887chr36719 659 651 491 374 140 --11815 --
NM_001017371chr211174 21351 352 160 11148
NM_001017395chr373416 3246 3125 2473 1007 842 440 43656 3326 2631 1000 12596 --
NM_001017434chr11160 --1742 --
NM_001017440chr767832 7247 6383 6177 6074 2274 --26234 5811 --
NM_001017926chr861453 1390 1328 678 389 60 ----1363
NM_001017962chr104815 758 198 29 --1835 --
NM_001018005chr15--1150 ----
NM_001018037chr9------11360
NM_001018053chr1--21875 692 11350 11511
NM_001018056chr9--2570 419 ----
NM_001018065chr986014 5677 5179 5007 3917 3758 1821 1642 14228 14262 --
NM_001018066chr986014 5677 5179 5007 3917 3758 1821 1642 14228 14262 --
NM_001018067chr194681 3318 1956 1683 1483 1174 812 426 417 --24804 504 13736
NM_001018068chr194681 3318 1956 1683 1483 1174 812 426 417 --24804 504 13736
NM_001018069chr194681 3318 1956 1683 1483 1174 812 426 417 --24804 504 13736
NM_001018074chr563847 3733 2750 1559 513 106 2595 56 23614 3190 --
NM_001018075chr563847 3733 2750 1559 513 106 2595 56 23614 3190 --
NM_001018076chr563847 3733 2750 1559 513 106 2595 56 23614 3190 --
NM_001018077chr563847 3733 2750 1559 513 106 2595 56 23614 3190 --
NM_001018090chr1531083 855 618 --3235 197 87 12086
NM_001018091chr152965 728 --3345 307 197 12196
NM_001018102chr1531083 855 618 --3235 197 87 12086
NM_001018115chr3--1621 ----
NM_001020658chr12665 233 --11476 11110
NM_001020658chr12665 233 --11476 11110
NM_001023567chr1572430 2357 2270 1878 772 723 529 12322 12420 12128
NM_001024094chr563847 3733 2750 1559 513 106 2595 56 23614 3190 --
NM_001024463chr151778 ----2936 882
NM_001024647chr1287501 7459 6896 4983 2667 936 782 469 17202 31165 687 166 11684
NM_001024649chr522144 998 1441 ----
NM_001024934chr62512 504 --1571 --
NM_001024935chr62512 504 --1571 --
NM_001024936chr62512 504 --1571 --
NM_001024947chr521072 181 2902 837 ----
NM_001024948chr173246 3052 3005 2761 2164 2134 187 ------
NM_001024956chr1185749 4720 4593 4341 4290 2264 1384 1050 25491 4507 23788 182 --
NM_001025076chr10136062 6042 5910 5869 5779 4686 3976 3897 3802 2158 1938 1361 1275 1769 21482 741 --
NM_001025077chr10187420 7400 7268 7227 7137 6044 5334 5255 5160 5064 4831 4703 4578 2719 2633 1244 917 653 12127 34644 2840 2099 --
NM_001025079chr321068 582 23268 757 ----
NM_001025105chr541534 1519 1137 357 11161 --1178
NM_001025108chr274102 3948 3784 3522 2709 1599 1072 --1485 --
NM_001025201chr21726 ------
NM_001025252chr853125 1287 988 703 39 12090 --21225 1090
NM_001025253chr853125 1287 988 703 39 12090 --21225 1090
NM_001025389chr1131620 1233 53 ------
NM_001025390chr1131620 1233 53 ------
NM_001025580chrX84291 3460 3344 1659 1585 953 711 289 192 --24272 2887
NM_001025780chr921579 1237 2532 257 --1290
NM_001029858chr6123230 3139 3097 2625 1170 1002 765 581 321 315 285 252 169 ----
NM_001029860chr81265 ------
NM_001029882chr12494 475 1439 1447 --
NM_001029882chr12494 475 1439 1447 --
NM_001029884chr652614 2258 1734 221 63 22366 184 --12708
NM_001029997chr192696 65 ----1149
NM_001029998chr441372 1056 498 421 1328 ----
NM_001030007chr1663992 3984 3128 2854 1511 402 33813 1567 599 --11193
NM_001030055chr1464398 3114 2900 1744 1555 1065 23736 1504 31473 745 306 --
NM_001031679chr1231383 1180 593 23548 3177 ----
NM_001031684chr211319 1540 ----
NM_001031685chr12662 589 --1219 1947
NM_001031695chr2254693 3890 2074 1390 545 --14979 15224
NM_001031700chr452026 971 952 583 547 --32372 2090 316 --
NM_001031712chr61427 --1298 --
NM_001031716chr25920 826 742 393 75 11099 ----
NM_001031732chr4103671 2613 1459 1397 1354 745 647 439 418 262 13213 ----
NM_001031801chr221185 ------
NM_001031804chr1654438 3377 1618 992 540 ------
NM_001031812chr561806 1478 699 595 529 50 11736 11773 --
NM_001032280chr631657 1263 538 11071 21677 1146 --
NM_001032282chr821207 330 --1463 1849
NM_001032288chr2031590 1357 1338 ----1156
NM_001032289chrX1141 ------
NM_001032393chrX1724 2747 234 ----
NM_001033047chr431913 781 642 12574 ----
NM_001033057chr331397 249 179 11462 1626 1440
NM_001033081chr141718 1704 1513 627 1218 --11744
NM_001033082chr141718 1704 1513 627 1218 --11744
NM_001033112chr51559 ----2865 699
NM_001033117chr374431 4378 4261 4246 3200 2960 1598 --11106 11015
NM_001033557chr251274 1175 1076 522 133 1342 195 --
NM_001033561chr17--1735 ----
NM_001033578chr8--12227 --22345 2199
NM_001033602chr1392577 2462 2347 2123 2077 1909 870 385 340 --11902 11058
NM_001033925chr1042190 1660 1587 336 ----1791
NM_001034836chr17143 ------
NM_001034841chr1665261 1887 1806 1694 685 442 13653 25182 263 15144
NM_001034852chr1461762 1472 589 549 424 395 1245 --1340
NM_001037132chr732043 1713 759 31620 438 112 ----
NM_001037133chr732043 1713 759 31620 438 112 ----
NM_001037174chr222302 467 1622 ----
NM_001037334chr186962 865 638 619 502 383 --12278 1831
NM_001037553chr2184707 4677 4603 4175 4094 2072 1209 428 14272 ----
NM_001037631chr2------1386
NM_001038493chr251501 1324 1315 1300 1090 ------
NM_001038640chr151839 ------
NM_001039091chrX2409 143 ------
NM_001039348chr2----150 1110
NM_001039349chr2----150 1110
NM_001039547chr3106692 6185 3118 1956 1810 1738 1406 791 705 305 25852 1601 28094 381 37910 6751 3216
NM_001039577chr171663 1173 1116 804 559 140 21 33882 1729 251 --1463
NM_001039585chr174227 4062 3683 3027 2644 1128 389 --1146 --
NM_001039590chrX53595 3112 1411 947 157 13067 --21298 645
NM_001039591chrX53595 3112 1411 947 157 13067 --21298 645
NM_001039618chr11104950 4857 4689 4015 3969 2144 2102 1470 1047 122 25047 4271 35808 5122 3919 --
NM_001039762chr1012196 --11908 --
NM_001039802chr11213 ------
NM_001039840chrX94806 4703 4396 4145 2287 2276 564 316 89 1629 23974 710 --
NM_001039844chr1042991 2465 2223 145 12170 2961 82 11010
NM_001039937chr1374068 3306 1503 1349 1228 1178 1017 1451 13267 13854
NM_001040001chr631991 748 450 21932 1913 11267 --
NM_001040100chr341004 508 413 75 ------
NM_001040142chr252409 2105 1643 565 406 21742 528 12155 11554
NM_001040143chr252409 2105 1643 565 406 21742 528 12155 11554
NM_001040152chr795120 5111 4144 3613 3097 1557 1515 430 312 25072 1242 13116 --
NM_001040153chr136972 960 711 401 222 190 1784 ----
NM_001040157chr472895 2251 575 431 188 95 87 1680 --151
NM_001040159chr431498 1167 1130 1970 ----
NM_001040284chr16135290 4342 3815 3636 3625 2320 1656 1216 1131 1055 888 578 496 14074 --11378
NM_001040402chr483041 2583 2134 469 260 164 90 70 1333 13151 --
NM_001040429chr132389 109 --23529 1084 11141
NM_001040446chr521848 86 12557 12436 12521
NM_001040450chr1572623 2565 2337 2329 1851 525 246 --1221 --
NM_001040453chr1572623 2565 2337 2329 1851 525 246 --1221 --
NM_001040624chr862634 2476 856 750 715 448 11758 ----
NM_001040625chr862634 2476 856 750 715 448 11758 ----
NM_001040626chr862634 2476 856 750 715 448 11758 ----
NM_001040627chr862634 2476 856 750 715 448 11758 ----
NM_001040628chr862634 2476 856 750 715 448 11758 ----
NM_001040629chr862634 2476 856 750 715 448 11758 ----
NM_001040630chr862634 2476 856 750 715 448 11758 ----
NM_001040633chr72927 910 ----1237
NM_001040665chr774907 4086 1604 902 716 680 642 1214 33825 3668 86 --
NM_001040712chr962680 2645 1065 525 439 356 31025 685 516 11373 --
NM_001040876chr451925 1591 1567 481 323 ------
NM_001042355chr16105371 5057 5010 3983 3536 1466 1145 727 513 482 13874 24973 3917 --
NM_001042403chr121415 ------
NM_001042404chr131777 1474 52 --1323 1721
NM_001042406chr621230 995 --3850 370 327 --
NM_001042412chr16105371 5057 5010 3983 3536 1466 1145 727 513 482 13874 24973 3917 --
NM_001042413chr953981 3913 3614 3568 1574 1705 ----
NM_001042425chr631657 1263 538 11071 21677 1146 --
NM_001042453chrX11516 ----11454
NM_001042473chr1021720 195 12180 1852 --
NM_001042481chr1462497 2160 1892 1734 285 37 12149 1616 --
NM_001042492chr17113438 3374 3284 3201 2185 2174 1368 1264 326 182 97 13255 13247 33344 3121 3098
NM_001042494chr1553852 3774 3192 2961 122 1532 1628 12841
NM_001042495chr1553852 3774 3192 2961 122 1532 1628 12841
NM_001042496chr1553852 3774 3192 2961 122 1532 1628 12841
NM_001042497chr1553852 3774 3192 2961 122 1532 1628 12841
NM_001042506chrX--21364 112 11372 --
NM_001042510chr861909 1604 762 553 260 45 22170 1353 2273 140 12055
NM_001042511chr861909 1604 762 553 260 45 22170 1353 2273 140 12055
NM_001042543chr4--11595 ----
NM_001042550chr961868 1849 1573 1518 202 101 12082 11909 11373
NM_001042555chr1284678 4630 4068 1652 1290 1013 605 271 24549 3769 34566 4025 1350 23997 3758
NM_001042585chr13630 512 112 ----1557
NM_001042599chr2117784 7416 6774 6647 6378 4781 2351 2269 1804 1595 286 47190 5964 4754 2150 25551 4762 --
NM_001042601chr383082 3027 1083 845 782 378 327 255 --2773 705 --
NM_001042603chr1285153 2104 2040 1848 1535 1245 994 755 13975 11039 11991
NM_001042604chr353126 1359 1064 1046 563 33591 3570 3528 44802 4480 4262 158 --
NM_001042683chr661650 1558 1524 740 376 131 --1181 --
NM_001042749chrX31840 1827 1359 1804 11612 1534
NM_001042750chrX31840 1827 1359 1804 11612 1534
NM_001042751chrX31840 1827 1359 1804 11612 1534
NM_001044385chr293739 3291 2816 2748 1211 1170 1153 165 119 --13153 --
NM_001044722chr561806 1478 699 595 529 50 11736 11773 --
NM_001044723chr561806 1478 699 595 529 50 11736 11773 --
NM_001046chr512597 1493 12438 22940 964
NM_001048183chr123132 2979 23701 1522 --1228
NM_001069chr61155 ------
NM_001071775chr1321788 331 ----1454
NM_001079874chr162009 1934 1842 178 172 154 11831 ----
NM_001083620chr492508 2446 2246 1873 851 609 450 221 61 22408 2007 2755 113 11944
NM_001099678chr386430 6400 6219 6025 5922 5660 4523 1051 25877 4608 15781 25466 1244
NM_001106chr3159594 9353 9175 8023 7788 7407 3397 3105 2382 1283 1162 651 407 289 210 38698 7248 220 12971 1971
NM_001113490chrX92961 2765 1127 734 721 554 426 260 240 ------
NM_001117chr1832125 1926 901 1472 1155 --
NM_001121chr1011890 ------
NM_001124chr112470 288 --1556 1526
NM_001126chr12336 155 ------
NM_001128chr1663992 3984 3128 2854 1511 402 33813 1567 599 --11193
NM_001128144chr21140 1161 ----
NM_001146chr822109 277 --32142 482 98 --
NM_001148chr432060 674 376 1609 12083 1385
NM_001149chr1041267 1184 887 575 21174 490 1281 --
NM_001156chr101234 ------
NM_001160chr1242155 1965 365 264 12675 2494 349 --
NM_001167chrX96595 6552 6112 1777 1540 617 450 288 211 26711 1682 35506 5111 2613 15213
NM_001173chr1464398 3114 2900 1744 1555 1065 23736 1504 31473 745 306 --
NM_001177chr1242428 2110 618 116 --22138 535 --
NM_001186chr2153061 2563 2384 1283 1097 12066 197 --
NM_001200chr20----1880 --
NM_001204chr286030 5668 5572 2951 2944 2338 1861 1083 27759 6189 --37524 7147 5967
NM_001206chr943070 3005 958 468 11069 --12728
NM_001219chr712219 --12180 --
NM_001233chr732239 1821 451 1619 1577 137
NM_001239chr51121 ------
NM_001241chr23547 196 64 12105 12343 31927 434 308
NM_001241chr23547 196 64 12105 12343 31927 434 308
NM_001256chr1752664 2005 737 572 72 11850 ----
NM_001259chr7136382 6026 5895 3860 2339 1869 1613 1147 943 742 314 167 120 25602 1982 34916 4834 4466 14080
NM_001270chr53817 193 120 11011 1873 --
NM_001271chr1552019 781 476 117 110 33245 3102 1203 ----
NM_001288chr61191 ------
NM_001290chr42746 235 --1346 1417
NM_001304chr1763516 3133 3011 2893 862 702 13021 13368 12751
NM_001310chr1242719 2261 2039 696 22567 853 ----
NM_001315chr622031 302 ----11517
NM_001326chr112415 113 ------
NM_001343chr521282 397 --1369 --
NM_001387chr542800 2586 2058 177 --1491 --
NM_001390chr1843530 3520 428 372 23501 3482 22268 464 --
NM_001396chr2142555 2267 922 620 1527 12420 12565
NM_001399chrX73727 3536 2359 1317 658 309 80 13530 23761 573 11245
NM_001401chr921373 174 11010 --11042
NM_001412chrX73607 3103 2614 1068 701 517 168 ------
NM_001427chr7----1111 --
NM_001429chr2221097 63 --1758 --
NM_001430chr221801 411 --11941 1517
NM_001432chr423832 3227 12591 ----
NM_001438chr131389 945 628 --43573 3516 2418 640 33565 2452 2253
NM_001448chrX31747 1662 1621 ------
NM_001452chr61556 ------
NM_001463chr22782 104 --2288 220 --
NM_001480chr1821182 86 --1433 1247
NM_001490chr922565 849 11488 43483 2419 1407 1341 1531
NM_001491chr641068 929 262 229 12692 22755 360 --
NM_001495chr81899 11107 21130 1023 --
NM_001497chr952669 2262 1093 872 51 --12568 1936
NM_001498chr65972 911 313 289 106 31151 871 358 ----
NM_001527chr6104875 4771 4357 3793 3507 880 732 471 165 48 --44662 4255 3843 3631 --
NM_001530chr1431137 188 106 --1810 --
NM_001533chr19--1242 ----
NM_001546chr641427 1076 442 249 ----2592 507
NM_001560chrX62453 2246 2186 2074 1646 456 --22665 2220 --
NM_001584chr1131190 801 401 --21118 1079 1833
NM_001604chr111837 1143 137 --
NM_001609chr1064455 4325 3887 2954 1317 467 141 11104 --
NM_001616chr273394 3328 2456 909 797 510 444 33387 2242 467 --13489
NM_001621chr722727 987 11227 11120 12644
NM_001621chr722727 987 11227 11120 12644
NM_001642chr111303 1151 ----
NM_001650chr1832898 365 185 --13162 11253
NM_001660chr31145 --1655 --
NM_001663chr143859 788 125 1429 --21777 648
NM_001668chr1------11715
NM_001681chr121197 --1632 --
NM_001682chr1221956 398 1546 22920 73 21932 629
NM_001684chr184190 3878 3621 3609 3521 1481 977 103 ------
NM_001690chr372537 2406 2016 1623 820 437 100 1264 ----
NM_001695chr874254 3842 2604 635 611 542 325 --1372 --
NM_001698chr92351 335 ------
NM_001706chr31222 ----163
NM_001709chr1152600 942 502 304 32 32831 2756 2329 ----
NM_001726chr1------1107
NM_001730chr1351531 1498 1203 1110 1009 1210 21294 1210 --
NM_001730chr1351531 1498 1203 1110 1009 1210 21294 1210 --
NM_001731chr121866 ------
NM_001742chr741662 1591 330 166 ------
NM_001746chr522144 998 1441 ----
NM_001753chr711634 --31420 1195 288 --
NM_001754chr2154224 3043 3029 1559 957 1740 33551 1243 351 13626
NM_001755chr1662077 2056 2028 1947 1724 790 --12276 --
NM_001759chr1294347 4211 3852 1858 1362 1024 745 611 247 1853 --14680
NM_001769chr121394 ----1322
NM_001777chr321068 582 23268 757 ----
NM_001786chr10156 ------
NM_001788chr73952 694 284 1980 ----
NM_001791chr11213 ------
NM_001821chr144896 4726 3800 3683 14418 21456 24 --
NM_001822chr21726 ------
NM_001829chr46975 951 636 626 260 163 ------
NM_001830chrX73465 2990 2807 853 726 315 247 23979 1420 ----
NM_001839chr11498 2192 112 1250 --
NM_001854chr121431 584 1283 1405 --
NM_001855chr91212 ------
NM_001858chr6104840 4801 4434 4144 3205 1808 1681 1634 1373 719 24864 1743 --11693
NM_001892chr541534 1519 1137 357 11161 --1178
NM_001920chr12182 1540 ----
NM_001924chr1--1426 ----
NM_001931chr11----2926 186 --
NM_001935chr22752 231 ------
NM_001938chr12418 152 11731 11523 11917
NM_001949chr632261 551 335 ----12370
NM_001954chr61650 ------
NM_001955chr621020 845 11127 ----
NM_001964chr5--1475 ----
NM_001967chr32576 390 1467 ----
NM_001969chr1463560 3005 2738 785 137 37 13477 1413 1932
NM_001977chr441655 1412 661 40 ------
NM_001981chr132166 255 52 --12337 1580
NM_001993chr121096 37 --11079 --
NM_001999chr531396 1143 961 1216 --21209 1104
NM_002006chr4125644 5070 4645 4486 3610 1837 1688 1243 1041 753 218 208 15754 --15715
NM_002009chr1542192 1922 942 647 --12649 1731
NM_002013chr141221 195 ----
NM_002015chr1383016 2666 2605 2493 2180 1159 794 761 22529 225 1430 12624
NM_002025chrX119278 9231 8326 7594 6672 5790 5652 2571 2280 1568 1221 16717 1290 17118
NM_002031chr63831 702 287 ------
NM_002035chr1833537 2513 97 1947 12476 --
NM_002039chr42900 219 1274 ----
NM_002041chr152130 44 ------
NM_002051chr102270 254 ----2307 295
NM_002054chr21189 ------
NM_002056chr23910 273 224 ------
NM_002069chr741827 1346 390 243 ------
NM_002114chr6--1422 1526 --
NM_002126chr1754106 3017 1478 755 594 1740 14122 --
NM_002128chr1352445 2414 2263 992 469 22525 1891 ----
NM_002129chr41389 ------
NM_002135chr121533 ------
NM_002138chr41650 1267 ----
