TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-146a-5p
miRNA Sequence: UGAGAACUGAAUUCCAUGGGUU

<
mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511236 ------
NM_000024chr51505 ------
NM_000037chr822400 991 ------
NM_000052chrX22177 485 1222 12800 --
NM_000081chr15603 239 181 69 23 ------
NM_000084chrX46010 2709 2357 1433 16158 11892 12172
NM_000088chr1721284 172 1551 ----
NM_000089chr72826 681 ------
NM_000092chr254266 3933 1689 1629 701 ------
NM_000093chr952507 2429 2187 837 576 12081 ----
NM_000096chr3--1364 1953 --
NM_000108chr741930 1792 1604 749 1420 ----
NM_000109chrX22588 2416 12497 --22512 668
NM_000112chr5115002 4743 4415 4244 4204 3861 1688 1165 1127 540 494 13880 23700 503 --
NM_000115chr1342551 2015 1808 1682 ------
NM_000125chr644021 3730 2953 1095 13269 --1160
NM_000134chr42493 325 11551 --11414
NM_000141chr1011205 1533 ----
NM_000142chr421362 1306 ------
NM_000158chr3148 ------
NM_000163chr512107 ------
NM_000165chr651714 1698 1581 1297 325 ------
NM_000168chr773035 2849 2763 2103 681 212 88 22080 689 ----
NM_000173chr17----1417 --
NM_000176chr513721 23438 111 ----
NM_000210chr222309 322 ------
NM_000212chr1741939 1698 635 332 1469 ----
NM_000214chr2051559 1471 415 349 121 --152 11693
NM_000216chrX22625 1368 23536 265 23092 313 --
NM_000217chr1233705 3402 1101 ----15301
NM_000232chr442999 772 540 216 1907 22100 1275 --
NM_000248chr363054 1980 1035 951 735 81 --32210 1006 709 --
NM_000251chr2157 ------
NM_000252chrX51118 1030 603 567 248 11243 ----
NM_000259chr1574989 4376 2254 1707 1438 1008 730 46249 4847 2278 1469 14911 46080 5996 1690 1596
NM_000264chr953286 3129 3121 2329 2233 ----12757
NM_000276chrX52142 1898 1724 234 113 ------
NM_000280chr113905 404 122 1818 11012 --
NM_000314chr1062849 2488 2154 1223 894 297 13041 --11004
NM_000325chr41546 ------
NM_000327chr111268 ------
NM_000328chrX3373 302 150 ------
NM_000332chr6127073 6472 6368 6162 5987 5747 2731 2696 2243 2033 1953 1574 26379 2535 26406 1794 --
NM_000333chr33790 286 102 ----1916
NM_000337chr566002 5262 5253 1732 1148 1090 25089 876 14651 --
NM_000340chr361496 1368 1317 289 275 254 ------
NM_000346chr1751944 1737 1480 1277 680 11262 ----
NM_000351chrX74274 3798 2916 1084 1047 888 869 11141 24039 1642 --
NM_000358chr51387 185 ----
NM_000362chr2243373 3044 2749 101 --23542 2875 --
NM_000368chr994550 3902 3563 3033 2969 1071 803 630 608 ------
NM_000378chr111344 ------
NM_000393chr232007 303 195 11895 --12129
NM_000396chr11443 ------
NM_000397chrX72127 1763 901 721 630 416 124 --12407 --
NM_000408chr241386 768 323 252 12993 ----
NM_000411chr2162860 2109 979 294 161 115 --11300 --
NM_000421chr171285 1316 158 --
NM_000430chr1763755 3124 2528 2521 1030 936 11080 ----
NM_000439chr552202 1828 956 436 250 --22382 749 --
NM_000445chr8--171 ----
NM_000447chr12450 65 ------
NM_000448chr1132690 2368 2355 33205 1184 379 12522 --
NM_000452chr131813 143 ----
NM_000459chr93853 847 374 ------
NM_000461chr384276 3651 3504 3297 3096 1672 1622 194 14373 24327 895 --
NM_000462chr15----1586 --
NM_000484chr21--11092 ----
NM_000489chrX113459 2878 2736 2433 2238 1276 1233 1112 897 495 134 22567 246 --1413
NM_000492chr731412 1075 128 1992 ----
NM_000493chr61237 11091 ----
NM_000503chr821709 664 ----11205
NM_000509chr41147 ------
NM_000523chr22223 190 1430 ----
NM_000533chrX21606 1298 22016 1681 11580 --
NM_000555chrX67831 6157 2985 2039 1174 105 25549 901 16685 27249 1390
NM_000589chr5121 ------
NM_000598chr721484 1114 ------
NM_000599chr284311 4282 4194 3935 2930 828 725 235 14329 14273 --
NM_000609chr1013150 ----11908
NM_000615chr1162686 2456 2416 2295 915 717 32850 2818 1073 12192 --
NM_000663chr1642419 2382 2298 291 180 12508 --
NM_000668chr41539 11030 --1428
NM_000686chrX11116 11552 ----
NM_000700chr91194 ------
NM_000718chr9161 ------
NM_000719chr1265449 4334 1673 955 884 81 1853 11798 --
NM_000721chr132622 988 218 ------
NM_000726chr221375 248 ------
NM_000729chr31214 ------
NM_000739chr7176 ------
NM_000767chr1921207 226 ------
NM_000783chr10152 ------
NM_000788chr431315 505 103 ------
NM_000800chr511651 ------
NM_000801chr2031093 901 34 1264 ----
NM_000806chr511829 159 ----
NM_000812chr41141 ------
NM_000813chr575284 5256 4954 4122 3632 1837 201 ----14500
NM_000814chr1564116 3869 1311 596 313 70 1580 ----
NM_000826chr431961 1894 207 12633 ----
NM_000827chr552554 2427 408 196 144 ----1473
NM_000828chrX42171 1871 692 368 21822 1707 ----
NM_000829chr1111581 --1348 --
NM_000838chr612733 12260 ----
NM_000840chr72519 370 --123 --
NM_000844chr32802 443 ------
NM_000859chr581351 1113 647 581 486 319 165 42 ------
NM_000865chr61190 ------
NM_000868chrX52303 1916 1043 503 179 21633 774 ----
NM_000875chr1595932 5452 5300 4880 1507 1289 1164 323 74 46538 6184 5577 4727 36756 2584 2448 --
NM_000880chr8174 ------
NM_000891chr1723314 2656 --33421 3129 436 --
NM_000895chr121101 ------
NM_000899chr1254242 4003 3274 2845 131 --11389 22936 1498
NM_000901chr452207 2022 1603 1587 315 ------
NM_000905chr71122 ------
NM_000912chr833463 3143 669 --131 13178
NM_000919chr5178 1643 ----
NM_000944chr442140 730 317 95 ------
NM_000945chr232024 1577 468 --1734 --
NM_000950chrX53512 2653 716 469 148 ----12272
NM_000958chr521163 991 ------
NM_000962chr942793 2702 2090 598 41130 360 259 231 ----
NM_000963chr13347 246 211 ----11675
NM_000965chr33863 357 91 ----21142 137
NM_000975chr1------139
NM_000983chr131604 1572 606 --135 --
NM_000990chr1193644 2652 2610 1043 1035 931 692 110 65 ----23775 404
NM_001001132chr2131287 953 329 ------
NM_001001323chr1212987 12442 12448 --
NM_001001330chr103526 504 195 1253 ----
NM_001001331chr33474 407 250 12416 12303 --
NM_001001395chr1242072 1819 617 334 12292 ----
NM_001001396chr194413 4051 3979 3520 3391 3287 2844 2762 1168 24333 1111 23273 845 --
NM_001001419chr574545 2038 1785 1089 870 622 515 --64748 4217 3995 2093 580 384 14567
NM_001001420chr574545 2038 1785 1089 870 622 515 --64748 4217 3995 2093 580 384 14567
NM_001001433chr2042944 2808 671 253 ------
NM_001001436chr161685 ------
NM_001001481chr853495 2927 2203 1234 1048 12887 11370 21333 384
NM_001001484chr101418 ----11554
NM_001001549chr742882 2514 2112 485 22705 417 ----
NM_001001550chr742882 2514 2112 485 22705 417 ----
NM_001001555chr742882 2514 2112 485 22705 417 ----
NM_001001557chr842082 1655 1649 273 11545 ----
NM_001001664chr233897 2499 481 33585 1655 1389 33975 1325 429 --
NM_001001701chr432182 496 36 22228 1507 --21793 205
NM_001001715chr132458 407 ------
NM_001001872chr141601 ------
NM_001001890chr2132876 868 640 --22940 2754 --
NM_001001924chr831648 715 362 11794 --1391
NM_001001925chr831648 715 362 11794 --1391
NM_001001928chr2278335 8211 7683 1489 1404 946 37 36096 2586 1169 ----
NM_001001931chr831648 715 362 11794 --1391
NM_001001933chr11485 ------
NM_001001937chr18137 ------
NM_001001971chr1021234 82 ------
NM_001001974chr101763 21629 253 ----
NM_001001995chrX31813 1696 1557 ------
NM_001002032chr171105 ------
NM_001002255chr6138 --1119 --
NM_001002257chr253498 2318 1384 1104 761 --12581 23530 2749
NM_001002295chr101438 ------
NM_001002759chr103524 493 480 ------
NM_001002843chr1521284 207 1275 11087 --
NM_001002860chr14114450 4151 3906 3799 3082 1833 1575 1311 1179 461 128 34631 3201 1404 ----
NM_001002909chr171131 ------
NM_001002926chr752046 705 667 460 25 167 ----
NM_001003396chr6129 ------
NM_001003397chr6129 ------
NM_001003407chr1064855 4713 3969 3420 616 288 13379 64800 3575 3481 3239 1698 947 13587
NM_001003408chr1064855 4713 3969 3420 616 288 13379 64800 3575 3481 3239 1698 947 13587
NM_001003652chr18228541 8365 8296 7623 7563 7429 6762 6633 6545 6305 6293 6212 6200 6149 6125 6072 2807 2620 2147 1658 1594 1326 58461 7341 5311 2840 1363 28691 7877 27297 3068
NM_001003674chr1886151 5924 4835 2451 2155 1571 1167 634 27045 5734 --36951 4375 2440
NM_001003675chr1886151 5924 4835 2451 2155 1571 1167 634 27045 5734 --36951 4375 2440
NM_001003681chr2242031 1907 1653 659 ------
NM_001003688chr431190 959 844 1452 ----
NM_001003712chr1273845 3506 3091 1593 1090 628 433 ------
NM_001003792chr331226 980 164 ------
NM_001003793chr331226 980 164 ------
NM_001003799chr72655 569 1482 ----
NM_001003800chr953556 2680 1325 1104 432 1753 ----
NM_001003810chr41633 ----1178
NM_001004051chrX2332 301 1322 --1243
NM_001004065chr994009 3892 3047 2804 2789 2606 2507 2469 1523 12880 1633 --
NM_001004106chr5166 ------
NM_001004196chr311145 ------
NM_001004304chr1253169 2148 1046 926 379 ----1214
NM_001004317chr653700 3534 1360 412 22 1827 2568 435 --
NM_001004342chr196069 6013 5157 5036 4746 4198 3777 1606 668 1329 --2912 905
NM_001004346chr42186 155 ------
NM_001004360chr241924 1828 279 250 ------
NM_001004419chr1274068 1604 1564 1325 1274 520 270 24170 247 24313 4091 --
NM_001004441chr51640 ----1365
NM_001004720chr211062 ------
NM_001004722chr211231 ------
NM_001005158chr31388 1351 ----
NM_001005159chr31388 1351 ----
NM_001005266chr15137 ------
NM_001005267chr15137 ------
NM_001005268chr15137 ------
NM_001005269chr15137 ------
NM_001005375chrY61597 1180 418 283 254 231 --1151 --
NM_001005386chr242401 1606 683 129 ----11765
NM_001005404chr17104355 3776 3652 3601 3187 3009 2774 1309 641 238 34409 3295 1124 --14531
NM_001005463chr101991 11936 ----
NM_001005473chr5124997 4632 4445 4332 4305 4057 4041 2648 2316 1182 472 315 26602 4796 ----
NM_001005474chr331391 1303 1243 ------
NM_001005732chr211556 1670 1124 --
NM_001005733chr211513 1627 1124 --
NM_001005743chr1421128 862 ------
NM_001005744chr1421128 862 ------
NM_001005745chr1421128 862 ------
NM_001005746chr221375 248 ------
NM_001005747chr221375 248 ------
NM_001005753chr232269 787 109 1165 12061 --
NM_001005781chr22382 162 ------
NM_001005782chr22831 400 1165 160 --
NM_001005849chr17138 --2559 116 --
NM_001005862chr171481 ------
NM_001006117chrY--1185 ----
NM_001006600chr541789 959 762 718 --12388 12139
NM_001006610chr162903 285 ------
NM_001006612chrX1452 ------
NM_001006613chrX1452 ------
NM_001006614chrX1452 ------
NM_001006618chr91198 ------
NM_001006624chr111277 12022 ----
NM_001006626chr7176 ------
NM_001006627chr7176 ------
NM_001006628chr7176 ------
NM_001006629chr7176 ------
NM_001006630chr7176 ------
NM_001006631chr7176 ------
NM_001006632chr7176 ------
NM_001006656chr1951707 1693 1379 1126 537 1494 1522 --
NM_001006684chrX2417 403 ------
NM_001007024chr1754300 4279 2917 2896 191 24361 239 33458 3039 291 12806
NM_001007025chr1754300 4279 2917 2896 191 24361 239 33458 3039 291 12806
NM_001007075chr411025 1880 ----
NM_001007097chr954558 3551 3499 1531 123 11084 11827 11820
NM_001007098chr15849 737 712 678 298 ------
NM_001007099chr11807 1739 --1705
NM_001007100chr11807 1739 --1705
NM_001007214chr14732 713 620 404 ------
NM_001007226chr1721003 390 --11260 11187
NM_001007227chr1721003 390 --11260 11187
NM_001007228chr1721003 390 --11260 11187
NM_001007229chr1721003 390 --11260 11187
NM_001007230chr1721003 390 --11260 11187
NM_001007245chr72166 79 ------
NM_001007257chr11541 1953 ----
NM_001007267chr23842 655 95 ------
NM_001007278chr1394331 4292 3676 3529 3335 3327 2016 1992 333 12004 32077 1633 25 1948
NM_001007466chr654594 934 551 361 300 34068 688 40 34571 1873 994 --
NM_001007468chr221299 ------
NM_001007471chr9167 ------
NM_001007544chr12474 396 --132 --
NM_001007553chr131234 134 66 --11198 --
NM_001007559chr1852016 1617 703 667 105 21499 607 11723 --
NM_001007794chr14765 722 695 34 ------
NM_001008226chr1561779 1371 1121 598 478 196 ------
NM_001008239chr1883686 3667 3232 3190 2691 1097 659 345 13648 12716 11451
NM_001008405chr741798 1585 283 81 ----1129
NM_001008408chr796201 4947 2566 2282 1333 367 299 248 128 1267 --1379
NM_001008495chr871868 1760 1510 420 393 121 85 11904 22012 1536 --
NM_001008540chr22136 96 1367 --1446
NM_001008541chr1032269 1794 1583 ------
NM_001008541chr1032269 1794 1583 ------
NM_001008564chr132203 109 ----1876
NM_001008660chr1111367 ------
NM_001008701chr1913075 ----11885
