TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-1469
miRNA Sequence: CUCGGCGCGGGGCGCGGGCUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000076chr11165 ------
NM_000125chr614141 ------
NM_000147chr1130 ------
NM_000161chr14132 ----1420
NM_000208chr1924069 3899 ------
NM_000217chr121724 ------
NM_000238chr7149 ------
NM_000278chr1022243 279 1538 12123 1382
NM_000332chr61405 --1319 --
NM_000362chr22143 ------
NM_000461chr323383 3130 ------
NM_000618chr12--1521 ----
NM_000618chr12--1521 ----
NM_000756chr8181 ------
NM_000824chr4--1337 ----
NM_000833chr16--11094 ----
NM_000841chr62856 58 ------
NM_000875chr15--15714 1628 --
NM_000885chr21867 ------
NM_000918chr172779 25 1109 ----
NM_000944chr4--11570 ----
NM_001001323chr12--1127 ----
NM_001001549chr722234 555 12157 ----
NM_001001550chr722234 555 12157 ----
NM_001001555chr722234 555 12157 ----
NM_001001557chr81101 ------
NM_001003406chr2223237 2535 --11042 --
NM_001003407chr1025020 429 --23133 1358 --
NM_001003408chr1025020 429 --23133 1358 --
NM_001003652chr1823230 393 ------
NM_001003698chr6----1211 --
NM_001003699chr6----1211 --
NM_001003800chr912664 --11339 --
NM_001004051chrX123 ------
NM_001005271chr17165 ------
NM_001005273chr17165 ------
NM_001005291chr17------173
NM_001005611chrX----1459 --
NM_001006617chr93987 268 176 ------
NM_001006619chr93987 268 176 ------
NM_001006620chr93987 268 176 ------
NM_001006621chr93987 268 176 ------
NM_001007237chr112219 ------
NM_001007533chr17160 ------
NM_001008392chr311007 ------
NM_001008407chr72479 181 ------
NM_001009955chr1123 ------
NM_001009955chr1123 ------
NM_001009993chr21159 ------
NM_001010938chr31189 ------
NM_001010971chr11778 ------
NM_001011537chr322250 448 ------
NM_001011724chr13--1318 ----
NM_001011725chr13--1318 ----
NM_001012446chr92277 55 ------
NM_001012614chr42690 145 ------
NM_001012643chr19----1477 --
NM_001012977chrX1951 ------
NM_001013031chr1033136 930 590 ------
NM_001013635chr1211109 ------
NM_001014283chr1341384 423 300 86 1372 11443 --
NM_001015053chr1721109 94 ------
NM_001015877chrX------12910
NM_001017405chr42677 650 ------
NM_001017999chr12192 115 ------
NM_001017999chr12192 115 ------
NM_001018000chr12192 115 ------
NM_001018000chr12192 115 ------
NM_001018001chr12192 115 ------
NM_001018005chr15138 ------
NM_001018111chr72315 62 ------
NM_001020658chr1135 ------
NM_001020658chr1135 ------
NM_001023567chr151978 ------
NM_001023587chr3----171 --
NM_001024808chr12--11785 ----
NM_001024948chr112287 1970 ----
NM_001025076chr1014890 ------
NM_001025077chr1016248 ------
NM_001025105chr511176 ------
NM_001025108chr21587 ------
NM_001025266chr323054 39 ------
NM_001029863chr611031 ------
NM_001030007chr16--13535 ----
NM_001031690chr7----1284 --
NM_001031804chr1611344 --23189 710 --
NM_001031812chr512164 ------
NM_001032296chr1331955 1161 87 ------
NM_001033057chr31530 ------
NM_001033117chr331194 155 21 ------
NM_001033518chr742396 407 383 163 ------
NM_001033519chr742396 407 383 163 ------
NM_001033520chr742396 407 383 163 ------
NM_001034025chr121130 ------
NM_001034837chr51732 ------
NM_001034838chr51732 ------
NM_001035254chr941930 1692 1665 311 ------
NM_001035260chr10--170 ----
NM_001037131chr221011 822 ------
NM_001037174chr21646 ------
NM_001037582chr4--1503 ----