NM_002146chr171234 11234 ----
NM_002148chr21583 ------
NM_002165chr20--1328 1359 --
NM_002203chr563822 2809 1073 516 467 55 34096 2538 1134 14131 --
NM_002210chr253144 2420 2414 2408 321 12743 1886 --
NM_002214chr7105515 5354 5145 4924 4604 3894 2276 2090 2057 210 1243 1350 --
NM_002222chr32479 100 1176 --1133
NM_002223chr1273735 3328 2691 943 831 359 96 --33506 1544 988 --
NM_002234chr122754 728 ------
NM_002239chr22974 827 ----1295
NM_002242chr241959 1881 1568 1555 21639 67 ----
NM_002264chr384854 3505 1511 1350 1247 1107 697 662 24182 3300 1113 13595
NM_002266chr17158 ------
NM_002267chr1342304 2136 1516 764 --22031 785 --
NM_002269chr62251 124 ------
NM_002270chr585109 5067 4172 3803 1952 1866 1393 1210 25625 1083 34960 2067 1691 55620 5189 4521 3681 1145
NM_002271chr1331843 1611 688 1984 22207 2010 12343
NM_002285chr274102 3948 3784 3522 2709 1599 1072 --1485 --
NM_002290chr621341 271 ------
NM_002310chr5106598 6381 5908 4625 2619 2556 2348 1901 695 103 36188 4558 603 25928 4213 11552
NM_002312chr131950 ----1814
NM_002336chr12104325 4208 4184 3649 1938 1578 1564 894 611 145 ------
NM_002342chr12------1599
NM_002351chrX21394 574 --1491 167
NM_002356chr682807 2764 2501 2060 1092 958 740 73 1815 1967 --
NM_002387chr5114963 4955 4947 4901 4199 4191 1307 1026 985 899 387 15075 ----
NM_002398chr2----1558 1542
NM_002399chr1511281 21296 574 11351 11172
NM_002408chr142545 242 ------
NM_002430chr2252415 2342 566 526 389 1375 --12579
NM_002444chrX61830 1797 1654 1422 717 321 --182 --
NM_002457chr111101 ------
NM_002467chr81425 ------
NM_002469chr12--1488 ----
NM_002480chr1221129 585 21500 1024 1606 --
NM_002487chr152737 175 ------
NM_002499chr1552098 936 908 636 332 ----12430
NM_002515chr1471688 1679 1421 643 636 572 366 2288 68 11381 --
NM_002519chr1131321 114 75 1585 2279 144 1271
NM_002524chr12420 98 ----11056
NM_002527chr121271 --177 --
NM_002545chr1154721 3925 3719 1807 909 ----11007
NM_002547chrX64227 3873 3420 2987 1693 662 --12893 --
NM_002552chr231241 134 65 ------
NM_002577chr313379 24024 1378 13643 13263
NM_002581chr985529 5098 3862 3783 2106 1275 1075 189 25232 1726 25576 3892 --
NM_002589chr42399 320 --140 --
NM_002595chr1251808 1576 1508 1343 334 ----11610
NM_002607chr7--1215 21171 1034 --
NM_002610chr253086 2675 2563 2407 684 1584 ----
NM_002613chr16105105 4341 3733 1726 1205 1162 790 778 629 399 35228 4887 3263 13311 --
NM_002623chr201726 --147 --
NM_002628chr351076 995 973 916 284 ------
NM_002645chr1132151 549 220 --12875 12270
NM_002647chr18170 ----1214
NM_002655chr885242 5190 5054 4995 4442 4432 3826 3458 15278 24569 3418 14749
NM_002656chr63895 767 164 --1241 --
NM_002657chr2023437 2386 1450 13146 13303
NM_002670chr321360 346 --31646 1277 486 139
NM_002709chr283075 3031 2769 2701 2191 1120 1065 752 1183 12386 11210
NM_002710chr1241027 793 731 79 --2929 422 --
NM_002715chr531280 1098 211 ------
NM_002718chr32515 80 42314 2262 1044 604 ----
NM_002719chr1421525 533 11790 --12362
NM_002731chr163127 2880 2815 2680 1978 1106 23113 2038 22861 411 --
NM_002734chr1751970 819 734 227 130 ----1413
NM_002736chr731936 1872 215 ------
NM_002738chr16156 ------
NM_002745chr22134327 4288 3588 3530 3356 2783 1453 1271 1170 921 729 699 270 23610 1369 13707 12900
NM_002748chr15--21080 1038 11204 1416
NM_002753chr42727 626 ------
NM_002755chr155613 322 242 193 169 --2799 665 --
NM_002765chrX2409 143 ------
NM_002788chr14--123 180 --
NM_002806chr141265 149 ----
NM_002814chrX3559 238 216 ------
NM_002821chr61751 ------
NM_002828chr181682 --1380 --
NM_002833chr15------21481 576
NM_002834chr12--33735 3554 3452 13849 --
NM_002835chr73664 282 34 ------
NM_002837chr1254333 3551 3533 2969 454 1173 --21187 867
NM_002839chr962680 2645 1065 525 439 356 31025 685 516 11373 --
NM_002843chr1163387 3229 1323 1171 578 416 11331 12980 23257 2392
NM_002845chr182544 182 ----1642
NM_002851chr73809 649 496 ------
NM_002852chr33537 155 144 1587 1244 --
NM_002869chr1182136 2124 1992 1790 1555 1544 687 82 1536 ----
NM_002874chr952487 2246 961 771 752 --12332 --
NM_002886chr3105099 4354 4309 4291 4230 4136 3283 1885 1495 1375 34840 3628 787 ----
NM_002895chr201716 ------
NM_002902chr15276 28 2542 268 1217 --
NM_002940chr451925 1591 1567 481 323 ------
NM_002941chr341612 1142 383 172 ------
NM_002942chr31339 1523 ----
NM_002968chr161805 2288 277 11136 11080
NM_002971chr32906 756 1463 ----
NM_002977chr283018 2874 2854 2473 2465 944 888 699 --122 23426 3415
NM_003031chr162837 312 ------
NM_003034chr12106556 6256 6185 5574 2099 1422 1175 1046 953 240 28024 5075 25471 252 --
NM_003035chr1------2606 306
NM_003042chr321931 1654 11460 11547 11992
NM_003046chr8135045 5000 4527 4493 4400 4067 2075 1842 771 374 365 322 84 15136 ----
NM_003048chr272624 2467 2013 1121 928 780 690 12710 12270 --
NM_003051chr141980 1577 518 488 11717 ----
NM_003054chr101278 ------
NM_003069chrX3733 490 44 --2724 619 --
NM_003070chr91667 1601 1203 --
NM_003074chr331708 835 419 --11959 --
NM_003106chr34919 871 762 690 ------
NM_003108chr276926 6439 6237 5092 1004 162 153 27086 1291 14564 --
NM_003110chr171159 ----1902
NM_003111chr211174 21351 352 160 11148
NM_003112chr731265 723 195 12791 --1460
NM_003126chr1--2440 164 ----
NM_003128chr222505 317 1927 22458 649 1704
NM_003140chrY----196 --
NM_003144chr631497 561 151 21449 483 1315 --
NM_003150chr1732330 2270 343 12379 12059 --
NM_003155chr842667 2624 1082 77 2762 661 ----
NM_003161chr1763456 3065 1133 1124 1056 803 --32713 2402 1004 --
NM_003176chr1----1217 --
NM_003176chr1----1217 --
NM_003182chr71389 1163 1147 --
NM_003182chr71389 1163 1147 --
NM_003184chr8----2883 819 1438
NM_003185chr2011315 11054 174 --
NM_003198chr11311 ------
NM_003199chr1855668 5438 875 733 505 25257 765 15058 --
NM_003202chr511850 11826 ----
NM_003206chr61449 ------
NM_003211chr1231713 1290 32 21524 1390 11191 --
NM_003220chr631657 1263 538 11071 21677 1146 --
NM_003221chr644174 1366 278 83 ------
NM_003246chr1552048 1828 578 328 43 11602 11404 --
NM_003262chr383763 3330 3286 1737 1053 328 167 72 ----11028
NM_003263chr4140 ------
NM_003274chr2142176 1875 626 221 --22947 2329 --
NM_003286chr201364 2877 344 ----
NM_003291chr132846 114 1709 ----
NM_003292chr172244 1920 1792 1782 1635 824 258 11537 ----
NM_003300chr14----1491 --
NM_003304chr351349 454 249 93 58 31561 1442 601 --11612
NM_003305chr41153 ------
NM_003319chr2----1364 1211
NM_003336chrX31059 117 47 2291 204 ----
NM_003337chr521061 316 11101 ----
NM_003338chr1041642 772 622 87 2433 37 --1345
NM_003339chr51985 11383 --1185
NM_003340chr451328 1269 1079 348 58 --1900 --
NM_003342chr1773115 2952 2504 1171 1005 615 166 33229 1149 1027 1296 --
NM_003348chr1231619 1331 576 ----11547
NM_003349chr2031590 1357 1338 ----1156
NM_003352chr22845 156 1884 ----
NM_003374chr52848 315 ----1813
NM_003383chr9--2570 419 ----
NM_003385chr21114 ------
NM_003387chr222520 667 --1186 --
NM_003390chr1131022 284 130 ----2928 748
NM_003392chr384207 3326 3177 3080 2949 2821 1611 1068 11318 14221 --
NM_003404chr2041912 505 442 248 --1435 --
NM_003406chr841957 1924 620 348 --168 --
NM_003407chr192593 547 ------
NM_003409chr1811331 ------
NM_003410chrX42866 2738 360 33 12975 1108 22895 92
NM_003411chrY51620 682 530 424 250 --1103 --
NM_003430chr195607 526 442 358 274 11145 11403 --
NM_003439chr742670 1332 921 482 --32822 1083 797 13403
NM_003441chr451061 898 496 414 334 11126 --183
NM_003442chr112708 597 1772 ----
NM_003458chr364012 3957 2900 1141 274 49 13879 --23629 3471
NM_003463chr633376 2851 214 2882 625 11163 --
NM_003467chr22431 185 1385 --189
NM_003468chr241514 1419 455 100 --13917 24393 3958
NM_003471chr351983 1788 669 459 149 21764 243 ----
NM_003473chr102784 335 --1902 --
NM_003478chr1113234 --43065 849 410 214 23250 2140
NM_003483chr1282832 2664 2559 2309 2161 690 611 283 1240 ----
NM_003487chr172263 235 ------
NM_003489chr2143394 3253 2808 2722 --12390 11212
NM_003505chr721759 1678 ------
NM_003506chr83469 128 121 11247 ----
NM_003507chr231369 606 316 21876 1718 --11969
NM_003508chr71292 ------
NM_003563chr1741488 1097 583 473 --2933 249 --
NM_003565chr1211427 ----11752
NM_003566chr1283336 3271 3038 2991 2188 1393 1058 412 13146 13056 --
NM_003574chr1895667 5010 4348 2170 1672 1638 1103 367 22 22149 1661 25396 1534 --
NM_003581chr2------11074
NM_003583chr1273905 3774 3707 3692 3499 3371 2731 21544 247 --23843 3516
NM_003589chr131384 ----11414
NM_003590chr253247 2693 1385 1145 752 42958 1578 809 269 13007 1545
NM_003591chr102418 123 ----1363
NM_003597chr231476 917 370 --1395 --
NM_003603chr461967 1484 1321 770 535 164 --1427 --
NM_003607chr144172 4144 1698 560 34379 3377 953 --14094
NM_003615chr363763 3571 3131 2820 2629 445 --33939 2663 94 183
NM_003618chr25833 430 261 183 123 1461 --11316
NM_003626chr1131387 1270 1188 2392 333 ----
NM_003633chr532099 695 678 32326 1663 337 --11959
NM_003659chr21307 ------
NM_003663chr332339 607 174 ----13325
NM_003664chr51222 ----1503
NM_003671chr923285 3073 --43541 3217 513 234 --
NM_003672chr13688 427 339 11729 ----
NM_003714chr562828 2655 2393 1164 639 417 12329 ----
NM_003722chr362522 2216 1058 988 900 389 ------
NM_003743chr221425 218 2800 736 ----
NM_003744chr1461314 1066 982 889 474 147 ------
NM_003749chr1362350 2274 2234 2131 1966 223 ------
NM_003759chr464235 3343 3267 3078 1255 1219 2993 897 ----
NM_003768chr131796 1193 129 ------
NM_003794chr311088 --21124 912 --
NM_003796chr19----1217 1522
NM_003799chr1863442 1465 1336 583 156 120 --14569 --
NM_003800chr61673 12425 ----
NM_003809chr171498 ------
NM_003822chr153187 2678 1198 835 137 43099 1950 1929 1231 13118 --
NM_003828chrX1519 1363 ----
NM_003850chr132282 75 --160 --
NM_003870chr1531952 1328 1317 ----1318
NM_003873chr1092111 1960 1009 767 687 598 545 358 239 1533 22221 582 --
NM_003884chr331695 1665 1426 --11749 11836
NM_003885chr1752678 2534 2099 2042 586 --12186 --
NM_003887chr221861 878 ----22226 859
NM_003895chr2162204 2081 1960 1863 1602 162 --11632 --
NM_003909chr882560 2471 2431 1866 988 710 596 379 --32377 1977 314 1780
NM_003913chr663675 3560 2748 967 757 306 11192 32893 1490 378 --
NM_003924chr421194 94 ------
NM_003927chr182840 383 ------
NM_003931chr62512 504 --1571 --
NM_003941chr742157 1735 618 209 1108 --32418 900 709
NM_003948chr432026 1929 312 22158 790 ----
NM_003958chr693923 3883 3363 3046 2750 2443 1354 1161 317 --23732 1283 11573
NM_003968chr3----1704 --
NM_003971chr17--1430 ----
NM_003972chr1041000 475 227 132 1853 11285 11339
NM_003983chr1653216 3122 1748 1070 844 23758 1452 23342 670 14375
NM_003994chr1264398 3270 919 691 360 186 --11697 14308
NM_003998chr41472 1604 ----
NM_004006chrX42661 2652 2504 240 12641 12534 1210
NM_004007chrX42661 2652 2504 240 12641 12534 1210
NM_004009chrX42661 2652 2504 240 12641 12534 1210
NM_004010chrX42661 2652 2504 240 12641 12534 1210
NM_004011chrX42661 2652 2504 240 12641 12534 1210
NM_004012chrX42661 2652 2504 240 12641 12534 1210
NM_004013chrX42661 2652 2504 240 12641 12534 1210
NM_004014chrX42661 2652 2504 240 12641 12534 1210
NM_004015chrX42661 2652 2504 240 12641 12534 1210
NM_004016chrX42575 2566 2418 154 12555 12448 1124
NM_004017chrX42661 2652 2504 240 12641 12534 1210
NM_004018chrX42575 2566 2418 154 12555 12448 1124
NM_004020chrX42661 2652 2504 240 12641 12534 1210
NM_004021chrX42575 2566 2418 154 12555 12448 1124
NM_004022chrX42575 2566 2418 154 12555 12448 1124
NM_004023chrX42575 2566 2418 154 12555 12448 1124
NM_004028chr1832898 365 185 --13162 11253
NM_004034chr101234 ------
NM_004056chr831043 1037 354 --1275 --
NM_004071chr21110 ------
NM_004073chr11242 ------
NM_004075chr121109 1481 123 --
NM_004080chr761395 1142 919 231 172 63 --11383 --
NM_004089chrX21091 1051 ------
NM_004093chr1352778 1056 978 496 248 12680 --12757
NM_004100chr662289 2171 1901 1886 642 512 22667 2198 22656 605 --
NM_004105chr2----150 1110
NM_004113chr361617 1603 822 812 426 290 ------
NM_004124chr14103575 3529 3071 2975 2677 2476 2166 366 205 50 --23342 792 --
NM_004126chr71265 ------
NM_004133chr882616 2567 2498 2456 2439 1958 338 114 31982 1847 472 ----
NM_004136chr1583227 3040 2944 2679 2350 1062 375 204 13214 22014 1226 23276 807
NM_004161chr241182 643 319 151 184 --2601 546
NM_004162chr341315 1164 976 903 1891 ----
NM_004170chr941850 1674 1667 1601 1613 ----
NM_004171chr11129604 8305 7706 6821 3477 2621 1612 1072 1000 763 245 177 29563 8126 29001 6696 17668
NM_004202chrY1123 129 1693 1650
NM_004215chr82520 98 ------
NM_004226chr2------199
NM_004229chrX1421 --11795 1398
NM_004232chr1853758 3563 3268 3040 1245 --11230 --
NM_004241chr10----1322 --
NM_004249chr4------129
NM_004272chr531314 813 684 21711 1367 1712 --
NM_004274chr1422516 1105 23227 752 ----
NM_004293chr953824 3818 2734 898 495 --33401 2779 1051 --
NM_004326chr11482 1416 11246 1426
NM_004330chr152240 54 1168 11115 11075
NM_004331chr83439 237 52 --1722 --
NM_004337chr851638 1507 397 171 72 ------
NM_004338chr1897007 6604 6593 6281 5295 4645 1449 775 417 45474 4993 1890 1343 47052 5899 1564 1098 26401 5059
NM_004342chr762331 611 563 537 497 197 --22256 237 --
NM_004346chr441051 579 219 101 169 21225 290 --
NM_004349chr841232 977 380 207 ------
NM_004354chr43674 567 108 ------
NM_004384chr561806 1478 699 595 529 50 11736 11773 --
NM_004392chr1332629 1654 1044 22636 2233 ----
NM_004396chr17----153 --
NM_004412chr1095842 5830 5772 5070 5037 3755 1978 1139 203 31898 849 180 16056 12268
NM_004430chr832672 1734 662 --22733 2567 12619
NM_004432chr942006 585 452 347 22208 576 11967 --
NM_004438chr223089 2344 ----1309
NM_004440chr661348 1302 626 362 78 52 --31597 1368 637 --
NM_004457chr241689 518 507 266 31602 1411 418 11716 --
NM_004459chr1741494 620 401 235 ----11819
NM_004464chr494305 4083 3951 3811 3695 3150 3108 1297 592 --1509 --
NM_004474chr11775 ------
NM_004480chr14----1309 --
NM_004482chr2--1977 1688 --
NM_004491chr1923770 2870 14303 ----
NM_004499chr51499 2455 420 ----
NM_004500chr1461869 1843 1496 710 460 156 --1585 --
NM_004501chr163567 2505 1522 1304 1209 466 --22818 1356 1861
NM_004504chr253079 1944 636 397 275 23064 285 ----
NM_004505chr1752021 1913 1745 809 449 11830 12002 --
NM_004508chr102815 450 1245 --21121 948
NM_004525chr231519 1354 1152 11076 --1252
NM_004538chrX2744 643 --2791 704 --
NM_004540chr214770 280 192 177 ------
NM_004571chr2142999 2597 1042 644 ----13386
NM_004582chr1190 --1108 1150
NM_004583chr171575 1740 ----
NM_004586chrX85407 5121 4749 3404 1235 596 493 124 14243 --25209 3318
NM_004591chr21156 --1388 --
NM_004593chr3167 1276 2157 44 --
NM_004598chr522894 2646 13194 --12663
NM_004602chr2031266 55 46 11192 11110 --
NM_004612chr974157 3508 1497 588 465 312 106 44412 4057 4000 3105 --14228
NM_004615chrX1768 --1942 --
NM_004634chr32636 441 ----1454
NM_004654chrY1368 ------
NM_004655chr1741190 417 261 195 11370 --11312
NM_004657chr241552 1494 1301 30 --1993 1389
NM_004684chr41332 ------
NM_004685chr1362602 2562 1154 977 772 51 ------
NM_004701chr151134 ------
NM_004703chr1752534 1995 1892 673 375 21927 1732 --1457
NM_004708chr19182 ------
NM_004714chr19--1235 ----
NM_004719chr1252842 2747 1159 633 281 1611 12817 --
NM_004726chrX75611 4917 4315 3953 1063 270 170 14974 11334 --
NM_004730chr562053 2031 2019 1463 400 139 1365 11637 --
NM_004742chr331664 1188 247 11451 --1733
NM_004744chr473645 1183 564 543 368 333 154 1388 13776 --
NM_004745chr845560 4938 4780 2114 22671 814 11193 12091
NM_004748chr1553278 3124 2889 2829 1186 12688 --11121
NM_004753chr11266 ------
NM_004775chr1831799 738 38 --2885 726 --
NM_004781chr161532 1243 582 526 89 27 --21229 608 --
NM_004781chr161532 1243 582 526 89 27 --21229 608 --
NM_004786chr18129 ------
NM_004787chr4------1100