NM_001008708chr21525 --1240 --
NM_001008711chr85486 479 198 144 57 ------
NM_001008738chr562933 2498 2371 2180 448 391 1806 ----
NM_001008744chr1441277 1247 565 480 ------
NM_001008801chr19----11982 3801 550 196
NM_001008895chr133341 309 196 --1209 --
NM_001008925chr453222 901 778 729 427 --3742 600 533 --
NM_001009554chr484566 4423 3949 3869 3410 2874 492 439 ------
NM_001009554chr484566 4423 3949 3869 3410 2874 492 439 ------
NM_001009567chr105580 552 464 158 83 --1449 --
NM_001009571chr741555 1353 1112 350 1540 11171 --
NM_001009881chr11237 1421 ----
NM_001009882chr11237 1421 ----
NM_001009899chr331768 813 627 22391 198 --1121
NM_001009959chr232464 1725 754 ------
NM_001009993chr224325 3055 11522 1817 24567 554
NM_001010000chr1873337 3274 3263 3194 2678 2344 344 13319 --11255
NM_001010852chr6--152 ----
NM_001010853chr662882 2319 2235 1250 980 455 ----12737
NM_001010854chr14------1279
NM_001010862chrX73009 2951 2672 1306 1001 540 493 ------
NM_001010867chr156229 1962 924 709 198 26041 5343 11593 36594 5024 2300
NM_001010888chrX24500 1127 23519 3369 43886 3013 720 378 24179 1247
NM_001010891chr5136669 6497 6430 5924 5091 4926 4863 4473 4259 2128 2103 1444 728 14487 3917 698 390 15962
NM_001010895chr95414 321 279 104 43 --31557 1446 543 --
NM_001010898chr133597 600 594 13753 --1374
NM_001010984chr162466 2021 2005 1985 1828 1676 --1908 --
NM_001010986chrX22428 1659 11668 ----
NM_001010989chr164575 559 364 100 ------
NM_001010990chr164575 559 364 100 ------
NM_001011513chr463906 3531 2588 2528 504 96 --11108 --
NM_001011537chr321454 709 31894 1880 209 --12173
NM_001011553chr72150 96 ------
NM_001011663chr102915 817 --1315 --
NM_001011666chr776296 6282 6092 6010 5413 4304 2050 --45862 606 241 108 --
NM_001011708chr242581 2018 1915 1849 ------
NM_001011713chr1451222 1212 1059 614 443 11415 2413 211 --
NM_001012393chr1193709 3361 3129 1507 1305 1286 1244 205 124 24114 3587 15013 --
NM_001012398chr164838 713 143 125 ------
NM_001012410chr31344 1330 ----
NM_001012420chr1512546 --12818 --
NM_001012423chr1512546 --12818 --
NM_001012456chr72127 22 ------
NM_001012614chr42269 253 ------
NM_001012751chr1031606 1290 634 --11932 --
NM_001012755chrX124924 4697 4370 3914 3894 3726 3313 3236 1817 1562 982 56 13834 24666 1133 --
NM_001012756chr1952440 2367 2361 2254 664 11006 ----
NM_001012761chr562406 1065 1026 741 221 192 22512 169 1817 --
NM_001012968chrX42444 1888 1719 60 32024 1072 965 12712 12494
NM_001012977chrX21365 1113 ------
NM_001012979chrX------1244
NM_001013031chr1043097 2913 2620 976 42500 2478 1212 853 13178 --
NM_001013398chr721484 1114 ------
NM_001013406chr731291 480 50 ------
NM_001013415chr431289 1248 373 1107 ----
NM_001013439chr3--1277 129 --
NM_001013703chr151451 ------
NM_001013843chr154860 194 173 101 1719 ----
NM_001014380chr1395465 5169 4028 1795 1547 1320 1098 341 107 2929 761 ----
NM_001014434chr12269 24 ------
NM_001014442chr13167 ------
NM_001014445chr175707 387 373 347 165 1691 1907 --
NM_001014446chr4128 ------
NM_001014797chr10117230 6828 5945 5741 5406 5197 3163 1907 1156 1108 762 --25475 5056 2784 770
NM_001014809chr43862 700 88 1240 1875 --
NM_001014831chr193800 261 166 ------
NM_001014832chr193800 261 166 ------
NM_001014834chr193800 261 166 ------
NM_001014835chr193800 261 166 ------
NM_001015045chr432200 569 354 1954 ----
NM_001015508chr83575 560 207 1248 ----
NM_001015877chrX62933 2727 2578 2338 2168 73 2973 571 ----
NM_001015880chr10--11711 21458 1186 --
NM_001017368chr172948 234 ------
NM_001017371chr2----11244 173
NM_001017395chr363252 2691 2684 2342 2292 194 22619 2430 187 --
NM_001017405chr41959 1344 ----
NM_001017415chr1--1241 1813 --
NM_001017416chr1--1241 1813 --
NM_001017424chr11266 --1577 1353
NM_001017425chr11266 --1577 1353
NM_001017440chr798272 8185 7621 7447 7382 5321 2468 2443 231 21314 610 22341 1678 16216
NM_001017523chr1231476 1401 1330 1574 144 --
NM_001017922chr151730 1213 1143 439 162 --11184 --
NM_001017923chr14128 ------
NM_001017926chr821603 192 11629 ----
NM_001017930chrX3976 968 279 --31426 385 317 --
NM_001017967chr16--2880 89 1925 --
NM_001017969chr94580 243 183 24 ------
NM_001017977chr11113 ------
NM_001017999chr122166 734 ------
NM_001017999chr122166 734 ------
NM_001018000chr122166 734 ------
NM_001018000chr122166 734 ------
NM_001018001chr122166 734 ------
NM_001018004chr153680 669 454 ------
NM_001018006chr153680 669 454 ------
NM_001018007chr153680 669 454 ------
NM_001018020chr153680 669 454 ------
NM_001018037chr921076 228 --1505 --
NM_001018057chr1121300 176 21208 904 21372 448 11252
NM_001018065chr985819 5349 4550 3999 2149 930 542 84 24721 4590 35442 5409 3720 --
NM_001018066chr985819 5349 4550 3999 2149 930 542 84 24721 4590 35442 5409 3720 --
NM_001018067chr1105305 5252 5208 4955 4255 3245 1473 845 540 201 21528 237 11347 --
NM_001018068chr1105305 5252 5208 4955 4255 3245 1473 845 540 201 21528 237 11347 --
NM_001018069chr1105305 5252 5208 4955 4255 3245 1473 845 540 201 21528 237 11347 --
NM_001018072chr1231476 1401 1330 1574 144 --
NM_001018074chr513721 23438 111 ----
NM_001018075chr513721 23438 111 ----
NM_001018076chr513721 23438 111 ----
NM_001018077chr513721 23438 111 ----
NM_001018115chr31602 1434 ----
NM_001018159chr161105 ------
NM_001018160chr161105 ------
NM_001020658chr121165 425 ----11275
NM_001020658chr121165 425 ----11275
NM_001020818chr1941904 1611 101 46 21602 245 2170 61 --
NM_001020819chr1941904 1611 101 46 21602 245 2170 61 --
NM_001020820chr1941904 1611 101 46 21602 245 2170 61 --
NM_001020821chr1941904 1611 101 46 21602 245 2170 61 --
NM_001023567chr1532241 1656 327 --22210 1736 --
NM_001024094chr513721 23438 111 ----
NM_001024218chr14----184 --
NM_001024226chr11183 11134 --11141
NM_001024227chr11183 11134 --11141
NM_001024228chr11183 11134 --11141
NM_001024455chrX32060 1916 382 --11956 --
NM_001024649chr562957 2809 2706 2029 880 408 ------
NM_001024660chr341350 1108 630 390 --41428 1216 509 107 --
NM_001024688chr871990 1823 1795 1581 1542 1490 788 1187 1754 1666
NM_001024808chr1211850 1467 ----
NM_001024847chr352337 1642 1579 894 497 ------
NM_001024947chr511056 ------
NM_001024948chr173487 3233 3074 2754 2412 1260 1165 ------
NM_001025076chr10146173 5921 5577 5461 3910 3817 1721 1574 1424 966 833 548 521 165 --24421 2066 14306
NM_001025077chr10167531 7279 6935 6819 5268 5175 4634 2932 2782 2324 2191 1906 1879 1523 1321 667 --25779 948 15664
NM_001025079chr394185 4172 3435 3305 2638 2629 696 238 164 1842 22817 1391 13461
NM_001025201chr21197 2653 570 1524 --
NM_001025233chr1252537 2041 1846 1792 835 --22431 279 --
NM_001025248chr1561283 1115 915 500 191 64 ------
NM_001025249chr1561283 1115 915 500 191 64 ------
NM_001025366chr631815 658 314 ------
NM_001025366chr631815 658 314 ------
NM_001025367chr631815 658 314 ------
NM_001025367chr631815 658 314 ------
NM_001025368chr631815 658 314 ------
NM_001025368chr631815 658 314 ------
NM_001025369chr631831 674 330 ------
NM_001025369chr631831 674 330 ------
NM_001025370chr631815 658 314 ------
NM_001025370chr631815 658 314 ------
NM_001025580chrX84280 3738 3091 1226 642 428 370 351 13100 33971 2996 461 --
NM_001025596chr111485 ------
NM_001025616chr441325 640 568 233 --11340 --
NM_001025777chr251151 377 301 64 45 ------
NM_001025780chr921505 30 ------
NM_001029835chr71327 ------
NM_001029858chr612391 33392 2941 2286 ----
NM_001029863chr632528 141 94 ----1387
NM_001029875chr582868 2642 2417 2399 2133 1167 933 106 ------
NM_001029882chr13620 593 277 ------
NM_001029882chr13620 593 277 ------
NM_001029884chr642239 1804 362 265 11092 --12598
NM_001030006chr1731083 536 170 32632 2051 1057 ----
NM_001030007chr1623676 2889 --12466 --
NM_001030055chr1464575 4376 4244 2989 1820 1494 --24681 4047 13758
NM_001030059chr10179 1311 ----
NM_001030272chr11159 ------
NM_001030273chr11159 ------
NM_001031623chr62553 71 --2429 341 --
NM_001031679chr1232846 296 109 ------
NM_001031685chr12897 279 1358 ----
NM_001031695chr2262151 1745 1147 674 627 171 --24210 3591 --
NM_001031700chr432309 703 296 ------
NM_001031702chr3185 ------
NM_001031710chr72932 83 ------
NM_001031711chr521339 642 --11820 --
NM_001031716chr24995 372 335 28 ------
NM_001031732chr472987 2436 2375 1380 1276 1150 1056 1286 11177 --
NM_001031743chr61157 ------
NM_001031746chr1041358 455 326 24 ------
NM_001031748chr122556 233 ------
NM_001031801chr221440 --1163 --
NM_001031803chr172307 231 ------
NM_001031804chr1683621 3438 3345 1490 1291 822 625 78 13356 2646 384 --
NM_001031812chr532369 1971 212 --1308 --
NM_001032279chr111371 ------
NM_001032280chr651724 1426 1274 598 306 ------
NM_001032296chr1372777 2738 2695 2196 2109 2048 1907 12923 12014 --
NM_001032380chr10------21803 1245
NM_001032393chrX1202 ------
NM_001032394chr652457 2325 1129 1055 131 ----12341
NM_001033047chr452629 2603 1005 491 358 22049 1741 ----
NM_001033057chr351838 619 485 452 42 --12122 --
NM_001033059chr621986 543 ----11689
NM_001033087chr2042860 2648 2333 1010 22286 1292 1915 --
NM_001033112chr53784 565 121 ------
NM_001033503chr51378 ----1465
NM_001033557chr241250 1137 248 112 1294 11156 --
NM_001033561chr174784 718 185 88 ------
NM_001033578chr822233 1597 ------
NM_001033602chr1362589 824 768 697 392 256 --1451 1312
NM_001033659chr171355 --11475 --
NM_001033756chr631749 592 248 ------
NM_001033756chr631749 592 248 ------
NM_001033925chr1061846 1681 1664 578 185 170 ------
NM_001034841chr16125523 5461 4982 4397 3779 1961 1634 1545 1431 1162 505 417 ------
NM_001034850chr541420 1301 1141 345 ------
NM_001034852chr1422040 251 --2567 371 --
NM_001034915chr821532 345 ------
NM_001034954chr1052963 2821 2253 1156 716 --1853 --
NM_001034955chr1052963 2821 2253 1156 716 --1853 --
NM_001034956chr1052963 2821 2253 1156 716 --1853 --
NM_001034957chr1052963 2821 2253 1156 716 --1853 --
NM_001035chr131060 1021 119 ------
NM_001035260chr1011506 ------
NM_001037164chr732014 1475 38 --1656 --
NM_001037165chr7178918 8880 8566 8544 8337 8330 7665 7646 7308 3131 2742 2578 2473 1501 1401 1215 574 38719 3025 1025 17525 --
NM_001037172chr33995 883 70 ------
NM_001037174chr242139 1769 613 193 1846 ----
NM_001037281chr161117 ------
NM_001037331chr181184 --1720 --
NM_001037332chr512341 ------
NM_001037333chr512341 ------
NM_001037535chrX1611 --11076 11554
NM_001037536chrX1611 --11076 11554
NM_001037540chrX1611 --11076 11554
NM_001037553chr2135074 4473 3806 11018 21494 733 --
NM_001037637chr51266 --1248 --
NM_001037954chr1153470 2988 1318 1183 664 13417 22517 716 --
NM_001038493chr221495 1476 ------
NM_001038702chr542761 2704 1077 249 --1158 --
NM_001038707chr172194 1924 1710 1602 807 680 21 --1292 --
NM_001038707chr172194 1924 1710 1602 807 680 21 --1292 --
NM_001039199chr2044151 4005 3968 3041 2711 309 1679 --
NM_001039348chr22849 410 ------
NM_001039349chr22849 410 ------
NM_001039457chr1151 ------
NM_001039459chr731108 999 988 ------
NM_001039465chr141447 --1332 --
NM_001039538chr283357 2462 2300 2257 1453 1295 920 475 --13212 --
NM_001039550chr21894 ------
NM_001039569chr253285 2730 2721 2187 705 --1426 --
NM_001039577chr164193 4009 3892 2881 1641 146 1499 12872 --
NM_001039580chr424193 1349 25011 1464 13084 14375
NM_001039590chrX63718 3631 3566 3451 3421 3274 --12877 --
NM_001039591chrX63718 3631 3566 3451 3421 3274 --12877 --
NM_001039618chr1184973 4659 3923 3749 2358 2166 1591 1163 ----24919 803
NM_001039693chr273747 3683 2774 1621 942 714 697 ------
NM_001039762chr1021588 206 --42376 2011 1947 773 --
NM_001039840chrX65543 5492 5337 4759 2372 1067 --14292 --
NM_001039937chr1333872 715 296 24139 1022 11567 --
NM_001039960chr1251250 1218 319 246 53 ------
NM_001040001chr671617 1576 1375 1323 1271 379 255 --11919 --
NM_001040020chr721568 1121 ----21137 986
NM_001040101chr411224 ------
NM_001040102chr1052425 2220 1717 1656 635 --1745 12455
NM_001040103chr1052425 2220 1717 1656 635 --1745 12455
NM_001040110chr771674 1618 1607 1339 496 110 28 ------
NM_001040134chr1911474 --1140 --