NM_001038493chr23589 473 49 ------
NM_001038640chr151785 ------
NM_001039538chr212660 ------
NM_001039618chr11----14380 --
NM_001039762chr1012279 ------
NM_001040101chr41160 ------
NM_001040110chr71429 ------
NM_001040113chr161748 ------
NM_001040134chr191501 11417 ----
NM_001040152chr71815 ------
NM_001040214chr61929 ------
NM_001042506chrX1951 ------
NM_001042555chr1213139 ------
NM_001042573chr174766 591 361 76 --1443 12228
NM_001042681chr1----12273 --
NM_001042682chr1----12273 --
NM_001042682chr1----12273 --
NM_001042749chrX1247 ------
NM_001042750chrX1247 ------
NM_001042751chrX1247 ------
NM_001043318chr141240 --1369 --
NM_001044722chr512164 ------
NM_001044723chr512164 ------
NM_001065chr123205 182 166 ------
NM_001080418chr1----167 --
NM_001126chr11855 ------
NM_001128chr16--13535 ----
NM_001163chr9--11026 1960 --
NM_001189chr41916 --158 --
NM_001273chr122210 31 ------
NM_001290chr4--1387 ----
NM_001328chr42690 145 ------
NM_001329chr1011321 ----1190
NM_001346chr31634 ------
NM_001364chr1113017 ------
NM_001389chr211503 ------
NM_001391chr18123 ------
NM_001396chr2111917 ------
NM_001494chr101120 ------
NM_001495chr81246 1131 ----
NM_001500chr62130 68 ------
NM_001508chr21645 ------
NM_001542chr112219 ------
NM_001543chr531217 318 61 --13106 --
NM_001670chr22183 ------
NM_001681chr121746 ------
NM_001707chr7166 ------
NM_001759chr1223245 1696 ------
NM_001773chr111243 ------
NM_001797chr16--1286 ----
NM_001844chr121331 ------
NM_001892chr511176 ------
NM_001931chr111169 ------
NM_001965chr22202 31 ------
NM_001980chr121178 ------
NM_002006chr4--1760 ----
NM_002149chr22305 48 ------
NM_002193chr211258 ----11298
NM_002221chr122856 1017 ------
NM_002226chr143853 838 285 ------
NM_002264chr323233 1252 ------
NM_002265chr171190 --1350 --
NM_002267chr131364 ------
NM_002285chr21587 ------
NM_002313chr1025020 429 --23133 1358 --
NM_002374chr212660 ------
NM_002382chr14--11281 ----
NM_002397chr5197 ------
NM_002442chr121317 ------
NM_002501chr1923428 1135 ------
NM_002515chr1411954 ------
NM_002537chr152974 263 ------
NM_002579chr191501 11417 ----
NM_002585chr1--182 ----
NM_002588chr511290 ------
NM_002595chr12----11739 --
NM_002607chr721099 423 ------
NM_002628chr31319 ------
NM_002636chr6176 ------
NM_002653chr52256 109 --1371 --
NM_002698chr19--12783 ----
NM_002716chr1113660 ------
NM_002748chr15--1467 ----
NM_002833chr15161 190 ----
NM_002892chr14--11208 ----
NM_002911chr1921077 494 --1484 --
NM_002941chr31332 ------
NM_002942chr3----11264 --
NM_002945chr171659 ------
NM_002955chr6----1211 --
NM_002960chr1123 ------
NM_002972chr221207 ------
NM_003011chr9--11501 ----
NM_003021chr1911015 ------
NM_003024chr21--1261 ----
NM_003081chr201424 ------
NM_003106chr321003 214 ------
NM_003107chr632157 2127 611 ------
NM_003108chr246966 2653 2023 446 12928 12785 --
NM_003110chr171321 ------
NM_003178chr32796 96 ------
NM_003185chr2021160 539 ------
NM_003203chr2----1465 --
NM_003253chr21175 ------
NM_003275chr9--11520 ----
NM_003298chr314619 1504 ----
NM_003315chr17--1177 ----
NM_003325chr22155 ------
NM_003345chr16--1168 ----
NM_003371chr92797 273 ------
NM_003404chr201105 ------
NM_003412chr321921 615 ------
NM_003413chrX1658 ------
NM_003468chr2----13118 --
NM_003482chr1212534 ------
NM_003576chr1331955 1161 87 ------
