TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-146a-3p
miRNA Sequence: CCUCUGAAAUUCAGUUCUUCAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr561664 1489 1476 831 555 123 1388 11447 --
NM_000084chrX66233 5977 5436 4863 4759 2366 12412 15687 22400 649
NM_000092chr243514 3370 1351 1153 ----21514 719
NM_000104chr262224 2102 1922 948 550 28 --1445 148
NM_000112chr5115225 4682 4674 4485 4190 3951 3537 1638 1340 1001 213 --15543 14144
NM_000168chr783307 3196 3111 2448 2388 2311 2162 335 1817 22666 615 --
NM_000208chr1974491 4133 4109 4029 3594 1303 1272 ----24233 117
NM_000321chr1311698 ----21664 1336
NM_000332chr6116602 5896 4501 2704 2445 2277 1874 1776 1058 235 136 --36336 544 487 25527 2412
NM_000337chr586290 5194 4512 2600 2291 2182 344 55 15842 ----
NM_000390chrX113356 2787 2627 2485 2353 2302 928 898 562 370 54 --13423 --
NM_000448chr1153143 2476 1112 1065 722 --43176 852 837 675 13134
NM_000489chrX53401 2993 2175 1174 416 13325 33251 1152 761 --
NM_000555chrX177694 7422 7251 7234 6862 6245 5274 3049 2143 2034 1878 1844 1093 993 978 903 21 15973 ----
NM_000633chr1884200 4087 3721 3554 3407 1677 638 180 24071 3768 --13971
NM_000719chr1276541 5889 5206 2384 1676 1586 64 36388 5549 4993 26621 5250 15651
NM_000813chr554460 2238 2092 989 288 1963 21780 1001 1644
NM_000859chr521304 566 1266 11179 2698 152
NM_000885chr262141 1772 1685 1641 873 616 ----1466
NM_000899chr1274152 3709 3578 2894 387 277 162 23137 2670 ----
NM_000912chr863363 3004 2827 1396 925 691 12905 21345 390 23262 123
NM_000959chr1123924 3868 3758 3311 3298 3264 3085 2648 1414 1372 142 102 23442 912 11598 1751
NM_001001419chr553963 3643 3383 2098 242 ----21704 55
NM_001001420chr553963 3643 3383 2098 242 ----21704 55
NM_001001664chr283852 3455 3053 2741 1622 1580 951 147 --1564 --
NM_001001928chr22167522 6929 5875 5853 5843 5527 5187 5168 5150 3080 2938 2380 1742 1656 302 112 36914 6584 3219 18326 27603 2590
NM_001002257chr253434 3382 3327 2392 1327 32233 2198 649 ----
NM_001002838chrX71450 1421 429 272 121 51 39 11282 ----
NM_001002860chr1451489 863 768 661 639 12994 13112 24321 545
NM_001003652chr18117468 7344 7220 7084 6906 6075 5903 5672 1929 1284 515 ----1983
NM_001004065chr943281 1405 1174 461 33705 1013 376 33941 2718 909 --
NM_001004317chr674275 3937 3405 1368 942 523 515 1981 13441 23834 198
NM_001005473chr575482 5271 4677 2463 1641 1531 1227 --25226 702 15816
NM_001007097chr964629 4205 3233 1190 912 826 13479 53852 3726 3493 1378 515 14570
NM_001007278chr1385206 4852 4666 4488 4365 4314 2061 67 147 ----
NM_001009554chr453964 3937 3782 204 40 1554 1255 14339
NM_001009554chr453964 3937 3782 204 40 1554 1255 14339
NM_001009899chr395713 5475 5259 5134 4658 4163 3985 2319 566 25662 4464 ----
NM_001010867chr1145901 5026 5018 4106 2613 2396 2383 1941 1902 1252 1031 648 481 174 16598 26048 842 26290 4051
NM_001010891chr554989 4752 2207 731 452 16833 16060 16275
NM_001010895chr931736 1489 679 1671 --2141 90
NM_001011537chr372335 1845 1783 882 548 355 327 1469 --1650
NM_001011666chr775871 5637 4636 4050 2257 1072 75 --14184 --
NM_001012393chr1195154 4850 4768 4464 4448 3650 1972 1759 1597 --24841 4178 13386
NM_001012420chr1582592 2407 2386 1930 1075 913 885 397 --1536 --
NM_001012423chr1572592 2407 1930 1075 913 885 397 --1536 --
NM_001012755chrX84733 4474 4314 3574 1939 1715 1110 235 --2890 527 --
NM_001012761chr552630 2433 2317 1963 609 --22470 2103 12143
NM_001014797chr10197620 7540 7396 7184 6833 6789 6269 5875 5690 5449 5402 5379 3069 2299 2243 2019 1715 1423 1069 26006 111 17275 --
NM_001015877chrX62738 2730 2280 1095 945 789 --22583 328 --
NM_001018065chr9105918 4979 4866 4574 4148 2335 1330 1265 582 328 12085 16043 --
NM_001018066chr9105918 4979 4866 4574 4148 2335 1330 1265 582 328 12085 16043 --
NM_001018067chr194988 4976 4392 3565 3280 1831 1439 383 210 ----1250
NM_001018068chr194988 4976 4392 3565 3280 1831 1439 383 210 ----1250
NM_001018069chr194988 4976 4392 3565 3280 1831 1439 383 210 ----1250
NM_001025077chr1096291 5165 5095 4618 2377 2212 1892 671 484 11289 --1700
NM_001025580chrX113762 3006 2846 1685 1359 1343 1222 1194 927 521 209 ----11231