NM_001040135chr72706 538 ------
NM_001040142chr2----11533 --
NM_001040143chr2----11533 --
NM_001040147chr182701 619 ------
NM_001040152chr744005 3776 1791 1756 --24524 770 --
NM_001040153chr132320 245 ------
NM_001040158chr53416 399 111 ------
NM_001040159chr43273 250 191 ------
NM_001040214chr611533 ----12066
NM_001040272chr921745 175 --1548 --
NM_001040284chr1695156 4590 4309 3692 2310 2285 2127 877 670 15969 15174 --
NM_001040402chr452542 1014 781 178 44 11295 12034 --
NM_001040409chr211006 --2688 673 --
NM_001040429chr1343472 1185 836 156 ------
NM_001040441chr144835 4238 2126 1999 11089 ----
NM_001040446chr532593 1852 257 --1918 --
NM_001040450chr151607 ------
NM_001040453chr151607 ------
NM_001040458chr541903 1790 606 159 ------
NM_001040633chr7--1206 --1271
NM_001040665chr774932 4092 3988 1894 941 910 36 --34669 1476 148 --
NM_001040666chr71634 ------
NM_001040708chr81203 --1968 --
NM_001040709chr162532 2280 2153 2125 1833 1698 11989 ----
NM_001040712chr953384 2730 1001 781 505 --23569 986 --
NM_001040876chr431649 700 154 1490 --1269
NM_001042355chr1654668 3452 606 546 74 ------
NM_001042388chr181909 --1845 --
NM_001042412chr1654668 3452 606 546 74 ------
NM_001042413chr994108 3668 3496 1406 774 744 208 133 62 --11208 --
NM_001042414chr131117 ------
NM_001042425chr651724 1426 1274 598 306 ------
NM_001042453chrX31342 1218 1169 ------
NM_001042481chr1442270 2245 1830 1075 22281 1625 168 --
NM_001042486chr20----21181 75 --
NM_001042493chr661621 1586 660 522 410 40 11993 ----
NM_001042494chr1552950 1059 896 820 33 23745 1344 23872 3785 --
NM_001042495chr1552950 1059 896 820 33 23745 1344 23872 3785 --
NM_001042496chr1552950 1059 896 820 33 23745 1344 23872 3785 --
NM_001042497chr1552950 1059 896 820 33 23745 1344 23872 3785 --
NM_001042510chr861762 1753 1703 1639 1614 722 --1842 --
NM_001042511chr861762 1753 1703 1639 1614 722 --1842 --
NM_001042517chr131105 --2905 250 --
NM_001042537chrX52324 2170 942 483 264 12514 2344 190 --
NM_001042550chr951413 1339 497 392 121 11854 ----
NM_001042555chr12104158 3603 3523 1893 1642 931 851 808 775 41 23118 229 44756 4450 4341 3576 --
NM_001042599chr246604 4984 1110 103 26396 631 25039 963 17699
NM_001042601chr372914 2892 2798 2429 900 341 102 11306 ----
NM_001042603chr12114710 4295 3579 3500 3442 3384 3326 1946 1916 1568 1561 --22138 1734 --
NM_001042604chr394369 3963 3739 3617 3485 3450 3118 1195 598 --14312 --
NM_001042632chr2032278 2208 192 --12050 12011
NM_001042633chr2032278 2208 192 --12050 12011
NM_001042646chr331329 813 44 31703 622 351 ----
NM_001042669chr441325 640 568 233 --11340 --
NM_001042681chr162615 1853 1757 922 797 511 --2297 42 --
NM_001042682chr162615 1853 1757 922 797 511 --2297 42 --
NM_001042682chr162615 1853 1757 922 797 511 --2297 42 --
NM_001042683chr661718 1174 749 398 358 75 11140 ----
NM_001042749chrX51916 1845 1469 215 158 11770 11378 11756
NM_001042750chrX51916 1845 1469 215 158 11770 11378 11756
NM_001042751chrX51916 1845 1469 215 158 11770 11378 11756
NM_001042762chr72171 108 ----1687
NM_001043318chr1434136 1166 269 13607 11137 --
NM_001043351chr122244 1730 ----1598
NM_001044305chr61460 --21530 280 --
NM_001044387chr1922580 1599 1471 23849 198 --
NM_001044388chr1922580 1599 1471 23849 198 --
NM_001044722chr532369 1971 212 --1308 --
NM_001044723chr532369 1971 212 --1308 --
NM_001046chr522634 2315 11969 1251 --
NM_001077628chr13635 602 76 ------
NM_001079874chr152056 2028 1397 463 267 ------
NM_001083620chr431959 1892 206 12631 ----
NM_001099678chr376180 6157 5495 2309 1737 302 258 ----1248
NM_001100108chr1137922 7625 6986 5382 5375 5083 2490 2437 1838 1500 803 74 64 48191 1749 904 81 22909 1667 21979 143
NM_001104548chr11160 ------
NM_001106chr3199772 9703 9157 8864 8807 8637 8293 8162 8099 6989 6301 5927 3640 3116 3009 2743 2710 2265 197 --36732 3673 2939 --
NM_001113490chrX53053 2605 1390 535 70 23303 296 22476 2422 --
NM_001117chr18157 --12187 --
NM_001121chr1031176 519 220 ------
NM_001122679chr511236 ------
NM_001126chr14429 394 357 323 2839 351 ----
NM_001128chr1623676 2889 --12466 --
NM_001144chr1631258 1107 952 ------
NM_001146chr832029 1614 145 21962 778 12318 2867 706
NM_001148chr42703 441 --1318 1187
NM_001149chr102484 32 ------
NM_001159chr22716 704 ----1514
NM_001167chrX96489 2366 2178 1786 1500 1457 1388 1086 976 34879 2628 35 34724 2324 2234 --
NM_001173chr1464575 4376 4244 2989 1820 1494 --24681 4047 13758
NM_001178chr11159 ------
NM_001186chr2152756 2436 558 462 47 23229 2551 12375 --
NM_001189chr41331 ------
NM_001191chr2011205 --1160 1368
NM_001200chr2031059 1041 794 1421 1995 --
NM_001204chr2137183 6614 6506 5684 2647 2450 1925 1657 1361 1115 629 442 205 16218 47736 7636 5194 2112 --
NM_001206chr983031 2970 2763 2110 2056 2040 1930 485 ------
NM_001207chr51266 --1248 --
NM_001219chr722250 798 ------
NM_001233chr752181 2154 581 344 261 ------
NM_001237chr43913 63 24 1725 1947 --
NM_001237chr43913 63 24 1725 1947 --
NM_001253chr61253 147 ----
NM_001257chr1611041 ------
NM_001259chr7115761 5218 4761 4470 2333 2195 2076 2034 1617 1297 662 25248 2355 11023 --
NM_001263chr41111 --1430 --
NM_001268chr13121 ------
NM_001269chr13996 974 902 1225 ----
NM_001270chr531026 885 231 --1413 --
NM_001271chr154563 347 232 100 ------
NM_001273chr121374 ------
NM_001278chr1041200 475 388 177 ------
NM_001280chr192587 127 1226 1688 1276
NM_001282chr1731083 536 170 32632 2051 1057 ----
NM_001293chr111560 --1126 --
NM_001304chr1793761 3622 3600 3074 2971 2628 1112 490 161 1904 ----
NM_001310chr1222927 2618 11988 22650 1229 1463
NM_001313chr43862 700 88 1240 1875 --
NM_001319chr1921029 434 ------
NM_001326chr115384 317 306 139 93 ------
NM_001328chr42269 253 ------
NM_001329chr1041475 1229 1193 244 ----11163
NM_001330chr161956 ------
NM_001331chr1122128 2110 --2297 284 --
NM_001338chr2121235 953 --1254 --
NM_001351chr351857 1571 188 159 143 ------
NM_001356chrX32300 1785 611 1723 ----
NM_001363chrX3737 714 113 --1519 --
NM_001364chr1164458 1642 1241 1079 763 541 ------
NM_001379chr192277 215 ------
NM_001380chr101678 2853 777 --1150
NM_001386chr842305 2064 1680 869 --1430 --
NM_001387chr573032 2783 2620 1070 601 595 187 --12717 --
NM_001389chr212538 237 1465 ----
NM_001390chr1833008 860 753 1233 23201 2297 --
NM_001391chr18135 ------
NM_001396chr2122441 2366 ------
NM_001400chr12492 379 11255 ----
NM_001401chr911051 ------
NM_001406chr1751730 1529 1238 434 383 ------
NM_001407chr331299 1176 484 ------
NM_001408chr131693 1314 258 ------
NM_001412chrX53218 2857 1200 536 206 1603 ----
NM_001415chrX41790 1576 671 283 ------
NM_001417chr1231958 541 405 ------
NM_001418chr111590 1102 --1263
NM_001418chr111590 1102 --1263
NM_001419chr19104673 4619 4448 4315 1532 1064 841 431 391 385 24257 2962 44817 4392 2988 1087 --
NM_001420chr1952470 2242 2224 2115 1191 ------
NM_001427chr761947 1791 1357 581 206 128 ------
NM_001430chr241860 1695 709 359 1229 ----
NM_001431chr62992 288 --1246 1496
NM_001438chr113039 23112 2760 --12864
NM_001448chrX41116 168 156 114 ------
NM_001452chr61587 1549 ----
NM_001454chr171993 ------
NM_001463chr22797 259 --1228 --
NM_001482chr151785 ------
NM_001491chr642759 2732 2708 567 ------
NM_001494chr101292 1168 ----
NM_001495chr81168 ------
NM_001497chr941886 981 750 370 ------
NM_001498chr671313 1023 896 880 371 301 111 ------
NM_001511chr42623 170 1671 ----
NM_001514chr11394 ------
NM_001518chr72421 159 --2843 414 11021
NM_001527chr654801 3803 172 160 64 14246 33610 1661 632 13736
NM_001530chr142217 180 ------
NM_001541chr111166 ------
NM_001543chr544872 4579 3596 3286 14033 1678 14434
NM_001546chr621192 933 1134 ----
NM_001550chr72166 79 ------
NM_001560chrX42546 2099 2078 335 ------
NM_001565chr4--4723 602 262 110 ----
NM_001567chr111745 ----1588
NM_001584chr1131102 443 227 --1104 --
NM_001587chrX52142 1898 1724 234 113 ------
NM_001604chr113905 404 122 1818 11012 --
NM_001608chr23658 246 219 --1193 --
NM_001609chr1064109 3657 3509 2872 1286 163 11386 13669 1989
NM_001614chr171644 ------
NM_001614chr171644 ------
NM_001616chr222758 1009 12206 ----
NM_001619chr11162 ------
NM_001627chr331720 957 212 1154 ----
NM_001629chr132286 254 131 ----
NM_001630chr10--1825 ----
NM_001634chr621986 543 ----11689
NM_001635chr71675 11063 --1748
NM_001642chr1121169 1078 --1263 --
NM_001650chr1833845 1357 855 33167 823 228 1476 --
NM_001655chr1122015 74 --1725 --
NM_001656chr531378 270 29 ------
NM_001658chr11183 11134 --11141
NM_001663chr1452731 2639 723 561 161 --2700 320 11960
NM_001664chr3----11060 1965
NM_001677chr11396 ------
NM_001682chr1222701 1122 12156 12162 --
NM_001683chr33474 407 250 12416 12303 --
NM_001684chr184130 3768 3696 3237 3108 3004 2561 885 24050 828 22990 562 --
NM_001690chr322395 1874 ------
NM_001693chr861111 1079 949 246 51 45 --21179 1026 --
NM_001701chr921506 1494 ----1565
NM_001704chr62414 194 1139 1528 --
NM_001706chr31308 ----2854 797
NM_001709chr1162843 2703 2565 1957 430 145 ------
NM_001717chr1521510 938 --1134 1578
NM_001719chr202176 37 ------
NM_001726chr1------1141
NM_001730chr1341371 1331 591 421 ------
NM_001730chr1341371 1331 591 421 ------
NM_001731chr12----1690 --
NM_001735chr9172 ------
NM_001743chr22586 146 ------
NM_001746chr562957 2809 2706 2029 880 408 ------
NM_001753chr711594 ----1148
NM_001754chr2132876 868 640 --22940 2754 --
NM_001755chr163827 416 273 ------
NM_001759chr1285260 3758 3413 3354 1884 1122 1108 75 12046 11851 14831
NM_001760chr61726 1347 ----
NM_001777chr394185 4172 3435 3305 2638 2629 696 238 164 1842 22817 1391 13461
NM_001788chr72150 96 ------
NM_001792chr18----1277 1949
NM_001797chr161119 147 --1676
NM_001806chr1942890 567 548 363 1281 ----
NM_001822chr21197 2653 570 1524 --
NM_001826chr11463 ------
NM_001839chr11701 --1282 --
NM_001854chr12398 80 1934 11030 --
NM_001855chr9199 ----131
NM_001858chr6115175 5077 5007 4988 3135 1848 1778 829 760 749 249 34087 2019 1602 1286 1588
NM_001859chr943448 3087 1154 299 ------
NM_001880chr2126 ------
NM_001881chr101402 1359 1344 --
NM_001884chr5126 ------
NM_001893chr171373 ------
NM_001895chr20----1848 --
NM_001902chr11284 1381 1170 --
NM_001904chr3124 1180 ----
NM_001924chr12457 45 ------
NM_001935chr21356 153 ----
NM_001938chr151504 1464 1238 663 464 ------
NM_001942chr1812073 ------
NM_001948chr1561283 1115 915 500 191 64 ------
NM_001949chr633197 2801 677 22821 638 1790 --
NM_001954chr61214 --1855 --
NM_001962chr51126 ------
NM_001969chr1453218 1351 664 508 306 --13310 --
NM_001975chr121789 --1750 --
NM_001977chr42665 535 ------
NM_001981chr142318 2308 2147 1495 1392 --1892
NM_001982chr121226 ------
NM_001987chr1232965 627 393 --13865 13275
NM_001999chr51549 ------
NM_002006chr455830 4873 4347 3711 455 11310 1523 33619 1264 957
NM_002009chr1552782 1945 867 801 61 ----22692 1998
NM_002014chr12169 ------
NM_002015chr1373180 2726 2475 812 728 482 330 --1104 12936
NM_002017chr115936 310 288 132 100 ----1508
NM_002024chrX31373 345 255 32112 862 392 ----
NM_002025chrX119201 7746 6985 5749 3143 2307 1119 1112 775 708 98 39153 8942 7676 11046 16435
NM_002035chr1883636 2911 2463 1364 1191 809 439 101 ----13732
NM_002039chr43884 600 314 1907 2578 350 --
NM_002040chr2172824 2744 2569 2556 2357 1056 989 ----12196
NM_002051chr101438 ------
NM_002054chr21177 ------
NM_002056chr21872 1786 ----
NM_002061chr131776 219 146 --11578 --
NM_002063chrX1256 ----1334
NM_002069chr72583 422 21704 615 1307 --
NM_002074chr161528 1460 1264 1236 1098 252 ------
NM_002076chr1263124 3116 2960 2048 1124 1113 32986 2332 261 22704 294 --
NM_002082chr5129 ------
NM_002086chr1732164 436 216 ------
NM_002107chr12175 78 ------
NM_002126chr1763463 2621 1657 1171 563 437 --21446 1079 --
NM_002128chr1372486 2381 2030 1739 1626 311 265 ----1651
NM_002130chr551722 1619 1507 1195 1077 ------
NM_002137chr752073 2044 1848 915 388 --11992 --
NM_002138chr41633 ----1178
NM_002140chr92885 52 ------
NM_002148chr21141 ------
NM_002158chr273745 2749 2563 1259 765 605 80 11413 ----