NM_003603chr41112 ------
NM_003620chr17----167 --
NM_003644chr1735137 298 71 ----1672
NM_003671chr911254 13099 ----
NM_003673chr171419 ------
NM_003701chr131930 ------
NM_003704chr41482 ------
NM_003735chr511290 ------
NM_003736chr511290 ------
NM_003750chr101691 ------
NM_003766chr171522 ------
NM_003779chr11114 ------
NM_003827chr192426 107 ------
NM_003873chr101486 ------
NM_003876chr171266 ------
NM_003913chr6------1449
NM_003924chr41167 ------
NM_003936chr211219 ------
NM_003987chr1022243 279 1538 12123 1382
NM_003988chr1032320 356 24 1615 12200 1459
NM_003989chr1022179 215 1474 12059 1318
NM_003990chr1022179 215 1474 12059 1318
NM_004055chr111305 ------
NM_004093chr1343045 1024 252 151 ------
NM_004176chr17------173
NM_004227chr731189 975 163 ------
NM_004302chr12----1564 --
NM_004309chr171921 ------
NM_004321chr263301 3075 2891 2545 2499 2195 ------
NM_004326chr11915 --123 --
NM_004359chr192338 23 ------
NM_004384chr512164 ------
NM_004393chr322249 345 ------
NM_004472chr51262 ------
NM_004474chr11909 ------
NM_004571chr211313 ------
NM_004596chr191177 ------
NM_004630chr111781 164 ----
NM_004685chr1312732 ------
NM_004739chr111196 ------
NM_004745chr826772 66 199 ----
NM_004762chr1741708 1469 507 82 --1799 --
NM_004783chr161508 ------
NM_004831chr19199 ------
NM_004840chrX--159 ----
NM_004860chr17183 ------
NM_004862chr16133 ------
NM_004869chr1811424 ------
NM_004973chr611661 ------
NM_004985chr12----14377 --
NM_004998chr151373 ------
NM_005011chr71429 ------
NM_005078chr151419 ------
NM_005116chr2031726 1284 514 ------
NM_005121chr17--13739 ----
NM_005124chr6----1346 --
NM_005234chr191341 ------
NM_005245chr42124 65 ------
NM_005281chr11760 ------
NM_005311chr722234 555 12157 ----
NM_005316chr111778 ------
NM_005318chr2211244 ------
NM_005324chr17--11959 ----
NM_005354chr191243 ------
NM_005378chr21610 ------
NM_005386chr20177 ------
NM_005397chr72315 62 ------
NM_005440chr1723276 947 ------
NM_005461chr2021683 220 ------
NM_005474chr1721109 94 ------
NM_005503chr1511112 ------
NM_005507chr111429 ------
NM_005574chr111295 ------
NM_005575chr5--1610 ----
NM_005598chr111277 ------
NM_005599chr121558 69 ------
NM_005613chr1--12006 ----
NM_005627chr61254 ------
NM_005715chr632742 1844 767 ------
NM_005730chr1233451 871 158 ------
NM_005736chr102246 138 ------
NM_005737chr21673 ------
NM_005781chr31189 ------
NM_005808chr311007 ------
NM_005842chr131156 ------
NM_005852chr17165 ------
NM_005882chr42677 650 ------
NM_005901chr1823230 393 ------
NM_005909chr5--1105 ----
NM_005920chr112483 --2626 365 --
NM_005923chr6198 ------
NM_005924chr71360 ------
NM_005933chr11--162 ----
NM_005934chr1951926 517 473 350 32 12421 1497 --
NM_005937chr17----1720 --
NM_005964chr171349 ------
NM_006022chr13--1878 ----
NM_006034chr1131871 1814 50 ------
NM_006037chr234127 3255 232 1340 ----
NM_006095chr41128 ------
NM_006160chr1731227 434 318 --21194 99 1493
NM_006224chr17----11565 --
NM_006312chr12182 ------
NM_006361chr1721751 1605 ------
NM_006372chr6174 ------
NM_006387chr193789 223 40 --125 --
NM_006393chr1023651 1493 ------
NM_006489chr1411954 ------
NM_006494chr191596 ------
NM_006526chr201331 ------
NM_006540chr81542 ------
NM_006547chr7----176 --
NM_006548chr31150 ------
NM_006549chr1232684 196 33 ------
NM_006561chr1014890 ------