NM_004795chr132766 177 ----31661 1378 1298
NM_004798chr20103389 3237 3027 2650 2633 2388 1169 998 964 164 13682 ----
NM_004800chr131199 ------
NM_004808chr1092400 2345 2109 1358 1217 1047 565 366 200 ------
NM_004815chr1104793 4463 3980 3963 3755 3232 1856 1519 159 54 13872 11897 --
NM_004836chr21382 ------
NM_004841chr11315 ------
NM_004849chr631326 1306 1194 ------
NM_004850chr231373 498 409 1669 21302 441 --
NM_004857chr1484820 4791 4458 3246 3057 1847 1444 578 ------
NM_004859chr17102649 2544 2414 2377 993 986 845 396 349 39 1682 1793 --
NM_004863chr1431945 1324 764 --15086 --
NM_004866chr584823 4638 3851 3063 1940 1325 645 420 23356 58 ----
NM_004871chr1764275 3892 3747 1571 507 185 14338 12832 --
NM_004872chr11167 --1321 --
NM_004873chr1443085 2648 984 857 12614 129 --
NM_004898chr462604 2401 1967 606 273 156 ------
NM_004902chr202823 103 ------
NM_004904chr766467 6269 2290 1739 1176 452 --16190 --
NM_004906chr62670 638 1699 154 --
NM_004912chr731213 1172 677 ----11136
NM_004947chr332638 2607 2207 22501 435 22509 2254 --
NM_004956chr784409 3835 1530 1144 1116 1062 741 567 31744 1393 492 1951 12901
NM_004958chr13827 584 175 1137 2787 190 --
NM_004985chr1234465 3875 2934 24524 2902 12857 13471
NM_004992chrX107717 7619 6961 6925 6363 5497 3185 2223 2037 1945 17188 --12464
NM_004992chrX107717 7619 6961 6925 6363 5497 3185 2223 2037 1945 17188 --12464
NM_004998chr151683 1262 --2764 703
NM_004999chr684487 4163 3551 2776 1234 1167 1073 682 ------
NM_005010chr732043 1713 759 31620 438 112 ----
NM_005036chr2277794 5507 2901 1270 546 387 201 18294 27154 5209 --
NM_005037chr3----1143 --
NM_005056chr1265397 2092 1779 1489 1238 999 14219 11283 12235
NM_005065chr1475297 5087 4226 1506 1336 1101 377 24004 296 13717 14056
NM_005066chr12521 307 1229 ----
NM_005079chr853125 1287 988 703 39 12090 --21225 1090
NM_005086chr1211304 1174 ----
NM_005095chr132027 621 34 --11866 --
NM_005116chr2054159 3550 3331 871 148 --14468 23285 1141
NM_005121chr1752806 2507 856 650 524 22979 451 1135 13090
NM_005124chr6160 1907 ----
NM_005135chr1553852 3774 3192 2961 122 1532 1628 12841
NM_005151chr186962 865 638 619 502 383 --12278 1831
NM_005156chr974567 3853 3733 3295 3258 1027 519 24877 1970 23629 1118 15002
NM_005160chr22146700 6521 6104 5999 5848 5839 5459 2654 1881 1401 1191 1018 979 416 ----26577 6562
NM_005168chr211345 ----11631
NM_005171chr1221283 1271 --21312 1213 --
NM_005180chr1021531 1071 --11411 11053
NM_005184chr19----11563 --
NM_005188chr11177373 6918 6739 6074 5838 3190 2478 2280 2180 2098 1899 1564 1419 768 719 500 424 11464 --12156
NM_005190chr651059 979 913 791 117 ------
NM_005197chr14126190 6111 5649 5410 5203 4763 2353 2280 1676 1145 1062 230 16142 15622 --
NM_005201chr33749 457 332 11133 ----
NM_005203chr101282 ------
NM_005204chr101635 --1821 1623
NM_005207chr2283452 2989 1406 1016 382 370 244 193 1968 ----
NM_005214chr2------1349
NM_005231chr111929 11337 --1214
NM_005233chr341640 1584 664 90 --22437 2159 --
NM_005235chr2117784 7416 6774 6647 6378 4781 2351 2269 1804 1595 286 47190 5964 4754 2150 25551 4762 --
NM_005238chr1143498 3195 2406 799 --23276 3052 23553 3535
NM_005242chr531474 1309 988 ------
NM_005249chr14--1738 1841 --
NM_005252chr143766 636 232 1531 ----
NM_005254chr151405 --11134 11301
NM_005256chr111127 --1941 --
NM_005257chr1831146 939 297 --1566 11202
NM_005259chr211253 11470 1971 1454
NM_005277chr411386 1533 --11318
NM_005279chr21115 ------
NM_005302chr71401 2323 131 ----
NM_005316chr113977 854 194 1151 ----
NM_005324chr1711938 11331 --21797 537
NM_005339chr4103853 3829 3751 3470 3200 3046 2745 2661 1671 1399 21731 1069 --23039 1569
NM_005342chrX62756 1764 1738 1021 813 287 ----1131
NM_005347chr941596 1547 1394 37 122 --21119 30
NM_005349chr41233 ----1395
NM_005358chr1331745 1578 349 1426 ----
NM_005359chr1886115 5430 5364 4662 2110 1984 658 440 1537 21094 982 --
NM_005369chrX2511 69 --1227 --
NM_005375chr62871 854 ------
NM_005382chr81479 ------
NM_005385chr392567 2262 1844 1673 1666 976 958 428 372 --1487 --
NM_005398chr1031280 1150 1013 11417 ----
NM_005400chr273073 3032 2943 2240 2213 1052 32 13047 1819 --
NM_005406chr1831285 563 129 --11231 1629
NM_005410chr52681 170 --1667 --
NM_005426chr12662 589 --1219 1947
NM_005429chr4----1283 --
NM_005430chr121747 ------
NM_005433chr1852181 885 792 356 238 12629 12636 12252
NM_005436chr1053628 3364 2991 2931 1230 13726 11290 21490 997
NM_005455chr111309 --1537 11810
NM_005458chr9--11826 --12204
NM_005461chr201656 21940 1243 11779 --
NM_005465chr121249 246 --1234 1646
NM_005476chr921403 1090 --1953 --
NM_005487chr22--31930 615 586 ----
NM_005493chr62811 102 --132 --
NM_005497chr1776014 5914 5908 5347 4675 1279 509 1368 24050 112 --
NM_005502chr952938 2876 2860 2710 2035 12693 22387 727 32929 1305 123
NM_005520chr52737 716 ------
NM_005544chr2--1929 21041 210 --
NM_005569chr2251352 1171 1062 209 70 ----11393
NM_005570chr1841213 923 324 253 ------
NM_005578chr363920 3338 1631 1167 779 348 14856 2904 878 --
NM_005584chr131639 ------
NM_005593chr121481 ----1460
NM_005596chr9116388 6369 6351 6237 5086 4891 4686 4604 2161 2017 1980 15437 ----
NM_005602chr351283 1211 1170 274 40 133 ----
NM_005603chr181108 --11917 --
NM_005611chr1651292 1213 1115 284 224 11300 ----
NM_005613chr141975 1439 122 69 --11532 --
NM_005627chr6--2909 819 ----
NM_005637chr1811994 --31494 743 48 11509
NM_005639chr1211542 1262 --11533
NM_005655chr821207 330 --1463 1849
NM_005664chr152889 195 ------
NM_005668chr574599 4572 3329 3056 1478 1435 559 33767 3540 3389 ----
NM_005694chr3--1110 ----
NM_005733chr51243 ------
NM_005737chr272089 1933 1014 1007 961 909 323 12872 12937 12364
NM_005742chr2--1837 ----
NM_005744chr15------1166
NM_005746chr752605 2305 1090 741 120 3707 549 52 ----
NM_005748chr1243159 2131 733 581 1660 ----
NM_005749chr171184 --1646 --
NM_005756chrX31230 1068 469 ------
NM_005759chr273312 3134 1364 1151 888 593 208 33989 1345 1076 12921 1339
NM_005780chr132276 240 2947 937 ----
NM_005786chr18----11008 11226
NM_005795chr232529 2470 1939 22695 830 --11039
NM_005798chr1355260 3563 3458 3351 2068 --33602 1455 256 2736 295
NM_005807chr12181 86 ------
NM_005808chr393545 3434 3240 3059 2954 2556 870 625 478 23344 3339 ----
NM_005813chr252433 2095 843 750 57 2967 142 --22285 1873
NM_005826chr12143 27 ------
NM_005828chr1774897 3975 3866 1058 1042 605 191 14821 11217 --
NM_005832chr33928 389 237 --145 11402
NM_005833chr91172 ------
NM_005840chrX147301 7084 6068 5347 5274 4941 4667 2768 2228 2109 1741 964 701 378 1785 ----
NM_005842chr131125 1518 1605 1555
NM_005843chr221374 610 ------
NM_005859chr52961 422 11537 1631 179
NM_005868chr732424 2332 263 --3905 179 100 --
NM_005870chr1331304 998 239 31094 405 155 ----
NM_005875chr31258 ------
NM_005884chr19----1650 --
NM_005898chr1123191 902 2875 112 --1643
NM_005901chr18128482 6048 3376 3098 2784 2561 2346 1757 1189 814 715 342 22240 1900 36229 2931 2590 --
NM_005902chr15104562 4360 3669 3582 3215 1499 1354 1341 934 614 ------
NM_005903chr524291 3227 23606 543 65217 5171 4624 3911 76 29 --
NM_005904chr1811330 ------
NM_005909chr543822 3061 1537 1109 --23637 131 --
NM_005910chr1744090 1294 1165 717 14127 --13269
NM_005920chr142662 1449 1217 313 33777 1428 1281 --11398
NM_005923chr61543 1468 ----
NM_005935chr4105238 4932 4587 4326 4264 4092 3331 2067 701 598 ------
NM_005941chr852709 2616 1598 1334 208 13286 34173 3697 78 --
NM_005944chr321237 1212 --11029 --
NM_005955chr1124983 4464 4238 3917 3806 3550 3511 3470 868 699 351 106 ----15466
NM_005966chr242339 1763 1752 220 --21638 557 1281
NM_005977chr132734 220 --126 --
NM_005999chr121511 90 ------
NM_006007chr923909 3177 23426 678 --21460 1037
NM_006016chr641861 1582 606 249 22240 1799 1787 --
NM_006036chr252554 2371 2155 2143 1603 ----1648
NM_006037chr242965 1754 1526 904 23984 3892 --13704
NM_006039chr1711081 ------
NM_006047chr2053488 2678 2239 1059 39 2545 187 23544 2433 --
NM_006060chr753703 2819 2774 1324 450 11259 13517 --
NM_006080chr73726 507 324 22975 1911 11112 --
NM_006083chr51113 ------
NM_006089chrX41590 1495 1240 44 ----11846
NM_006095chr452744 1146 1085 435 313 34300 3757 183 --12776
NM_006100chr32464 52 1382 1107 1160
NM_006106chr1172990 2603 2558 1145 496 256 170 1846 ----
NM_006113chr162009 1934 1842 178 172 154 11831 ----
NM_006135chr121105 311 1971 1143 --
NM_006136chr721230 440 ----1932
NM_006139chr211151 12785 1552 22290 2076
NM_006141chr1642473 1718 748 50 --1528 12618
NM_006147chr1163 ----143
NM_006159chr121215 1496 ----
NM_006164chr2166 ----1377
NM_006166chr1251628 1013 329 294 280 21694 505 31962 1051 609 --
NM_006167chr811807 --12101 2916 216
NM_006178chr1751436 1009 219 171 88 --21595 566 --
NM_006190chr231032 826 703 ------
NM_006195chr911123 31281 1228 107 ----
NM_006197chr831962 480 334 21600 1534 11825 --
NM_006202chr1921929 660 21714 1375 11457 11588
NM_006203chr595561 4871 4716 4671 2177 1787 1758 1234 1139 14528 13956 --
NM_006206chr482673 2280 1936 903 671 528 474 330 ----1645
NM_006211chr8182 ------
NM_006223chrX2372 116 ------
NM_006243chr11215 1166 --1187
NM_006246chr14183 11173 ----
NM_006251chr553157 2634 2480 2452 2433 12784 --1996
NM_006252chr1137017 6733 4778 4732 2943 2139 1825 1116 1005 711 555 356 200 --22811 409 --
NM_006254chr31304 ------
NM_006256chr142631 2619 610 421 42720 2181 905 490 2959 768 --
NM_006258chr103386 269 126 ------
NM_006264chr42417 159 1448 --1169
NM_006265chr831292 959 278 1946 11501 --
NM_006267chr231166 1151 762 ------
NM_006281chr83999 309 181 1385 1817 --
NM_006281chr83999 309 181 1385 1817 --
NM_006282chr203790 476 225 ----11581
NM_006283chr894678 4292 3498 1997 1962 1440 1236 541 451 --11827 --
NM_006284chr11173 ------
NM_006287chr252639 2513 2439 2214 571 2490 127 ----
NM_006300chr1961912 923 603 550 479 169 --1395 --
NM_006310chr1721299 312 ------
NM_006313chr1251294 1269 483 372 275 21417 1251 ----
NM_006315chr433916 2958 1800 --24097 2969 --
NM_006320chr42345 175 --1426 11133
NM_006330chr82547 287 41625 1369 1093 1072 31619 540 392 --
NM_006345chr421365 1065 --11016 1309
NM_006352chr161638 1550 690 643 578 491 21607 697 12031 1704
NM_006364chr1431109 315 96 ------
NM_006366chr61467 --31344 1140 502 --
NM_006379chr732312 1648 805 12163 12078 --
NM_006380chr1731723 1349 1014 21368 1066 156 1428
NM_006413chr1021491 91 ------
NM_006415chr91469 ------
NM_006416chr62239 212 ------
NM_006420chr2083318 2971 2941 2560 938 604 440 356 ------
NM_006421chr841202 915 431 195 --11051 --
NM_006463chr21569 153 ----
NM_006466chr201172 ------
NM_006482chr1273905 3774 3707 3692 3499 3371 2731 21544 247 --23843 3516
NM_006483chr19--1235 ----
NM_006484chr19--1235 ----
NM_006489chr1471688 1679 1421 643 636 572 366 2288 68 11381 --
NM_006493chr1321472 191 ------
NM_006496chr131491 1341 64 11898 21969 1234 --
NM_006516chr111637 ----11204
NM_006517chrX31940 1519 364 1550 ----
NM_006521chrX21362 1192 ----11148
NM_006524chr751111 1032 871 283 199 ------
NM_006526chr2041861 1743 585 502 1127 1448 --
NM_006534chr2053154 2595 920 843 212 ----1992
NM_006538chr234017 3483 2831 24149 3964 22639 1313 32863 2845 2800
NM_006540chr8----11310 --
NM_006544chr1495541 4844 4780 4744 4141 3791 1430 876 303 25364 3742 25594 5581 26104 5331
NM_006546chr1766693 6661 2409 2219 2199 1430 --11619 --
NM_006559chr11220 ------
NM_006561chr10136062 6042 5910 5869 5779 4686 3976 3897 3802 2158 1938 1361 1275 1769 21482 741 --
NM_006575chr1431158 430 116 ------
NM_006577chr241277 1213 989 916 ------
NM_006597chr11--1193 ----
NM_006599chr16137284 6498 6274 3276 2917 2852 2416 2407 2275 2006 1057 993 160 ----15849
NM_006601chr121337 21005 915 --21052 107
NM_006603chrX31840 1827 1359 1804 11612 1534
NM_006614chr363196 2980 2572 1182 1141 98 13600 21010 209 --
NM_006625chr12924 243 ----177
NM_006625chr12924 243 ----177
NM_006625chr12924 243 ----177
NM_006628chr1574628 4534 4166 3254 1486 267 141 1376 --11762
NM_006629chr1822309 1884 1713 --22600 746
NM_006644chr13175 --1589 --
NM_006646chr1351218 1045 335 166 122 --22964 421 --
NM_006654chr1284678 4630 4068 1652 1290 1013 605 271 24549 3769 34566 4025 1350 23997 3758
NM_006682chr722524 231 21081 305 22894 195 11855
NM_006696chr51243 ------
NM_006699chr11438 21917 282 ----
NM_006704chr13264 28 ------
NM_006713chr53286 164 31 2641 98 1834 --
NM_006717chr943137 2925 2762 1022 12559 11243 --
NM_006718chr63895 767 164 --1241 --
NM_006722chr372965 2446 912 791 699 532 486 22941 215 ----
NM_006726chr42994 385 1862 --1408
NM_006729chrX95573 5200 5069 3896 1996 1214 877 648 533 34679 4384 1395 11437 --
NM_006738chr1554579 3959 3395 164 62 11618 --14488
NM_006749chr841248 1231 1093 522 2281 205 --1470
NM_006750chr1654895 2653 1456 1312 501 37290 6658 5696 25123 4957 18106
NM_006754chr741205 1071 467 112 1386 3952 786 337 --
NM_006759chr2--1100 1232 --
NM_006766chr842195 1974 553 60 22139 107 --1782
NM_006769chr11657 1521 ----
NM_006775chr653037 2922 582 444 382 1866 32241 2219 530 --
NM_006777chrX32747 2122 990 12847 22395 2377 --
NM_006805chr521763 1369 ------
NM_006807chr1711122 --11245 1320
NM_006813chr61346 --1198 1174
NM_006823chr831287 571 477 1502 11268 11004
NM_006827chr1462685 2337 2318 2104 1175 1035 --12176 --
NM_006836chr12----1445 --
NM_006856chr12----11002 --
NM_006873chr243556 3221 3178 1192 2608 78 1937 --
NM_006885chr1644077 3816 2787 554 14068 ----
NM_006888chr1463242 3192 3019 2975 2398 806 23109 2883 --12941
NM_006895chr262054 1541 611 455 277 177 ------
NM_006896chr71852 ----1906
NM_006897chr122645 196 ------
NM_006910chr161124 1270 ----
NM_006914chr92975 460 1304 ----
NM_006916chr241395 435 98 64 --1226 --
NM_006918chr1185749 4720 4593 4341 4290 2264 1384 1050 25491 4507 23788 182 --
NM_006920chr242004 1827 575 214 ----11432
NM_006924chr1763889 3228 851 788 664 505 14121 24006 252 --
NM_006930chr531297 159 123 ------
NM_006931chr1252138 1514 691 308 101 ------
NM_006936chr2141099 510 477 43 21306 1226 1240 --
NM_006937chr171191 1156 ----
NM_006939chr1421156 783 11093 --1768
NM_006947chr461381 1220 1138 1103 718 581 ------
NM_006952chr321071 415 ------
NM_006999chr531815 798 482 ------
NM_007006chr1693550 3387 3326 2594 2555 1229 991 708 137 --13336 13145
NM_007007chr1254624 1540 950 936 535 13890 32987 1788 1496 13903
NM_007010chr1731831 1419 771 --31709 497 22 --
NM_007013chr81182 ------
NM_007023chr2--1820 1962 --
NM_007038chr21115929 5350 4756 4657 4407 3914 3682 1758 1598 560 383 11266 --36008 5760 5382
NM_007042chr332229 1931 478 11721 1665 --
NM_007050chr2097889 7739 7567 7198 6921 1934 1512 194 42 35105 2866 1319 17181 --
NM_007054chr553948 3038 771 744 239 33956 1138 329 --23845 3796
NM_007099chr22842 125 ------
NM_007106chr1342297 804 234 48 ------
NM_007107chr352287 2271 2139 1807 820 1254 --12388
NM_007111chr136842 695 580 564 179 108 ------
NM_007114chr332574 1206 409 42093 2088 328 111 11130 13120
NM_007115chr21459 --1490 --
NM_007124chr641912 1648 415 207 ----12003
NM_007145chr1941315 1185 341 153 ----11292
NM_007146chr1752883 2775 883 667 463 1357 ----
NM_007159chr321355 60 1203 21616 1507 --
NM_007166chr11185 1379 11431 1584
NM_007175chr873440 3153 2971 2822 1383 577 112 1904 2714 303 --
NM_007178chr122332 81 ------
NM_007191chr121103 --1684 1644
NM_007192chr14----1262 --
NM_007200chr1554579 3959 3395 164 62 11618 --14488
NM_007214chr6153 11032 11276 11070
NM_007218chr82687 143 2222 157 ----
NM_007222chr861453 1390 1328 678 389 60 ----1363
NM_007249chr13119230 8867 8169 7210 6781 5805 1688 1465 1152 260 232 39114 9082 5947 28044 2044 --
NM_007276chr721106 919 11099 11086 --
NM_007285chr161137 ------
NM_007287chr3103043 3037 2891 2852 2673 903 809 646 259 102 ------