NM_002166chr22258 186 --1508 --
NM_002193chr211600 ------
NM_002196chr201929 ------
NM_002196chr201929 ------
NM_002202chr51812 ------
NM_002210chr263364 2852 2349 1346 953 248 13174 1895 --
NM_002211chr1021108 923 ------
NM_002214chr794197 1989 1562 1069 981 863 783 669 582 13788 33639 1845 1267 --
NM_002222chr341215 1134 125 70 ------
NM_002232chr1----11262 --
NM_002239chr231183 260 110 ------
NM_002240chr212423 95 ------
NM_002247chr1062326 2297 1761 1615 428 88 ----1676
NM_002264chr364240 4133 3436 3401 562 102 14101 1483 --
NM_002267chr1332390 2257 1654 11571 --12323
NM_002268chr331526 1243 747 11231 ----
NM_002270chr5135574 5273 5200 5121 4928 4910 4582 3777 3481 2165 1995 591 475 --1490 --
NM_002271chr1362262 2149 1885 883 824 530 1963 ----
NM_002293chr132468 1969 1048 1850 22063 1090 12214
NM_002296chr141767 1591 1547 625 11306 ----
NM_002310chr596016 5814 1806 1617 1314 953 688 357 335 15392 12393 --
NM_002313chr1064855 4713 3969 3420 616 288 13379 64800 3575 3481 3239 1698 947 13587
NM_002335chr11147 ------
NM_002336chr1263350 1905 1264 1156 544 252 21369 1257 ----
NM_002356chr662879 2669 2654 2515 2377 1831 ------
NM_002358chr42646 49 --1505 --
NM_002374chr283357 2462 2300 2257 1453 1295 920 475 --13212 --
NM_002376chr14144 ------
NM_002387chr5105065 4803 4793 4608 3802 1828 1722 1276 1256 24 ----24044 2068
NM_002397chr5123 11408 ----
NM_002398chr2------1268
NM_002403chr11411 ------
NM_002408chr142788 742 1631 ----
NM_002430chr2272598 2182 1789 821 517 208 125 2984 365 1721 --
NM_002438chr105580 552 464 158 83 --1449 --
NM_002442chr1221768 1639 ------
NM_002473chr2221354 985 --1349 --
NM_002480chr121445 1537 --11048
NM_002481chr1177901 7557 7347 7102 6744 5865 5555 5088 2540 1832 1500 994 897 615 217 206 184 --33092 2853 1781 12511
NM_002485chr871990 1823 1795 1581 1542 1490 788 1187 1754 1666
NM_002487chr151732 ----1121
NM_002498chr132190 145 ------
NM_002501chr1933998 2597 2577 24008 3455 --1231
NM_002505chr651580 1337 1309 497 129 ----11302
NM_002509chr201680 ------
NM_002515chr1471977 1807 606 487 342 210 88 --11840 2689 331
NM_002519chr1131218 957 544 1323 ----
NM_002537chr152167 141 21009 871 1756 --
NM_002539chr2185 ------
NM_002543chr1231538 1339 42 1484 --11203
NM_002545chr1193709 3361 3129 1507 1305 1286 1244 205 124 24114 3587 15013 --
NM_002547chrX94055 3817 3627 3441 3305 2897 1283 843 49 --13576 2964 331
NM_002572chr112291 49 ------
NM_002577chr3104053 3930 3792 3771 3553 1598 1344 964 659 375 ------
NM_002579chr1911474 --1140 --
NM_002581chr9115670 5580 5567 5505 4590 4109 4039 3991 3467 1412 387 35554 5208 1339 ----
NM_002585chr12396 250 ------
NM_002586chr621621 1019 --11568 --
NM_002588chr531737 568 445 ------
NM_002590chr131529 ------
NM_002591chr201643 --1512 --
NM_002594chr2012210 ------
NM_002595chr1221812 1580 11771 11715 --
NM_002610chr242786 410 311 240 1104 12182 --
NM_002612chr721791 1683 --1279 --
NM_002628chr32895 861 ------
NM_002641chrX3349 327 44 --1393 --
NM_002645chr1132304 361 333 ----1696
NM_002655chr874907 4157 4039 3807 3267 2030 1306 ------
NM_002657chr2023229 28 1552 41527 1439 1395 922 --
NM_002667chr61313 ------
NM_002670chr341613 1506 1485 341 ------
NM_002687chr1421261 521 1883 ----
NM_002699chr111239 --1415 --
NM_002706chr22533 110 ------
NM_002709chr263517 3331 3106 2390 2289 906 2842 408 ----
NM_002713chr1------1776
NM_002714chr621007 156 --1980 --
NM_002715chr53911 468 456 31186 1035 119 11243 --
NM_002716chr1193715 3696 3398 2576 1430 943 930 854 797 2222 66 22278 2234 --
NM_002719chr1462255 2005 766 373 353 315 --2468 40 32060 927 521
NM_002721chr92398 184 ------
NM_002727chr102200 130 ------
NM_002730chr1921411 28 ----11287
NM_002731chr141275 815 647 298 12750 22572 823 12094
NM_002734chr1751990 1932 1399 580 211 11784 ----
NM_002736chr732069 804 553 --21972 485 --
NM_002737chr1776302 5672 5477 4315 2086 1401 1370 --14073 --
NM_002742chr142528 515 ------
NM_002745chr2264119 4107 3560 3099 3024 54 14279 167 --
NM_002747chr1821959 587 1695 ----
NM_002748chr151406 --1127 1175
NM_002755chr151699 ------
NM_002763chr12196 172 ------
NM_002806chr141330 --1372 --
NM_002814chrX3648 633 181 --1105 --
NM_002815chr17------1168
NM_002816chr17--1295 ----
NM_002821chr6----1234 1600
NM_002822chr122297 33 1239 ----
NM_002825chr73607 464 267 ------
NM_002828chr182968 749 --1708 --
NM_002835chr71783 1625 ----
NM_002839chr953384 2730 1001 781 505 --23569 986 --
NM_002840chr131586 665 659 11238 ----
NM_002841chr33665 500 124 ------
NM_002843chr1143204 3129 2197 505 23220 661 1756 --
NM_002844chr641431 1056 920 187 --1550 --
NM_002849chr121808 ------
NM_002851chr74733 577 80 42 --2635 570 --
NM_002858chr1195 ------
NM_002868chr1242341 1905 1768 398 --22298 2087 --
NM_002874chr922156 784 ------
NM_002880chr32805 604 199 ----
NM_002886chr384834 4715 4467 4009 3619 3436 1857 472 44513 4090 2059 1925 --14702
NM_002890chr52958 346 ------
NM_002892chr1431384 1341 1187 ----1692
NM_002894chr182205 37 ------
NM_002897chr23169 116 105 128 ----
NM_002906chr1181608 1536 829 823 611 328 189 27 ------
NM_002911chr1951706 1593 505 330 93 --11678 --
NM_002912chr61356 ------
NM_002920chr12--1352 ----
NM_002928chr141362 1306 445 88 1312 ----
NM_002940chr431649 700 154 1490 --1269
NM_002941chr32504 315 31668 1562 1166 ----
NM_002942chr32904 175 2573 348 ----
NM_002956chr1231030 882 225 ----1208
NM_002971chr32817 176 ----1316
NM_002973chr121589 ------
NM_002979chr11807 1739 --1705
NM_002984chr17--1277 ----
NM_002994chr42632 274 --156 --
NM_002998chr81856 2864 94 12252 --
NM_003011chr921178 122 1153 ----
NM_003012chr821988 137 1450 12712 1821
NM_003014chr72938 167 --11406 --
NM_003015chr101722 196 ----
NM_003016chr1711684 ------
NM_003017chr6176 21176 968 ----
NM_003022chrX2889 864 1126 1464 --
NM_003026chr931216 976 840 ----1270
NM_003029chr12983 542 11417 1480 --
NM_003030chr321819 227 ------
NM_003031chr162903 285 ------
NM_003034chr1287965 6820 6379 6316 5282 2522 1722 50 16667 15965 --
NM_003035chr12939 330 ----1177
NM_003036chr11154 ------
NM_003042chr342270 1775 533 362 --11418 --
NM_003048chr211075 ------
NM_003060chr511314 ------
NM_003068chr831030 1011 915 ------
NM_003069chrX1166 ------
NM_003070chr91644 ------
NM_003071chr371848 1664 1622 1394 594 71 46 ------
NM_003073chr221299 ------
NM_003074chr32756 349 ------
NM_003076chr1241623 654 648 545 ------
NM_003079chr171730 ------
NM_003082chr1441050 473 149 22 --137 --
NM_003093chr6----2174 86 --
NM_003096chr21180 ------
NM_003099chr1585311 5044 1443 793 626 514 493 332 --11305 --
NM_003101chr13606 594 522 --1585 --
NM_003106chr341067 936 733 363 ------
NM_003107chr632004 1639 150 --1424 --
NM_003108chr2107281 5818 5761 5563 5050 2857 2130 1999 1800 238 ----26754 4478
NM_003111chr2----11244 173
NM_003112chr743230 2849 2433 1042 1107 ----
NM_003113chr22303 257 --1805 --
NM_003130chr731131 164 153 ------
NM_003131chr6171 ------
NM_003133chr11890 1177 ----
NM_003136chr14--1251 ----
NM_003137chr642229 1964 1434 505 11811 ----
NM_003140chrY1100 ------
NM_003144chr652133 1771 1548 751 410 12177 ----
NM_003145chr11468 ------
NM_003155chr842409 946 832 67 ----12393
NM_003161chr1762874 2600 2359 1167 1109 335 1917 ----
NM_003162chr23270 164 144 --1407 --
NM_003174chr10----1334 1118
NM_003178chr32209 109 ------
NM_003185chr2041302 1031 350 111 ------
NM_003188chr62856 630 ------
NM_003189chr133420 2126 665 140 ----
NM_003194chr61387 ------
NM_003198chr11296 ------
NM_003199chr1844914 1999 1847 1780 35664 5656 4378 ----
NM_003201chr101290 1364 ----
NM_003206chr61416 ------
NM_003211chr122472 39 ------
NM_003217chr1221780 1249 --1440 --
NM_003220chr651724 1426 1274 598 306 ------
NM_003221chr674220 4130 3515 1352 994 746 259 23048 203 13210 --
NM_003234chr342130 1805 1567 529 12059 1715 --
NM_003236chr253157 3027 2925 2643 426 --12782 --
NM_003242chr352337 1642 1579 894 497 ------
NM_003246chr15------1176
NM_003253chr2141618 1583 617 135 ----11848
NM_003257chr154977 903 896 347 ------
NM_003259chr191152 ------
NM_003262chr395008 4230 3729 3460 1406 1152 898 450 313 ------
NM_003274chr2152714 2605 2019 1898 158 1171 11198 --
NM_003275chr91193 --1120 --
NM_003290chr1921144 1020 ------
NM_003291chr132203 40 197 ----
NM_003292chr121894 1472 11901 ----
NM_003298chr366065 5797 5752 4332 4161 794 12050 12275 --
NM_003304chr341000 591 259 179 11185 ----
NM_003318chr62301 201 ------
NM_003319chr24789 278 240 107 --1930 --
NM_003336chrX3837 741 242 --1141 1269
NM_003337chr51374 ----1269
NM_003338chr1041974 1421 1324 369 ------
NM_003340chr411124 --1176 --
NM_003342chr1753211 3176 3167 1276 390 2802 594 22807 1098 --
NM_003344chr761505 1338 1215 1175 1089 702 ------
NM_003347chr2221839 209 --2610 145 --
NM_003350chr8--1170 11011 --
NM_003352chr22831 400 1165 160 --
NM_003359chr431158 1123 935 ------
NM_003360chr42285 218 ------
NM_003362chr122846 840 ------
NM_003368chr1--1241 1813 --
NM_003369chr1172672 2634 2406 2316 1787 819 632 12225 12503 --
NM_003370chr192800 638 ------
NM_003371chr9--11959 12161 --
NM_003372chrX----2710 31 1701
NM_003376chr631815 658 314 ------
NM_003376chr631815 658 314 ------
NM_003379chr63732 716 179 ------
NM_003387chr232727 2370 369 ------
NM_003390chr1141059 974 835 109 ------
NM_003392chr393585 3544 3520 3338 3309 3285 2990 1665 1578 1932 11212 --
NM_003394chr122717 637 ------
NM_003400chr21666 --1614 --
NM_003404chr2022011 218 ----11372
NM_003405chr221600 ------
NM_003406chr841909 1371 1332 83 1206 ----
NM_003409chr1871307 1289 1227 1197 507 423 182 ------
NM_003410chrX63101 2760 2251 2183 1929 268 11163 22621 1237 --
NM_003411chrY41740 1260 671 648 ------
NM_003412chr31356 ------
NM_003413chrX41988 1524 691 87 --11712 --
NM_003418chr31788 ------
NM_003423chr1922391 522 11900 ----
NM_003432chr52515 214 ------
NM_003439chr773085 2853 2699 2318 832 685 661 --12997 --
NM_003442chr11----195 --
NM_003453chr131107 ------
NM_003454chr1651514 1398 1202 362 64 ------
NM_003458chr32466 189 11160 13392 --
NM_003463chr633072 1187 126 ------
NM_003467chr22136 96 1367 --1446
NM_003468chr264120 4071 3570 3013 146 65 1869 11391 --
NM_003469chr22427 339 ------
NM_003472chr61616 11506 ----
NM_003474chr1022015 69 22035 1479 31789 1562 265 --
NM_003478chr1172997 2773 2191 2062 688 638 323 13044 12154 --
NM_003482chr1242742 2297 987 579 --22471 1776 12465
NM_003483chr1242816 2658 2053 287 1761 ----
NM_003487chr17160 ------
NM_003489chr2122325 22 ----1860
NM_003505chr721886 345 --11637 --
NM_003506chr811055 --11111 --
NM_003507chr221691 1327 --21507 142 --
NM_003557chr121490 1215 --1436 --
NM_003558chr92725 698 ----1145
NM_003563chr1721003 390 --11260 11187
NM_003566chr1273250 3212 2855 2733 2248 1222 1187 1852 13118 --
NM_003567chr11314 ------
NM_003574chr1895802 5359 4808 4388 4185 3940 926 542 279 44787 4769 941 820 11863 --
NM_003576chr1372777 2738 2695 2196 2109 2048 1907 12923 12014 --
NM_003580chr81106 1449 --1517
NM_003581chr211062 ------
NM_003583chr1253832 3630 2589 1041 196 12635 ----
NM_003589chr133341 309 196 --1209 --
NM_003590chr283894 3686 3673 3615 2886 2794 1055 260 21272 1175 162 --
NM_003591chr101117 ------
NM_003592chr71481 ------
NM_003597chr252170 1505 902 467 207 21623 627 ----
NM_003603chr422114 387 ----1644
NM_003607chr164101 3362 2889 2782 2769 143 12983 33882 2972 1643 --
NM_003613chr153667 212 102 ------
NM_003615chr383645 3603 3161 2977 1281 816 581 529 1205 1871 --
NM_003618chr221205 1108 ------
NM_003620chr171138 --1802 1876
NM_003629chr173372 3022 2985 768 181 50 27 ------
NM_003630chr63695 580 198 ------
NM_003644chr1746269 5054 1706 303 24535 2286 24429 1098 36612 2350 820
NM_003659chr211053 1135 --150
NM_003663chr373417 2825 2522 2140 1198 1109 117 1482 1845 12377
NM_003671chr943353 3089 2822 2803 12981 23293 2269 --
NM_003672chr181987 1675 1669 719 533 466 239 30 ------
NM_003676chr11645 ------
NM_003677chr1221521 902 ----11903
NM_003685chr193837 818 713 --1928 --
NM_003687chr5--11067 ----