NM_001030055chr1484360 4057 3769 1524 1419 1283 816 489 --23485 66 --
NM_001031804chr1674004 3917 3630 3536 3022 2683 1116 14446 1532 --
NM_001032394chr672496 2436 2226 720 405 282 75 22689 440 ----
NM_001032395chr662363 2303 2093 587 272 149 22556 307 ----
NM_001033045chr2104456 4235 3778 3748 3001 2931 2867 2828 2812 723 ------
NM_001034841chr1655007 4205 3829 3638 364 1655 1528 1305
NM_001034954chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_001034955chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_001034956chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_001034957chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_001037334chr1862435 2405 2314 2188 1943 722 --32002 272 78 --
NM_001037535chrX61390 1371 1158 558 364 23 --21031 565 --
NM_001037536chrX61390 1371 1158 558 364 23 --21031 565 --
NM_001037540chrX61390 1371 1158 558 364 23 --21031 565 --
NM_001039580chr475004 4926 4753 3421 3262 409 88 21468 1337 31910 1401 1158 --
NM_001039585chr1124181 4125 4015 3568 3555 3521 3342 2905 1671 1629 399 359 23699 1169 --11008
NM_001039590chrX63924 3395 3260 1601 1253 745 ----13918
NM_001039591chrX63924 3395 3260 1601 1253 745 ----13918
NM_001039618chr1175762 5264 4797 4166 2333 1460 518 1862 2705 101 --
NM_001039840chrX95804 5351 5316 4361 1215 1020 1010 750 428 14061 ----
NM_001040284chr1675535 5064 3836 2078 379 103 85 --21884 1515 13866
NM_001040429chr1353590 3272 3029 2193 1237 ----32961 872 182
NM_001042355chr16125075 4948 4588 4537 4503 3742 3417 2021 1509 1094 914 125 22005 475 14086 15353
NM_001042412chr16125075 4948 4588 4537 4503 3742 3417 2021 1509 1094 914 125 22005 475 14086 15353
NM_001042599chr276488 5181 2520 1846 1771 974 171 --45455 2498 2474 996 22540 1881
NM_001042603chr1265123 4807 4220 1065 926 365 --12022 24826 120
NM_001044385chr264035 2576 1368 919 717 312 1853 13002 23798 1351
NM_001046chr542326 2073 905 842 22555 1032 --12722
NM_001100108chr1117587 7384 7312 7194 7101 3000 2700 2543 2049 545 83 16560 67024 5881 2679 2384 857 475 23136 1344
NM_001106chr3149606 8488 8362 8168 6948 6716 6537 6422 6042 3691 2950 2256 1904 1735 18353 1699 11031
NM_001167chrX52622 2605 902 390 343 14711 32511 477 180 --
NM_001173chr1484360 4057 3769 1524 1419 1283 816 489 --23485 66 --
NM_001201chr473865 3824 2623 1308 1096 280 132 1291 ----
NM_001204chr2146332 6294 6275 6268 6130 5952 5347 5312 4892 2986 2839 1627 1408 1099 --16575 --
NM_001227chr1041154 506 109 84 ----1176
NM_001256chr1762915 2535 2470 2285 1810 1059 --11868 1782
NM_001259chr786389 6368 4594 4450 2414 1840 1746 736 --15844 15054
NM_001331chr1112848 ----22397 479
NM_001356chrX42425 645 325 194 --12526 11590
NM_001364chr1164269 3395 3045 1804 1771 42 1522 11558 11046
NM_001412chrX63583 3289 3214 2963 839 605 --23696 2631 --
NM_001419chr1954504 4361 4212 3899 3694 13314 14615 21284 692
NM_001438chr173649 3619 2791 2566 2524 154 81 ----1893
NM_001527chr674720 4430 4150 1209 959 946 25 ----13214
NM_001609chr1094221 3706 3243 3165 3085 1150 791 173 137 53974 3893 3459 2905 696 1585 --
NM_001621chr792452 2322 2186 1879 1095 907 721 684 161 2422 298 ----
NM_001621chr792452 2322 2186 1879 1095 907 721 684 161 2422 298 ----
NM_001806chr1942738 2518 2081 916 11030 22324 25 12070
NM_001858chr684930 4658 4552 3760 3427 1490 395 245 1621 ----
NM_001859chr963923 3424 2783 2775 2762 282 ----12820
NM_001918chr189225 8370 8063 7277 2131 1325 948 221 29171 5757 --13559
NM_001941chr1842882 1540 1486 1080 --11112 13136
NM_001981chr122044 690 ----2682 527
NM_002006chr4105502 5243 5111 4968 4406 3655 3600 877 304 54 --23943 3638 --
NM_002025chrX88829 7867 7338 6616 5845 3256 492 450 13640 --16763
NM_002040chr2152942 2676 2065 411 186 1781 148 --
NM_002158chr221298 560 ----22803 701
NM_002223chr1263688 2820 2459 1186 963 660 23242 1199 --13295
NM_002241chr173017 2943 2842 2512 2383 2325 466 1671 --12781
NM_002264chr383935 3560 1581 958 717 589 444 276 --31698 1557 465 --
NM_002310chr586426 5682 4711 4548 4298 4133 1785 631 ----14577
NM_002336chr12114797 4430 4015 3986 3679 1929 1847 1605 1268 686 413 21190 91 23775 1814 --
NM_002515chr142808 239 --21835 712 11864
NM_002545chr1195154 4850 4768 4464 4448 3650 1972 1759 1597 --24841 4178 13386