NM_007288chr3103043 3037 2891 2852 2673 903 809 646 259 102 ------
NM_007289chr3103043 3037 2891 2852 2673 903 809 646 259 102 ------
NM_007345chr1821647 1502 21596 237 ----
NM_007347chr1563107 3000 1205 1101 560 553 ------
NM_007349chr72418 158 ------
NM_007350chr1284433 4411 3983 1813 1181 1103 870 69 2779 284 24253 3209 --
NM_007353chr722538 497 22912 2775 32647 2205 138 --
NM_007358chr141928 749 525 488 --1173 --
NM_007372chr17------1316
NM_007373chr1051790 1476 1364 477 88 41731 1720 1126 412 ----
NM_007375chr142674 1103 239 216 1593 1617 21113 75
NM_012073chr54484 388 286 85 1269 ----
NM_012081chr553452 3208 1346 1065 331 21355 864 33631 1199 724 --
NM_012082chr84891 834 708 295 2760 285 ----
NM_012089chr161304 1129 1118 547 325 306 ------
NM_012095chr1042962 2535 1163 1122 1610 11076 --
NM_012096chr393700 2861 2673 1247 1026 820 758 614 565 11098 ----
NM_012097chr222302 467 1622 ----
NM_012110chr41224 ------
NM_012115chr6134 ----1421
NM_012129chr742327 2169 234 210 12472 ----
NM_012141chr1374068 3306 1503 1349 1228 1178 1017 1451 13267 13854
NM_012177chr6180 ------
NM_012180chr41485 ------
NM_012193chr1174546 4488 3642 2007 779 722 542 35383 3727 637 1326 --
NM_012214chr254770 4530 4130 1788 936 76201 5945 5081 1099 1003 835 112 31046 756 290 --
NM_012229chr1011338 1439 ----
NM_012234chr3113613 3312 2616 1445 1288 895 694 385 291 119 69 ------
NM_012238chr10--1662 --11641
NM_012242chr101722 1199 ----
NM_012243chr11105 1893 1121 1939
NM_012247chr10----2247 234 --
NM_012250chr1131166 376 368 ------
NM_012252chr7125001 4821 4700 4611 4414 3437 3377 2014 1913 1021 718 46 1638 34983 4845 3971 --
NM_012262chr1155251 5160 4981 4067 3781 3750 3414 3218 1186 1089 1061 966 703 680 158 43821 3434 1318 532 35212 5199 4095 21793 959
NM_012281chr722417 890 12298 1731 --
NM_012286chrX1578 ------
NM_012287chr361757 1265 1022 929 603 109 --23510 3287 --
NM_012290chr241664 1557 1408 1392 ----21478 1360
NM_012297chr4102598 2391 2325 2154 2067 1804 961 600 367 349 22521 859 ----
NM_012300chr522403 365 ----1760
NM_012309chr1133299 3201 140 13410 --34786 4773 4534
NM_012311chr102421 80 1134 ----
NM_012316chr113979 13432 11249 --
NM_012319chr183409 328 130 1989 --179
NM_012323chr2221519 348 ------
NM_012328chr731131 1070 305 ------
NM_012329chr1731585 1311 134 11687 11066 --
NM_012330chr101354 2496 423 ----
NM_012334chr554681 4084 3446 2936 1131 2851 784 --14551
NM_012338chr72494 211 11196 21116 907 --
NM_012421chr1------1416
NM_012464chr472922 2843 1059 936 922 894 78 12739 12094 --
NM_012479chr71706 --22232 2182 12288
NM_013229chr1242155 1965 365 264 12675 2494 349 --
NM_013230chrY41668 714 560 494 1477 11735 11711
NM_013231chr14104255 4240 3502 3042 2926 2818 896 805 554 345 1262 13466 --
NM_013233chr221408 450 ------
NM_013254chr123455 277 175 ----1140
NM_013255chr788248 6842 6197 5732 2273 2241 1219 407 17646 27591 1025 13052
NM_013257chr8--12227 --22345 2199
NM_013261chr443698 3626 2857 819 11243 33610 2900 2373 --
NM_013262chr611272 ------
NM_013281chr2041139 1128 348 273 2255 122 ----
NM_013282chr191219 11036 ----
NM_013286chr363164 2548 1382 1056 905 247 --1240 --
NM_013316chr71301 ------
NM_013322chr7--11277 ----
NM_013341chr252812 2370 2033 768 752 --1156 --
NM_013351chr17--1686 1605 --
NM_013354chr821165 126 11390 ----
NM_013372chr1543272 2369 1226 883 12647 ----
NM_013374chr372257 2122 953 793 670 521 194 23094 925 22137 580 --
NM_013390chr941585 1239 622 497 1372 11146 --
NM_013396chr2111092 --31348 1116 985 21434 461
NM_013411chr121957 866 1162 ----
NM_013437chr811195 --21357 220 1270
NM_013438chr951730 1168 523 405 104 1232 --1439
NM_013943chr133287 2210 595 33302 1187 490 1503 --
NM_013958chr8190 ------
NM_013959chr8190 ------
NM_013961chr8190 ------
NM_013962chr8190 ------
NM_013989chr1475090 4734 3421 2042 1151 372 27 --11907 --
NM_013993chr61650 ------
NM_013994chr61650 ------
NM_013995chrX62370 1909 1797 675 261 67 --12236 --
NM_013996chr71389 1163 1147 --
NM_013996chr71389 1163 1147 --
NM_013997chr71389 1163 1147 --
NM_013997chr71389 1163 1147 --
NM_013998chr71389 1163 1147 --
NM_013998chr71389 1163 1147 --
NM_014010chr91618 ------
NM_014011chr272182 2102 1597 910 586 341 145 11699 11665 --
NM_014016chr331533 1491 397 21702 1514 ----
NM_014021chr193495 2875 2840 2638 2160 1326 972 872 670 23007 325 12615 1392
NM_014023chr1092945 2464 2265 2255 1815 1780 989 494 214 12738 22554 2400 --
NM_014028chr673218 3151 2693 2438 2387 1048 455 ----13144
NM_014034chr611251 --11415 --
NM_014043chr331664 1339 623 ------
NM_014048chr16105117 4786 4493 4384 3857 3850 3548 3248 1485 711 35257 5180 3837 31406 1190 692 25200 4529
NM_014059chr13------1248
NM_014089chr1362268 2092 2036 1971 426 160 ------
NM_014106chr1552902 2886 2740 2632 2248 12290 --22265 242
NM_014109chr81198 1375 ----
NM_014112chr884396 4238 4069 3527 1537 1288 387 271 24021 995 11359 --
NM_014154chr31396 1342 1348 --
NM_014155chr1195440 3002 2393 1882 1136 1107 1017 995 853 37291 7217 691 25839 2851 17315
NM_014203chr191329 ------
NM_014250chr22--31930 615 586 ----
NM_014253chrX42481 1957 590 342 167 2582 163 --
NM_014267chr11143 --1360 --
NM_014278chr42355 149 1455 ----
NM_014283chr121279 1194 ------
NM_014294chr831442 1318 336 1121 11202 --
NM_014296chr311048 ------
NM_014309chr2254683 3880 2064 1380 535 --14969 15214
NM_014314chr911284 1360 11619 1611
NM_014317chr101261 ------
NM_014319chr1241487 1217 591 175 21820 1391 ----
NM_014325chr1241833 1764 1754 879 ------
NM_014331chr457557 7020 6576 1498 622 26748 4875 53053 2889 2156 1340 406 --
NM_014333chr1182506 2456 1817 1792 703 188 145 68 1720 ----
NM_014350chr53925 819 181 ------
NM_014372chr132001 1487 1475 ------
NM_014379chr84788 415 134 103 ------
NM_014382chr3--1480 11437 1366
NM_014393chr831860 1810 881 --22286 2269 12368
NM_014399chr72945 375 2876 235 1740 --
NM_014423chr5105581 5155 4841 4715 4344 4287 1631 1012 909 565 --25274 4749 14076
NM_014445chr332265 855 719 12041 2887 621 --
NM_014494chr1652353 2225 2213 560 523 ------
NM_014504chr751980 719 526 478 424 11866 ----
NM_014554chr1271982 1942 1579 1473 792 208 99 11857 11835 --
NM_014577chr221624 1571 164 --
NM_014584chr1451220 1013 652 244 192 11604 1138 11079
NM_014606chr42125 97 ------
NM_014612chr961471 1098 1085 585 421 31 21418 1074 ----
NM_014615chr1663111 1423 1004 978 843 785 23621 3571 13523 --
NM_014616chr363244 2696 1353 964 494 415 33460 1290 638 --13359
NM_014620chr122714 541 1745 ----
NM_014630chr1573721 3163 3025 1024 796 740 307 12998 13844 --
NM_014659chr151778 ----2936 882
NM_014660chr72806 321 --1125 --
NM_014676chr12665 233 --11476 11110
NM_014677chr8--11302 ----
NM_014682chr861822 1613 933 662 102 77 12323 12265 12189
NM_014683chr1741724 1335 847 593 ------
NM_014701chr1573096 3081 2899 2665 2376 1025 860 1549 1664 --
NM_014705chr741618 816 596 585 1671 21404 319 --
NM_014707chr731572 541 141 12189 32247 862 767 --
NM_014712chr16--1636 ----
NM_014720chr1031753 1511 1289 11719 21838 479 --
NM_014721chr6117409 7029 6959 5817 5683 5574 2403 1332 1305 1238 75 56915 6850 5078 4840 4627 --26130 2677
NM_014727chr19------1222
NM_014729chr852018 1525 875 709 262 --1888 --
NM_014733chr53410 273 27 --1704 --
NM_014739chr6104181 3663 3198 3152 2670 1527 1206 800 188 107 --11001 --
NM_014743chr442318 1967 746 26 --1583 --
NM_014746chr264338 3553 2888 726 681 260 32752 853 649 1705 11377
NM_014751chr852076 2053 819 715 206 ----11999
NM_014755chr243746 3097 1024 895 --2606 585 --
NM_014757chr522273 2259 ------
NM_014764chr122821 297 --11014 1289
NM_014774chr143085 2855 2234 674 1104 1477 --
NM_014779chr321027 730 11102 ----
NM_014781chr81491 --1967 1845
NM_014787chr111782 22166 826 11821 22670 524
NM_014795chr251129 415 178 71 48 ----11023
NM_014810chr173504 3355 2533 2273 1475 1158 968 23469 550 2961 908 --
NM_014812chr131777 1474 52 --1323 1721
NM_014819chr582446 2280 1981 1940 1675 832 492 326 ------
NM_014822chr4----1548 --
NM_014826chr144172 4144 1698 560 34379 3377 953 --14094
NM_014827chr121276 372 31207 646 66 ----
NM_014828chr142821 491 21567 185 21810 840 --
NM_014832chr1342109 1693 412 114 ------
NM_014839chr172520 2427 2050 1859 974 773 564 --12533 --
NM_014841chr641274 1190 904 75 21053 237 11093 11062
NM_014848chr1542692 2675 1872 755 ------
NM_014850chr374431 4378 4261 4246 3200 2960 1598 --11106 11015
NM_014862chr1564106 1645 1355 603 443 383 2237 28 146 --
NM_014872chr942363 2027 742 727 1526 --12142
NM_014873chr174429 3660 1788 1703 1625 602 552 14184 --14638
NM_014877chr17127344 7141 6608 6578 6556 5358 5352 3095 2426 547 402 251 17086 ----
NM_014897chr1723049 2663 12853 --13170
NM_014900chr23839 771 220 --1780 --
NM_014904chr1083829 2807 1327 1244 645 415 270 123 ------
NM_014906chr1783421 3353 3234 3119 2826 2630 1061 424 13770 ----
NM_014910chr191656 ------
NM_014912chr1093144 3110 3084 2968 2872 678 333 218 29 --33418 2960 1179 --
NM_014913chr1821491 189 --11125 --
NM_014917chr1--1732 1265 --
NM_014918chr1521326 1119 21579 335 ----
NM_014920chr643472 3195 588 177 13453 12518 23389 3299
NM_014923chr13--32213 1573 1543 2441 149 22017 1661
NM_014932chr351802 1414 566 501 425 --1474 --
NM_014936chr652856 2554 2387 2239 678 ------
NM_014942chr651989 1755 1611 426 96 189 12086 12550
NM_014946chr242728 2059 882 437 12374 22244 318 11251
NM_014947chr152964 2339 2321 1917 430 13073 12871 12907
NM_014949chr14953 899 657 377 ------
NM_014961chr442206 2153 882 182 11599 ----
NM_014962chr2032369 2020 738 22848 2843 1925 --
NM_014969chr11206 ----21026 472
NM_014978chr1011785 21808 533 11770 11447
NM_014982chr1455384 5146 3847 3654 1875 11595 14203 15335
NM_014988chr442468 2055 1779 180 ----1556
NM_014990chr1441238 1088 526 359 --11080 --
NM_014991chr463109 3070 2551 2391 2030 841 ----21170 424
NM_015000chr1252715 1061 706 316 238 22958 754 11210 11157
NM_015008chr373416 3246 3125 2473 1007 842 440 43656 3326 2631 1000 12596 --
NM_015009chr31678 ------
NM_015015chr19172 --1368 11808
NM_015017chr121210 275 ----1945
NM_015018chr61197 --1185 --
NM_015020chr1673898 3233 3120 1512 1395 553 372 23798 3113 ----
NM_015025chr282688 2640 2539 2469 2439 2418 2283 1045 2703 62 21937 518 --
NM_015026chr1253327 1866 1280 1184 899 33579 2981 441 13671 24415 821
NM_015027chr1691990 1980 696 597 430 210 100 37 29 ------
NM_015032chr1341121 881 778 439 22528 828 --12172
NM_015040chr253292 3169 3049 999 533 43403 3312 2835 2213 --12425
NM_015045chr1061636 1429 563 357 342 36 ------
NM_015046chr932584 2480 109 --22648 814 141
NM_015049chr253235 2719 2440 2068 325 22871 1072 12390 --
NM_015051chr942203 1030 506 481 12307 --12704
NM_015055chr1141881 1082 748 39 12682 11003 --
NM_015057chr132668 632 ------
NM_015068chr763972 3963 2996 2465 409 367 23924 94 ----
NM_015069chr162478 211 ------
NM_015071chr596206 6016 4760 4530 2146 1894 1173 1034 196 11653 15670 26324 6197
NM_015074chr174329 4146 3723 3585 1374 406 337 14905 ----
NM_015075chrX11739 ------
NM_015076chr641803 1181 524 137 21530 940 33655 3172 1596 21668 326
NM_015092chr1664335 3591 3021 2941 1402 499 --23327 763 --
NM_015097chr3112279 2239 1965 1952 1921 1602 1589 1552 1447 340 105 --1641 --
NM_015110chr952467 2101 1598 866 652 ------
NM_015115chr483041 2583 2134 469 260 164 90 70 1333 13151 --
NM_015124chr221140 22488 2412 ----
NM_015137chr842411 2219 2056 790 12311 1651 --
NM_015144chr1694009 3706 3360 2829 2537 1381 919 592 83 --23560 2593 --
NM_015149chr121995 1398 ----11969
NM_015156chr1443412 2642 519 38 --23840 2824 13777
NM_015172chr161540 1502 1471 1388 623 70 21077 170 ----
NM_015176chr11569 --31653 1637 74 --
NM_015184chr31208 ------
NM_015185chrX62697 781 725 712 451 432 ------
NM_015192chr2032516 2059 741 12293 12812 1597
NM_015199chr332996 2648 2615 21894 325 12468 1626
NM_015200chr421824 1810 --1752 --
NM_015203chr1167 ------
NM_015206chr1523276 1214 12783 13462 23506 3499
NM_015208chr1863279 1531 865 220 67 26 --53016 1317 534 500 58 --
NM_015215chr142897 2872 2420 1166 23187 2152 1440 11181
NM_015216chr551023 579 508 420 315 11269 ----
NM_015230chr4--2499 331 1347 144
NM_015233chr1392577 2462 2347 2123 2077 1909 870 385 340 --11902 11058
NM_015239chr91441 ------
NM_015247chr16105371 5057 5010 3983 3536 1466 1145 727 513 482 13874 24973 3917 --
NM_015250chr91203 11792 11731 1687
NM_015263chr1521014 186 2912 218 11212 --
NM_015265chr212083 1868 --12582
NM_015268chr31672 ------
NM_015269chr12572 60 --1416 --
NM_015271chr444102 3111 2883 2777 32621 1537 400 13530 --
NM_015272chr1632142 1949 1919 --1457 --
NM_015275chr1231725 1575 1477 ----11982
NM_015278chr683369 3345 3261 2554 2171 926 317 60 33102 2190 454 12927 --
NM_015285chr1811750 11875 21603 489 --
NM_015288chr543544 3533 2663 2639 --13106 --
NM_015308chr114756 218 75 34 ------
NM_015310chr898240 7945 6794 5901 5167 2972 2513 1082 974 35355 1629 134 48058 7627 6109 2455 --
NM_015313chr1153874 3791 1451 1100 585 24507 4300 ----
NM_015314chr742604 2470 576 382 --12437 1671
NM_015317chr211756 ----21153 688
NM_015323chr641715 1638 1420 655 21705 148 ----
NM_015326chr143016 1905 969 574 ----12902
NM_015335chr1221687 493 ------
NM_015336chr1252703 609 523 335 27 --1493 --
NM_015344chr852079 1967 765 85 22 1143 ----
NM_015345chr6------12795
NM_015349chr622274 519 11969 23031 3002 --
NM_015358chr21--21178 123 1156 --
NM_015359chr872828 2769 2401 1877 665 658 617 --11865 1164
NM_015361chr2--1319 ----
NM_015365chrX84291 3460 3344 1659 1585 953 711 289 192 --24272 2887
NM_015375chr174960 4548 3268 1878 1654 1291 501 25030 3079 24885 4063 --
NM_015387chr261690 1558 1470 580 125 25 21934 52 12091 --
NM_015393chr4103823 3686 3164 3020 2453 2339 1368 1000 644 524 ------
NM_015423chr1161705 1457 1330 450 416 379 ------
NM_015429chr32997 205 --1765 --
NM_015455chr543806 3642 3206 199 1524 33477 2860 1023 --
NM_015457chr112786 330 ------
NM_015458chr845230 4249 935 794 24994 1626 25106 5015 1150
NM_015460chr342116 1839 1783 1732 2310 83 11554 --
NM_015461chr181706 1115 ----
NM_015509chr1241515 1074 571 548 --21185 1036 11643
NM_015532chr1531083 855 618 --3235 197 87 12086
NM_015548chr6192 1280 --1621
NM_015554chr1542369 1971 1870 1829 32539 432 37 ----
NM_015569chr184823 4742 4315 4307 4145 1804 816 225 ------
NM_015570chr711735 11703 1578 --
NM_015577chr551763 1657 718 686 276 ----11780
NM_015578chr1932055 1619 1565 --41555 716 571 383 --
NM_015601chr1041013 816 719 323 1188 ----
NM_015602chr111431 11579 11458 --
NM_015626chr1741112 406 320 129 21013 354 ----
NM_015630chr21126 ------
NM_015640chr194681 3318 1956 1683 1483 1174 812 426 417 --24804 504 13736
NM_015678chr1321163 515 11657 21253 263 --
NM_015687chr62440 175 --1111 --
NM_015691chrX42926 1089 807 381 1340 1276 1538
NM_015713chr883382 2916 2643 2263 2255 1449 914 431 ------
NM_015723chr72266 242 1487 1278 --
NM_015852chr7173616 2867 2708 1459 1375 1294 1129 1045 961 625 541 457 373 289 205 121 37 12534 ----
NM_015866chr121235 205 11529 1941 11088
NM_015869chr3----1143 --
NM_015872chr111583 1248 1224 --
NM_015874chr41233 ----1395
NM_015878chr81568 11988 --12092
NM_015879chr1878610 8253 8245 6802 3209 2208 243 23163 1603 38500 8166 7528 13152
NM_015886chr875747 5663 4325 3833 3766 2032 1574 11305 25386 910 25562 231
NM_015888chr143132 2448 1253 1127 12221 ----
NM_015891chr61275 ----11961
NM_015906chr164590 3803 1698 1553 1201 303 24071 3290 43824 3336 1091 555 --
NM_015912chr842563 2210 1877 687 11821 12133 12278
NM_015913chr13739 669 68 ----1770
NM_015932chr133642 508 89 160 --1715
NM_015975chrX31265 404 61 ----11209
NM_015990chr421086 849 ------
NM_015995chr1545535 4419 3483 2007 --22082 1119 15485