NM_003692chr92244 154 11031 ----
NM_003705chr21786 ------
NM_003711chr5138 ------
NM_003713chr141585 1131 560 482 --21121 55 --
NM_003714chr543113 2454 2366 873 ------
NM_003716chr3----1714 --
NM_003718chr72564 393 ------
NM_003722chr372591 2415 2004 1942 1053 1039 773 12613 22371 567 12459
NM_003735chr531737 568 445 ------
NM_003736chr531737 568 445 ------
NM_003741chr31378 ------
NM_003743chr211768 ------
NM_003744chr1421128 862 ------
NM_003749chr1332216 1805 1794 1295 199 --
NM_003759chr474218 3377 3051 2638 947 937 239 1356 --23691 1398
NM_003763chr2042944 2808 671 253 ------
NM_003766chr171216 1509 ----
NM_003772chr1131332 1019 904 1153 ----
NM_003777chr71557 ------
NM_003778chr32697 686 ------
NM_003783chr151221 1089 478 315 89 ------
NM_003784chr182701 619 ------
NM_003787chr1851409 1352 1187 1058 682 ------
NM_003794chr32682 428 ------
NM_003795chr62135 64 1605 ----
NM_003800chr642249 1507 777 579 --11529 --
NM_003816chr851474 1224 1043 335 72 --11499 --
NM_003822chr163091 2619 2348 2019 993 327 11983 13131 --
NM_003825chr1551289 573 485 285 161 2258 236 2612 83 --
NM_003831chr1831757 1548 1312 ------
NM_003860chr111347 --1142 --
NM_003861chr1442674 1875 599 318 11087 1377 --
NM_003872chr251022 888 569 285 241 --22365 2001 --
NM_003873chr1031985 1013 517 12311 1591 --
NM_003884chr361854 1714 1317 1291 558 67 ------
NM_003885chr1752369 2015 778 590 68 ------
NM_003887chr241550 1414 358 111 21589 189 1748 --
NM_003893chr101492 ------
NM_003895chr2172065 2008 1648 1625 787 428 202 1660 ----
NM_003899chr1351766 954 791 380 37 ----12339
NM_003902chr11826 1731 --1790
NM_003905chr161105 ------
NM_003908chr20--21062 534 1321 --
NM_003909chr832295 2093 627 33021 2440 1874 --12334
NM_003913chr664124 3523 3355 1389 1315 394 43717 1250 1007 325 --1859
NM_003921chr121815 1786 --11800 --
NM_003922chr151372 ------
NM_003930chr742136 1888 447 253 11794 12284 21704 1680
NM_003932chr2231778 1640 208 --21799 697 --
NM_003934chr921259 348 ------
NM_003947chr32873 411 ------
NM_003948chr482509 2397 2325 2180 1713 1690 423 287 12706 ----
NM_003953chr132795 571 560 ----12453
NM_003955chr1711276 ------
NM_003971chr17--1574 1416 --
NM_003980chr641493 1368 1126 100 21378 526 1110 --
NM_003983chr1663542 2968 1298 529 397 247 13273 --13794
NM_003994chr1254242 4003 3274 2845 131 --11389 22936 1498
NM_004006chrX22588 2416 12497 --22512 668
NM_004007chrX22588 2416 12497 --22512 668
NM_004009chrX22588 2416 12497 --22512 668
NM_004010chrX22588 2416 12497 --22512 668
NM_004011chrX22588 2416 12497 --22512 668
NM_004012chrX22588 2416 12497 --22512 668
NM_004013chrX22588 2416 12497 --22512 668
NM_004014chrX22588 2416 12497 --22512 668
NM_004015chrX22588 2416 12497 --22512 668
NM_004016chrX22502 2330 12411 --22426 582
NM_004017chrX22588 2416 12497 --22512 668
NM_004018chrX22502 2330 12411 --22426 582
NM_004020chrX22588 2416 12497 --22512 668
NM_004021chrX22502 2330 12411 --22426 582
NM_004022chrX22502 2330 12411 --22426 582
NM_004023chrX22502 2330 12411 --22426 582
NM_004028chr1833845 1357 855 33167 823 228 1476 --
NM_004040chr231346 1325 1085 ------
NM_004046chr18137 ------
NM_004047chr1151 ------
NM_004050chr1422169 726 21758 419 1584 --
NM_004061chr52592 195 ------
NM_004063chr831069 981 956 ------
NM_004067chr7192 ------
NM_004080chr74601 545 181 127 11430 ----
NM_004081chrY61597 1180 418 283 254 231 --1151 --
NM_004086chr141276 1568 ----
NM_004087chr342059 1396 1301 609 11251 11346 --
NM_004094chr1443068 658 568 258 --2889 78 12387
NM_004096chr1031976 1549 770 11403 ----
NM_004098chr10------11121
NM_004100chr642707 1668 1057 1011 1879 ----
NM_004105chr22849 410 ------
NM_004107chr191180 ------
NM_004114chrX51087 984 470 454 367 --11182 --
NM_004124chr1492605 2499 2365 2339 2220 1382 1367 1025 711 --13455 --
NM_004126chr71288 --154 --
NM_004130chr32645 617 1108 1573 --
NM_004133chr821817 422 22479 2042 ----
NM_004136chr1563189 2728 2344 2188 1219 349 ------
NM_004145chr19----1378 --
NM_004157chr32746 252 ------
NM_004162chr311309 ------
NM_004169chr171152 ------
NM_004170chr941740 556 542 224 --1749 11404
NM_004171chr11129517 8883 8746 8637 6712 5997 3432 2600 1334 593 417 280 18394 18768 --
NM_004172chr522058 402 ------
NM_004175chr221174 ------
NM_004215chr81212 ------
NM_004229chrX1320 22209 1470 --11652
NM_004232chr1893235 2999 2771 1510 1401 1008 496 187 113 1669 13380 --
NM_004235chr91872 ------
NM_004237chr52580 329 ----1920
NM_004238chr21264 --1229 --
NM_004242chr61319 ------
NM_004244chr121438 --1109 --
NM_004252chr171151 1453 ----
NM_004261chr15937 784 677 302 79 ------
NM_004263chr23418 303 147 --41622 1347 515 106 --
NM_004272chr531910 1395 647 --1585 11665
NM_004274chr1481062 1038 729 487 355 258 214 174 13076 23187 2902 11162
NM_004279chr771987 1872 1457 797 335 267 178 2879 770 ----
NM_004280chr62176 163 ------
NM_004282chr61156 --179 --
NM_004286chr221271 --11755 --
NM_004291chr51100 ------
NM_004293chr942699 676 101 45 --21111 26 --
NM_004319chr142989 1070 554 177 --12560 12841
NM_004326chr141034 1027 757 324 ------
NM_004338chr1886151 5924 4835 2451 2155 1571 1167 634 27045 5734 --36951 4375 2440
NM_004342chr732054 1530 376 1880 ----
NM_004346chr41384 ------
NM_004349chr82873 420 --11077 --
NM_004352chr163499 458 117 ------
NM_004354chr41728 ----1653
NM_004365chr52258 230 --195 --
NM_004370chr62832 290 ------
NM_004379chr231268 1242 686 21366 625 ----
NM_004384chr532369 1971 212 --1308 --
NM_004385chr5--128 1250 --
NM_004392chr1352076 1880 1816 553 128 1732 32483 1830 167 1241
NM_004393chr332362 1458 491 ------
NM_004396chr17--1221 ----
NM_004397chr1163723 2655 1529 1130 1005 261 23200 2800 13513 --
NM_004412chr10105899 5676 5041 4124 2415 1892 1850 1537 842 380 --14632 14452
NM_004428chr12758 742 2611 168 ----
NM_004430chr811841 12256 12231 --
NM_004432chr922388 1905 ----12001
NM_004437chr151302 1111 925 918 260 --42587 2438 1405 1230 --
NM_004438chr252925 2083 1062 946 300 12769 ----
NM_004439chr4------1175
NM_004440chr611723 ------
NM_004442chr11289 11138 11446 --
NM_004448chr171481 ------
NM_004449chr2121022 391 --11106 11323
NM_004450chr142250 75 ------
NM_004454chr342147 1925 1406 814 1587 ----
NM_004457chr21297 11585 ----
NM_004458chrX32642 188 178 151 11652 --
NM_004464chr493895 3631 3090 2913 2744 1379 632 428 69 14079 ----
NM_004480chr142826 259 ------
NM_004481chr132353 2097 2013 --1582 --
NM_004482chr23696 363 75 ------
NM_004497chr191588 ------
NM_004500chr1471857 1717 1421 1289 570 205 118 --1334 --
NM_004501chr144085 3697 250 64 13325 22650 960 --
NM_004504chr242809 2557 1051 648 ------
NM_004505chr171435 ----11466
NM_004506chr62681 667 ------
NM_004514chr1753052 2430 1925 805 553 1566 ----
NM_004520chr51269 ------
NM_004523chr10----1544 1529
NM_004524chr172279 203 ------
NM_004525chr211532 ----11446
NM_004529chr941461 1302 965 83 ------
NM_004535chr2061471 1435 498 476 321 251 2484 311 ----
NM_004537chr1231465 362 248 ----1171
NM_004538chrX3804 734 124 ------
NM_004569chr142193 70 1722 ----
NM_004571chr21103399 3273 2942 2926 2841 1285 1054 763 351 61 ------
NM_004575chr441488 1460 1254 1132 1566 --11206
NM_004576chr53373 164 56 --1285 --
NM_004577chr71532 ------
NM_004583chr171747 ------
NM_004586chrX65085 4943 4771 4381 3811 54 14296 --25340 1267
NM_004593chr31771 2210 162 ----
NM_004598chr542745 1104 529 28 ----12733
NM_004599chr221453 ------
NM_004600chr151331 550 529 366 275 1379 ----
NM_004612chr964210 4048 3948 3437 592 477 --24458 1602 --
NM_004630chr1121208 1102 --1890 --
NM_004654chrY21114 201 ------
NM_004660chrY62293 2090 850 607 576 528 ------
NM_004663chr1531453 1236 974 --11163 --
NM_004664chr121265 ------
NM_004670chr10--11711 21458 1186 --
NM_004671chr182310 77 ------
NM_004673chr14991 456 251 113 ------
NM_004685chr1332751 521 206 ----12210
NM_004687chr1731620 1585 645 11852 11382 --
NM_004697chr9396 85 53 ------
NM_004701chr15----1121 --
NM_004703chr1721957 525 22155 2038 ----
NM_004707chr541622 1387 1380 70 1343 --1322
NM_004709chrX4700 333 143 77 11762 1178 --
NM_004717chr7--11192 ----
NM_004719chr1252670 2218 2210 1874 1095 1352 ----
NM_004725chr1031328 269 256 ----1577
NM_004726chrX84256 4202 3598 3540 1411 1085 621 345 --13711 --
NM_004730chr542002 1937 1467 264 21610 1425 ----
NM_004731chr1221838 160 ------
NM_004733chr3147 ------
NM_004734chr1332767 723 648 2385 242 --11214
NM_004736chr121929 35 --1620 --
NM_004738chr2042657 2357 743 480 11016 --12300
NM_004739chr111657 1632 --1577
NM_004740chr17136 ------
NM_004741chr1041559 1484 588 177 ------
NM_004742chr351758 1650 1593 1412 1374 ------
NM_004744chr483905 3802 3608 2796 1576 1044 849 622 ------
NM_004745chr887040 6895 6666 6512 6360 4862 4395 1747 25252 290 1639 34363 2616 1416
NM_004748chr1543795 3519 2571 884 11273 14178 --
NM_004755chr1421156 312 1440 ----
NM_004760chr782350 2281 1974 1879 1735 1709 1609 741 12399 ----
NM_004762chr1731893 1852 1285 21774 1456 ----
NM_004768chr121068 234 ------
NM_004772chr521357 172 ------
NM_004774chr1753047 2896 2518 1975 309 1951 11026 --
NM_004775chr1872241 2040 1946 1768 1475 563 397 ------
NM_004781chr1----11121 --
NM_004781chr1----11121 --
NM_004792chr22197 83 ------
NM_004794chrX143 ------
NM_004796chr1442448 2166 1525 557 ----132
NM_004798chr2063588 3202 2660 1254 499 359 12716 ----
NM_004800chr13184 1231 ----
NM_004801chr211094 1240 ----
NM_004805chr21410 ------
NM_004808chr1032710 2248 674 12885 ----
NM_004817chr93794 540 79 --1567 --
NM_004821chr52672 509 ------
NM_004822chr171962 ------
NM_004824chr661429 1261 1060 381 300 163 ------
NM_004831chr191443 11020 1694 --
NM_004834chr253215 1246 897 738 138 1977 ----
NM_004836chr24669 220 187 98 ------
NM_004841chr13795 319 225 ------
NM_004842chr621802 600 ------
NM_004845chrX73644 3067 2988 2947 1201 1117 649 --23934 158 --
NM_004855chr15----1212 --
NM_004857chr1423170 410 --24642 4135 --
NM_004859chr1792843 2080 2042 980 971 934 860 853 98 --22620 1938 --
NM_004869chr1821595 541 ------
NM_004871chr1754300 4279 2917 2896 191 24361 239 33458 3039 291 12806
NM_004874chr8--1184 --1191
NM_004884chr1541518 1284 1247 416 ------
NM_004893chr53416 399 111 ------
NM_004895chr13501 495 35 ------
NM_004896chr1011421 ------
NM_004898chr492841 2741 2608 2271 1870 945 745 356 223 11000 --11940
NM_004904chr776296 6282 6092 6010 5413 4304 2050 --45862 606 241 108 --
NM_004906chr63606 533 469 ------
NM_004912chr731291 480 50 ------
NM_004921chr142355 1757 432 270 ------
NM_004927chr1121423 270 ------
NM_004946chr52511 416 ------
NM_004947chr342080 1903 290 244 ------
NM_004956chr743398 2950 1493 300 ------
NM_004965chr213499 301 94 ------
NM_004966chr102996 151 ------
NM_004967chr41497 ------
NM_004972chr94456 374 166 51 --1821 --
NM_004973chr641766 1713 1556 1393 11381 ----
NM_004985chr1294358 3398 3003 1619 1528 1312 921 201 167 14176 33961 2961 1338 --
NM_004992chrX138373 8279 7073 6636 6310 5804 5424 5412 5316 3271 3057 932 398 --26253 1827 11969
NM_004992chrX138373 8279 7073 6636 6310 5804 5424 5412 5316 3271 3057 932 398 --26253 1827 11969
NM_004993chr1481501 1230 1015 976 550 537 484 361 1583 2503 232 --
NM_004996chr1641702 1512 508 320 --1648 --
NM_004999chr6134387 4146 3743 3211 3170 1745 1251 1187 1061 763 751 574 312 12846 11685 --
NM_005006chr2124 1694 ----
NM_005011chr771674 1618 1607 1339 496 110 28 ------
NM_005020chr71553 1586 ----
NM_005023chr511485 1221 1615 --
NM_005036chr2278335 8211 7683 1489 1404 946 37 36096 2586 1169 ----
NM_005045chr71845 ------
NM_005053chr192585 56 ------
NM_005054chr221521 1410 11214 11279 --
NM_005056chr12114954 4539 3823 3744 3686 3628 3570 2190 2160 1812 1805 --11978 --
NM_005063chr1063629 3481 3188 2568 988 812 --23430 950 --
NM_005065chr1455021 3842 1400 1141 671 ----1352
NM_005080chr222773 724 --1652 --
NM_005087chr3--1277 129 --
NM_005095chr162210 2191 2181 1575 871 199 ----1219
NM_005104chr62597 480 ------
NM_005105chr14708 198 157 27 --1794 --
NM_005109chr352562 2394 1826 560 139 ------
