TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-144-5p
miRNA Sequence: GGAUAUCAUCAUAUACUGUAAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1585603 4956 4938 918 890 598 554 349 26259 564 24131 486 2860 671
NM_000332chr656804 5533 4704 1296 687 25865 757 21563 1404 12168
NM_000337chr585288 2616 2574 1552 1119 831 389 258 14909 11763 15373
NM_000618chr1266589 6041 5921 4976 4099 1330 15056 --12098
NM_000618chr1266589 6041 5921 4976 4099 1330 15056 --12098
NM_000813chr564052 1974 1526 985 309 64 15436 35318 1486 623 --
NM_000899chr12114380 4290 3952 3878 3573 3075 3045 863 614 586 292 ------
NM_000950chrX73643 3583 3475 2798 2687 551 241 1402 22739 1002 13145
NM_001001396chr154123 3180 2792 1259 1160 ----24287 4197
NM_001001419chr555006 4813 4094 3632 3376 24029 101 --24022 1363
NM_001001420chr555006 4813 4094 3632 3376 24029 101 --24022 1363
NM_001001668chr1973805 2953 1663 1579 1519 1497 1015 --33792 3705 1245 13085
NM_001003652chr1867834 7244 3375 2763 1722 1472 28354 1627 28487 246 17317
NM_001008925chr4103506 3498 3256 1197 1118 682 444 285 222 55 --1245 --
NM_001009554chr464697 4573 3248 3059 1186 323 14300 21659 589 21337 565
NM_001009554chr464697 4573 3248 3059 1186 323 14300 21659 589 21337 565
NM_001010853chr653181 2336 839 435 223 12503 --22585 210
NM_001013620chr12128409 8264 8048 7550 7307 7150 7046 6928 6649 6374 1649 241 --27625 485 --
NM_001014797chr1076200 5228 3178 1525 1417 602 188 25489 5469 26225 1649 12003
NM_001015877chrX23087 2269 12776 11132 22493 198
NM_001018065chr976027 5178 4400 4121 3804 2204 599 --54932 4055 3970 2099 1138 11720
NM_001018066chr976027 5178 4400 4121 3804 2204 599 --54932 4055 3970 2099 1138 11720
NM_001024956chr1185743 5332 4739 4401 1981 1201 868 469 24085 682 21635 1548 1115
NM_001039580chr494706 4579 4276 4015 3463 3240 1923 733 467 45063 4054 3838 1667 13199 --
NM_001039590chrX53024 2665 1230 566 550 11243 --1612
NM_001039591chrX53024 2665 1230 566 550 11243 --1612
NM_001039840chrX95732 4948 4660 4531 4356 3817 1027 812 592 14710 21916 1073 --
NM_001040284chr16105725 4573 4541 4043 3873 1856 1213 778 409 81 15856 1532 11739
NM_001042355chr1664061 4045 4039 1752 894 103 --35209 2031 289 11182
NM_001042412chr1664061 4045 4039 1752 894 103 --35209 2031 289 11182
NM_001042555chr1294354 3643 3564 3383 3346 3318 1913 873 687 ----1664
NM_001042599chr277421 6323 2209 2157 1442 1256 427 13116 14868 14968
NM_001412chrX73725 3549 2817 2776 2581 412 137 --13342 1529
NM_001432chr463831 3601 3231 3223 2842 445 23863 3299 1218 23125 466
NM_001616chr273263 3181 2880 2773 1347 1208 105 11238 11200 --
NM_001695chr873824 3762 3391 2816 2804 427 299 ----2592 293
NM_001918chr1129106 8306 8050 7627 7264 6691 3541 2902 2199 969 780 248 28427 2798 13486 --
NM_002006chr465012 4943 4326 2240 1448 712 1985 11607 25028 4492
NM_002025chrX119213 6844 6611 6315 3414 2942 2658 1540 1463 1037 229 11017 19230 --
NM_002270chr585654 5399 4998 4970 3932 1221 1180 956 --35482 2243 1142 --
NM_003108chr2107221 6738 6438 5974 5249 4974 1329 1244 539 172 --2671 161 14817
NM_003615chr3113793 3237 3150 2900 2702 2596 2560 1191 1061 635 502 --23896 3845 12751
NM_003800chr631996 695 104 ----3893 835 689
NM_003909chr853001 777 698 362 105 12906 11113 1455
NM_003948chr452253 2164 1928 1891 281 1593 31732 660 76 --
NM_003994chr12114380 4290 3952 3878 3573 3075 3045 863 614 586 292 ------
NM_004171chr1199592 8086 7904 3551 1076 937 879 762 64 --26057 1234 --
NM_004272chr592023 1809 1748 1382 1272 710 609 479 402 ----1305
NM_004504chr263086 3037 2693 2683 1969 1095 1219 12492 11082
NM_004775chr1852190 2110 787 777 350 --21990 1606 11503
NM_004788chr1122280 431 1776 --32574 2456 408
NM_004866chr52873 110 --34911 693 570 11411