NM_006603chrX1247 ------
NM_006654chr1213139 ------
NM_006698chr2011026 ------
NM_006717chr912766 ------
NM_006720chr1025020 429 --23133 1358 --
NM_006734chr611077 ------
NM_006749chr8176 ------
NM_006761chr17--1553 ----
NM_006827chr14--13050 ----
NM_006832chr141949 ------
NM_006861chr1231762 262 94 ------
NM_006885chr161365 --13809 --
NM_006908chr7----1349 --
NM_006927chr163558 233 169 ------
NM_006936chr212989 70 ------
NM_006943chr201687 ------
NM_006950chrX2816 782 ------
NM_007039chr1411510 1151 1927 --
NM_007042chr3------1246
NM_007084chr13165 ------
NM_007129chr131825 ------
NM_007182chr3154 ------
NM_007249chr1313386 ------
NM_007260chr11300 ------
NM_007374chr14--1342 ----
NM_007375chr1----1809 --
NM_012082chr81674 ------
NM_012097chr21646 ------
NM_012102chr1----12273 --
NM_012154chr81567 ------
NM_012155chr19164 ------
NM_012164chr932729 38 22 ------
NM_012237chr19128 ------
NM_012307chr181845 ------
NM_012308chr1112105 --1521 --
NM_012396chr11146 ------
NM_012402chr1111051 ------
NM_012425chr1012329 1764 ----
NM_013230chrY1519 ------
NM_013261chr41607 ------
NM_013309chr1512224 ------
NM_013353chr1130 ------
NM_013433chr19266 36 --12004 --
NM_013438chr91654 ------
NM_013449chr1251932 1037 998 945 715 ----1489
NM_014071chr201335 ------
NM_014112chr822085 1979 ------
NM_014155chr1117183 ------
NM_014225chr191378 ------
NM_014240chr333681 2988 796 ------
NM_014253chrX2976 287 ------
NM_014299chr191626 ------
NM_014368chr9159 --11739 --
NM_014392chr41160 ------
NM_014417chr192878 776 ------
NM_014470chr121187 ------
NM_014520chr171110 ------
NM_014554chr121852 ------
NM_014572chr131115 ------
NM_014577chr221177 ------
NM_014592chr51732 ------
NM_014661chr1013377 ------
NM_014665chr833407 3056 1289 22805 1090 33129 2841 1258 --
NM_014667chr322326 2061 ------
NM_014676chr1135 ------
NM_014690chr7----1284 --
NM_014729chr812200 ------
NM_014743chr4--12224 ----
NM_014764chr12124 ------
NM_014767chr1013238 11245 1233 --
NM_014779chr31180 ------
NM_014810chr1126 ------
NM_014835chr2021472 191 --11651 --
NM_014850chr331194 155 21 ------
NM_014867chr813841 ------
NM_014872chr9127 ------
NM_014912chr101636 1807 ----
NM_014914chr221011 822 ------
NM_014916chr72609 270 ------
NM_014974chr1011486 ------
NM_014982chr141227 ------
NM_014990chr141144 ------
NM_015024chr81192 ------
NM_015069chr161138 ------
NM_015080chr112698 649 ------
NM_015094chr2244045 1089 754 518 23453 1132 ----
NM_015125chr19----1568 --
NM_015155chr1023186 34 ------
NM_015162chr152467 397 ------
NM_015208chr181298 ------
NM_015209chr12192 115 ------
NM_015213chr111237 ------
NM_015216chr511037 ------
NM_015229chr1721130 185 1777 1849 --
NM_015250chr91410 ------
NM_015265chr2--1729 ----
NM_015268chr3--129 ----
NM_015318chr1931570 273 143 --11712 --
NM_015483chr721054 1010 ------
NM_015503chr161236 --168 --
NM_015520chr32706 194 --1310 1214
NM_015542chr1011251 ------
NM_015548chr61254 ------
NM_015549chr141587 ------
NM_015575chr2141 ------
NM_015589chr14127 ------
NM_015610chr742396 407 383 163 ------
NM_015872chr1----1608 --
NM_015912chr8--1358 ----
NM_015980chr521558 218 ------
NM_015981chr521253 34 ------
NM_016003chr742396 407 383 163 ------
NM_016235chr16--194 ----
NM_016269chr41175 ------
NM_016422chr1113080 ------
NM_016436chr2012652 ------