NM_005112chr42698 171 ------
NM_005116chr2064447 4323 1647 1506 1447 949 24288 3246 13387 --
NM_005119chr12837 340 ------
NM_005121chr1773500 3150 2531 1045 966 457 392 11456 --13519
NM_005125chr111150 ------
NM_005126chr331877 1533 383 --11948 --
NM_005133chr111371 ------
NM_005134chr181909 --1845 --
NM_005135chr1552950 1059 896 820 33 23745 1344 23872 3785 --
NM_005148chr17137 --1104 1567
NM_005156chr994968 4645 4326 4163 3577 3401 3318 1217 583 34140 1202 868 ----
NM_005160chr22106792 6601 6515 5609 5556 5454 2714 1283 1147 731 56449 5764 5692 1813 1729 34375 4268 207 1758
NM_005171chr1231071 889 66 11151 ----
NM_005180chr102587 375 ------
NM_005188chr11157830 7083 6306 6091 5892 3280 3075 2781 2704 2079 1425 1320 1136 713 612 25775 2944 37877 1749 1554 12535
NM_005192chr141130 --148 --
NM_005197chr1495751 5143 4989 4191 3965 1861 1453 755 123 --45079 4010 3856 1333 --
NM_005201chr31339 ------
NM_005203chr10------168
NM_005206chr1721028 148 1505 ----
NM_005215chr181507 ------
NM_005233chr322163 668 11657 ----
NM_005235chr246604 4984 1110 103 26396 631 25039 963 17699
NM_005238chr1163523 3469 2172 1319 1036 515 ------
NM_005239chr213812 768 291 1485 ----
NM_005241chr341263 1020 979 467 ------
NM_005242chr531316 1128 531 ------
NM_005245chr42696 70 1190 ----
NM_005252chr141536 --1617 --
NM_005254chr152345 215 --1150 --
NM_005256chr11------1623
NM_005257chr1821377 1126 ------
NM_005259chr25353 307 222 205 46 11541 ----
NM_005264chr104610 372 291 67 ------
NM_005273chr71339 ------
NM_005277chr42397 259 31270 650 553 11509 --
NM_005295chr7143 ------
NM_005296chrX3822 408 145 ------
NM_005302chr7160 ------
NM_005308chr102335 189 ------
NM_005311chr742882 2514 2112 485 22705 417 ----
NM_005313chr151361 ----11046
NM_005318chr2211050 --1415 --
NM_005328chr81588 ----1615
NM_005329chr1632345 1745 382 31497 778 231 ----
NM_005336chr231955 1814 1417 1595 ----
NM_005338chr72431 206 ----14061
NM_005339chr464349 1591 1302 1239 962 880 --1753 --
NM_005342chrX52783 2424 2051 668 265 22618 2494 --1383
NM_005349chr42482 246 ------
NM_005359chr18136211 5434 5335 5126 4437 4269 2254 2008 1933 1921 1421 1109 616 14936 --22409 397
NM_005373chr111244 ----11499
NM_005374chr1742414 2261 1872 902 --32398 1533 386 --
NM_005385chr342289 1898 692 359 1527 22050 1835 --
NM_005392chr941877 1725 1359 1166 ------
NM_005398chr1011154 ------
NM_005399chr164344 1315 915 656 484 469 23365 281 23469 865 --
NM_005400chr272760 2750 2637 2244 1210 897 201 12010 21961 325 12508
NM_005406chr1851538 1198 1024 468 442 --1327 --
NM_005407chr1421452 1233 11355 --1109
NM_005426chr12897 279 1358 ----
NM_005433chr1852089 1736 1040 483 447 ----12666
NM_005436chr1044006 3553 2907 887 --13691 --
NM_005437chr1041103 1031 595 434 1977 21233 114 --
NM_005445chr10------1102
NM_005450chr171227 1103 ----
NM_005461chr2041945 1770 1450 590 --11505 --
NM_005465chr12352 190 ------
NM_005475chr1242107 861 430 338 --1229 13312
NM_005476chr921301 1185 1134 158 --
NM_005487chr2242031 1907 1653 659 ------
NM_005493chr61591 ------
NM_005494chr72535 499 ------
NM_005497chr1796170 5760 5463 4692 1341 1105 559 470 292 23773 203 35121 1516 770 --
NM_005499chr191197 ----1528
NM_005502chr953298 2798 1065 510 242 ------
NM_005504chr1296179 6113 5896 5769 5014 4085 1949 544 450 ------
NM_005509chr51281 1546 ----
NM_005517chr12237 73 ------
NM_005521chr102806 164 1729 ----
NM_005530chr15--1182 ----
NM_005537chr13--2955 169 ----
NM_005539chr1011296 ----1315
NM_005542chr731925 1227 362 ----11912
NM_005544chr2--2848 689 ----
NM_005565chr52467 431 ------
NM_005570chr1821117 986 ------
NM_005573chr51162 ------
NM_005578chr394472 3790 3368 2022 1669 1657 1070 359 102 14591 25109 1951 --
NM_005585chr151141 ------
NM_005587chr152971 308 ------
NM_005595chr12643 632 ------
NM_005596chr9126308 6261 5201 4578 4378 3995 2330 1859 1173 1003 810 454 12238 ----
NM_005597chr19182 ------
NM_005599chr161534 1361 1141 1096 1086 153 --1335 --
NM_005602chr321094 958 ------
NM_005604chr642386 691 491 101 1906 ----
NM_005607chr83917 693 47 ------
NM_005610chr12308 154 1603 ----
NM_005611chr161835 ----11129
NM_005614chr721099 65 ------
NM_005627chr6--1199 ----
NM_005634chrX2451 141 1687 ----
NM_005637chr1852016 1617 703 667 105 21499 607 11723 --
NM_005638chrX31403 686 433 ------
NM_005639chr1241365 1310 1265 1196 11377 --11594
NM_005647chrX83302 3265 3243 3131 2141 431 177 155 22710 2680 ----
NM_005650chr2221323 1211 ----1180
NM_005655chr811257 ------
NM_005657chr151116 ------
NM_005664chr156943 351 272 118 62 39 ------
NM_005665chr1114754 4678 4633 3717 3337 1713 1484 1441 951 944 248 1427 24947 1780 --
NM_005668chr554565 3492 2845 1608 971 23754 1483 44160 3847 1687 1380 24326 634
NM_005685chr7199 ------
NM_005686chr111577 1488 ----
NM_005688chr341123 1017 514 213 1221 ----
NM_005708chr132155 110 ------
NM_005711chr52777 433 ------
NM_005715chr652245 1075 1029 690 190 12016 150 --
NM_005717chr131196 1018 942 ----11084
NM_005721chr21701 --2879 252 --
NM_005722chr242401 1606 683 129 ----11765
NM_005730chr1253274 2421 1206 768 727 11309 22708 1355 --
NM_005731chr21353 198 ----
NM_005734chr111252 ------
NM_005737chr262857 2787 2762 1979 748 507 11813 ----
NM_005738chr732014 1475 38 --1656 --
NM_005739chr1582385 1918 1803 1649 1628 1572 375 172 --22407 896 --
NM_005740chr222834 825 ------
NM_005746chr752652 2522 2014 1816 1011 1654 ----
NM_005748chr12103477 3349 3263 2626 2587 2295 1185 886 874 120 --13074 --
NM_005752chr1621215 1126 21226 301 ----
NM_005759chr264517 4014 1898 1456 826 388 14028 13888 13929
NM_005768chr121716 ------
NM_005776chr14--1178 ----
NM_005779chr551047 756 440 430 251 --1424 12719
NM_005780chr133920 373 98 ------
NM_005786chr1831265 230 126 --11297 --
NM_005789chr1732104 339 155 32112 622 296 ----
NM_005798chr1394331 4292 3676 3529 3335 3327 2016 1992 333 12004 32077 1633 25 1948
NM_005801chr171763 1814 ----
NM_005802chr91744 ------
NM_005813chr2170 --22223 1691 --
NM_005826chr12598 417 --1448 --
NM_005828chr1754028 3413 1645 1333 222 24455 1611 11911 --
NM_005832chr321315 49 1218 ----
NM_005840chrX96981 5607 4889 2661 2088 1076 910 372 176 22998 411 12405 --
NM_005841chr42925 82 ------
NM_005842chr132635 274 ------
NM_005843chr261727 1447 1322 1232 700 244 --11537 --
NM_005845chr1331349 432 49 ----11734
NM_005857chr131473 1112 221 --21057 947 1976
NM_005859chr531485 1232 519 ------
NM_005863chr106996 920 280 134 66 60 ------
NM_005868chr732277 1671 697 11591 12291 --
NM_005871chr1011067 ------
NM_005875chr3245 39 ------
NM_005880chr1631570 542 304 159 ----
NM_005882chr41959 1344 ----
NM_005884chr193800 261 166 ------
NM_005895chr1254071 3737 3274 2640 106 33508 2765 2629 ----
NM_005897chr11805 1869 1108 --
NM_005898chr1152678 2635 2385 1101 91 1127 22753 2072 --
NM_005899chr1741603 1512 1083 226 11136 ----
NM_005900chr431190 959 844 1452 ----
NM_005901chr18228541 8365 8296 7623 7563 7429 6762 6633 6545 6305 6293 6212 6200 6149 6125 6072 2807 2620 2147 1658 1594 1326 58461 7341 5311 2840 1363 28691 7877 27297 3068
NM_005903chr574545 2038 1785 1089 870 622 515 --64748 4217 3995 2093 580 384 14567
NM_005904chr181136 11094 ----
NM_005907chr641587 1281 660 217 ----1117
NM_005909chr531514 441 167 32845 1421 1267 1564 --
NM_005920chr163844 3490 2833 1456 842 518 13757 ----
NM_005930chr142718 251 ------
NM_005933chr112943 502 12303 ----
NM_005934chr1912622 --21021 544 12118
NM_005935chr4125216 5152 4918 4191 4068 3936 3673 3495 1948 1780 946 481 11238 --14200
NM_005937chr1724160 3429 13560 13647 --
NM_005941chr82244 212 1731 --11487
NM_005943chr621136 1066 ------
NM_005944chr311145 ------
NM_005955chr1105267 4459 4401 3930 3665 3488 3432 1871 1629 765 14990 --1397
NM_005962chr1032269 1794 1583 ------
NM_005962chr1032269 1794 1583 ------
NM_005966chr232123 1815 23 ------
NM_005969chr11--31194 1079 190 ----
NM_005977chr131879 ------
NM_005986chr1352297 2257 481 295 241 --1717 --
NM_005994chr171719 1893 ----
NM_005996chr1241524 1159 1046 1040 2603 499 11516 --
NM_005999chr121495 1253 ------
NM_006007chr984465 2838 1376 1349 1321 1063 108 99 21253 792 --23971 932
NM_006011chr151108 24223 1260 ----
NM_006016chr642182 2170 1785 706 11650 ----
NM_006017chr411132 --1804 --
NM_006037chr2114768 4726 4426 3390 3358 3090 1500 1352 716 503 24 24355 996 11730 --
NM_006038chr2051822 1641 1611 853 272 --21887 1879 --
NM_006047chr2043408 2466 1255 67 ------
NM_006054chr1131051 386 137 11123 11463 1352
NM_006055chr283055 2776 2401 2371 2272 1215 771 751 ----13214
NM_006060chr733542 3228 3154 11688 14098 --
NM_006064chrX1371 ------
NM_006067chr163829 414 299 ------
NM_006080chr72739 692 1973 --12325
NM_006089chrX41230 1188 662 83 1654 1271 11900
NM_006090chr14765 722 695 34 ------
NM_006091chr15121 21822 1442 ----
NM_006094chr851525 1487 771 418 79 --12218 --
NM_006095chr484238 4101 4048 3791 3643 3233 3181 909 --24356 1375 11427
NM_006100chr32212 40 --1244 1591
NM_006106chr1133250 2140 1367 --11353 188
NM_006107chr172507 156 ----1339
NM_006108chr1151628 1563 917 689 571 --12076 1103
NM_006113chr152056 2028 1397 463 267 ------
NM_006121chr12----134 1178
NM_006135chr131227 180 124 ------
NM_006136chr721052 282 --1376 --
NM_006139chr242569 2488 1863 556 12674 22438 755 --
NM_006141chr1652264 2203 2170 396 98 12221 ----
NM_006145chr191130 ------
NM_006148chr1772594 2573 2365 2291 708 313 219 12191 1762 --
NM_006153chr32267 242 ------
NM_006154chr1542953 670 358 42 ------
NM_006159chr122620 43 ------
NM_006164chr2135 ------
NM_006166chr1242587 1805 860 677 ------
NM_006177chr1441103 753 350 74 1366 ----
NM_006183chr121432 1168 ----
NM_006186chr2----1477 --
NM_006187chr1242959 2611 2052 942 --12470 12560
NM_006190chr21945 1785 11092 --
NM_006197chr842038 1991 496 284 1633 --11687
NM_006203chr585607 5153 4932 4813 1863 1483 1107 172 15527 --1697
NM_006211chr81232 1217 ----
NM_006212chr1125250 4607 4591 3593 3433 3384 1992 1165 965 774 457 188 31632 1598 1493 21902 749 --
NM_006216chr2181 ----1126
NM_006223chrX127 ------
NM_006224chr1711748 1399 12384 --
NM_006237chr1332248 653 318 11436 1853 --
NM_006241chr352205 1955 1838 743 74 12288 --11855
NM_006243chr1139 ------
NM_006251chr573231 2995 2985 2795 1281 964 417 ------
NM_006252chr1167379 7041 6590 6463 6066 5524 5200 2996 2546 2229 2143 1867 1860 1256 1223 530 --16252 14664
NM_006256chr132646 982 99 11933 ----
NM_006258chr102263 192 ------
NM_006265chr831505 1171 952 --21386 334 --
NM_006268chr111865 --21036 388 --
NM_006275chr20--11916 21907 1621 22193 849
NM_006277chr21138 ------
NM_006282chr20104713 4404 2962 1690 1058 994 439 338 295 246 --1588 --
NM_006284chr11--157 ----
NM_006300chr1932357 1664 451 ------
NM_006306chrX55907 5879 4103 1661 835 12145 ----
NM_006311chr172258 49 1284 ----
NM_006315chr474546 3892 3190 1495 1306 851 285 --11618 --
NM_006320chr4--1965 ----
NM_006321chr341999 1951 270 159 ------
NM_006325chr12137 ------
NM_006327chr101262 ------
NM_006333chr2--1477 ----
NM_006350chr5151 ------
NM_006352chr162039 1800 1495 551 395 350 ------
NM_006353chr641206 392 242 74 1502 ----
NM_006359chrX52324 2170 942 483 264 12514 2344 190 --
NM_006364chr1441154 994 816 229 1940 --1795
NM_006366chr621251 846 ------
NM_006372chr6--1473 ----
NM_006375chrX11418 2292 86 1770 --
NM_006379chr741936 813 538 131 ------
NM_006380chr1754255 4018 3360 3278 1672 --11514 14137
NM_006386chr2282460 2322 2117 1830 1554 1508 890 697 ------
NM_006387chr192829 251 ----199
NM_006390chr1211462 ------
NM_006393chr1064465 3679 2918 2804 1331 945 23349 3319 ----
NM_006405chr142215 30 ------
NM_006416chr61763 ------
NM_006420chr2073044 2829 2543 1230 655 447 294 --13413 --
NM_006421chr811249 --11164 --
NM_006425chr52562 246 11047 ----
NM_006434chr1052963 2821 2253 1156 716 --1853 --
NM_006439chr42464 212 1484 ----
NM_006449chr251626 1617 784 107 94 1491 --1534
NM_006451chr52972 25 ----1801
NM_006457chr463906 3531 2588 2528 504 96 --11108 --