NM_016009chr1104901 4826 4384 3734 3704 3146 3087 1778 1022 345 33186 1259 785 54781 4152 1946 1135 1113 --
NM_016018chr852485 1886 1130 1013 659 --1754 --
NM_016019chr74915 870 244 56 1776 1329 --
NM_016021chr672841 2657 2590 2582 898 491 306 --1645 --
NM_016040chr132789 2781 933 22009 2004 22514 2269 --
NM_016048chr521000 283 1392 --1864
NM_016072chr1242353 2170 1674 1622 --136 12407
NM_016073chr1551097 1064 891 882 472 11035 1934 --
NM_016075chr1342471 2218 984 425 11170 1639 --
NM_016076chr143121 3043 2500 2028 ----12897
NM_016078chr17--1951 --1873
NM_016079chr242083 2048 572 224 ------
NM_016081chr451840 558 451 425 179 12033 --12141
NM_016083chr6123938 3777 3642 3300 3178 1433 1242 956 938 827 705 72 13369 11065 23687 3008
NM_016096chr861909 1604 762 553 260 45 22170 1353 2273 140 12055
NM_016101chr1621386 308 1131 1227 --
NM_016120chrX2906 478 ------
NM_016121chr121121 446 1906 ----
NM_016125chr17--1563 ----
NM_016127chr82253 227 --1740 --
NM_016132chr1533422 2598 759 33081 443 327 3924 901 234 2158 81
NM_016133chr231666 1480 473 --1345 --
NM_016152chr31973 1441 11263 1368
NM_016195chr102707 119 168 ----
NM_016201chr352326 2286 1667 728 595 --21595 451 --
NM_016203chr72927 910 ----1237
NM_016205chr421232 1200 11336 1901 --
NM_016217chr663415 1453 1126 908 587 546 22377 562 22310 2227 --
NM_016220chr7142219 1864 1826 1641 862 789 624 540 456 376 292 209 125 41 12046 ----
NM_016227chr121279 1194 ------
NM_016247chr31433 ------
NM_016248chr1363813 3666 2559 1000 771 657 23488 2569 --12545
NM_016255chr652594 2358 738 690 586 1868 22468 1211 12091
NM_016258chr11621 ----1710
NM_016260chr2157508 7384 7270 7225 7077 6144 5943 5877 5189 1858 1774 1717 1607 124 59 36802 5006 5001 1214 --
NM_016270chr191340 1397 --2389 366
NM_016271chr1812312 1351 --21434 820
NM_016275chr332264 654 84 11017 11066 1224
NM_016277chr64554 445 296 136 --3633 346 328 --
NM_016281chr1221017 344 ----1843
NM_016287chr131868 1742 619 ------
NM_016289chr292166 1851 1612 1583 931 865 538 106 45 1838 ----
NM_016308chr142083 1521 1502 42 1533 ----
NM_016315chr2--31629 235 194 1489 --
NM_016322chr973148 1995 1170 886 843 433 299 33185 2029 1058 12351 12451
NM_016374chr121245 64 21229 343 11169 11578
NM_016374chr121245 64 21229 343 11169 11578
NM_016376chr1784327 3820 3041 1414 1100 1090 788 755 --14035 --
NM_016395chr1551920 1862 1357 337 157 1169 ----
NM_016410chr92492 419 1525 ----
NM_016422chr1173105 2899 2523 857 319 200 31 22637 599 13074 1635
NM_016424chr1741571 1547 78 46 ------
NM_016436chr2062117 1910 1038 773 588 89 --3888 493 477 --
NM_016441chr211807 12238 21586 881 --
NM_016470chr201498 --1471 1399
NM_016480chr51559 ----2865 699
NM_016485chr642207 918 896 300 21431 792 ----
NM_016507chr1713031 12671 32687 1189 1124 --
NM_016513chr643472 3195 588 177 13453 12518 23389 3299
NM_016531chr473886 3574 3194 2624 1351 857 689 13707 13334 13086
NM_016542chrX11516 ----11454
NM_016570chr12----170 --
NM_016577chr354053 3972 1481 1201 809 --11105 1233
NM_016584chr121265 1256 ----
NM_016587chr721106 919 11099 11086 --
NM_016603chr572212 2079 757 742 720 671 397 ------
NM_016607chrX61520 1432 1119 1103 353 132 ----1120
NM_016613chr462764 2026 971 952 583 547 --32372 2090 316 --
NM_016617chr1331983 200 45 22158 1425 12222 --
NM_016651chr1441142 968 216 142 ------
NM_016654chr151405 --11134 11301
NM_016655chr152130 44 ------
NM_016733chr2251352 1171 1062 209 70 ----11393
NM_016824chr1011890 ------
NM_016834chr1744090 1294 1165 717 14127 --13269
NM_016835chr1744090 1294 1165 717 14127 --13269
NM_016841chr1744090 1294 1165 717 14127 --13269
NM_016950chr431498 1167 1130 1970 ----
NM_016953chr2115954 5691 5483 4871 4525 4498 3955 1854 1532 1097 573 14790 --15293
NM_017415chr594405 3972 3768 3062 1771 1510 1483 583 112 11761 ----
NM_017420chr14103604 3044 2989 2890 2817 2622 1172 898 762 744 23764 3561 ----
NM_017423chr441951 507 187 87 12016 --12240
NM_017426chr41148 1270 ----
NM_017435chr126745 731 697 576 315 161 ------
NM_017452chr2031266 55 46 11192 11110 --
NM_017453chr2031266 55 46 11192 11110 --
NM_017454chr2031266 55 46 11192 11110 --
NM_017544chrX4345 218 201 136 --1190 --
NM_017548chr33865 312 175 1496 --22103 1994
NM_017563chr376099 5319 4351 1235 792 770 128 36277 4842 798 11152 --
NM_017577chr321227 1143 1496 --1601
NM_017580chr1042194 1932 1626 663 ------
NM_017582chr181780 1639 1588 1241 1223 1202 462 288 ----164
NM_017583chr1151798 1482 634 426 181 11664 11705 1322
NM_017593chr41175 --1351 --
NM_017599chr122817 230 31619 1296 385 --1639
NM_017610chr1561530 768 699 676 553 54 2508 235 1467 --
NM_017615chr10------169
NM_017628chr455205 4281 1328 727 417 1902 2953 560 1665
NM_017633chr673328 3297 3002 2593 1376 1186 508 1326 33387 1275 1140 --
NM_017634chr821801 237 11594 ----
NM_017635chr1141611 524 147 101 1128 ----
NM_017637chr9109314 8015 6994 6563 5760 3633 3494 2620 2152 1746 26335 2134 29074 6436 19220
NM_017641chr124853 415 249 228 --21112 35 --
NM_017643chr1732709 2689 2443 --12732 --
NM_017644chr394238 3546 3420 2014 1454 1154 605 582 573 11514 24421 837 --
NM_017645chr922973 442 --13175 --
NM_017650chr796096 6062 5112 2292 2242 2189 1723 812 786 24975 2042 14858 --
NM_017651chr631046 391 224 --1251 --
NM_017657chr21174 1732 ----
NM_017658chr14104363 4227 4017 3779 3260 3254 1652 667 440 45 11387 13400 --
NM_017661chr152501 79 11272 1831 1911
NM_017664chr131292 --1280 1955
NM_017666chrX42224 2082 637 408 --11662 --
NM_017672chr1541378 1280 1011 54 --21069 961 --
NM_017676chr531890 508 395 11372 ----
NM_017694chr251956 1808 1468 811 174 31763 1603 1598 --1819
NM_017709chr183411 3325 2989 2630 1518 1421 1180 674 ----1648
NM_017719chr352569 2489 2177 1999 172 --12274 --
NM_017737chr171955 1761 1714 1470 873 843 275 1704 ----
NM_017738chr92831 229 ------
NM_017742chr1831915 1403 299 11842 --11837
NM_017745chrX1680 ------
NM_017752chrX51918 1721 1698 828 711 11763 ----
NM_017754chr655029 4568 4028 1318 1188 --1673 --
NM_017762chr1552227 2172 1984 1969 1835 ----1847
NM_017780chr83843 182 57 ------
NM_017789chr24863 816 755 116 ------
NM_017813chr875208 4622 4422 4213 1358 203 58 15754 34963 4299 1787 24644 870
NM_017824chr1032723 2477 1703 22675 949 22586 331 --
NM_017830chr4----1183 --
NM_017831chr1884557 4529 4254 3414 3018 1124 136 54 13308 --1870
NM_017890chr831786 1714 719 1415 ----
NM_017893chr1011353 ------
NM_017905chr13--1540 ----
NM_017910chr2162 ------
NM_017919chr9105704 4371 3976 3854 3811 2012 1775 1320 736 59 23869 3702 ----
NM_017925chr931752 206 152 11690 11378 --
NM_017938chrX42081 1425 676 33 21995 570 ----
NM_017944chr1122821 2110 1212 --13013
NM_017953chr131165 846 88 --11016 --
NM_017954chr731663 1208 508 ------
NM_017964chr2132 ------
NM_017987chr1051797 1668 1491 737 572 --1721 --
NM_017998chr951366 1127 1042 506 274 --1382 --
NM_018011chr132570 467 --1492 --
NM_018024chr82525 455 --1478 --
NM_018036chr1444389 1563 1072 95 --11015 14397
NM_018043chr11----1996 11404
NM_018046chr531778 1632 676 1604 --1549
NM_018061chr141639 1151 385 235 1523 11221 --
NM_018084chr262704 2119 2098 2062 1257 264 ----22742 468
NM_018085chr1107448 6923 5486 5044 5025 2465 2281 2146 1350 186 16602 15292 11946
NM_018092chr1621684 548 31341 1291 134 21262 67 11176
NM_018098chr34955 914 435 338 ------
NM_018101chr1179 --11265 --
NM_018105chr841154 1120 870 375 ----1150
NM_018112chr92975 893 1908 160 --
NM_018121chr1022371 758 11003 1717 1832
NM_018124chr1652500 1856 441 88 30 1265 ----
NM_018126chr431536 1208 504 --1268 1971
NM_018133chr342154 2103 1357 520 1869 ----
NM_018149chr17185 1181 1167 --
NM_018155chr342226 1306 1034 22 11273 --1341
NM_018157chr1252553 2355 1024 176 29 --23261 2864 13224
NM_018159chrX51533 1486 1462 646 26 ------
NM_018164chr12133 ------
NM_018176chr4--21563 1552 --11547
NM_018181chr1861967 1713 1406 682 305 95 ----11370
NM_018182chr1741990 1594 1433 568 11813 --12193
NM_018184chr351680 1520 409 351 53 ------
NM_018238chr71945 ------
NM_018247chr642016 345 204 73 23049 2921 1327 11247
NM_018254chr172128 1875 1639 1542 659 376 102 32038 2020 309 11971 --
NM_018260chr1961273 1095 1054 223 151 66 ------
NM_018263chr252489 2417 2158 712 672 1649 12366 --
NM_018266chr3----11111 --
NM_018272chr12--124 ----
NM_018293chr342785 2455 2002 504 22973 2756 12694 --
NM_018299chr853447 3377 2140 621 308 ------
NM_018312chr1132134 594 186 1354 --1230
NM_018313chr342349 1713 1669 665 1119 ----
NM_018320chr111248 ------
NM_018323chr451672 1591 330 275 77 ----1213
NM_018325chr941098 1045 664 303 31575 1458 417 11510 --
NM_018328chr22379 186 1421 --1370
NM_018330chr1051645 1070 693 551 281 21426 459 --11705
NM_018339chr941693 229 84 59 1704 11186 --
NM_018364chr141576 1376 774 368 --11498 --
NM_018367chr1131954 734 135 --11882 1479
NM_018374chr755128 5044 4768 3639 1235 ----1731
NM_018375chr14------11512
NM_018388chrX31087 487 477 1521 --1508
NM_018403chr341595 1366 1099 923 --12743 23991 3365
NM_018429chr542501 2086 1992 636 ------
NM_018433chr2--2492 450 ----
NM_018439chr182403 389 --52643 2607 2427 1930 74 --
NM_018440chr885786 5630 5397 1822 1379 820 369 98 16779 18408 12272
NM_018444chr862282 2045 1531 803 375 339 12075 ----
NM_018448chr12----1982 21192 1114
NM_018466chrX1677 ------
NM_018469chr1741310 1229 1101 104 176 129 --
NM_018475chr42671 503 ----197
NM_018482chr852388 2172 1830 1795 90 12557 3963 649 263 --
NM_018509chr1711424 ------
NM_018555chr1962087 1610 585 568 463 363 1744 31846 1583 539 --
NM_018557chr231533 1466 236 --11147 125
NM_018566chr11607 --11204 15130
NM_018638chr1245424 5211 4809 3946 54956 4102 2093 1737 1278 35025 3591 936 24613 4438
NM_018641chr71194 1129 2557 139 --
NM_018650chr12886 67 21825 1542 1230 11451
NM_018667chr16--12669 12627 --
NM_018682chr73540 249 177 --1689 1262
NM_018686chr12--1240 1130 --
NM_018695chr521742 494 62449 1933 1909 1782 1777 800 ----
NM_018703chr161124 1270 ----
NM_018710chr821399 1264 1460 --11351
NM_018834chr52950 81 1104 ----
NM_018841chr153916 3376 2641 793 248 23651 611 13803 --
NM_018844chr771956 1426 666 596 574 241 178 1137 22027 30 --
NM_018898chr551893 1768 1651 1522 446 ------
NM_018899chr551893 1768 1651 1522 446 ------
NM_018900chr551893 1768 1651 1522 446 ------
NM_018901chr551893 1768 1651 1522 446 ------
NM_018902chr551893 1768 1651 1522 446 ------
NM_018903chr551893 1768 1651 1522 446 ------
NM_018904chr551893 1768 1651 1522 446 ------
NM_018905chr551893 1768 1651 1522 446 ------
NM_018906chr551893 1768 1651 1522 446 ------
NM_018907chr551893 1768 1651 1522 446 ------
NM_018908chr551893 1768 1651 1522 446 ------
NM_018909chr551893 1768 1651 1522 446 ------
NM_018910chr551893 1768 1651 1522 446 ------
NM_018911chr551893 1768 1651 1522 446 ------
NM_018945chr62947 433 1712 1885 --
NM_018947chr784985 4625 3639 3121 3074 1284 1169 368 33840 3237 1451 ----
NM_018948chr13912 437 165 --21446 158 --
NM_018951chr731241 470 298 --21036 261 11231
NM_018970chr742099 742 576 445 1485 ----
NM_018976chr1252811 2547 2276 1045 407 --22385 2040 --
NM_018979chr1242315 533 145 49 1859 11755 --
NM_018981chr251170 1140 425 369 125 11097 --11115
NM_018993chr20--11324 11423 21485 958
NM_018999chr10104833 4319 4083 3902 3564 3122 1323 1085 809 364 1175 ----
NM_019001chr353126 1359 1064 1046 563 33591 3570 3528 44802 4480 4262 158 --
NM_019004chr732120 1692 809 21880 869 22388 1601 --
NM_019022chr1832832 2081 813 11220 22853 2275 1987
NM_019027chr432377 944 514 12125 --1266
NM_019028chr111314 ------
NM_019035chr432051 495 128 ----1144
NM_019036chr621230 995 --3850 370 327 --
NM_019072chr543973 2805 790 429 --13817 --
NM_019083chr111590 --2580 118 --
NM_019091chr241020 864 851 66 2337 53 --1756
NM_019098chr841743 665 364 93 ------
NM_019114chr921880 1730 12515 12025 11632
NM_019117chrX51261 1173 1016 758 546 22653 708 ----
NM_019555chr31316 1159 11484 --
NM_019597chrX1724 2747 234 ----
NM_019600chr152740 204 ----2812 594
NM_019852chr14--1113 ----
NM_019860chr101251 --11624 --
NM_019903chr1011890 ------
NM_020066chr11846 1166 --1948
NM_020116chr421415 182 21206 675 ----
NM_020119chr733961 3911 2879 31226 898 696 ----
NM_020122chr245975 3843 713 312 24638 38 --25949 2168
NM_020123chr1041552 612 505 486 ------
NM_020130chr841369 533 286 213 1951 ----
NM_020132chr2184707 4677 4603 4175 4094 2072 1209 428 14272 ----
NM_020147chr15--176 ----
NM_020148chr1832912 406 299 12864 1160 22602 1209
NM_020154chr151210 ------
NM_020159chr431654 1453 1184 --1354 --
NM_020177chr553013 893 770 419 279 13309 1198 --
NM_020178chr1721233 779 ------
NM_020199chr52529 250 --161 1862
NM_020204chr11183 ------
NM_020209chr19188 ------
NM_020228chr1162351 1603 816 646 614 288 12503 42191 1902 993 333 --
NM_020245chr684607 3994 3901 1768 1548 940 263 198 34646 4521 999 ----
NM_020315chr221963 ------
NM_020336chr2053844 3215 1059 780 114 13670 ----
NM_020337chr442686 2094 1147 266 21977 144 22800 423 --
NM_020338chr1013084 ------
NM_020341chr2031255 607 339 11999 --11481
NM_020347chr342071 1995 1779 1710 ------
NM_020357chr331081 1045 335 31189 1160 432 ----
NM_020379chr1--1614 ----
NM_020386chr3227 21 ------
NM_020390chr374485 3676 3464 3342 3014 1624 437 34325 4142 3147 24588 1857 13780
NM_020403chr1331265 475 437 --11318 --
NM_020428chr19--11166 ----
NM_020432chr751962 1739 1666 397 49 11901 --1622
NM_020466chr664546 4421 4022 1729 1173 252 1771 11844 13720
NM_020529chr143445 306 145 ------
NM_020640chr352122 2012 1863 647 491 --21933 345 --
NM_020648chr1852289 1846 1825 1041 398 12804 ----
NM_020654chr311469 --1466 21148 425
NM_020673chr2067574 7562 7456 5486 2223 480 42824 2237 1481 1049 27690 815 --
NM_020708chr2022485 2448 ------
NM_020711chr242623 2437 2427 1784 ------
NM_020715chr1422210 80 11608 --1635
NM_020717chrX94471 3433 1836 1699 1513 1459 1421 1089 841 14325 ----
NM_020718chr1695875 5218 4431 4071 4027 1906 1743 1566 430 12238 11987 14521
NM_020727chr2143380 3025 2678 1502 24053 3681 53729 2761 857 348 198 --
NM_020734chr1233390 3313 3064 --42806 2755 2178 81 --
NM_020739chr1553278 3124 2889 2829 1186 12688 --11121
NM_020748chr1742157 1982 712 101 1223 ----
NM_020752chr101889 --2811 763 --
NM_020766chrX124379 4273 4025 3964 3829 3691 1262 598 584 540 450 129 23338 1391 1909 --
NM_020768chr563137 3094 2141 2122 763 510 ------
NM_020770chr121343 391 ------
NM_020771chr621090 508 1443 --2624 550
NM_020772chr17117255 6786 5429 2996 2817 2235 951 751 537 356 257 33399 3040 1824 38030 5863 5632 11910
NM_020774chr1855618 5359 4857 4532 1310 16212 24159 1397 --
NM_020779chr253074 2982 2929 2316 768 1506 --164
NM_020783chr1832147 959 70 --1284 --
NM_020794chr121016 549 11463 --11561
NM_020796chr562566 2334 1904 1858 1215 709 --32894 2465 572 12079
NM_020801chr532369 2025 1899 2670 651 11814 --
NM_020805chr1821463 345 --1396 --
NM_020809chr1111817 12044 22290 900 12059
NM_020818chr14194 1102 ----
NM_020819chr63437 389 82 11168 1889 --
NM_020825chr1623835 375 ----23715 2565
NM_020841chr1253247 3008 1174 782 500 --13489 11612
NM_020844chr897046 6371 5130 5107 5029 2709 2454 1911 1638 11307 35268 2992 349 --
NM_020856chr1911472 21173 1131 --21260 596
NM_020858chr1532363 1848 1667 11734 22315 1777 --
NM_020860chr44969 937 462 165 --11114 --
NM_020868chr252014 1493 1300 175 35 1428 --174
NM_020872chr371738 1683 1522 1154 559 523 425 ----11515
NM_020886chr1121013 133 --11266 --
NM_020899chr171744 --12282 --
NM_020905chr21109 ------
NM_020918chr1093605 3560 1416 1332 1003 985 594 584 330 13258 --1668
NM_020921chr1443130 2227 1183 438 22707 938 --1915
NM_020924chr91430 ------
NM_020929chr111153 ------
NM_020937chr144640 544 324 70 --1694 1123
NM_020940chr1062561 2261 2172 1985 802 39 22916 117 ----