NM_004956chr774347 4040 3457 2998 1347 1039 374 ----11418
NM_005065chr1454305 3799 3586 3553 1121 24738 4644 24281 3356 11417
NM_005160chr2296574 5469 5404 5312 5304 2391 2166 529 500 12191 11360 2514 292
NM_005235chr277421 6323 2209 2157 1442 1256 427 13116 14868 14968
NM_005359chr1896340 5205 5066 4853 4536 2137 1063 1048 1029 --25420 1092 25803 4527
NM_005497chr1766013 5086 4700 977 839 748 --15913 15010
NM_005901chr1867834 7244 3375 2763 1722 1472 28354 1627 28487 246 17317
NM_005903chr555006 4813 4094 3632 3376 24029 101 --24022 1363
NM_005909chr544276 4270 4137 3806 --64236 3635 1693 1550 1536 668 --
NM_005941chr842615 1383 1212 1140 ----22820 2715
NM_006095chr444378 3768 2830 698 12783 3410 387 257 1892
NM_006203chr555587 5339 4870 2051 566 15598 35560 4721 2015 14052
NM_006306chrX84034 2071 1923 1635 1253 392 161 65 --12049 1963
NM_006393chr1074349 4229 3880 1609 1176 739 108 13594 44177 3558 1157 595 --
NM_006599chr16108220 8137 8072 6415 5931 5387 2111 1985 838 43 --33245 1516 769 25811 2249
NM_006620chr674328 3824 3654 3070 3043 1265 100 34506 3303 602 1427 13398
NM_006629chr1832395 963 743 --12256 11011
NM_006654chr1294354 3643 3564 3383 3346 3318 1913 873 687 ----1664
NM_006750chr1687803 6764 5128 3138 2918 1395 1369 190 11284 27466 5683 17423
NM_006918chr1185743 5332 4739 4401 1981 1201 868 469 24085 682 21635 1548 1115
NM_007007chr12134812 4767 4347 4226 1671 1076 1054 843 732 664 464 438 289 ----1641
NM_007038chr21105817 4946 4561 2399 1751 1440 1004 948 532 408 --23825 932 24508 340
NM_007114chr353280 2910 2775 2055 2044 ----21266 924
NM_007195chr183889 335 96 13352 12409 1839
NM_012158chr1361522 1273 1170 721 586 77 21310 575 1112 --
NM_012262chr165226 5147 4426 1507 849 809 --35276 4980 3413 15103
NM_012287chr333347 485 108 14173 24298 2997 11609
NM_013255chr7137715 6193 6086 2660 2443 1214 1123 1064 1023 707 686 540 223 48592 6773 5456 725 1556 --
NM_014021chr163494 3046 897 888 871 592 11294 22170 911 --
NM_014155chr1197337 6491 5682 5394 3001 2981 2731 1144 484 --15121 --
NM_014243chr411483 1747 --21672 1519
NM_014331chr497495 7397 6205 6145 5547 2185 1171 794 398 ----17703
NM_014423chr585450 5067 3914 1193 1115 1031 675 593 25545 1908 45083 2146 1977 536 --
NM_014702chr632411 891 480 11334 23011 643 12622
NM_015026chr1253219 1618 491 352 325 11516 14066 --
NM_015247chr1664061 4045 4039 1752 894 103 --35209 2031 289 11182
NM_015310chr8128292 8222 8204 8056 7421 6735 6051 5578 2014 1668 1655 1081 17278 2973 875 --
NM_015393chr463082 1539 1238 931 706 120 --23785 3685 23793 3487
NM_015550chr753497 3072 2667 1396 1083 13025 --23236 2201
NM_015879chr1898257 7114 6561 1885 1456 1211 829 602 126 21901 1781 17965 23235 2060
NM_015886chr865655 5647 5576 608 407 228 --1558 11871
NM_015888chr153212 2629 2400 2087 1015 23329 117 12787 11350
NM_016206chr3108687 8335 8141 6684 6313 5651 2319 1997 1386 553 25799 1529 1766 28992 5684
NM_016248chr1362987 2888 2882 2672 2622 1595 --23220 407 13122
NM_016260chr286911 5178 5020 4849 1803 1504 1043 416 12287 36437 1606 346 --
NM_017658chr1453776 3386 3233 809 661 23903 1184 2964 632 13301
NM_017769chr1472581 2277 2113 939 905 228 129 1515 22509 1065 --
NM_017799chr1421556 610 --21966 535 21297 393
NM_018084chr232943 2928 831 ----33203 1002 672
NM_018085chr186826 6584 5290 2686 1943 1547 924 421 11404 45491 2280 1563 800 --
NM_018440chr887765 7266 6852 3105 3067 2702 2552 2039 1693 --16528
NM_018638chr1265586 5294 4997 4409 2197 505 1246 24737 4022 1172
NM_018717chr452515 2347 2181 1122 366 12240 21167 1158 12683
NM_019022chr1852851 2027 1210 869 358 23017 2392 23183 2750 12294
NM_020205chr153341 3045 2923 1239 1219 ----23221 1229
NM_020297chr1252328 945 909 627 193 42674 1151 691 167 12819 --
NM_020432chr741721 786 629 217 --2792 251 1844