NM_006459chr1041638 575 319 22 --11646 --
NM_006460chr1771790 1239 1228 639 234 219 180 ------
NM_006464chr274491 4314 3653 2984 1635 933 250 --13857 --
NM_006474chr111277 12022 ----
NM_006482chr1253832 3630 2589 1041 196 12635 ----
NM_006489chr1471977 1807 606 487 342 210 88 --11840 2689 331
NM_006496chr121698 669 --1689 --
NM_006509chr191396 ------
NM_006526chr2021648 1415 11641 ----
NM_006529chr431653 1321 1059 --31496 1284 610 --
NM_006532chr1941833 1804 1771 327 ------
NM_006534chr2043199 3105 2468 463 23159 576 13006 --
NM_006537chr151123 --155 --
NM_006538chr254038 3727 3470 309 107 1898 1588 --
NM_006544chr14125974 5909 5212 4125 3707 1910 1707 487 439 387 341 335 25086 2281 15686 --
NM_006546chr1746587 6396 6308 4377 1884 16615 --
NM_006547chr772048 1707 1681 1669 1503 1350 107 1470 11309 --
NM_006558chr81380 ------
NM_006560chr111485 ------
NM_006561chr10146173 5921 5577 5461 3910 3817 1721 1574 1424 966 833 548 521 165 --24421 2066 14306
NM_006565chr165499 411 373 348 268 ------
NM_006572chr1742747 603 486 50 22600 613 22520 2183 --
NM_006575chr1411454 1419 ----
NM_006591chr113519 500 123 ----1284
NM_006593chr22574 238 ------
NM_006595chr1151533 449 413 391 179 ------
NM_006599chr16168151 7466 6792 6432 6395 5705 2829 1917 1753 1710 1590 1367 1357 812 516 377 57965 6315 6198 6184 1819 1670 11903
NM_006602chr201300 1624 ----
NM_006603chrX51916 1845 1469 215 158 11770 11378 11756
NM_006609chr262630 2512 1841 889 416 219 11066 ----
NM_006614chr343687 3068 2803 1092 21156 214 ----
NM_006618chr131481 487 471 ------
NM_006620chr654115 3439 1885 1326 669 --1354 13101
NM_006622chr5----2216 176 --
NM_006624chr1042069 1941 1702 179 ------
NM_006625chr11445 ------
NM_006625chr11445 ------
NM_006625chr11445 ------
NM_006626chr932291 852 483 --1984 --
NM_006628chr15113160 2841 1667 1275 1185 1107 735 632 293 272 164 34107 3140 2885 13539 --
NM_006629chr1872414 2179 1824 1767 1096 1089 268 --22338 1125 --
NM_006633chr51508 ------
NM_006636chr211006 --2688 673 --
NM_006646chr1332829 2797 2777 12059 --1951
NM_006654chr12104158 3603 3523 1893 1642 931 851 808 775 41 23118 229 44756 4450 4341 3576 --
NM_006660chr151247 ------
NM_006667chrX2121 101 ------
NM_006681chr4168 1130 ----
NM_006698chr2011036 ------
NM_006705chr91422 ------
NM_006706chr52526 294 ------
NM_006711chr164751 529 213 54 ------
NM_006713chr53310 86 75 ------
NM_006717chr973304 2874 2718 1085 1036 858 361 12738 13064 --
NM_006720chr1064855 4713 3969 3420 616 288 13379 64800 3575 3481 3239 1698 947 13587
NM_006722chr363054 1980 1035 951 735 81 --32210 1006 709 --
NM_006729chrX85421 4537 4265 3476 2236 1799 1246 302 ------
NM_006734chr611605 --11118 --
NM_006736chr211904 ------
NM_006738chr1564556 4525 3261 3009 2821 799 11307 ----
NM_006746chrX1611 --11076 11554
NM_006751chr23979 778 747 ------
NM_006756chr821531 1102 --184 --
NM_006761chr171230 1844 --2179 169
NM_006766chr831053 705 200 --12155 --
NM_006772chr631780 1645 1637 --11118 --
NM_006775chr653030 2574 2196 643 224 12525 ----
NM_006777chrX92891 2267 2186 1098 753 456 303 172 26 ----22926 224
NM_006788chr1831683 577 511 --1222 --
NM_006790chr51377 ------
NM_006791chr151119 2217 54 1600 --
NM_006803chr851845 1580 1555 1545 831 ----2715 216
NM_006805chr521175 434 ------
NM_006806chr21------181
NM_006807chr1731349 408 65 --11237 --
NM_006808chr91156 ------
NM_006813chr61226 ------
NM_006814chr2041954 989 710 82 12576 --12510
NM_006815chr1251306 1172 1026 542 280 21205 309 ----
NM_006818chr13770 140 93 --1867 --
NM_006822chr173605 533 202 ------
NM_006823chr811321 11126 ----
NM_006827chr1442911 2285 730 336 11149 1384 --
NM_006832chr143849 757 695 ------
NM_006852chr1742906 2726 2345 420 1833 ----
NM_006868chr1843225 2403 1949 466 --13076 12861
NM_006873chr253104 2983 1326 924 636 ------
NM_006874chr431099 1013 887 --1953 2437 336
NM_006884chr321819 227 ------
NM_006885chr16124023 3847 3616 3438 2695 2572 1599 1467 806 566 424 154 23057 529 23407 2843 --
NM_006888chr1473293 2712 2706 2410 404 310 219 11223 13353 --
NM_006892chr2021379 1243 11304 ----
NM_006892chr2021379 1243 11304 ----
NM_006898chr21615 ------
NM_006902chr142519 2105 1044 487 11225 22328 617 11290
NM_006908chr731324 1154 21 --21110 606 1449
NM_006910chr161328 ----1404
NM_006912chr152176 732 334 247 129 ------
NM_006915chrX61648 779 688 321 242 195 --12111 --
NM_006920chr211781 21808 219 ----
NM_006924chr1764336 4052 3941 3279 2847 1078 14190 147 1331
NM_006925chr141447 --1332 --
NM_006930chr561914 1802 1287 1257 557 231 ----1189
NM_006937chr17138 --2559 116 --
NM_006938chr1871066 956 948 816 219 126 75 ----1933
NM_006939chr144756 454 441 49 ----11176
NM_006940chr121437 11335 --11835
NM_006947chr431629 1263 502 ----11548
NM_006948chr2131735 986 606 12348 --1363
NM_006951chr103790 763 581 ------
NM_006965chr1831207 361 92 ------
NM_006981chr922631 265 --12901 --
NM_006982chr121241 ------
NM_006996chr131830 735 622 ------
NM_006999chr572064 1651 1526 1337 838 747 222 --11698 --
NM_007006chr1683535 3482 2800 2694 1305 945 213 89 --1674 --
NM_007007chr1284106 3992 3769 1778 1621 1544 1271 345 23359 3050 --13659
NM_007008chr2--1702 ----
NM_007010chr17--11487 --11462
NM_007011chr1596594 5188 4729 4654 2733 1932 1760 1225 204 16811 2553 246 --
NM_007013chr851028 409 298 134 127 ------
NM_007017chr51891 ----1367
NM_007023chr2--11030 ----
NM_007027chr32405 146 ------
NM_007033chr162277 1990 1761 494 155 42 22176 573 ----
NM_007040chr1921078 264 ------
NM_007042chr342016 1967 1695 377 32618 2391 2050 ----
NM_007050chr2088119 6695 6302 5999 5763 1516 694 678 --11630 --
NM_007052chrX1202 ----2212 195
NM_007064chr341350 1108 630 390 --41428 1216 509 107 --
NM_007068chr22--11065 ----
NM_007078chr1022338 793 ----1388
NM_007084chr1331426 601 364 ------
NM_007106chr1332747 2092 1713 12151 ----
NM_007107chr342333 2182 754 367 --32255 1799 557 --
NM_007111chr133668 299 74 1248 ----
NM_007112chr12250 240 ----1181
NM_007114chr313026 ----1841
NM_007118chr5--1320 ----
NM_007124chr621439 211 11775 11944 --
NM_007125chrY41395 1003 979 452 ------
NM_007129chr132314 158 ------
NM_007136chr341128 1083 866 31 ------
NM_007137chrX135460 5383 4974 4434 4408 3763 3710 1921 1909 1158 1142 1039 715 ------
NM_007147chr1911244 ------
NM_007150chrX41986 1681 551 67 ------
NM_007158chr131234 134 66 --11198 --
NM_007166chr1111367 ------
NM_007172chr2263292 3237 2660 2636 658 73 13105 --12857
NM_007173chr111409 145 ----
NM_007175chr853518 3024 2750 2738 1193 1387 ----
NM_007191chr12----2720 168 --
NM_007192chr1451013 457 392 224 104 193 ----
NM_007195chr1853551 3175 2540 1486 455 13641 13327 --
NM_007197chr1221039 206 ------
NM_007200chr1564556 4525 3261 3009 2821 799 11307 ----
NM_007203chr994009 3892 3047 2804 2789 2606 2507 2469 1523 12880 1633 --
NM_007212chr152156 2112 1416 789 679 --2571 444 --
NM_007214chr62378 114 ------
NM_007218chr84902 740 362 133 1242 ----
NM_007222chr821603 192 11629 ----
NM_007238chr2041446 1248 1110 447 23098 348 11562 --
NM_007246chr421003 352 ----1294
NM_007249chr13119477 9055 8909 8514 8480 6208 3320 2177 2100 1394 252 23589 3419 47963 2806 2419 1288 28891 7148
NM_007250chrX1378 ------
NM_007269chr11450 ------
NM_007271chr631463 1356 1230 --2285 38 --
NM_007274chr1----1127 --
NM_007276chr711132 1336 ----
NM_007285chr162194 182 ------
NM_007315chr241461 1358 1237 448 --2476 38 --
NM_007325chrX42171 1871 692 368 21822 1707 ----
NM_007345chr1861873 1754 1745 479 200 114 ------
NM_007347chr1562637 2231 1991 942 648 132 --1369 --
NM_007349chr72408 98 1277 ----
NM_007353chr732884 2477 2138 ------
NM_007357chr12223 86 ------
NM_007358chr121264 324 ------
NM_007373chr1031619 1329 1296 --1196 --
NM_007375chr141127 1022 463 192 11030 ----
NM_012081chr573401 3229 3042 2807 2740 1017 281 13055 13153 13497
NM_012082chr81787 ------
NM_012084chrX------1446
NM_012089chr141408 1349 1048 186 1164 11215 1630
NM_012096chr383239 3133 2649 2355 1485 1471 901 866 11313 --1704
NM_012097chr242139 1769 613 193 1846 ----
NM_012098chr931002 180 133 ----1450
NM_012102chr162615 1853 1757 922 797 511 --2297 42 --
NM_012104chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_012104chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_012108chr42386 353 ----162
NM_012111chr141152 ------
NM_012115chr61621 ------
NM_012120chr631993 1924 294 11917 1938 --
NM_012129chr752248 2044 874 834 155 ------
NM_012137chr122886 77 22325 1875 12375 --
NM_012141chr1333872 715 296 24139 1022 11567 --
NM_012154chr82782 139 ------
NM_012155chr191224 ------
NM_012156chr2073413 3213 3159 2984 2448 459 419 ------
NM_012157chr32941 304 ----1167
NM_012158chr1371716 1261 1141 331 164 72 57 1503 ----
NM_012160chr61524 1174 ----
NM_012164chr9127245 7099 6477 5980 5001 2939 2687 2635 2508 2084 658 650 15965 56272 6207 5741 2857 970 197
NM_012183chr11454 ------
NM_012188chr511081 ------
NM_012189chr181468 ------
NM_012193chr1185455 1898 1487 1212 726 491 330 78 ----14921
NM_012199chr174045 3874 3784 3457 3294 1750 1374 14423 ----
NM_012200chr11184 ------
NM_012207chr103953 308 164 2749 118 1826 --
NM_012210chr931147 963 121 --159 --
NM_012214chr246002 5039 4605 986 12302 24072 545 --
NM_012215chr1021343 1235 --31672 1662 1409 --
NM_012218chr195851 411 256 248 61 11044 ----
NM_012219chr31814 2978 828 2915 565 --
NM_012223chr241308 968 245 166 1847 1115 --
NM_012224chr441045 1025 865 456 1439 ----
NM_012234chr373754 3283 3277 3259 2457 1001 463 1900 1432 --
NM_012238chr1011404 11624 11538 21182 355
NM_012242chr102547 98 ------
NM_012247chr102901 421 ------
NM_012248chr161253 162 ----
NM_012249chr283181 2823 2557 2502 2494 1344 1242 406 13407 --12833
NM_012250chr112530 298 ------
NM_012252chr7104987 4882 4706 1667 1105 1086 819 811 250 208 ----1940
NM_012255chr20286 45 ------
NM_012259chr611247 --1423 --
NM_012262chr144119 1065 720 318 35236 1709 63 15015 --
NM_012266chr921114 1076 1134 ----
NM_012281chr732080 1593 960 12095 ----
NM_012286chrX3593 130 85 2472 57 ----
NM_012290chr271315 1175 1154 629 383 365 83 ----11247
NM_012294chr773884 3520 3485 2655 405 389 102 --13815 1295
NM_012297chr452334 2021 1967 1736 870 ------
NM_012300chr552170 1789 682 115 32 ------
NM_012307chr181824 ----1282
NM_012316chr165671 4492 4049 1674 1158 512 25480 3464 ----
NM_012325chr2011083 --11009 --
NM_012327chr1841566 1500 996 582 ------
NM_012328chr731464 939 915 --11320 --
NM_012329chr173619 491 467 --1663 --
NM_012330chr1031812 1158 534 ------
NM_012334chr574774 4473 3209 3144 1571 1368 1267 14686 14055 --
NM_012341chr10------1472
NM_012345chr1331671 1437 161 1274 ----
NM_012347chr612992 --1180 --
NM_012384chr2062419 2326 2235 1657 1548 554 12303 1522 --
NM_012388chr1563081 2932 2523 2018 199 22 ----1359
NM_012395chr753413 2605 524 456 173 11066 23191 112 --
NM_012399chr2231527 1359 703 1172 ----
NM_012412chr71789 1154 ----
NM_012416chr931037 496 94 --1120 --
NM_012419chr61162 ------
NM_012420chr105919 713 181 51 32 ------
NM_012426chr163477 360 344 ------
NM_012463chr1221312 425 ------
NM_012464chr442182 1792 1129 340 --2744 701 --
NM_012479chr732574 442 352 1305 1543 --
NM_012486chr12450 65 ------
NM_013230chrY2564 539 ----1376
NM_013231chr1484287 3996 3988 3935 3785 3678 1061 209 --13773 --
NM_013233chr231030 526 197 ------
NM_013236chr2241149 834 402 179 --11260 --
NM_013253chr1121300 176 21208 904 21372 448 11252
NM_013257chr822233 1597 ------
NM_013261chr452727 2494 1482 1137 973 --12919 --
NM_013262chr651162 1116 1102 1086 1007 ------
NM_013269chr1273995 1531 1491 1252 1201 447 197 24097 174 24240 4018 --
NM_013272chr15--1277 ----
NM_013283chr52856 82 --1800 --
NM_013286chr363463 2999 2788 2341 1425 253 12543 --1164
NM_013293chr72486 159 ------
NM_013302chr1684731 3748 3642 3510 3300 1243 1048 597 24454 1263 ----
NM_013316chr7151 ------
NM_013322chr711614 ------
NM_013334chr3135 ------
NM_013341chr242581 2018 1915 1849 ------
NM_013354chr831485 425 395 ------
NM_013357chr82670 82 ------
NM_013363chr32428 60 --1182 --