NM_020948chr143591 2908 1184 1091 --12785 --
NM_020977chr432060 674 376 1609 12083 1385
NM_020987chr1041267 1184 887 575 21174 490 1281 --
NM_021005chr152812 309 ----11093
NM_021007chr252409 2105 1643 565 406 21742 528 12155 11554
NM_021032chr361617 1603 822 812 426 290 ------
NM_021033chr1353420 3121 2327 1408 435 21051 315 ----
NM_021038chr352913 2403 886 714 142 33365 3029 2220 12245 2962 86
NM_021061chr854353 4025 2877 1197 157 1471 11207 12854
NM_021064chr631783 1685 691 11500 11640 --
NM_021069chr461967 1484 1321 770 535 164 --1427 --
NM_021083chrX43402 3143 2866 299 --23623 586 --
NM_021101chr332149 977 412 21687 97 1867 --
NM_021111chr921368 89 ------
NM_021116chr788544 7664 7655 3435 3229 2724 2559 2327 17635 46589 3624 3122 998 --
NM_021120chrX83055 2671 2370 1010 983 922 435 101 12413 ----
NM_021132chr1021307 930 ------
NM_021140chrX31142 853 165 11053 ----
NM_021146chr1----1897 1862
NM_021148chr782247 2214 2148 1707 601 417 226 70 22261 346 --11747
NM_021159chr431586 663 346 --11624 --
NM_021180chr11506 ----1667
NM_021183chrX166 12421 11617 1849
NM_021190chr14975 855 511 333 --1137 --
NM_021222chr11590 --1117 --
NM_021239chr1421185 349 4900 512 361 254 ----
NM_021240chr91647 1228 ----
NM_021252chr1022069 1846 1780 --11735
NM_021255chr1463979 3606 3500 3338 2832 42 24070 3234 188 --
NM_021269chr1971969 1745 1659 1597 584 309 59 21796 693 ----
NM_021614chr5--169 ----
NM_021622chr1052339 1584 1552 442 111 1484 11978 --
NM_021629chr334749 4386 1139 --23866 3541 45101 3878 1655 431
NM_021638chr444980 3824 1284 688 24713 178 14245 --
NM_021639chr11169 ------
NM_021647chr474115 3446 3309 1552 972 923 709 --11006 --
NM_021809chr2072325 2159 1957 1834 1641 519 379 22463 908 ----
NM_021813chr675774 4819 4730 4469 3619 1140 82 25651 5585 23881 141 34512 928 833
NM_021818chr1441078 1018 477 92 11278 1407 1221
NM_021911chr564813 4636 3595 3573 2227 1487 13672 35270 842 390 14084
NM_021912chr1524057 1159 14093 13335 --
NM_021914chr1442353 2112 1934 318 --1192 --
NM_021925chr261638 1455 1379 1200 1158 709 ------
NM_021946chrX2972 468 11454 ----
NM_021947chr175447 381 287 70 45 11309 ----
NM_021954chr1332401 1093 176 22744 2258 1870 --
NM_021960chr131996 1804 1735 2469 385 ----
NM_021961chr11117141 6270 6123 5569 4736 4601 2307 1985 1003 856 349 1786 --16941
NM_021964chr3126187 5854 5803 5208 4692 4139 2450 1794 1638 724 566 28 24618 85 34797 4735 364 14412
NM_021988chr2031590 1357 1338 ----1156
NM_021998chrX21462 1117 --11284 1468
NM_022041chr1621000 894 22562 362 22476 1713 --
NM_022048chr15126392 5816 3918 2234 2058 1956 1672 1264 1181 816 645 228 12330 26358 802 --
NM_022079chr1041013 816 719 323 1188 ----
NM_022103chr1921007 941 ------
NM_022114chr174074 3661 3062 1722 1623 1496 692 --13829 24719 636
NM_022130chr52921 219 21244 566 ----
NM_022133chr841245 1218 319 305 --1271 --
NM_022136chr213682 465 177 ------
NM_022137chr1461762 1472 589 549 424 395 1245 --1340
NM_022166chr1646027 5388 1626 1078 15396 16322 26273 4813
NM_022337chr11----1535 1591
NM_022351chr823437 2447 198 23598 311 21422 404
NM_022373chr71232 ------
NM_022442chr2031590 1357 1338 ----1156
NM_022456chr1287501 7459 6896 4983 2667 936 782 469 17202 31165 687 166 11684
NM_022459chr1395411 5252 4710 4639 4456 4340 4081 3990 185 14042 11551 --
NM_022465chr1262588 2182 1979 1117 480 244 23060 3046 --13011
NM_022473chr1534320 3622 759 14092 13797 --
NM_022474chr1452081 1761 708 426 367 62823 2357 2049 1945 1026 1021 --12811
NM_022475chr4--1690 ----
NM_022484chr721020 393 1215 11046 177
NM_022648chr272897 2887 1721 1709 1633 1594 554 24580 4219 33592 694 570 --
NM_022658chr1211137 11348 ----
NM_022716chr173021 2348 1273 1002 808 407 134 ----1955
NM_022728chr72492 136 --1304 --
NM_022735chr12251 113 21370 1242 11526 11635
NM_022739chr173847 265 84 ----1978
NM_022753chr162529 2451 1832 957 899 76 12549 12650 --
NM_022763chr342614 2594 2029 1997 13069 ----
NM_022784chr1521047 44 ------
NM_022825chrX1308 ------
NM_022836chr141853 539 406 400 --11762 11698
NM_022838chrX1273 ----170
NM_022841chr1552717 2430 2397 1985 894 2499 51 12459 --
NM_022843chr13--21338 393 1444 21035 125
NM_022845chr1662031 2010 1982 1901 1678 744 --12230 --
NM_022893chr262603 2295 1218 1134 483 430 13080 --22593 843
NM_022894chr231314 551 225 11271 --1175
NM_022898chr1474702 4488 3968 3331 1526 1339 62 14531 --11191
NM_022900chr72480 163 ------
NM_022918chr1141807 1777 1663 1653 --11561 --
NM_023016chr212021 1595 ----
NM_023074chr19144 11362 2852 168 --
NM_023075chr182377 168 --1784 --
NM_023923chr123132 2979 23701 1522 --1228
NM_023925chr12----1242 --
NM_023929chr852317 1111 120 100 29 ----11722
NM_024007chr542306 1058 641 164 13094 21932 849 --
NM_024019chr41229 ------
NM_024045chr101208 ------
NM_024061chr73607 457 190 ------
NM_024076chr1922366 467 ----12357
NM_024094chr83854 590 148 ------
NM_024102chr131169 1132 926 ------
NM_024345chr9165602 5483 5283 5057 4949 4551 4362 4072 2200 2082 1242 657 542 525 464 456 12144 12092 --
NM_024408chr133282 2660 48 --13603 1687
NM_024424chr1131214 1116 847 2365 283 ----
NM_024425chr1131214 1116 847 2365 283 ----
NM_024426chr1131214 1116 847 2365 283 ----
NM_024429chr72927 910 ----1237
NM_024524chr363088 2562 2340 1018 473 292 12551 12056 --
NM_024529chr11916 ------
NM_024539chrX3787 427 108 ----11216
NM_024546chr1341245 1136 987 164 --11191 11226
NM_024557chr1171747 1689 1628 1577 1520 577 523 21711 283 ----
NM_024582chr441008 992 359 150 --1951 11112
NM_024615chr5191 ------
NM_024627chr2284932 4724 4653 4634 4571 3066 748 26 14781 34792 3501 3440 --
NM_024631chr11--1520 ----
NM_024632chr5--196 ----
NM_024646chr163773 3570 3496 3296 411 142 ------
NM_024665chr384545 4512 3701 3215 1646 966 232 75 12893 14322 --
NM_024670chr1031415 488 435 --1501 --
NM_024692chr251565 1475 1319 1155 619 11290 ----
NM_024721chr82151 143 52630 2522 1814 1055 341 1861 --
NM_024740chr1194092 4047 3681 3348 1461 491 354 260 118 ----11371
NM_024744chr242617 1723 756 685 --12363 --
NM_024745chr16248 32 184 --11087
NM_024751chr441846 1745 1571 115 --11990 --
NM_024770chr265715 5359 4972 2332 599 68 34616 1752 58 26032 4317 --
NM_024772chr11510 2444 201 1214 --
NM_024806chr111276 ------
NM_024814chr71321 ------
NM_024817chr1585666 4408 2081 1952 1941 1475 1047 223 25875 1229 1561 --
NM_024828chr91196 ----21535 1129
NM_024884chr1474539 4054 3941 3509 2926 2893 1187 --14167 11400
NM_024920chr441261 612 587 97 --11567 --
NM_024944chr211505 --1183 1372
NM_024945chr951102 1051 916 865 366 ------
NM_024947chr3168801 8765 8493 7983 6939 5844 3723 3418 3119 2392 1265 1254 867 557 139 97 17712 59574 9506 8562 6779 911 29597 9123
NM_024949chr464980 4635 4541 2007 521 322 ------
NM_024953chr1222404 2314 31845 1840 179 ----
NM_024989chr2117748 7378 6510 5390 4992 3048 2114 1123 921 731 126 16940 --16572
NM_025054chr883104 3059 2824 2660 2619 658 176 37 ----11668
NM_025058chr11727 ------
NM_025065chr12325 21 2880 594 ----
NM_025073chr194688 4231 3418 3138 1250 196 151 70 52 --74746 3471 3158 2894 1058 671 655 --
NM_025074chr473013 2886 2787 1061 1047 807 61 12848 ----
NM_025133chr22215 177 --11084 --
NM_025147chr231092 417 262 ------
NM_025151chr852136 2018 1485 441 354 1188 --12064
NM_025160chr163990 3737 1277 1253 1245 552 ------
NM_025179chr194945 4886 3936 3251 1795 843 529 337 106 14898 ----
NM_025189chr194810 617 533 62 ------
NM_025191chr183458 3413 3397 3171 2379 1057 466 448 13387 1166 13284
NM_025235chr1051939 884 870 676 505 12229 1350 --
NM_025238chr1521529 1284 ----11266
NM_030621chr14114167 4115 3452 3234 3082 2981 2844 1640 1173 1039 839 14032 21671 527 13715
NM_030623chr231687 1354 661 --11628 --
NM_030625chr1072595 902 793 725 682 675 59 ------
NM_030627chr563902 3632 3485 3285 1641 356 ----13668
NM_030647chr786210 5655 4509 2341 1331 1032 1025 142 --35593 4190 676 24573 4536
NM_030648chr445461 3885 697 223 --197 --
NM_030664chr104655 510 414 389 11722 22007 572 --
NM_030670chr1252202 2027 1866 1793 677 1189 22216 2063 --
NM_030671chr1252202 2027 1866 1793 677 1189 22216 2063 --
NM_030751chr1031164 641 114 11297 195 11429
NM_030751chr1031164 641 114 11297 195 11429
NM_030759chr10--2779 686 ----
NM_030762chr1231750 1387 1378 --31818 1640 1610 --
NM_030789chr201283 ------
NM_030799chr552224 1845 1466 1374 181 32004 1750 837 --11362
NM_030806chr1119419 8180 7028 6696 3709 3254 2937 1135 761 178 37 --31283 582 308 1129
NM_030809chr12------22494 2399
NM_030816chr143640 3351 1118 284 --13453 12806
NM_030820chr62957 162 ------
NM_030885chr322314 470 22337 805 --12065
NM_030893chr13630 512 112 ----1557
NM_030918chr194864 4782 4129 3739 3490 3384 1267 322 308 --14808 --
NM_030920chr151868 1843 1573 1561 1543 1272 12048 1186
NM_030922chr152669 225 --1787 --
NM_030949chr621483 1448 ------
NM_030954chr8----1344 --
NM_030964chr553729 3488 3443 3403 3272 23678 578 13759 --
NM_031266chr51499 2455 420 ----
NM_031268chr16105105 4341 3733 1726 1205 1162 790 778 629 399 35228 4887 3263 13311 --
NM_031289chr12----1803 --
NM_031314chr1461869 1843 1496 710 460 156 --1585 --
NM_031362chr292820 2727 2067 1830 1734 1039 238 126 27 --22742 704 1566
NM_031365chr292956 2863 2203 1966 1870 1175 374 262 163 --32878 840 129 1702
NM_031366chr292956 2863 2203 1966 1870 1175 374 262 163 --32878 840 129 1702
NM_031369chr41650 1267 ----
NM_031370chr41650 1267 ----
NM_031371chr121245 64 21229 343 11169 11578
NM_031371chr121245 64 21229 343 11169 11578
NM_031411chr551893 1768 1651 1522 446 ------
NM_031418chr1172752 2713 2521 2374 2173 824 571 22791 997 --1905
NM_031419chr321074 88 ----1551
NM_031427chr1455919 5216 2133 842 261 --24968 3970 --
NM_031435chr1283407 3190 3100 2715 2326 2210 354 279 --23318 2624 --
NM_031445chr233137 1137 274 13439 11346 --
NM_031461chr861573 1545 886 726 543 230 21813 83 11980 --
NM_031468chr767832 7247 6383 6177 6074 2274 --26234 5811 --
NM_031476chr16--12725 12632 --
NM_031483chr2083317 3054 2730 2470 2415 1140 1032 510 33434 2951 2554 12174 --
NM_031844chr163567 2505 1522 1304 1209 466 --22818 1356 1861
NM_031849chr551893 1768 1651 1522 446 ------
NM_031857chr551893 1768 1651 1522 446 ------
NM_031860chr551893 1768 1651 1522 446 ------
NM_031914chr146987 901 673 315 54 27 --1743 1178
NM_031922chr61454 ------
NM_031953chr43438 424 385 --1169 1329
NM_032012chr994618 4558 4496 4440 4420 4208 1348 412 364 34714 4227 1201 35213 3813 753 11225
NM_032041chr862634 2476 856 750 715 448 11758 ----
NM_032042chr552824 1791 1016 869 669 --12087 --
NM_032047chr332287 2119 835 --22335 390 --
NM_032102chr1183138 3063 3020 2972 2824 2712 1177 609 1209 13094 --
NM_032116chr1385250 4934 4544 4306 4182 1094 511 238 24600 1664 --11597
NM_032121chrX62094 1887 1828 625 357 35 --12426 --
NM_032124chr183436 321 46 --11078 --
NM_032128chr41241 1850 --21032 703
NM_032132chr11420 --2584 149 --
NM_032142chr18--1187 ----
NM_032144chr251848 1646 1412 1401 539 1385 ----
NM_032147chr121415 ------
NM_032153chr322422 2378 --32342 2183 708 --
NM_032156chr12----1242 --
NM_032181chr22718 696 1606 1101 --
NM_032189chr1385009 4802 4316 4250 1223 1193 327 266 --34671 1947 428 --
NM_032199chr1053749 1525 1379 983 785 13222 --23816 3598
NM_032217chr421014 1004 1306 ----
NM_032228chr1111300 22738 1371 ----
NM_032229chr134833 730 461 264 1811 134 --
NM_032233chr141276 1668 ----
NM_032239chr42572 61 --1977 --
NM_032256chr1211058 1193 ----
NM_032288chr351960 1838 1619 821 411 11906 --12096
NM_032289chr521696 1383 21905 1400 ----
NM_032291chr12417 350 1233 1206 --
NM_032295chr73506 63 47 ----11064
NM_032320chr111122 ------
NM_032373chr1075846 5750 5114 4492 4216 1466 861 ----25494 1560
NM_032379chr111304 --1839 --
NM_032408chr711212 ----1428
NM_032410chr821286 363 ------
NM_032424chr115619 608 400 248 204 ----11203
NM_032431chr11------11048
NM_032435chr152291 261 180 164 84 32351 2197 940 ----
NM_032438chr651598 1049 544 479 194 --11399 --
NM_032439chr1051491 571 525 386 255 ------
NM_032440chr1082912 2562 2539 2360 1842 1028 413 94 2733 27 ----
NM_032445chr1531639 580 430 12516 12405 --
NM_032446chr563636 3324 3066 2865 219 49 1258 1467 1952
NM_032457chr433727 3316 2984 32924 2455 179 22850 161 --
NM_032458chrX93366 2852 2736 2726 2509 1179 652 276 135 32640 2156 1213 ----
NM_032491chr1231328 841 386 21022 472 1994 --
NM_032494chr21550 ------
NM_032505chr342205 1829 511 496 12710 12062 --
NM_032521chr202340 242 12047 --12832
NM_032547chr411203 1207 1548 --
NM_032569chr16----11713 --
NM_032582chr1721757 460 11842 ----
NM_032595chr1711535 ------
NM_032626chr16------161
NM_032632chr143660 498 200 --1481 --
NM_032638chr341564 1490 1196 159 --11517 --
NM_032663chr1252053 1720 1692 705 71 ----1312
NM_032682chr363266 3225 2248 1456 860 452 13200 13086 --
NM_032804chr1032461 510 213 31810 983 835 --12010
NM_032810chr102425 174 11291 --21114 256
NM_032813chr1331077 947 411 --1997 --
NM_032828chr196994 927 464 121 91 68 13313 13723 --
NM_032829chr1211144 11052 11170 --
NM_032857chr15--1164 1202 --
NM_032859chr1373977 3243 1095 634 516 379 362 --1265 --
NM_032860chr6------1180
NM_032869chr841745 1565 331 30 2697 409 11840 175
NM_032918chr12180 ------
NM_032926chrX142 ------
NM_032932chr17106005 5644 5356 5307 4728 4031 1864 1590 331 255 26445 296 14161 --
NM_032943chr111304 --1839 --
NM_032961chr411271 ------
NM_032968chrX74073 3256 2789 1700 578 556 335 14174 23107 611 --
NM_032969chrX74073 3256 2789 1700 578 556 335 14174 23107 611 --
NM_032973chrY74065 3251 2784 1694 578 556 335 14166 23102 611 --
NM_032975chr1843530 3520 428 372 23501 3482 22268 464 --
NM_032980chr1843530 3520 428 372 23501 3482 22268 464 --
NM_032991chr441051 579 219 101 169 21225 290 --
NM_033020chr164590 3803 1698 1553 1201 303 24071 3290 43824 3336 1091 555 --
NM_033023chr7--1191 21147 1010 --
NM_033031chrX1206 --1164 --
NM_033081chr2021410 251 2292 124 ----
NM_033116chr141197 ------
NM_033119chr164815 117 101 83 ------
NM_033121chr1241418 1381 613 451 --159 --
NM_033138chr762331 611 563 537 497 197 --22256 237 --
NM_033139chr762331 611 563 537 497 197 --22256 237 --
NM_033140chr762331 611 563 537 497 197 --22256 237 --
NM_033143chr4104636 4414 4282 4142 4026 3481 3439 1628 923 222 --1840 --
NM_033157chr762331 611 563 537 497 197 --22256 237 --
NM_033181chr6123938 3777 3642 3300 3178 1433 1242 956 938 827 705 72 13369 11065 23687 3008
NM_033211chr521885 492 168 --11647
NM_033222chr9----2962 370 --
NM_033224chr766858 6192 5903 5629 4934 1370 44884 2342 2175 2131 11922 --
NM_033225chr872880 2260 2052 1970 1179 1159 985 ----22960 2218
NM_033254chr3----135 --
NM_033285chr874321 3723 3549 3487 3413 2845 1225 34242 4151 1077 1165 --
NM_033290chrX93770 3758 3092 2985 2977 2911 2629 1461 165 ----12387
NM_033305chr9------11360
NM_033326chr1162268 2154 1649 351 198 192 12414 2460 389 1723
NM_033331chr923285 3073 --43541 3217 513 234 --
NM_033360chr1234586 3996 3055 24645 3023 12978 13592
NM_033379chr10156 ------
NM_033389chr1754379 1640 1023 286 116 --43416 1626 1195 1010 13120
NM_033402chr81356 148 --167
NM_033426chr14102832 2771 2591 2576 2127 1887 1140 311 156 53 ------
NM_033427chr72875 787 1313 ----
NM_033430chr4103430 3399 3322 2975 2966 2854 1288 1074 471 278 2576 118 1605 --
NM_033437chr4103430 3399 3322 2975 2966 2854 1288 1074 471 278 2576 118 1605 --
NM_033495chrX4941 816 252 122 --1288 127
NM_033505chr2116675 5332 4721 4697 4624 4605 2714 2553 2227 960 507 36747 2076 32 34747 4654 2412 --
NM_033515chr611179 11098 21275 1072 1358
NM_033644chr522403 365 ----1760
NM_033645chr522403 365 ----1760
NM_033656chr2165465 5457 5310 3790 603 451 --25988 4158 13672
NM_052811chr1355260 3563 3458 3351 2068 --33602 1455 256 2736 295