NM_002547chrX53308 408 362 133 32 12663 --13758
NM_002577chr383285 2931 2837 1044 815 662 587 263 --24059 381 --
NM_002613chr1694938 4036 3953 2022 1936 1922 1853 1118 1108 --34879 4503 213 14328
NM_002709chr263045 2960 2458 2409 1355 967 --12673 1585
NM_002737chr1776343 6051 5707 5639 5481 2074 760 15210 34262 1977 163 15911
NM_002869chr1131435 795 30 --11458 11810
NM_002886chr375094 5045 4526 4327 3612 3380 1286 24370 3176 21579 1017 --
NM_002994chr471833 1663 1244 792 668 611 560 1511 ----
NM_003012chr8113001 2735 2348 2308 2262 2197 1271 889 863 452 220 --11952 --
NM_003043chr374241 3526 3161 1478 1330 968 526 32747 2680 347 24288 3372 12928
NM_003099chr15105814 5412 5050 4858 4238 1780 1728 1178 789 301 --14913 14834
NM_003108chr2137240 5244 4856 4724 2792 2294 2165 1255 1027 966 787 774 32 --26896 6745 15231
NM_003133chr12117 108 160 --21076 155
NM_003262chr365085 3582 3303 1701 1014 781 ----1839
NM_003320chr11104432 3706 3031 3018 1355 1229 1104 802 727 539 --43381 3259 3172 1744 11339
NM_003344chr791628 1487 1465 1294 1160 498 477 157 24 ----11266
NM_003439chr743465 1367 1341 946 13311 --157
NM_003574chr1884887 4243 3843 1905 1397 644 416 394 --1318 --
NM_003644chr17106614 5843 5783 5633 5026 1842 1167 887 800 395 12264 22353 2289 1861
NM_003663chr353446 3433 3317 1131 492 11206 2438 218 12803
NM_003671chr932354 679 349 22547 197 32826 915 708 1751
NM_003679chr142508 2149 1089 899 22906 300 23419 490 1669
NM_003759chr4104028 4009 3876 3784 3693 2906 1677 1638 658 366 --13904 13492
NM_003831chr181537 ----21708 1605
NM_003924chr451593 1490 1221 439 329 ----21476 669
NM_003930chr732115 1682 54 12439 --1397
NM_003966chr5126425 6400 6217 5715 5636 5127 2387 2377 1869 1676 1572 334 --45517 2954 1816 86 --
NM_003994chr1274152 3709 3578 2894 387 277 162 23137 2670 ----
NM_004035chr1794883 4815 4695 3908 3148 1476 928 219 33 ----1152
NM_004171chr11179128 8784 8673 8528 8477 7645 7132 7014 6289 3695 3601 3351 3141 3078 1953 1888 139 --38763 8361 7160 18579
NM_004281chr10------2439 74
NM_004287chr1742601 2472 2454 1649 --22408 1998 21004 750
NM_004293chr953851 3347 2818 565 472 12936 --23710 598
NM_004323chr962389 2260 1690 670 362 337 --32092 1952 89 11861
NM_004397chr11104137 3826 3421 3202 1490 1090 923 585 496 481 ------
NM_004612chr9134451 3926 3296 3178 1923 1849 1712 1293 605 482 451 418 38 ------
NM_004660chrY52296 1697 1476 323 187 ----11532
NM_004726chrX75095 4050 1472 523 400 375 316 15005 11132 15159
NM_004745chr8105773 4611 4365 2119 2101 2075 1356 374 293 163 25096 5086 34567 1410 949 --
NM_004774chr1742691 2556 953 758 --1771 22749 836
NM_004815chr164936 3671 3454 1547 831 711 24714 4041 ----
NM_004866chr565028 4847 3492 1957 1414 558 11924 43702 3561 1754 667 23598 361
NM_004904chr775871 5637 4636 4050 2257 1072 75 --14184 --
NM_004956chr774373 3551 3329 2815 1198 1021 746 --24222 3913 --
NM_004992chrX88362 8304 5940 2002 1930 1822 873 140 1360 47262 6447 2898 156 1511
NM_004992chrX88362 8304 5940 2002 1930 1822 873 140 1360 47262 6447 2898 156 1511
NM_004999chr6103443 3295 3153 1759 1373 1200 1004 728 486 95 12743 --11257
NM_005036chr22167522 6929 5875 5853 5843 5527 5187 5168 5150 3080 2938 2380 1742 1656 302 112 36914 6584 3219 18326 27603 2590
NM_005056chr1265367 5051 4464 1309 1170 609 ----25070 364
NM_005151chr1862435 2405 2314 2188 1943 722 --32002 272 78 --
NM_005156chr994142 3875 1702 1087 963 904 870 233 56 14809 13962 --
NM_005168chr2------31318 1306 1113
NM_005188chr1188237 7705 6043 5910 5664 1848 1714 593 15280 129 15602
NM_005235chr276488 5181 2520 1846 1771 974 171 --45455 2498 2474 996 22540 1881
NM_005359chr18126299 5663 5585 4573 4545 4137 2011 1619 595 314 212 190 --36371 5953 4194 14940
NM_005399chr131047 596 31 13369 23646 122 11412
NM_005436chr1024041 469 11361 --24049 3141
NM_005475chr1283314 3033 2836 2363 825 604 536 236 1292 --1817
NM_005497chr1776128 3782 2068 1527 647 525 135 --35771 2295 466 1106
NM_005596chr986185 5954 4429 4323 1664 1334 1306 538 14481 --14115
NM_005665chr194493 3992 3962 3782 1809 1500 1429 355 284 11546 13798 --
NM_005725chr13577 364 339 12093 --1430
NM_005746chr742625 2118 2101 1809 1760 --1816