NM_020734chr1242628 2543 2201 2052 --12804 12476
NM_020772chr1756364 5630 3003 1766 1376 27928 3170 48546 5861 5442 1907 18496
NM_020844chr887438 7321 6444 5073 1817 1760 1033 62 24669 2768 --11077
NM_020940chr1032961 1825 1785 11819 1327 11872
NM_020951chr1982209 2087 1517 747 732 683 277 167 --22016 367 --
NM_020964chr1833282 2945 871 21852 150 11701 11912
NM_021629chr3104706 4692 3974 3906 3496 1412 1266 1170 1041 32 --2662 478 --
NM_021647chr464697 4573 3248 3059 1186 323 14300 21659 589 21337 565
NM_021911chr564052 1974 1526 985 309 64 15436 35318 1486 623 --
NM_021964chr3126607 5022 4926 2629 2074 1562 1057 990 942 759 530 126 24405 787 35484 4754 4585 --
NM_024408chr163743 2315 1336 630 599 180 --12528 23317 3076
NM_024646chr173882 3660 3442 1184 611 463 81 ----23709 3502
NM_024743chr451278 1159 1056 446 254 ----1273
NM_024947chr389120 8642 7243 2690 1590 1560 890 305 22298 1698 1259 --
NM_024989chr2107990 6909 5835 5548 5282 5064 1415 971 775 313 16042 11945 --
NM_030762chr1221867 1243 --41816 1525 1481 665 11938
NM_030816chr163668 2457 2381 1291 827 183 --12387 12941
NM_032012chr955248 5083 4614 1612 579 1984 14759 14624
NM_032228chr1131241 432 135 11164 13045 22404 537
NM_032446chr533698 3569 2901 --23641 2419 33370 2717 2577
NM_032458chrX53417 2599 251 76 54 13106 --22823 528
NM_032968chrX73486 3002 2801 2794 2759 1524 276 --33144 2710 1612 14099
NM_032969chrX73486 3002 2801 2794 2759 1524 276 --33144 2710 1612 14099
NM_032973chrY83482 3442 2997 2796 2789 2754 1524 276 --33139 2705 1611 14091
NM_033505chr2116519 6086 6029 5482 4754 4124 2611 1354 1186 1179 1047 --45698 4878 2410 1467 14952
NM_033656chr2174616 4365 3648 3630 2189 2045 1569 23798 1891 12245 11461
NM_053016chr987518 6000 5476 5442 5409 1560 877 300 --27786 7590 12851
NM_080867chr1454730 4248 1812 1761 199 11769 31311 1225 485 --
NM_080872chr853675 3598 1443 1390 368 1719 21297 1121 1438
NM_138333chr94931 528 376 138 --32512 2287 2097 11848
NM_138713chr16108220 8137 8072 6415 5931 5387 2111 1985 838 43 --33245 1516 769 25811 2249
NM_138714chr16108220 8137 8072 6415 5931 5387 2111 1985 838 43 --33245 1516 769 25811 2249
NM_144571chr4126943 5414 5180 4704 4628 4282 1898 1321 987 797 537 423 --22705 1468 35505 1767 165
NM_144632chr222380 2024 --1813 21762 1626
NM_144973chr1284929 4758 4157 4092 4004 3829 2045 617 1415 --15264
NM_145259chr222061 1197 34822 2152 1178 56780 6019 2343 1362 825 --
NM_145320chr753497 3072 2667 1396 1083 13025 --23236 2201
NM_145321chr753497 3072 2667 1396 1083 13025 --23236 2201
NM_145322chr753497 3072 2667 1396 1083 13025 --23236 2201
NM_152519chr2--1251 11731 21484 271
NM_152624chr587321 6927 6626 6527 5424 2224 1874 914 1443 21590 1330 1867
NM_153188chr585654 5399 4998 4970 3932 1221 1180 956 --35482 2243 1142 --
NM_153456chr1366308 6185 5793 4010 1533 433 --11518 26357 212
NM_173214chr16108220 8137 8072 6415 5931 5387 2111 1985 838 43 --33245 1516 769 25811 2249
NM_173468chr455535 4681 2319 1178 333 14489 1685 25949 3932
NM_175861chr1275934 5440 4406 4182 960 641 290 34788 4566 858 45261 4706 4668 4376 15025
NM_181787chr84807 646 442 379 --23058 198 11494
NM_182493chr1675314 5158 4406 4074 3299 3258 98 --15227 14586
NM_182503chr675405 4689 4448 3420 2248 1201 978 13441 34759 3755 3387 13483
NM_182762chr754424 1933 1927 1863 410 16155 11055 13889
NM_194314chr185549 5211 5173 4452 2059 962 585 522 --15647 1286
NM_198581chr286237 2806 2242 2006 808 747 370 164 17326 16876 --
NM_199421chr1454730 4248 1812 1761 199 11769 31311 1225 485 --
NM_203459chr11518 21687 302 --21919 268
NM_206855chr686283 6124 5194 4825 4342 3908 2145 610 --31972 953 581 16096
NM_206909chr8128292 8222 8204 8056 7421 6735 6051 5578 2014 1668 1655 1081 17278 2973 875 --