NM_016530chr15--12504 ----
NM_016547chr14686 631 181 49 1466 1474 --
NM_016592chr2011005 --1483 --
NM_016605chr51303 ------
NM_016620chr11444 ------
NM_016621chr1133340 3285 406 ------
NM_017456chr1741708 1469 507 82 --1799 --
NM_017540chr511996 --12448 --
NM_017596chr124594 1517 ------
NM_017637chr917493 ----11116
NM_017715chr71207 1488 ----
NM_017763chr171173 ------
NM_017778chr81405 ------
NM_017799chr14----11321 --
NM_017966chr1141411 273 120 68 ------
NM_018014chr2140 ------
NM_018028chr192327 189 ------
NM_018070chr1123 ------
NM_018071chr14--198 ----
NM_018198chr121373 1133 1410 11183 --
NM_018223chr123884 288 221 ------
NM_018416chr12--1159 ----
NM_018419chr20169 ------
NM_018482chr8--12476 ----
NM_018489chr11777 ------
NM_018667chr1632022 1044 152 ------
NM_018689chr15--12577 ----
NM_018700chr5187 ------
NM_018715chr1----12135 --
NM_018717chr4--12495 1519 --
NM_018890chr7----1349 --
NM_018912chr511290 ------
NM_018913chr511290 ------
NM_018914chr511290 ------
NM_018915chr511290 ------
NM_018916chr511290 ------
NM_018917chr511290 ------
NM_018918chr511290 ------
NM_018919chr511290 ------
NM_018920chr511290 ------
NM_018921chr511290 ------
NM_018922chr511290 ------
NM_018923chr511290 ------
NM_018924chr511290 ------
NM_018925chr511290 ------
NM_018926chr511290 ------
NM_018927chr511290 ------
NM_018928chr511290 ------
NM_018929chr511290 ------
NM_018945chr6--1207 ----
NM_018951chr7142 --1405 --
NM_019114chr912278 ------
NM_019594chr931541 557 481 ------
NM_019884chr191412 ------
NM_020182chr2013266 ------
NM_020310chr172906 269 ----12077
NM_020336chr2013812 ------
NM_020404chr11137 ------
NM_020449chrX181 1741 ----
NM_020463chr2--11173 ----
NM_020647chr8169 ------
NM_020692chr141102 ------
NM_020693chr112532 37 ------
NM_020699chr113475 ------
NM_020718chr161182 15551 ----
NM_020734chr12--12166 ----
NM_020753chr17--133 ----
NM_020761chr1751842 460 398 79 65 1308 11917 --
NM_020764chr1621338 29 11142 ----
NM_020766chrX13764 ------
NM_020807chr162172 44 ------
NM_020814chr22540 359 ------
NM_020820chr2021065 71 ------
NM_020830chr222527 80 ------
NM_020871chrX11674 ------
NM_020899chr1712423 ------
NM_020917chr191621 ------
NM_020920chr141305 ------
NM_020956chr1994318 4074 1822 1744 1666 763 708 675 654 11854 ----
NM_020993chr12--11785 ----
NM_021044chr12188 ------
NM_021069chr41112 ------
NM_021096chr2223237 2535 --11042 --
NM_021132chr101488 ------
NM_021168chr1631573 480 80 --1122 --
NM_021200chr1121184 330 ------
NM_021242chrX1364 ------
NM_021637chrX----1410 --
NM_021907chr2----160 --
NM_022073chr1411611 ------
NM_022753chr12161 91 ------
NM_022802chr1011321 ----1190
NM_022844chr161748 ------
NM_022898chr141805 ------
NM_023000chr14--11208 ----
NM_023001chr14--11208 ----
NM_023076chr1632468 2217 313 ------
NM_024007chr512556 ------
NM_024016chr172673 61 ------
NM_024052chr1731051 595 58 ------
NM_024085chr21992 ------
NM_024117chr93987 268 176 ------
NM_024320chr171161 ------
NM_024551chr1212285 ------
NM_024551chr1212285 ------
NM_024676chr121083 221 --1375 --
NM_024704chr20--147 ----
NM_024742chr16122 --1762 --
NM_024761chr92601 431 ------
NM_024949chr41435 --1403 --
NM_024953chr121757 ------
NM_025073chr114498 ------
NM_025080chr1121104 929 ------
NM_025140chr12126 ----1225
NM_025179chr11205 ------