NM_005759chr2114076 4030 3816 3301 1791 1628 1573 1432 916 519 308 --13325 --
NM_005798chr1385206 4852 4666 4488 4365 4314 2061 67 147 ----
NM_005840chrX92778 2557 2473 2316 1404 1152 607 256 136 --13047 26532 1868
NM_005885chr551419 1383 1295 1282 469 11235 --1139
NM_005901chr18117468 7344 7220 7084 6906 6075 5903 5672 1929 1284 515 ----1983
NM_005903chr553963 3643 3383 2098 242 ----21704 55
NM_005935chr4105160 4570 3828 3363 3242 3226 1800 1471 1027 725 24308 1069 11126 13533
NM_005955chr1105067 4957 4404 1646 1434 1172 911 579 534 127 23427 484 13442 11726
NM_006095chr481571 1429 1227 849 818 754 427 140 ----11442
NM_006108chr1131556 718 588 --1750 22296 851
NM_006197chr851673 1657 867 620 504 2412 384 11681 11714
NM_006203chr554884 4119 1100 645 369 11819 14443 11868
NM_006212chr134213 1039 1021 1929 44738 1976 1554 848 23811 3492
NM_006252chr1116868 6508 5715 4931 4631 4581 2320 2296 2286 612 519 ------
NM_006275chr2022170 1651 --1410 21920 827
NM_006298chr652190 2124 1073 263 243 --12266 12836
NM_006352chr12464 137 --1188 11845
NM_006380chr1763455 3383 1045 820 780 767 12805 22888 1425 --
NM_006403chr651850 1500 642 608 149 --1675 1159
NM_006434chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_006489chr142808 239 --21835 712 11864
NM_006538chr273909 3599 3525 3313 710 416 136 --33636 3365 1418 1486
NM_006544chr1495479 4639 4621 4538 1640 1553 1169 367 255 11814 35607 2054 1525 14343
NM_006572chr1763359 3106 2707 2508 575 288 11397 --13536
NM_006599chr16126999 6187 6051 6035 5892 5356 4983 2986 2705 2617 2312 1860 --18120 2895 657
NM_006609chr232854 2411 531 11174 --22452 258
NM_006620chr6104596 4545 3026 1467 1440 1304 851 673 416 109 13830 11023 14625
NM_006621chr121936 186 21505 1312 1204 2534 420
NM_006729chrX74398 3867 3854 3641 2244 859 558 13962 22150 2102 11474
NM_006731chr945744 2017 1935 616 34046 1570 568 --14463
NM_006746chrX61390 1371 1158 558 364 23 --21031 565 --
NM_006750chr16117828 7512 7436 7071 6478 5508 5085 2860 1579 414 331 --13053 12266
NM_006851chr1252681 1164 1012 415 103 22436 536 21080 448 --
NM_007006chr1663365 3262 2947 1032 1002 669 --1662 --
NM_007038chr21145969 5655 5544 5171 4767 4459 4168 3873 2290 1448 1343 771 741 270 ----12423
NM_007050chr2097018 6732 6462 6230 5921 5719 5156 1741 1652 --22650 486 36396 3040 2285
NM_007078chr1072978 2001 1119 560 350 248 182 --32225 450 257 --
NM_007106chr1362316 929 923 722 91 80 --12177 --
NM_007203chr943281 1405 1174 461 33705 1013 376 33941 2718 909 --
NM_007249chr13189179 9095 8917 7102 7058 7011 6467 6157 6150 6039 5916 3601 3522 2471 2225 2007 1892 1597 29207 7257 17142 --
NM_007292chr1794883 4815 4695 3908 3148 1476 928 219 33 ----1152
NM_007345chr1842327 1803 731 447 ----2929 155
NM_012081chr593499 3255 3232 2665 2486 2305 706 478 326 12790 13001 --
NM_012096chr393713 3602 3262 2411 977 953 795 577 354 ------
NM_012164chr9127567 7109 6147 5410 4957 4890 4603 2828 2580 1419 930 259 21610 756 15083 --
NM_012193chr1165254 3378 547 472 431 223 24457 3802 24364 842 13556
NM_012262chr194717 4185 4112 4055 1728 1623 1215 309 188 11670 13762 13947
NM_012309chr11104122 3670 3326 1553 1299 1159 1136 962 465 172 14470 ----
NM_012316chr1105483 4584 4295 4204 3755 3676 2014 1889 1432 809 24551 1064 25517 1624 --
NM_012382chr574297 3941 3235 2894 1024 443 120 33054 1494 1290 43864 3734 1508 1415 --
NM_013231chr1473659 3486 1612 1037 967 867 409 21516 728 12972 1758
NM_013255chr7168747 8487 8406 7293 6947 6660 6559 5588 5501 2887 2820 2545 2290 1119 782 323 15624 37125 5661 2998 --
NM_013322chr761657 1371 1170 1076 1069 682 ------
NM_013374chr383043 2976 2680 2175 1930 702 37 31 ------
NM_013995chrX72584 2265 2007 322 302 294 108 --1656 1779
NM_014011chr242641 631 487 157 ----12229
NM_014048chr1683472 3373 3253 2036 1773 934 565 289 24414 3573 --23735 73
NM_014112chr885468 1940 1594 960 726 687 590 548 24688 1241 ----
NM_014141chr754442 3428 3385 2064 880 --33259 308 250 25027 1174
NM_014155chr11157513 6369 6295 5907 5535 5108 4885 4810 2798 2288 2091 2031 1613 1004 248 ------
NM_014263chr1031446 1374 1127 ----11200
NM_014331chr486785 6219 5701 4980 1307 1081 776 520 --17132 --