NM_052832chr892934 2295 1971 1075 686 678 310 248 60 1316 22836 2758 --
NM_052834chr1811750 11875 21603 489 --
NM_052854chr11------1440
NM_052876chr1952710 1810 1015 965 80 12658 ----
NM_052879chr1232749 191 64 --23074 1400 --
NM_052900chr831179 618 289 ------
NM_052904chr62216 54 --1249 --
NM_052905chr231731 664 373 11219 11419 11411
NM_052910chr1341969 1750 1665 1487 1475 ----
NM_052911chr184975 874 387 171 1374 ----
NM_052917chr243418 2276 999 546 --11088 1876
NM_052927chr561551 1393 841 773 379 160 ------
NM_052937chr832565 1945 535 1488 32019 1775 1090 --
NM_052958chr81301 ------
NM_052971chr5165 ------
NM_052996chr16----21382 1372 --
NM_053016chr977355 5472 5205 2797 1895 571 425 37880 5403 1013 3859 463 86 17984
NM_053024chr361398 1317 1295 1238 1025 606 ------
NM_053042chr452912 2696 488 318 135 13104 1967 12160
NM_053043chr786341 6279 5441 4622 4591 2496 2048 1552 24996 1122 13874 16398
NM_053064chr1432677 769 347 --22847 385 --
NM_054016chr111728 12021 31956 1650 157 --
NM_054016chr111728 12021 31956 1650 157 --
NM_054016chr111728 12021 31956 1650 157 --
NM_057159chr921373 174 11010 --11042
NM_057175chr411919 32305 2164 2025 22382 397 --
NM_057749chr841223 1025 308 92 11072 11347 --
NM_058237chr143979 945 902 ------
NM_058241chr23902 447 96 12005 12243 31827 334 208
NM_058241chr23902 447 96 12005 12243 31827 334 208
NM_078487chr952956 2831 2213 1029 148 --13165 --
NM_078625chr61176 ------
NM_080422chr18--2301 284 ----
NM_080423chr18--2301 284 ----
NM_080425chr20----1312 --
NM_080426chr20----1312 --
NM_080617chr202435 404 --2899 423 --
NM_080629chr121431 584 1283 1405 --
NM_080630chr121431 584 1283 1405 --
NM_080647chr221310 ----2419 410
NM_080683chr42417 159 1448 --1169
NM_080684chr42417 159 1448 --1169
NM_080685chr42417 159 1448 --1169
NM_080742chr62275 92 ------
NM_080759chr1332629 1654 1044 22636 2233 ----
NM_080760chr1332629 1654 1044 22636 2233 ----
NM_080798chr101282 ------
NM_080799chr101282 ------
NM_080800chr101282 ------
NM_080801chr101282 ------
NM_080802chr101282 ------
NM_080803chr101282 ------
NM_080804chr101282 ------
NM_080805chr101282 ------
NM_080806chr101282 ------
NM_080807chr101282 ------
NM_080808chr101282 ------
NM_080809chr101282 ------
NM_080810chr101282 ------
NM_080811chr101282 ------
NM_080812chr101282 ------
NM_080813chr101282 ------
NM_080814chr101282 ------
NM_080815chr101282 ------
NM_080818chr131655 --1104 --
NM_080867chr1484869 4571 4249 4100 3913 1860 1526 1207 14513 21085 353 --
NM_080872chr832876 1031 316 23957 2793 11299 --
NM_080927chr353179 2481 2151 380 318 23250 234 12617 22649 918
NM_130391chr962680 2645 1065 525 439 356 31025 685 516 11373 --
NM_130392chr962680 2645 1065 525 439 356 31025 685 516 11373 --
NM_130393chr962680 2645 1065 525 439 356 31025 685 516 11373 --
NM_130436chr2142555 2267 922 620 1527 12420 12565
NM_130438chr2133132 2844 1197 11104 12997 13142
NM_130787chr191329 ------
NM_130810chr15127 ------
NM_130838chr152565 422 11475 11693 --
NM_130839chr152565 422 11475 11693 --
NM_130847chr11105783 5679 5254 5240 5172 4063 1463 1405 957 805 --15790 15847
NM_133170chr2097889 7739 7567 7198 6921 1934 1512 194 42 35105 2866 1319 17181 --
NM_133265chrX92961 2765 1127 734 721 554 426 260 240 ------
NM_133334chr4176406 6052 5382 5196 4740 4686 4576 4375 4264 4136 4075 2470 2440 2277 1949 603 25 26211 474 --1653
NM_133370chr4103671 2613 1459 1397 1354 745 647 439 418 262 13213 ----
NM_133372chr552335 2247 2066 670 659 12123 ----
NM_133378chr2----1364 1211
NM_133432chr2----1364 1211
NM_133433chr51584 2833 644 1736 --
NM_133437chr2----1364 1211
NM_133445chr943302 2748 1391 653 --23684 3486 --
NM_133468chr732599 1647 221 ------
NM_133473chr1961632 770 581 497 415 34 ----1333
NM_133474chr451700 1562 659 427 227 ------
NM_133493chr6124612 4558 4211 2985 1867 1506 1231 1063 730 698 661 80 12999 --13144
NM_133496chr163900 3783 3342 1399 1120 587 21294 53 ----
NM_133503chr12182 1540 ----
NM_133504chr12182 1540 ----
NM_133505chr12182 1540 ----
NM_133506chr12182 1540 ----
NM_133631chr341612 1142 383 172 ------
NM_133646chr265331 5237 4710 4309 3635 727 14819 25186 1617 --
NM_133647chr1553852 3774 3192 2961 122 1532 1628 12841
NM_134265chr1741112 406 320 129 21013 354 ----
NM_134428chr92325 49 ------
NM_134447chr19----1217 1522
NM_138270chrX52762 2583 2310 1042 532 22655 2457 12689 12319
NM_138286chr1983938 3290 2934 2816 1067 1020 450 263 1845 --13352
NM_138288chr1432214 1970 378 1391 ----
NM_138290chr7----2295 91 --
NM_138316chr1051255 1213 1134 481 441 ----1224
NM_138335chr42767 230 1849 1888 --
NM_138350chr11104 ------
NM_138410chr31575 ------
NM_138423chr1531959 1599 858 22043 38 12213 1183
NM_138426chr752397 887 557 353 268 ----21849 378
NM_138444chr1344903 4774 3103 1204 11906 11746 13437
NM_138459chr653663 3181 2435 1111 453 13582 12271 --
NM_138468chr21276 15977 12061 15837
NM_138473chr1253484 3457 3252 1149 525 12033 14905 --
NM_138565chr111929 11337 --1214
NM_138576chr1474702 4488 3968 3331 1526 1339 62 14531 --11191
NM_138621chr234017 3483 2831 24149 3964 22639 1313 32863 2845 2800
NM_138638chr1442353 2112 1934 318 --1192 --
NM_138689chr112221 185 ------
NM_138711chr3----1143 --
NM_138712chr3----1143 --
NM_138713chr16137284 6498 6274 3276 2917 2852 2416 2407 2275 2006 1057 993 160 ----15849
NM_138714chr16137284 6498 6274 3276 2917 2852 2416 2407 2275 2006 1057 993 160 ----15849
NM_138731chr1484160 3930 3476 3290 2898 871 836 720 11287 22853 389 --
NM_138766chr51493 ------
NM_138771chr721450 133 2594 464 11404 21327 212
NM_138779chr131210 ------
NM_138782chr522119 176 11678 11859 1721
NM_138786chr32308 84 ----1396
NM_138792chr15--138 ----
NM_138821chr51493 ------
NM_138822chr51493 ------
NM_138927chr21173 --1341 1871
NM_138931chr31222 ----163
NM_138959chr166172 5129 2254 2218 1715 1071 11513 24715 2037 26814 6449
NM_138980chr42596 495 ------
NM_138981chr42727 626 ------
NM_138982chr42596 495 ------
NM_139012chr622031 302 ----11517
NM_139035chrX3733 490 44 --2724 619 --
NM_139045chr91667 1601 1203 --
NM_139057chr1562571 2532 2070 1784 780 737 12587 1173 22807 936
NM_139058chrX1320 ------
NM_139072chr22888 770 --1706 --
NM_139076chr42541 65 21239 1023 ----
NM_139126chr67865 691 679 649 636 210 139 ------
NM_139168chr571731 1425 793 648 544 394 32 ------
NM_139182chr4--2499 331 1347 144
NM_139207chr1231632 553 460 21531 1500 ----
NM_139215chr172263 235 ------
NM_139246chr91847 --1726 1659
NM_139276chr1732330 2270 343 12379 12059 --
NM_139318chr141191 ------
NM_139319chr1241862 1848 1294 100 11494 ----
NM_139321chr2063761 3375 3240 3012 2587 1391 24128 4052 ----
NM_139323chr2041912 505 442 248 --1435 --
NM_144571chr486385 5616 5419 2742 2060 1445 643 159 22126 132 11288 1253
NM_144574chr141140 ----1395
NM_144578chr14124534 3567 3500 2221 1594 1515 1485 1342 770 541 335 264 14767 22198 1822 13988
NM_144591chr10--1140 2452 392 --
NM_144595chr136972 960 711 401 222 190 1784 ----
NM_144599chr1555080 4164 3763 1202 860 14879 15223 14755
NM_144600chr1661667 1576 1554 420 206 63 31430 683 669 ----
NM_144632chr231681 841 208 22216 1884 22245 758 --
NM_144642chr311404 ------
NM_144660chr10----1393 --
NM_144664chr1152464 2442 2350 1027 717 2660 614 --12531
NM_144689chr192526 241 --1648 --
NM_144767chr1554579 3959 3395 164 62 11618 --14488
NM_144778chr1341092 607 526 467 21814 63 1318 12518
NM_144949chr272182 2102 1597 910 586 341 145 11699 11665 --
NM_144967chrX11088 1981 ----
NM_144973chr1285257 5188 4637 4170 3664 3562 2076 481 31310 507 161 15173 --
NM_144979chr41651 --171 --
NM_144981chr11131 ------
NM_145025chr611123 11132 ----
NM_145036chr172266 44 ----182
NM_145049chr53992 401 109 --11054 --
NM_145055chr1833583 2574 1290 --23348 3141 1990
NM_145175chr211213 ----31379 1312 1288
NM_145243chr11173 ------
NM_145259chr287055 6531 5583 5280 1118 846 583 486 --22780 2765 --
NM_145284chrX52514 1982 617 241 35 --21022 772 --
NM_145306chr102506 472 ------
NM_145307chr1064519 3335 1814 1758 1720 510 --1643 --
NM_145313chr1041417 1404 1353 427 ------
NM_145649chr641068 929 262 229 12692 22755 360 --
NM_145655chr641068 929 262 229 12692 22755 360 --
NM_145690chr841957 1924 620 348 --168 --
NM_145693chr272583 2561 2517 2255 1028 1006 914 ----12278
NM_145698chr1021720 195 12180 1852 --
NM_145725chr14----1491 --
NM_145726chr14----1491 --
NM_145735chr1382775 2399 1059 900 688 494 349 72 12757 ----
NM_145753chr331660 593 518 ------
NM_145756chr1831416 1148 1044 --11275 --
NM_145805chr153579 569 114 ------
NM_145808chr752812 2751 1027 901 414 --13113 12833
NM_147156chr1011469 11381 1954 --
NM_147175chrX92046 1998 1928 1473 1436 790 669 593 269 12055 1168 --
NM_147189chr852183 1431 787 636 329 ------
NM_147223chr221608 401 2983 919 ----
NM_147233chr221425 218 2800 736 ----
NM_148174chr81568 11988 --12092
NM_148957chr1342628 2538 2512 562 ----1760
NM_148977chr1051255 1213 1134 481 441 ----1224
NM_148978chr1051255 1213 1134 481 441 ----1224
NM_152132chr14--123 180 --
NM_152284chr83944 758 107 --1834 --
NM_152300chr1731831 1419 771 --31709 497 22 --
NM_152323chr121152 ------
NM_152330chr1462497 2160 1892 1734 285 37 12149 1616 --
NM_152365chr1--1400 ----
NM_152375chr1--12543 ----
NM_152388chr293739 3291 2816 2748 1211 1170 1153 165 119 --13153 --
NM_152390chr25637 568 531 455 178 ------
NM_152392chr21102 ------
NM_152400chr421974 235 11909 31899 1596 547 --
NM_152407chr551210 949 696 260 124 23098 81 12362 --
NM_152408chr5----186 --
NM_152409chr583474 3328 2827 2726 2524 2375 1297 161 12561 ----
NM_152417chr841322 918 539 65 --1414 --
NM_152422chr9--21877 260 ----
NM_152423chrX2624 41 11029 1507 1491
NM_152424chrX74384 3721 3550 1811 1492 1473 1313 14416 23479 1745 1286
NM_152437chr1231763 980 410 12075 12359 --
NM_152493chr1--11319 11369 --
NM_152519chr231732 1366 803 11394 1124 --
NM_152536chr31859 ------
NM_152538chr36719 659 651 491 374 140 --11815 --
NM_152556chr741643 282 225 85 12159 11859 12322
NM_152564chr831786 1714 719 1415 ----
NM_152574chr91152 --1337 --
NM_152594chr1551918 1900 1782 712 602 12231 22133 2020 --
NM_152605chr1921390 443 ------
NM_152608chr131819 1648 406 --12314 22504 2465
NM_152622chr553268 3200 2812 2542 1327 --22931 1201 --
NM_152624chr5207398 7134 6633 5968 5952 5921 5199 4509 2945 2917 2420 2124 2077 1958 1856 1828 1684 773 379 314 27209 1365 26500 659 14517
NM_152629chr953981 3913 3614 3568 1574 1705 ----
NM_152636chr1162787 2249 2138 1006 710 90 --22212 766 --
NM_152641chr1262630 2527 1780 809 227 131 --157 32358 817 340
NM_152665chr12509 455 ----11142
NM_152676chr18121 ------
NM_152678chr33305 213 52 22410 147 ----
NM_152699chr33757 178 122 ------
NM_152716chr1131568 1269 1056 21647 1357 --11423
NM_152739chr721154 950 31016 791 212 1847 --
NM_152745chr721086 402 1911 --1863
NM_152756chr512746 ----14145
NM_152758chr842256 703 630 252 1512 ----
NM_152773chr3----163 --
NM_152774chr732442 2045 143 --2817 666 1739
NM_152787chrX12922 33765 3543 3507 13854 13368
NM_152792chr2133 ------
NM_152835chr162920 2237 1110 981 367 36 12765 11081 --
NM_152836chr841245 1218 319 305 --1271 --
NM_152837chr841245 1218 319 305 --1271 --
NM_152838chr2053488 2678 2239 1059 39 2545 187 23544 2433 --
NM_152878chr2221519 348 ------
NM_152896chr9----1807 --
NM_152905chr12176 ------
NM_152994chr22111 84 ----1242
NM_152999chr774907 4086 1604 902 716 680 642 1214 33825 3668 86 --
NM_153013chr562360 2104 2057 945 235 94 --1682 1845
NM_153020chr651693 1450 1356 1132 124 --21080 364 --
NM_153029chr1654050 3655 1213 331 193 --11136 --
NM_153035chr162097 1298 1220 1183 594 97 ----12037
NM_153038chr2------1785
NM_153042chr641465 1241 1188 476 2688 570 ----
NM_153184chr341719 584 300 44 21797 182 11546 31483 704 117
NM_153188chr585109 5067 4172 3803 1952 1866 1393 1210 25625 1083 34960 2067 1691 55620 5189 4521 3681 1145
NM_153201chr11--1193 ----
NM_153207chr1293191 2742 2536 1425 1297 1194 660 368 240 31138 1047 213 --11206
NM_153235chr622406 353 ------
NM_153261chr1651310 1049 613 595 493 21293 336 11231 --
NM_153262chr163181 3092 2599 710 159 62 1745 ----
NM_153267chr92155 79 ----2615 279
NM_153331chr34677 600 502 55 1452 ----
NM_153343chr472090 1919 1870 798 551 509 458 ------
NM_153353chr32156 42 ------
NM_153354chr55885 861 774 618 369 1829 ----
NM_153367chr1031155 1035 668 --23066 2987 13996
NM_153371chr1332265 1891 410 21715 839 1805 --
NM_153426chr42694 635 ------
NM_153427chr42694 635 ------
NM_153456chr1396242 5273 5007 4725 4322 4122 3965 2074 1806 --1405 --
NM_153464chr192788 150 ------
NM_153607chr552925 2793 2725 1123 321 31281 1194 794 --1983
NM_153616chr1532363 1848 1667 11734 22315 1777 --
NM_153617chr1532363 1848 1667 11734 22315 1777 --
NM_153618chr1532363 1848 1667 11734 22315 1777 --
NM_153619chr1563601 3086 2905 743 213 70 12972 23553 3015 12491
NM_153633chr122714 541 1745 ----
NM_153634chr1231087 448 294 11359 1334 --
NM_153686chr432136 1806 616 2720 339 ----
NM_153687chr122429 323 ----1310
NM_153689chr24920 799 321 250 12260 1444 --
NM_153712chr293528 3328 2721 1133 710 608 501 404 211 13475 ----
NM_153715chr731241 470 298 --21036 261 11231
NM_153809chr91577 ------
NM_153810chr10104563 4475 4387 4090 3867 3803 3484 3095 1475 1105 11666 23410 1374 --
NM_153812chr122342 1690 ------
NM_153836chr231796 554 371 --1471 --
NM_170607chr1721093 209 ------
NM_170665chr12104032 3829 3685 2848 1429 983 508 401 101 55 1765 14467 11162
NM_170674chr1511281 21296 574 11351 11172
NM_170675chr151957 2972 250 11027 1848
NM_170676chr151957 2972 250 11027 1848
NM_170677chr1511281 21296 574 11351 11172
NM_170692chr11315 ------
NM_170709chr8--12227 --22345 2199
NM_170710chr432103 1206 332 13075 --12447
NM_170725chr11160 --1742 --
NM_170731chr1152600 942 502 304 32 32831 2756 2329 ----
NM_170732chr1152600 942 502 304 32 32831 2756 2329 ----
NM_170733chr1152600 942 502 304 32 32831 2756 2329 ----
NM_170734chr1152600 942 502 304 32 32831 2756 2329 ----
NM_170735chr1152600 942 502 304 32 32831 2756 2329 ----
NM_170768chr1141560 1410 1355 555 ------
NM_170775chr5--169 ----
NM_172070chr262261 2126 2007 1934 668 549 12174 11741 21632 501
NM_172071chr185704 5377 4947 4552 2078 1808 1714 1176 15420 22868 1509 --
NM_172103chr662289 2171 1901 1886 642 512 22667 2198 22656 605 --
NM_172105chr662289 2171 1901 1886 642 512 22667 2198 22656 605 --
NM_172127chr441759 430 377 262 11943 1643 --
NM_172128chr441715 386 333 218 11899 1599 --
NM_172159chr351983 1788 669 459 149 21764 243 ----
NM_172160chr351983 1788 669 459 149 21764 243 ----
NM_172193chr1441328 1163 903 515 21307 1249 ----
NM_172230chr11------11048
NM_172315chr1511281 21296 574 11351 11172
NM_172316chr1511281 21296 574 11351 11172
NM_172375chr1421125 1067 --1794 --
NM_173075chr421770 1680 3472 250 210 1258 --
NM_173082chr671387 1295 1261 593 521 477 113 ------
NM_173157chr121533 ------
NM_173214chr16137284 6498 6274 3276 2917 2852 2416 2407 2275 2006 1057 993 160 ----15849
NM_173355chr2--1160 ----
NM_173468chr465943 5104 4316 809 695 617 25479 4122 25693 275 11968
NM_173469chr154489 421 345 244 2597 219 1379 --
NM_173470chrX72525 2431 2153 2069 386 99 49 1685 42686 2208 375 152 --
NM_173475chr1641719 1410 478 465 --1443 1151
NM_173478chr17----1868 --
NM_173491chr521182 246 11295 --160
NM_173495chrX22257 1990 --11658 12514
NM_173496chr1063007 2953 2710 438 360 129 1213 --11095
NM_173510chr2252701 2540 1983 1081 580 12931 12894 --
NM_173511chr263897 3180 2952 837 747 392 13581 ----
NM_173517chr71412 ----1402
NM_173519chr812074 21836 278 ----
NM_173552chr352426 1633 818 584 558 22417 499 21518 280 --
NM_173582chr1166241 4316 4120 2077 2047 263 34264 2034 619 21772 1580 --