NM_025245chr19278 29 ------
NM_025248chr1732560 1242 723 ------
NM_030581chr16151 ------
NM_030593chr19128 ------
NM_030648chr41417 ------
NM_030661chr721359 1178 ------
NM_030761chr12802 241 1148 123 --
NM_030808chr171219 ------
NM_030912chr10124 --1278 --
NM_030984chr7159 ------
NM_031216chr18193 ------
NM_031434chr74182 136 58 27 ------
NM_031439chr81171 ------
NM_031442chrX----1385 --
NM_031445chr21150 ------
NM_031459chr111675 ------
NM_031475chr12259 116 ------
NM_031845chr212660 ------
NM_031847chr212660 ------
NM_032017chr121889 371 --11641 --
NM_032042chr53340 323 233 12663 ----
NM_032088chr511290 ------
NM_032092chr511290 ------
NM_032102chr111182 ------
NM_032153chr312757 --1680 --
NM_032186chr11444 ------
NM_032193chr11----11386 --
NM_032199chr10--11074 ----
NM_032207chr1941238 1089 805 255 ------
NM_032211chr10132 ------
NM_032288chr322250 448 ------
NM_032289chr51454 ------
NM_032295chr7----182 --
NM_032329chr252778 1411 593 493 130 ------
NM_032403chr511290 ------
NM_032432chr42612 32 --21354 40 --
NM_032458chrX12190 ----13240
NM_032536chr91462 ------
NM_032595chr172487 267 ------
NM_032638chr31178 ------
NM_032682chr31963 --11310 --
NM_032687chr8--139 ----
NM_032808chr1521007 660 ------
NM_032826chr72745 87 ------
NM_032837chr1742141 1974 852 41 ------
NM_032859chr1313669 ------
NM_032900chr1013550 ------
NM_032978chr18123 ------
NM_032979chr18123 ------
NM_032981chr18123 ------
NM_033012chr131930 ------
NM_033023chr721075 399 ------
NM_033132chr132328 76 ------
NM_033147chr2----160 --
NM_033148chr2----160 --
NM_033150chr121331 ------
NM_033201chr16--1227 ----
NM_033259chr31131 ------
NM_033326chr111393 ------
NM_033331chr911254 13099 ----
NM_033360chr12----14498 --
NM_033420chr193921 107 77 ------
NM_033428chr911873 ----11613
NM_052898chr811434 ------
NM_052900chr811470 ------
NM_052905chr2--11237 ----
NM_052918chr1033335 1129 789 ------
NM_052934chr11680 ------
NM_053056chr1121964 1049 12742 12348 --
NM_057175chr4--11688 ----
NM_058172chr411281 ------
NM_058175chr212551 192 ------
NM_058243chr193881 615 263 ------
NM_080599chr1011251 ------
NM_080616chr201282 ------
NM_080647chr222329 54 --1438 --
NM_080669chr1711527 ------
NM_080865chr31708 ------
NM_130436chr2111917 ------
NM_130438chr2112494 ------
NM_130811chr201424 ------
NM_130901chr151120 ------
NM_133499chrX2886 852 ------
NM_133631chr31332 ------
NM_134421chr22305 48 ------
NM_138316chr101326 ------
NM_138426chr7------12421
NM_138437chrX123 ------
NM_138473chr121915 ------
NM_138559chr2130 ------
NM_138576chr141805 ------
NM_138732chr112698 649 ------
NM_138734chr112698 649 ------
NM_138795chr111209 ------
NM_139159chr193288 217 121 ------
NM_139167chr81216 ------
NM_139244chr61351 ------
NM_139286chr9130 ------
NM_139323chr201105 ------
NM_144498chr2021472 191 --11651 --
NM_144583chr211741 ------
NM_144982chr121604 ------
NM_145065chr111288 ------
NM_145068chr17244 34 ------
NM_145112chr14--11281 ----
NM_145159chr143853 838 285 ------
NM_145206chr10----189 --
NM_145716chr1123 ------
NM_145735chr131159 ------
NM_145805chr15--1548 ----
NM_147156chr1011000 ------
NM_147223chr2--11863 ----
NM_148977chr101326 ------
NM_148978chr101326 ------
NM_152253chr2253760 3362 3328 2886 170 --11628 --
NM_152271chr81416 ------
NM_152280chr122647 1332 ------