NM_014388chr1114959 1878 1723 1704 1647 1135 1092 1003 960 210 152 --25312 3917 --
NM_014423chr594506 4216 4187 3693 2181 1903 1581 994 982 14445 25472 5310 --
NM_014586chr21124674 4276 3953 3770 3640 1767 1126 1069 552 530 231 70 13934 24388 987 --
NM_014636chr9103886 3786 3285 3043 1614 1519 1319 801 631 125 --21462 30 --
NM_014701chr1582166 2130 1104 1090 890 843 361 210 --11155 --
NM_014721chr677016 6410 6140 5542 2332 1513 860 22353 555 17461 26363 5382
NM_014746chr261660 929 607 598 487 398 23522 368 --1151
NM_014755chr242734 667 526 412 1216 1480 1104
NM_014781chr821186 455 --1820 11084
NM_014832chr1361922 1864 1522 285 260 160 ----21957 1329
NM_014838chr22102674 2145 1145 1018 954 886 646 632 173 119 1672 --11064
NM_014873chr1104822 4814 3220 3059 1555 1219 1135 910 693 41 14122 ----
NM_014877chr1776938 6857 6312 5270 4780 2157 573 26341 5423 35432 2894 1360 --
NM_014904chr1073316 1136 1055 552 543 408 308 11577 ----
NM_014912chr10103171 3051 2350 2248 1353 830 735 521 405 72 1415 ----
NM_014946chr263066 2865 2603 2293 658 249 --1111 --
NM_014962chr2072338 2122 729 715 680 591 480 --1238 --
NM_014965chr362339 1712 793 681 385 315 1117 11772 1522
NM_014982chr1444055 1817 1325 872 ----24108 1275
NM_015026chr1254051 3864 3548 1165 1009 --24332 4101 13691
NM_015074chr174415 3756 3480 3439 1952 1431 528 21784 498 1800 23095 607
NM_015092chr1694685 4260 4201 3742 3673 2866 1084 555 463 1182 13212 11853
NM_015156chr1473706 3567 2692 2540 1625 1401 1165 --2420 340 --
NM_015200chr462097 1795 1785 1047 652 110 22321 1855 1420 11894
NM_015245chr652211 793 631 351 260 22415 841 31920 593 398 11977
NM_015247chr16125075 4948 4588 4537 4503 3742 3417 2021 1509 1094 914 125 22005 475 14086 15353
NM_015278chr673113 2951 2713 1141 1042 542 252 ----12490
NM_015291chr163009 1199 807 107 69 33 11300 22503 1322 12741
NM_015310chr8108412 7530 7016 6239 5413 5333 5203 1880 1482 253 11617 22231 1342 15674
NM_015313chr1184087 3061 1862 1783 1419 978 425 259 1668 13407 --
NM_015365chrX113762 3006 2846 1685 1359 1343 1222 1194 927 521 209 ----11231
NM_015385chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_015455chr573779 3132 2716 2548 1372 719 412 --13161 11463
NM_015458chr845275 1908 758 110 13651 11384 23745 3425
NM_015508chr331364 1285 117 --2616 604 11130
NM_015535chr253488 1454 1232 645 286 ----2578 344
NM_015554chr1561838 1797 812 625 203 184 12338 ----
NM_015564chr583421 2914 2837 2724 867 778 606 336 --12509 --
NM_015575chr242333 986 516 407 1571 22964 825 12605
NM_015640chr194988 4976 4392 3565 3280 1831 1439 383 210 ----1250
NM_015879chr18187840 7795 7110 6691 5765 5589 5439 5405 5310 5266 2414 2327 1757 1740 1010 363 203 69 18144 --22432 2280
NM_015886chr895572 4950 4700 4107 1608 1366 1163 1146 811 15476 --11535
NM_015906chr153951 3254 1797 1568 1170 --1714 21633 1531
NM_016023chr852065 1906 1791 594 145 2680 158 ----
NM_016076chr182921 2474 2233 921 475 462 83 25 --22983 2829 --
NM_016206chr3178959 8918 7972 7008 6981 6077 5842 5532 3086 3016 2336 2214 2161 1798 1686 1257 365 21554 511 ----
NM_016217chr683203 2907 2331 2284 1435 1171 884 386 --13644 --
NM_016248chr1393925 3413 3395 3331 2983 2714 2603 1068 783 --1286 1980
NM_016260chr2116993 6907 6598 6164 6023 2893 2593 1586 1175 788 350 --1379 25902 482
NM_016356chr641097 648 458 329 1824 1603 12569
NM_016422chr1152610 2322 2297 789 206 13059 22908 911 --
NM_016530chr15103679 3575 3200 2990 2871 2766 1406 1129 1000 590 11188 13553 --
NM_016936chr164401 384 374 249 11898 11474 1604
NM_016953chr296153 5808 5792 5458 4702 4655 3862 1954 529 14598 15255 --
NM_017447chr21124092 4041 3442 3267 3121 2930 2767 1304 1066 732 681 529 ------
NM_017623chr292269 2222 1830 1695 1683 486 338 332 115 ----11012
NM_017628chr465075 1797 1570 1193 194 163 23974 554 13802 --
NM_017637chr988852 8568 8254 6892 6521 2210 1413 1239 37125 3059 1591 32275 1221 251 --
NM_017644chr385033 4844 4724 4310 1843 1698 1679 558 13203 24968 1913 33959 1691 1385
NM_017650chr764780 2302 1649 1425 1075 922 --25949 1542 11101
NM_017813chr875730 5090 4779 4598 3770 1763 956 42125 1715 173 138 25429 819 --