NM_173591chr124989 981 973 917 --3957 241 94 1108
NM_173595chr1284798 4538 4038 4022 1785 1557 1208 476 1634 25263 3319 --
NM_173602chr1243810 3677 1486 1225 1389 13622 --
NM_173642chr1128769 8609 7826 7680 7572 7454 6914 6531 2394 929 288 242 49138 8906 6926 1822 38282 6120 3325 --
NM_173644chr2071885 1752 1609 550 440 234 41 11875 ----
NM_173645chr21474 ------
NM_173665chr53778 754 209 1608 ----
NM_173666chr531224 1144 516 1210 ----
NM_173694chrX51975 1764 1604 49 34 21751 213 ----
NM_173808chr163904 3671 3087 1429 473 351 --11489 --
NM_173822chr261960 1629 1612 1524 1503 92 11772 --1138
NM_173851chr842448 1215 199 53 11474 ----
NM_173854chr112305 ------
NM_174890chr102273 22 1153 1130 --
NM_174900chr4298 68 ------
NM_174911chr882982 2677 1572 1461 1258 1005 980 837 ------
NM_174916chr1542340 2176 1856 1687 ------
NM_175061chr7--12033 22014 305 --
NM_175085chr214589 505 466 227 ----1626
NM_175607chr341714 1352 687 26 --21515 87 --
NM_175612chr341714 1352 687 26 --21515 87 --
NM_175623chr1287501 7459 6896 4983 2667 936 782 469 17202 31165 687 166 11684
NM_175634chr841232 977 380 207 ------
NM_175635chr841232 977 380 207 ------
NM_175636chr841232 977 380 207 ------
NM_175736chr1257472 7455 7273 6339 195 57844 7145 7104 1648 836 11166 12725
NM_175839chr20--1261 ----
NM_175840chr20--1261 ----
NM_175841chr20--1261 ----
NM_175842chr20--1261 ----
NM_175854chr1321072 392 --22263 1967 11877
NM_175856chr53617 100 80 173 ----
NM_175876chr152755 2739 2041 1813 188 ----12014
NM_175907chr1842865 2489 2210 276 --12339 --
NM_175910chr19112390 2036 1650 1578 776 692 608 524 356 188 104 ------
NM_175921chr594244 3909 3788 3470 2915 1287 742 316 89 13133 ----
NM_176081chr1095842 5830 5772 5070 5037 3755 1978 1139 203 31898 849 180 16056 12268
NM_176083chr1095842 5830 5772 5070 5037 3755 1978 1139 203 31898 849 180 16056 12268
NM_176823chr1103745 3334 3163 3077 2798 2374 972 845 609 384 ------
NM_177424chr121499 408 --21982 334 1543
NM_177438chr14114167 4115 3452 3234 3082 2981 2844 1640 1173 1039 839 14032 21671 527 13715
NM_177538chr268615 3408 1993 1196 563 199 ------
NM_177553chr111127 --1941 --
NM_177947chrX61520 1432 1119 1103 353 132 ----1120
NM_177948chrX61520 1432 1119 1103 353 132 ----1120
NM_177968chr221626 1416 --11651 --
NM_177974chr1531959 1599 858 22043 38 12213 1183
NM_177985chr222302 467 1622 ----
NM_177990chr2031255 607 339 11999 --11481
NM_177995chr9--21877 260 ----
NM_178011chr1032578 1296 524 ----1321
NM_178120chr251323 1146 1137 1122 912 ------
NM_178123chr21780 ------
NM_178140chr522406 1914 ----11874
NM_178151chrX97741 6597 6373 2823 1902 1644 1587 1308 658 16912 11104 --
NM_178152chrX97741 6597 6373 2823 1902 1644 1587 1308 658 16912 11104 --
NM_178153chrX97741 6597 6373 2823 1902 1644 1587 1308 658 16912 11104 --
NM_178154chr14----1309 --
NM_178155chr14----1309 --
NM_178156chr14----1309 --
NM_178157chr14----1309 --
NM_178427chr1------11715
NM_178558chr751079 941 506 307 115 2906 435 ----
NM_178566chr961701 1418 1340 715 314 38 --11527 11902
NM_178581chr201283 ------
NM_178585chr463109 3070 2551 2391 2030 841 ----21170 424
NM_178586chr1421525 533 11790 --12362
NM_178812chr831378 1105 595 11162 159 --
NM_178864chr11----140 --
NM_180989chr1362481 2321 2272 1886 1652 785 ------
NM_181054chr1431283 334 252 --1956 --
NM_181077chr1562263 1876 1407 772 723 529 12315 ----
NM_181265chr432103 1206 332 13075 --12447
NM_181302chr141140 ----1395
NM_181308chr141140 ----1395
NM_181353chr20--1585 1616 --
NM_181354chr841648 1203 1059 361 ------
NM_181358chr1103947 3899 3045 2726 2702 1273 934 428 404 63 21624 1494 ----
NM_181361chr33928 389 237 --145 11402
NM_181427chr152130 44 ------
NM_181443chr2032369 2020 738 22848 2843 1925 --
NM_181481chr1897007 6604 6593 6281 5295 4645 1449 775 417 45474 4993 1890 1343 47052 5899 1564 1098 26401 5059
NM_181482chr1897007 6604 6593 6281 5295 4645 1449 775 417 45474 4993 1890 1343 47052 5899 1564 1098 26401 5059
NM_181483chr1897007 6604 6593 6281 5295 4645 1449 775 417 45474 4993 1890 1343 47052 5899 1564 1098 26401 5059
NM_181504chr543740 3637 721 461 11454 22771 902 --
NM_181521chr1686567 4862 2685 2641 2463 1448 1368 1174 27262 4616 15949 --
NM_181523chr543740 3637 721 461 11454 22771 902 --
NM_181524chr543740 3637 721 461 11454 22771 902 --
NM_181656chr17----134 --
NM_181659chr2053154 2595 920 843 212 ----1992
NM_181659chr2053154 2595 920 843 212 ----1992
NM_181670chr1231332 960 385 --21300 1283 --
NM_181672chrX41560 1384 825 380 22004 1909 ----
NM_181673chrX41560 1384 825 380 22004 1909 ----
NM_181705chr565586 2269 1762 1427 1121 102 24748 3616 25345 891 11789
NM_181711chr12----1648 --
NM_181713chr21275 ------
NM_181714chr631354 1333 38 ------
NM_181723chr852274 2115 2093 679 452 1923 22109 891 --
NM_181741chr231241 134 65 ------
NM_181742chr231241 134 65 ------
NM_181762chrX31059 117 47 2291 204 ----
NM_181777chrX31059 117 47 2291 204 ----
NM_181782chr642280 2242 2011 635 --32218 518 334 --
NM_181836chr582585 1978 1807 1676 511 84 69 42 ------
NM_181838chr51985 11383 --1185
NM_181839chr831287 571 477 1502 11268 11004
NM_181847chr1251682 1340 1266 546 308 ------
NM_181861chr1242155 1965 365 264 12675 2494 349 --
NM_181868chr1242155 1965 365 264 12675 2494 349 --
NM_181869chr1242240 2050 450 349 12760 2579 434 --
NM_181886chr451328 1269 1079 348 58 --1900 --
NM_181887chr451328 1269 1079 348 58 --1900 --
NM_181888chr451328 1269 1079 348 58 --1900 --
NM_181889chr451328 1269 1079 348 58 --1900 --
NM_181890chr451328 1269 1079 348 58 --1900 --
NM_181891chr451328 1269 1079 348 58 --1900 --
NM_181892chr451375 1316 1126 395 105 --1947 --
NM_181893chr451328 1269 1079 348 58 --1900 --
NM_181897chr32515 80 42314 2262 1044 604 ----
NM_182485chr4103663 3621 3113 3053 2717 1404 890 455 71 57 --23739 2948 --
NM_182492chr22--1298 ----
NM_182493chr1665347 5228 4972 4543 3866 3690 21095 440 35335 3929 1694 --
NM_182503chr694449 3897 3699 2079 1894 1573 1269 861 617 --199 --
NM_182511chr1861445 1248 1051 338 300 179 ------
NM_182515chr19115657 5462 2315 2136 1249 760 571 487 403 236 155 21683 1180 36025 5823 2483 1321
NM_182551chr253307 2975 1320 584 160 22624 2179 2377 201 13344
NM_182569chr17------1188
NM_182641chr1741494 620 401 235 ----11819
NM_182646chr4103663 3621 3113 3053 2717 1404 890 455 71 57 --23739 2948 --
NM_182659chrY1184 ------
NM_182700chr741605 1474 1422 534 --11798 --
NM_182715chr741205 1071 467 112 1386 3952 786 337 --
NM_182734chr2032763 2306 988 12540 13059 1844
NM_182758chr15112863 2782 2752 1296 969 623 415 318 230 189 168 174 --23938 903
NM_182763chr131985 1793 1724 2458 374 ----
NM_182765chr1042090 602 501 56 12329 ----
NM_182767chr121768 --22089 1578 --
NM_182898chr766467 6269 2290 1739 1176 452 --16190 --
NM_182899chr766467 6269 2290 1739 1176 452 --16190 --
NM_182931chr73540 249 177 --1689 1262
NM_182943chr311169 11161 ----
NM_182948chr163127 2880 2815 2680 1978 1106 23113 2038 22861 411 --
NM_182972chr192546 2197 2148 1733 1014 895 736 607 404 12416 ----
NM_183004chr1463560 3005 2738 785 137 37 13477 1413 1932
NM_183043chr132734 220 --126 --
NM_183044chr132734 220 --126 --
NM_183050chr632289 2065 60 12318 11741 --
NM_183078chr693829 3789 3269 2952 2656 2349 1260 1067 223 --23638 1189 11479
NM_183227chr64554 445 296 136 --3633 346 328 --
NM_183353chrX2906 478 ------
NM_183380chr6192 1280 --1621
NM_184234chr202823 103 ------
NM_194247chr253702 1713 1520 1464 326 ------
NM_194285chr1183365 2528 2327 1228 1037 711 596 316 --1129 --
NM_194291chr842003 1926 468 147 1296 2209 61 --
NM_194292chr121122 138 21403 1315 11458 --
NM_194301chr1441066 916 354 187 --1908 --
NM_194314chr1105495 5205 5097 4891 4549 4160 3964 2093 1842 1636 15614 ----
NM_194317chr242614 2303 2094 979 ----12738
NM_194318chr1362543 2456 756 625 291 72 --32154 1877 448 1542
NM_194434chr1895667 5010 4348 2170 1672 1638 1103 367 22 22149 1661 25396 1534 --
NM_194449chr18------1387
NM_194452chr111248 ------
NM_194453chr111248 ------
NM_194454chr731213 1172 677 ----11136
NM_194455chr731213 1172 677 ----11136
NM_194456chr731213 1172 677 ----11136
NM_194463chrX3787 427 108 ----11216
NM_197941chr552853 2506 2303 631 267 1470 ----
NM_198057chrX21091 1051 ------
NM_198120chr82520 98 ------
NM_198123chr831179 618 289 ------
NM_198124chr831179 618 289 ------
NM_198128chr1812312 1351 --21434 820
NM_198150chr51982 ----2608 565
NM_198158chr372965 2446 912 791 699 532 486 22941 215 ----
NM_198159chr372965 2446 912 791 699 532 486 22941 215 ----
NM_198173chr11506 ----1667
NM_198174chr11506 ----1667
NM_198177chr372965 2446 912 791 699 532 486 22941 215 ----
NM_198178chr372965 2446 912 791 699 532 486 22941 215 ----
NM_198181chr1572771 2730 2683 2647 1897 782 507 --12938 12505
NM_198186chr91618 ------
NM_198187chr91618 ------
NM_198188chr91357 ------
NM_198195chr3----1704 --
NM_198204chr1721093 209 ------
NM_198205chr1721093 209 ------
NM_198212chr732201 1783 413 1581 1539 --
NM_198268chr1103947 3899 3045 2726 2702 1273 934 428 404 63 21624 1494 ----
NM_198269chr1103947 3899 3045 2726 2702 1273 934 428 404 63 21624 1494 ----
NM_198270chrX43233 2897 2564 699 --13097 --
NM_198271chr31328 1374 1777 --
NM_198273chr552981 2324 2175 2006 851 --1835 --
NM_198281chr483380 3234 2641 2431 2387 1154 640 392 22194 311 43435 2520 2106 868 1462
NM_198391chr2041139 1128 348 273 2255 122 ----
NM_198401chr831101 510 194 1134 ----
NM_198404chr131132 ----1241
NM_198467chr71448 1590 ----
NM_198485chr321779 230 12377 32361 1626 250 --
NM_198513chr811735 ----22005 384
NM_198549chr132678 2426 511 1151 22247 578 --
NM_198581chr2127542 7287 5953 2629 2547 2218 1902 1887 1705 792 732 57 67239 6250 5969 5010 607 250 27498 2516 1614
NM_198595chr444980 3824 1284 688 24713 178 14245 --
NM_198715chr1116018 5811 5634 5553 4379 4072 1225 872 531 405 62 25667 1963 15216 15038
NM_198793chr321064 578 23264 753 ----
NM_198794chr1431158 430 116 ------
NM_198889chr421014 1004 1306 ----
NM_198896chr1182136 2124 1992 1790 1555 1544 687 82 1536 ----
NM_198900chr1257472 7455 7273 6339 195 57844 7145 7104 1648 836 11166 12725
NM_198903chr52629 205 --1153 --
NM_198904chr542146 1955 629 205 --1153 --
NM_198935chr2072787 2714 2498 1289 1040 214 147 22294 227 ----
NM_198956chr741605 1474 1422 534 --11798 --
NM_198965chr12283 33 ----197
NM_198966chr12283 33 ----197
NM_198989chr132507 381 --1534 --
NM_198990chr773337 3160 3149 2975 2123 311 33 ------
NM_198992chr1241325 859 338 148 1346 1394 --
NM_199003chr841438 1404 1154 950 --158 1434
NM_199039chr421086 849 ------
NM_199072chr743174 2859 2428 992 1125 11030 --
NM_199144chr2031590 1357 1338 ----1156
NM_199168chr101203 11516 ----
NM_199188chr1232749 191 64 --23074 1400 --
NM_199189chr52950 81 1104 ----
NM_199190chr1232749 191 64 --23074 1400 --
NM_199203chr2031590 1357 1338 ----1156
NM_199229chr251395 706 435 98 64 --2650 226 --
NM_199244chr931024 912 192 ------
NM_199324chr483735 3375 3192 2841 2723 2393 1084 139 23158 1036 22747 2452 --
NM_199342chr11288 ------
NM_199421chr1484869 4571 4249 4100 3913 1860 1526 1207 14513 21085 353 --
NM_199436chr242728 2059 882 437 12374 22244 318 11251
NM_199437chr1162351 1603 816 646 614 288 12503 42191 1902 993 333 --
NM_199438chr1162351 1603 816 646 614 288 12503 42191 1902 993 333 --
NM_199439chr1162351 1603 816 646 614 288 12503 42191 1902 993 333 --
NM_199454chr174074 3661 3062 1722 1623 1496 692 --13829 24719 636
NM_199461chr1052793 2590 1317 796 473 1303 1773 --
NM_199462chr174960 4548 3268 1878 1654 1291 501 25030 3079 24885 4063 --
NM_199482chr261690 1558 1470 580 125 25 21934 52 12091 --
NM_201263chr142107 2006 1347 593 1800 2646 295 --
NM_201434chr171575 1740 ----
NM_201438chr121330 ------
NM_201570chr1051412 1269 545 237 134 21657 554 --1775
NM_201571chr1051412 1269 545 237 134 21657 554 --1775
NM_201572chr1051412 1269 545 237 134 21657 554 --1775
NM_201590chr1051412 1269 545 237 134 21657 554 --1775
NM_201591chr411386 1533 --11318
NM_201592chr411386 1533 --11318
NM_201593chr1051412 1269 545 237 134 21657 554 --1775
NM_201596chr1051412 1269 545 237 134 21657 554 --1775
NM_201597chr1051412 1269 545 237 134 21657 554 --1775
NM_201624chr121210 275 ----1945
NM_201632chr511850 11826 ----
NM_201634chr511949 11925 ----
NM_201647chr21569 153 ----
NM_203282chr1951474 1369 1160 319 218 1527 11535 --
NM_203283chr41233 ----1395
NM_203284chr41233 ----1395
NM_203327chr2054159 3550 3331 871 148 --14468 23285 1141
NM_203349chr1551699 1579 1444 385 266 11719 ----
NM_203350chr111204 --1432 11705
NM_203372chr241689 518 507 266 31602 1411 418 11716 --
NM_203390chr821740 480 --2681 219 --
NM_203403chr941247 439 425 145 --11108 --
NM_203406chr531138 877 676 --22738 663 12358
NM_203416chr121488 2566 388 ----
NM_203434chr911214 1266 ----
NM_203437chr21174 1732 ----
NM_203446chr2173014 2891 2770 2673 2412 1923 972 193 12442 --
NM_203459chr142063 1610 1036 753 12569 32578 2563 1666 --
NM_203473chrX1308 ------
NM_203474chrX1308 ------
NM_203475chrX1308 ------
NM_203476chrX1308 ------
NM_203486chr191207 ------
NM_203487chr1331265 475 437 --11318 --
NM_203488chr141284 ------
NM_203499chr17------1316
NM_203504chr4102598 2391 2325 2154 2067 1804 961 600 367 349 22521 859 ----
NM_203505chr4102598 2391 2325 2154 2067 1804 961 600 367 349 22521 859 ----
NM_205768chr161638 1550 690 643 578 491 21607 697 12031 1704
NM_205860chr153187 2678 1198 835 137 43099 1950 1929 1231 13118 --
NM_206594chr131389 945 628 --43573 3516 2418 640 33565 2452 2253
NM_206595chr131389 945 628 --43573 3516 2418 640 33565 2452 2253
NM_206853chr653560 2637 686 618 218 23799 3677 2597 240 1500
NM_206854chr694821 3898 3496 1947 1879 1479 1008 660 208 35060 4938 3680 31858 1501 155 11761
NM_206855chr695786 4863 4461 4151 2444 1973 1625 1173 426 36025 5903 4645 22466 1120 --
NM_206866chr2153061 2563 2384 1283 1097 12066 197 --
NM_206876chr283075 3031 2769 2701 2191 1120 1065 752 1183 12386 11210
NM_206907chr553157 2634 2480 2452 2433 12784 --1996
NM_206909chr898240 7945 6794 5901 5167 2972 2513 1082 974 35355 1629 134 48058 7627 6109 2455 --
NM_206927chr111304 --1839 --
NM_206928chr111304 --1839 --
NM_206929chr111304 --1839 --
NM_206930chr111304 --1839 --
NM_206933chr162726 2709 887 848 403 87 12660 ----
NM_206937chr131950 ----1814
NM_207012chr1042962 2535 1163 1122 1610 11076 --
NM_207113chr74655 212 196 148 ----11213
NM_207123chr42900 219 1274 ----
NM_207189chr1------1107
NM_207292chr352913 2403 886 714 142 33365 3029 2220 12245 2962 86
NM_207293chr352913 2403 886 714 142 33365 3029 2220 12245 2962 86
NM_207294chr352913 2403 886 714 142 33365 3029 2220 12245 2962 86
NM_207295chr352913 2403 886 714 142 33365 3029 2220 12245 2962 86
NM_207296chr352913 2403 886 714 142 33365 3029 2220 12245 2962 86
NM_207297chr352938 2428 911 739 167 33390 3054 2245 12270 2987 111
NM_207303chr1041540 1476 1249 33 22903 1364 24166 273 --
NM_207304chr134979 494 413 354 11701 1205 12405
NM_207361chr1386181 6171 5879 1841 1673 1507 716 355 12157 ----
NM_207362chr2172 ------
NM_207366chr711582 1116 ----
NM_207481chr21459 11353 178 --
NM_207517chr1531944 634 24 31932 1891 1599 ----
NM_207645chr1151309 1234 1173 1094 183 ------
NM_207647chr942566 859 172 102 --31921 1595 599 --
NM_212471chr1751970 819 734 227 130 ----1413
NM_212472chr1751970 819 734 227 130 ----1413
NM_212539chr31304 ------
NM_212554chr1021350 224 ------
NM_213589chr275030 4157 2139 2001 1594 834 729 35511 4805 4414 11818 --
NM_213590chr1355260 3563 3458 3351 2068 --33602 1455 256 2736 295
NM_213594chr1231328 841 386 21022 472 1994 --
NM_213622chr21569 153 ----
NM_213648chr511850 11826 ----
NM_213654chr31396 1342 1348 --
NM_213662chr1732424 2364 437 12473 12153 --