NM_152326chr14122 ------
NM_152344chr17148 ------
NM_152379chr1--1161 ----
NM_152380chr111190 ------
NM_152493chr111300 ------
NM_152556chr71927 ------
NM_152572chr9123 ------
NM_152624chr512084 ------
NM_152666chr11167 ------
NM_152724chr1012329 1764 ----
NM_152748chr7--1129 ----
NM_152769chr192861 47 ------
NM_152793chr72855 317 ------
NM_152857chr61232 ------
NM_152858chr61232 ------
NM_152910chr13------1222
NM_152991chr111514 ------
NM_153035chr12202 124 ------
NM_153334chr22147 ------
NM_153367chr101898 ------
NM_153498chr10----1209 --
NM_153499chr1232782 294 131 ------
NM_153500chr1232782 294 131 ------
NM_153631chr721359 1178 ------
NM_153632chr721359 1178 ------
NM_153715chr7142 --1405 --
NM_153832chr1173 ------
NM_170665chr1214581 ------
NM_170711chr193643 188 112 ----1841
NM_170712chr3154 ------
NM_170713chr3154 ------
NM_170714chr3154 ------
NM_171825chr521253 34 ------
NM_171999chr182150 129 ------
NM_172057chr7149 ------
NM_172071chr117214 ------
NM_172216chr1232684 196 33 ------
NM_172226chr1232782 294 131 ------
NM_173156chr11147 ------
NM_173201chr16----1223 --
NM_173359chr311215 189 ----
NM_173468chr425874 311 ------
NM_173475chr1611586 ------
NM_173557chr182741 113 ------
NM_173576chr10--1396 ----
NM_173595chr1221004 27 --15090 --
NM_173642chr117809 ----16717
NM_173698chrX133 ------
NM_174937chr102224 48 ------
NM_175747chr62996 60 ------
NM_175768chr6198 ------
NM_175876chr11662 ------
NM_175898chr1531333 627 164 --1129 --
NM_175920chr5--1610 ----
NM_176812chr201296 ------
NM_177424chr1125 ------
NM_177985chr21646 ------
NM_177999chr943229 3110 2718 436 ------
NM_178009chr13------1185
NM_178557chr441203 626 455 435 ------
NM_178568chr1711460 11768 ----
NM_178569chr51225 ------
NM_178835chr41125 ------
NM_181672chrX--11759 11459 --
NM_181673chrX--11759 11459 --
NM_181689chr20177 ------
NM_181784chr2------1420
NM_181805chr201661 ------
NM_182488chr131363 ------
NM_182717chr10--1286 ----
NM_182720chr10--1286 ----
NM_182721chr10--1286 ----
NM_182722chr10--1286 ----
NM_182723chr10--1286 ----
NM_182853chr10--1286 ----
NM_182895chr22147 ------
NM_182970chr2033994 3549 670 ------
NM_182972chr11288 ------
NM_183011chr10--1286 ----
NM_183012chr10--1286 ----
NM_183013chr10--1286 ----
NM_183360chr2----160 --
NM_183361chr2----160 --
NM_183380chr61254 ------
NM_183422chr13--1878 ----
NM_194247chr2----1606 --
NM_194259chr16--1168 ----
NM_194260chr16--1168 ----
NM_194261chr16--1168 ----
NM_194272chr15152 ------
NM_194278chr141240 --1369 --
NM_194285chr1112660 ------
NM_197941chr511987 ------
NM_198123chr811470 ------
NM_198124chr811470 ------
NM_198321chr511996 --12448 --
NM_198829chr7----1349 --
NM_199129chr201415 ------
NM_199131chr101568 ------
NM_199160chr9----11680 --
NM_199169chr2013266 ------
NM_199170chr2013266 ------
NM_199171chr2013266 ------
NM_199461chr102311 290 1194 ----
NM_201269chr11444 ------
NM_201432chr1735137 298 71 ----1672
NM_201433chr1735137 298 71 ----1672
NM_201568chr11147 ------
NM_201569chr11147 ------
NM_203305chr941930 1692 1665 311 ------
NM_203327chr2031726 1284 514 ------
NM_203394chr121320 --1229 --
NM_203434chr93900 371 334 --2381 95 1406
NM_207113chr7----1231 --
NM_207372chr10------1340
NM_207406chr422124 1110 1879 ----
NM_207442chr141297 ------
NM_207645chr112218 156 ------