NM_017831chr1864361 3897 3493 3409 1553 973 24505 4390 34378 4009 1683 --
NM_017848chrX104580 4559 4272 4105 3894 1883 1506 1286 580 174 --11675 --
NM_017919chr9115503 4831 4785 4712 4279 4108 4051 3754 917 455 425 --14338 --
NM_018003chr1562250 1834 950 783 620 404 21887 938 --2975 354
NM_018017chr1072737 2306 2246 2174 1856 714 632 12417 12468 --
NM_018036chr14144281 3927 3887 3776 3701 3177 2722 1401 1298 1184 1050 627 387 53 13813 23278 73 13381
NM_018085chr1117898 7570 6016 5960 5461 1555 964 701 582 428 152 15828 18056 13199
NM_018100chr673398 2892 2797 2643 899 850 802 --22903 2264 33270 1351 295
NM_018159chrX41212 1123 1091 484 ----11524
NM_018247chr673080 2505 2220 888 780 430 261 ----1439
NM_018263chr231626 611 319 12332 2526 169 22352 118
NM_018323chr441773 1510 489 34 ----1187
NM_018373chr1466392 4270 2357 1260 1045 365 24534 4511 25252 4317 12367
NM_018374chr784885 4684 4133 4002 3499 1107 844 568 --11018 --
NM_018409chr452584 2368 700 351 214 11071 --12687
NM_018429chr532091 615 605 22470 2146 32166 1967 80 --
NM_018440chr8138327 7761 7621 6977 6739 3080 3063 2790 1638 1598 1496 730 378 12101 16817 --
NM_018947chr7104949 4781 4693 3726 3648 3036 1529 730 331 96 --11208 11589
NM_018976chr1242817 2650 804 513 ----1644
NM_018981chr271253 1161 1145 398 322 205 69 --21308 858 --
NM_018999chr1093887 3814 3687 3285 3017 3005 1571 248 27 14214 24863 962 --
NM_019083chr141052 1037 203 161 1178 --1506
NM_019591chr1261028 889 822 156 49 39 1111 --1250
NM_020122chr2105932 5890 5370 4774 4080 4046 2102 979 834 97 14432 12088 --
NM_020347chr382185 1626 1587 854 725 636 132 117 --1278 --
NM_020440chr173072 2680 2105 1192 947 877 551 --22276 544 1442
NM_020455chr672496 2436 2226 720 405 282 75 22689 440 ----
NM_020466chr684874 4472 1896 1814 1786 1249 1236 729 11500 11015 --
NM_020673chr20106998 5941 5889 5845 5446 5055 4899 4797 1655 421 11377 25617 1553 12843
NM_020718chr16116426 5965 5606 4685 2447 1911 1790 1765 1117 973 50 ------
NM_020727chr21103774 3590 3212 3100 1522 1446 1223 808 378 176 ----13649
NM_020772chr17128186 7886 7111 6059 5339 3027 2675 2495 2023 1840 1477 42 ----23213 2550
NM_020782chr1294832 3542 3215 1893 1507 1489 1402 779 517 ------
NM_020844chr8127385 7177 5561 5472 5421 5069 4793 4684 2378 2323 1469 528 15307 --17169
NM_020899chr1762441 2292 2096 1869 1652 138 ----22487 641
NM_020918chr1083377 3303 3239 3137 2500 1101 804 604 --12406 --
NM_020922chrX71450 1421 429 272 121 51 39 11282 ----
NM_021061chr8104105 3642 3556 3283 3234 3107 3073 2985 1407 1250 --23350 3169 53720 3202 2922 2770 179
NM_021116chr7178826 8139 7878 7843 7709 7214 6032 5852 3483 3354 2474 2383 1611 1492 1037 712 313 11367 37745 3298 350 1858
NM_021148chr762459 2285 1796 629 611 242 22403 573 1717 --
NM_021629chr374319 4122 3789 3695 1451 846 266 21238 649 24116 3630 23959 3103
NM_021647chr453964 3937 3782 204 40 1554 1255 14339
NM_021911chr554460 2238 2092 989 288 1963 21780 1001 1644
NM_021964chr3146203 6128 4450 4303 4191 2603 2539 2383 2302 2221 2026 664 233 38 ------
NM_022048chr1596064 5851 5476 5264 5084 4137 2052 1325 575 14397 --1872
NM_022166chr16106331 5613 5381 4191 2254 1778 1578 1136 496 320 15191 25785 380 --
NM_022458chr752568 2183 444 391 107 1646 --1851
NM_022459chr1385469 4702 3888 2245 1259 350 225 27 --32373 963 478 25227 1241
NM_022828chr541563 1428 392 130 11159 1118 --
NM_023016chr252261 2032 929 816 147 1547 --22359 184
NM_024345chr995950 5854 5405 4728 2175 2069 1250 83 63 --25096 1932 --
NM_024607chr873691 3350 3072 2995 1336 616 177 14058 13290 24267 1510
NM_024639chr692864 2329 2279 2003 1845 1025 935 893 91 42515 668 500 51 --12112
NM_024692chr261769 1358 1300 1206 581 528 ----1141
NM_024947chr3129346 9177 9129 6282 6219 3596 3241 2406 2101 1804 979 506 11751 36012 750 656 --
NM_024991chr10103275 2506 2387 2215 1309 1106 887 835 811 795 1354 12260 1645
NM_025134chr1652398 868 722 522 125 11614 1646 1146
NM_025191chr183292 2936 2694 2677 2526 2156 890 417 --23186 2501 --
NM_025235chr1052037 1776 1606 830 468 ----1854
NM_030579chr1653648 3263 2956 880 179 --1865 1921
NM_030627chr562940 1124 754 578 289 27 --21426 628 12718
NM_030648chr474415 3909 3765 2013 1869 1652 1372 44565 4425 2081 2068 --31759 293 25
NM_030650chr283897 3102 1540 1066 991 967 249 124 --33840 3018 1032 --
NM_030755chr1453040 2745 2299 837 145 --1487 1352
NM_030806chr1138148 7719 7087 6817 6783 6741 5965 5959 3303 2923 2337 1869 1648 27655 7644 37726 7284 1378 16999
NM_030816chr163441 3271 2353 1374 1346 630 ----11404
NM_030817chr1293447 3293 2729 2689 2670 1520 756 649 515 --11191 --
NM_030918chr1105109 4517 4486 4313 4299 3748 3689 1179 882 769 14936 --15269
NM_031268chr1694938 4036 3953 2022 1936 1922 1853 1118 1108 --34879 4503 213 14328
NM_031427chr14135936 5463 5044 4606 3881 3706 2158 1417 1267 1179 430 393 216 35396 1303 567 15228 --
NM_031435chr1243426 1316 719 46 1321 22169 713 --
NM_031483chr2093049 2944 2891 2603 2569 2453 1357 336 141 --13293 2607 103
NM_032012chr984666 4331 4015 3502 3459 3438 1882 1120 --24502 210 --
NM_032288chr372335 1845 1783 882 548 355 327 1469 --1650
NM_032373chr1055328 4949 3641 583 467 15758 1963 15056
NM_032446chr573148 2458 741 656 624 229 179 2301 200 13622 22834 1062
NM_032832chr641505 1467 1307 337 ----1191
NM_032842chr74260 225 126 30 11198 --1402
NM_032859chr1362706 2519 1598 1263 743 68 ------
NM_032873chr1144531 4370 3046 3020 11083 21241 181 11626
NM_032933chr1811366 11330 --2656 493
NM_032968chrX54234 2698 425 188 29 ----13166
NM_032969chrX54234 2698 425 188 29 ----13166
NM_032973chrY64226 3537 2693 425 188 29 ----13161
NM_033020chr153951 3254 1797 1568 1170 --1714 21633 1531
NM_033224chr7117916 7768 7376 6367 5153 2744 1974 1627 1278 733 547 15693 14877 16420
NM_033331chr932354 679 349 22547 197 32826 915 708 1751
NM_033338chr1041154 506 109 84 ----1176
NM_033339chr1041154 506 109 84 ----1176
NM_033656chr2174776 4444 1750 1508 1393 887 734 21733 1581 15358 196
NM_052811chr1385206 4852 4666 4488 4365 4314 2061 67 147 ----
NM_052832chr862215 983 815 707 607 90 11888 --1900
NM_052879chr1273939 3898 2654 1408 1039 997 322 1701 21471 801 --
NM_052885chr12104715 4597 4318 4151 3946 3420 865 763 618 600 ----14089
NM_053016chr967953 7924 6517 5313 2691 2084 --36997 6938 5615 15778
NM_058170chr141542 1205 1102 305 1312 ----
NM_080546chr972015 1951 1695 935 549 485 328 1158 1396 --
NM_080764chr2253244 3092 2177 2123 145 --1988 1312
NM_080872chr883864 3526 1522 1184 533 526 465 409 21555 442 ----
NM_080927chr343286 1326 1156 756 12527 1613 1283
NM_133170chr2097018 6732 6462 6230 5921 5719 5156 1741 1652 --22650 486 36396 3040 2285
NM_133334chr495788 5746 5154 4841 2263 2098 1800 576 332 15044 --13884
NM_133646chr295518 4213 3857 3374 2042 1712 1260 765 612 13526 44733 4148 3449 1073 --
NM_138270chrX53401 2993 2175 1174 416 13325 33251 1152 761 --
NM_138286chr1984159 3895 3166 2791 1450 1046 642 278 32749 1664 224 ----
NM_138444chr1384803 4265 3965 3173 3006 1224 541 373 --13203 --
NM_138459chr653327 2906 1387 1337 569 --1546 13495
NM_138468chr282009 1979 1727 1150 791 271 137 76 21166 522 ----
NM_138473chr1294510 4398 3216 1929 1912 1520 1290 1119 803 11655 --13147
NM_138621chr273909 3599 3525 3313 710 416 136 --33636 3365 1418 1486
NM_138713chr16126999 6187 6051 6035 5892 5356 4983 2986 2705 2617 2312 1860 --18120 2895 657
NM_138714chr16126999 6187 6051 6035 5892 5356 4983 2986 2705 2617 2312 1860 --18120 2895 657
NM_138782chr561965 1492 856 340 236 219 1390 2940 383 131
NM_138959chr1126343 5843 5234 4144 2596 2400 2209 1941 1385 1013 490 404 36415 5770 4371 15253 26354 539
NM_139169chr1061846 1667 1656 676 557 265 --12006 --
NM_139207chr1271692 1592 1478 1405 878 641 536 --11745 --
NM_139312chr1031446 1374 1127 ----11200
NM_139319chr1241441 1344 259 37 ----11214
NM_144578chr14104082 3966 3774 3510 1753 1713 953 716 214 95 25200 133 11113 14022
NM_144599chr1595217 5149 5105 4908 4685 4260 2143 1328 1171 13948 ----
NM_144664chr1172456 845 526 405 385 335 327 ------
NM_144949chr242641 631 487 157 ----12229
NM_145259chr2126993 6871 6854 6784 6372 6335 5831 5492 4552 2130 836 412 34706 4335 1972 22731 1033 --
NM_145307chr1044283 1404 874 564 24421 3132 158 1690
NM_147150chr943281 1405 1174 461 33705 1013 376 33941 2718 909 --
NM_148955chr15105814 5412 5050 4858 4238 1780 1728 1178 789 301 --14913 14834
NM_152388chr264035 2576 1368 919 717 312 1853 13002 23798 1351
NM_152529chr2104456 4235 3778 3748 3001 2931 2867 2828 2812 723 ------
NM_152624chr5107393 6359 6311 5794 4856 2326 2151 1694 1594 1119 138 26737 6084 --
NM_152641chr1282306 1863 1812 1039 960 528 485 264 --12116 --
NM_152787chrX53940 3838 2795 1273 663 --32998 1315 556 13653
NM_152793chr744627 4325 3239 1995 --1260 14217
NM_152826chr15105814 5412 5050 4858 4238 1780 1728 1178 789 301 --14913 14834
NM_153013chr552471 2436 2341 540 53 --1281 1790
NM_153235chr662369 2325 2179 698 618 155 11911 11935 --
NM_153371chr13102394 2365 2355 2227 1637 1571 1558 240 233 43 11625 ----
NM_153456chr1385311 4516 4262 4103 2492 1410 1139 250 --1917 14897
NM_172071chr176804 5790 5710 5617 2463 2436 238 1106 15462 1491
NM_173214chr16126999 6187 6051 6035 5892 5356 4983 2986 2705 2617 2312 1860 --18120 2895 657
NM_173468chr4104610 4349 2162 1889 1856 1822 1459 1406 1391 773 25086 1037 1800 --
NM_173473chr1042566 2370 782 511 1745 --2245 183
NM_173536chr474124 3740 3401 1186 1011 173 148 ----13933
NM_173654chr352158 2007 1895 791 131 ----11640
NM_173808chr164166 3991 2942 544 537 481 --1251 13271
NM_175058chr115488 300 282 172 49 --11167 31021 324 117
NM_175736chr12127738 7495 7023 5536 5205 2590 2509 1931 1516 1239 256 37 25180 4907 ----
NM_177972chr11104432 3706 3031 3018 1355 1229 1104 802 727 539 --43381 3259 3172 1744 11339
NM_178151chrX177694 7422 7251 7234 6862 6245 5274 3049 2143 2034 1878 1844 1093 993 978 903 21 15973 ----
NM_178152chrX177694 7422 7251 7234 6862 6245 5274 3049 2143 2034 1878 1844 1093 993 978 903 21 15973 ----
NM_178153chrX177694 7422 7251 7234 6862 6245 5274 3049 2143 2034 1878 1844 1093 993 978 903 21 15973 ----
NM_181054chr1431165 234 126 ----1871
NM_181443chr2072338 2122 729 715 680 591 480 --1238 --
NM_181521chr16156541 6258 5929 5717 5439 5064 4877 4792 4473 2761 2217 1998 1687 1593 1046 22789 1234 ----
NM_182515chr19106037 5835 5440 4522 4320 4086 2619 2266 1454 776 11239 12163 15044
NM_182551chr253434 3382 3327 2392 1327 32233 2198 649 ----
NM_182697chr791628 1487 1465 1294 1160 498 477 157 24 ----11266
NM_182898chr775871 5637 4636 4050 2257 1072 75 --14184 --
NM_182899chr775871 5637 4636 4050 2257 1072 75 --14184 --
NM_194247chr284459 4394 4372 1208 823 654 188 101 --22995 1106 13469
NM_194314chr154554 4199 3938 2004 820 --25017 4992 --
NM_194434chr1884887 4243 3843 1905 1397 644 416 394 --1318 --
NM_198270chrX71397 1060 915 731 430 333 171 --13383 --
NM_198273chr532825 1159 921 ----197
NM_198465chrX82638 2172 1826 1150 1009 387 300 62 ----171
NM_198569chr662363 2303 2093 587 272 149 22556 307 ----
NM_198581chr276986 6228 6115 6070 2946 2365 319 ----12442
NM_198859chr344236 3466 1851 1758 21222 804 24149 3115 24719 3770
NM_198896chr1131435 795 30 --11458 11810
NM_198900chr12127738 7495 7023 5536 5205 2590 2509 1931 1516 1239 256 37 25180 4907 ----
NM_199078chr292269 2222 1830 1695 1683 486 338 332 115 ----11012
NM_199188chr1273939 3898 2654 1408 1039 997 322 1701 21471 801 --
NM_199190chr1273939 3898 2654 1408 1039 997 322 1701 21471 801 --
NM_199436chr263066 2865 2603 2293 658 249 --1111 --
NM_201432chr17106614 5843 5783 5633 5026 1842 1167 887 800 395 12264 22353 2289 1861
NM_201433chr17106614 5843 5783 5633 5026 1842 1167 887 800 395 12264 22353 2289 1861
NM_203406chr552915 2714 2143 1168 1001 1118 22010 634 --
NM_203459chr172276 1771 968 790 492 397 24 ------
NM_205768chr12464 137 --1188 11845
NM_206594chr173649 3619 2791 2566 2524 154 81 ----1893
NM_206595chr173649 3619 2791 2566 2524 154 81 ----1893
NM_206853chr643906 3024 1416 291 12864 12772 13249
NM_206854chr635167 4285 1552 14125 14033 14510
NM_206855chr656132 5250 2517 816 171 15090 14998 25475 65
NM_206876chr263045 2960 2458 2409 1355 967 --12673 1585
NM_206909chr8108412 7530 7016 6239 5413 5333 5203 1880 1482 253 11617 22231 1342 15674
NM_207303chr10104136 4000 3889 3768 3762 3730 3037 2592 1125 701 --21318 975 --
NM_207406chr496479 6395 5133 4336 4117 4088 1450 1378 1001 14795 35806 4682 1830 --
NM_213589chr2104616 3886 3761 3553 2078 1509 1293 375 109 76 --185 14599
NM_213590chr1385206 4852 4666 4488 4365 4314 2061 67 147 ----