NM_013374chr322627 2577 --1380 --
NM_013380chr192807 275 --144 --
NM_013396chr2151500 1277 969 421 95 --1624 148
NM_013423chrX51285 1105 1046 795 95 ------
NM_013427chrX51285 1105 1046 795 95 ------
NM_013433chr1931781 1771 1612 --11649 --
NM_013436chr2196 ------
NM_013437chr8183 2473 257 ----
NM_013446chr73226 183 83 1286 ----
NM_013448chr141184 --1698 --
NM_013449chr1222508 393 11117 --1579
NM_013450chr231185 466 347 --1917 --
NM_013993chr61214 --1855 --
NM_013994chr61214 --1855 --
NM_013995chrX42425 2407 1946 251 2566 287 ----
NM_014005chr552168 1014 991 977 939 --2706 310 --
NM_014010chr92434 407 ------
NM_014011chr222304 396 ------
NM_014021chr153303 2632 2300 414 221 --1697 --
NM_014023chr1062865 2731 2451 1173 533 128 --1623 --
NM_014028chr632749 1183 352 ------
NM_014034chr611366 ------
NM_014038chr72405 94 ------
NM_014043chr351671 1594 1259 1230 1089 11621 ----
NM_014048chr1654855 3208 1968 558 67 14791 24879 1956 --
NM_014055chr121442 1105 --1132
NM_014057chr921317 499 ------
NM_014089chr132203 109 ----1876
NM_014106chr1522036 1068 ------
NM_014110chr1------1776
NM_014112chr875512 5438 5354 4736 4589 1602 40 25402 5361 11742 --
NM_014117chr1662561 2490 1959 899 729 150 ----1539
NM_014141chr765369 5094 5077 3474 1006 555 --2344 207 --
NM_014154chr33546 371 352 ----11118
NM_014155chr11117553 7547 7500 5783 5508 5324 2829 1650 1095 295 276 32746 2220 1188 37129 1998 1071 15728
NM_014178chr14160 ------
NM_014191chr12------1824
NM_014203chr19164 ------
NM_014211chr53671 541 461 11518 ----
NM_014217chr11266 --1577 1353
NM_014232chr1721511 199 ------
NM_014232chr1721511 199 ------
NM_014241chr102281 61 ------
NM_014243chr411616 1525 ----
NM_014245chr32681 171 ------
NM_014250chr2242031 1907 1653 659 ------
NM_014253chrX52130 616 454 329 76 --1205 1262
NM_014271chrX1317 ------
NM_014278chr41131 197 ----
NM_014282chr93909 883 514 --1433 --
NM_014283chr12184 46 ------
NM_014289chrX11395 1335 ----
NM_014290chr91158 ------
NM_014292chr2231948 1859 1344 11909 1694 --
NM_014294chr831206 462 83 1454 ----
NM_014300chr15----141 --
NM_014302chr72127 22 ------
NM_014309chr2262141 1735 1137 664 617 161 --24200 3581 --
NM_014313chr121289 430 ------
NM_014319chr1252001 1929 1437 240 206 ------
NM_014331chr487550 6456 6194 6117 5134 1421 985 712 37639 2118 420 12337 --
NM_014333chr1172675 2634 2358 2164 961 458 168 ------
NM_014335chr1531301 1215 83 ------
NM_014342chr112942 152 ------
NM_014353chr161715 2689 118 ----
NM_014363chr132919 121 ------
NM_014365chr122887 225 1587 ----
NM_014372chr131838 1700 479 --21503 500 --
NM_014376chr512341 ------
NM_014382chr341356 1209 581 544 ------
NM_014388chr1126044 5373 5279 5081 4612 4535 4388 4186 4028 1712 1619 592 --24947 4701 --
NM_014392chr411224 ------
NM_014394chr1021043 967 --11167 --
NM_014397chr9------1434
NM_014409chr131155 1126 1091 ------
NM_014423chr534613 1473 1103 --42221 2016 1576 112 --
NM_014445chr34700 553 524 285 --1173 --
NM_014452chr61278 --1173 --
NM_014456chr1041742 613 293 74 ------
NM_014458chr131172 1046 234 ------
NM_014462chr82264 103 ------
NM_014469chr112331 190 ------
NM_014470chr121104 ------
NM_014491chr73943 272 188 ------
NM_014494chr1652372 898 596 411 131 41736 941 732 476 ----
NM_014507chr221903 ------
NM_014516chr191268 ------
NM_014517chr341980 1711 1657 1223 1762 11613 --
NM_014521chr211856 ------
NM_014552chr211430 ----11130
NM_014554chr1252162 1970 1931 1843 269 1284 11730 --
NM_014570chr223828 168 92 ----1705
NM_014572chr1341738 1184 1164 1125 11114 1670 11512
NM_014574chr1451401 1391 1186 587 309 ------
NM_014575chr32545 354 ----1458
NM_014577chr22----1150 --
NM_014583chr31512 --1327 --
NM_014603chr1731401 1176 1043 ------
NM_014606chr431463 1146 360 ------
NM_014607chr251665 785 550 538 482 --1825 --
NM_014612chr961434 1209 1089 527 492 176 11325 ----
NM_014614chr22603 86 --11037 --
NM_014615chr1662625 816 371 365 254 234 22587 734 ----
NM_014635chr221493 1378 11177 11242 --
NM_014636chr944390 4243 4002 716 1316 21414 1136 14041
NM_014637chr81261 1446 11221 --
NM_014644chr111024 ------
NM_014649chr191170 --122 --
NM_014655chr192351 2170 2032 1601 1540 874 561 369 31 ------
NM_014660chr711004 ------
NM_014665chr843686 2776 2440 182 ------
NM_014667chr311565 --12311 --
NM_014670chr241543 1076 343 330 2633 76 --11617
NM_014671chr71272 1604 11038 --
NM_014674chr363954 3722 1501 1010 993 693 11486 ----
NM_014676chr121165 425 ----11275
NM_014679chr113487 288 204 --21254 322 --
NM_014682chr842159 1796 742 334 11763 ----
NM_014683chr1752114 2020 1838 1356 71 ------
NM_014685chr164575 559 364 100 ------
NM_014689chr2------198
NM_014701chr1572796 2418 2151 1101 870 707 327 ------
NM_014702chr683348 2563 2405 2330 905 432 88 35 --22724 214 --
NM_014703chr331045 957 931 --1852 --
NM_014705chr731735 1427 550 ------
NM_014707chr732306 1512 377 --11689 --
NM_014709chr2167 1406 ----
NM_014711chr1662093 1847 1799 1499 808 347 ------
NM_014713chr21208 ------
NM_014715chr112936 865 ----1793
NM_014718chr12--1837 ----
NM_014720chr102265 123 21387 57 ----
NM_014721chr697260 7145 6752 5905 5376 2899 2791 2513 1427 26839 652 11280 --
NM_014729chr81576 2340 50 184 --
NM_014730chr1294820 3589 3231 1817 1351 1215 1191 875 765 --24866 973 15022
NM_014730chr1294820 3589 3231 1817 1351 1215 1191 875 765 --24866 973 15022
NM_014731chr2041795 1375 708 118 ------
NM_014733chr531870 1594 459 11698 22095 633 --
NM_014735chrX51467 1300 860 169 145 1823 32089 1707 1446 --
NM_014738chr17--1947 ----
NM_014742chr2051270 1182 1173 217 201 --11110 --
NM_014743chr482953 2716 2366 2170 1015 782 589 420 12106 11054 --
NM_014746chr22886 778 13558 23774 3041 --
NM_014747chr1115353 4939 4831 4395 1798 1096 972 789 503 452 414 --23998 2077 --
NM_014749chr141165 ------
NM_014751chr832103 1977 1895 ------
NM_014752chr1151397 713 605 592 258 ------
NM_014755chr2114277 4000 3922 3350 3040 2758 1679 1524 990 365 139 13892 166 --
NM_014757chr542238 1995 269 256 --1848 --
NM_014761chr161745 21153 901 1183 --
NM_014764chr1211107 ----1917
NM_014765chr182670 2330 2121 2070 1982 960 793 328 ------
NM_014767chr101312 ------
NM_014774chr163191 3119 2597 2141 1245 712 ------
NM_014776chr1252591 2227 647 154 30 --22951 2482 12767
NM_014779chr341004 294 195 67 ----1423
NM_014787chr12947 71 1106 12653 --
NM_014793chr151535 --148 --
NM_014800chr731108 999 988 ------
NM_014803chr1092802 2636 2630 2390 2008 1170 583 255 198 22608 1186 1310 12749
NM_014804chr1741396 1238 943 188 1966 ----
NM_014819chr542407 1777 1535 588 ------
NM_014820chr331851 1470 558 ------
NM_014824chr1121777 790 --21718 1490 --
NM_014826chr164101 3362 2889 2782 2769 143 12983 33882 2972 1643 --
NM_014827chr131220 335 239 --11055 --
NM_014829chr562379 2201 2119 1531 907 509 1208 ----
NM_014830chr1273817 3289 3009 2851 1272 319 218 21464 397 12399 --
NM_014832chr1321682 580 --11318 --
NM_014836chr10------21803 1245
NM_014838chr224507 493 286 276 --11756 --
NM_014839chr182456 2092 2029 923 790 738 382 290 --1227 --
NM_014840chr1232968 2316 190 23299 1045 12436 12841
NM_014841chr621075 965 ------
NM_014849chr121295 205 ------
NM_014862chr1584138 3591 3430 3233 2656 1242 1236 1158 22761 1404 1835 --
NM_014873chr164872 3900 3891 1792 806 613 34622 3590 1063 1400 --
NM_014874chr111190 --11851 --
NM_014877chr17117633 7220 6211 5902 4865 2707 2237 2206 1947 570 511 47735 5222 5072 122 37726 6759 2974 27675 7291
NM_014883chr432200 569 354 1954 ----
NM_014888chr721568 1121 ----21137 986
NM_014893chrY31592 864 551 1683 ----
NM_014897chr1762629 2179 2043 871 582 24 ----189
NM_014898chr191123 --1420 --
NM_014900chr2--11115 ----
NM_014901chr532227 1404 789 22077 1610 ----
NM_014902chr20----21181 75 --
NM_014903chr1222308 719 1612 --11907
NM_014904chr1053141 2960 1132 743 136 ------
NM_014905chr241931 1333 764 755 --1130 11962
NM_014906chr1743919 3500 2699 798 1167 ----
NM_014912chr1033437 992 107 --12670 --
NM_014913chr181286 21496 227 ----
NM_014917chr11963 ------
NM_014918chr1551349 587 270 114 74 21457 1104 ----
NM_014921chr1913075 ----11885
NM_014923chr1332378 1743 1551 --1592 --
NM_014924chr14103187 2986 2867 2436 2249 2171 706 469 393 279 22056 958 145 --
NM_014926chr341165 1029 756 403 ------
NM_014932chr32694 404 ------
NM_014939chr185598 586 476 416 41 11153 ----
NM_014942chr632629 218 48 22674 1676 11798 --
NM_014946chr272697 2456 2111 1142 1116 1110 614 12156 12568 --
NM_014947chr173002 2783 2753 2640 2244 437 395 ------
NM_014949chr13358 341 21 ------
NM_014951chr1042617 2549 1670 426 12515 --1591
NM_014953chr1374213 4131 3843 3736 3641 2739 499 24235 2891 --12781
NM_014959chr1962594 2334 2314 1389 941 859 145 11376 --
NM_014961chr43763 472 186 --11862 --
NM_014962chr2052612 1003 455 301 130 1215 ----
NM_014964chr171709 1692 ----
NM_014969chr11346 ----11096
NM_014974chr1051799 1183 415 377 51 ------
NM_014977chr141581 ------
NM_014982chr1465192 4855 4320 3462 285 257 --15369 --
NM_014989chr661354 512 473 459 419 127 1486 ----
NM_014990chr143945 460 414 1894 ----
NM_014992chr141647 ------
NM_014996chr321045 145 131 --160
NM_015000chr1292826 2516 2258 2186 2158 1987 1214 978 568 ------
NM_015001chr12979 629 1765 ----
NM_015008chr363252 2691 2684 2342 2292 194 22619 2430 187 --
NM_015009chr3182 ------
NM_015015chr191425 ------
NM_015017chr131017 196 22 ------
NM_015018chr6180 ------
NM_015020chr1663721 3237 2711 2422 1413 272 ------
NM_015023chr111335 ------
NM_015025chr232270 967 179 --11963 --
NM_015026chr1284668 4181 3991 3684 1901 1698 1545 521 1801 --13566
NM_015032chr1382350 2256 1945 1179 1125 1047 859 813 1458 2977 652 --
NM_015039chr1114357 3549 3512 2673 1544 1379 878 854 817 546 103 ------
NM_015040chr263334 3182 3162 2173 1040 124 ------
NM_015042chr1564379 4363 3793 3659 1488 564 --11044 --
NM_015045chr1042052 1871 1501 296 ------
NM_015051chr943369 2989 2296 262 12525 12604 1469
NM_015052chr72931 488 1208 1968 --
NM_015059chr1543307 2803 2589 1054 31087 310 140 ----
NM_015061chr92836 87 --1257 --
NM_015068chr742857 2628 643 608 11012 13376 --
NM_015070chr1331311 1130 415 160 11278 --
NM_015071chr586255 4696 4276 2074 2003 1726 822 265 11184 --32268 2236 2209
NM_015074chr124523 932 11474 34873 3784 1821 --
NM_015076chr684282 3659 3633 1500 1458 1076 926 410 1473 11357 --
NM_015080chr112925 297 ------
NM_015087chr1352613 2510 2305 2230 920 11864 ----
NM_015091chr142748 613 ------
NM_015092chr1644292 3611 2934 1088 23879 1460 13317 13074
NM_015093chr621766 1741 ------
NM_015094chr2253112 1535 1310 1226 448 11023 ----
NM_015097chr381690 1657 1578 1546 625 440 122 116 ----178
NM_015101chr142408 2348 975 913 22104 101 183 1648
NM_015110chr921885 562 11530 1223 1254
NM_015111chr543788 3740 1213 398 ----1649
NM_015115chr452542 1014 781 178 44 11295 12034 --
NM_015125chr191446 ------
NM_015130chr4273 59 2444 133 ----
NM_015132chr741303 793 576 149 11524 11236 --
NM_015137chr852619 2406 640 412 157 ------
NM_015139chr1139 ------
NM_015143chr441398 920 430 236 21321 504 ----
NM_015149chr131464 839 793 11761 ----
NM_015153chr63502 297 232 ------
NM_015156chr1433876 1062 464 ------
NM_015163chr1451883 1627 1517 1488 568 2493 35 ----
NM_015170chr862056 2011 1834 1707 1660 215 ------
NM_015172chr121182 434 ------
NM_015176chr121324 426 21717 628 21399 634 --
NM_015185chrX22797 207 --1292 --
NM_015186chr91121 ------
NM_015191chr1132475 2023 176 --22567 195 1528
NM_015192chr2052909 2634 2490 2463 241 --1616 --
NM_015197chr1443352 2537 2387 698 --1307 --
NM_015199chr353021 1032 573 169 156 --12493 125
NM_015200chr432467 359 233 --22265 1909 --
NM_015203chr1187 ------
NM_015206chr1543245 1101 807 316 3968 451 147 ----
NM_015208chr1863758 3716 3542 2912 1540 492 1735 23261 478 --
NM_015209chr122166 734 ------
NM_015215chr153160 3044 1949 1133 148 32606 543 54 ----
NM_015229chr1721195 761 ------
NM_015231chr113925 806 601 ------
NM_015233chr1362589 824 768 697 392 256 --1451 1312
NM_015238chr51709 ------
NM_015247chr1654668 3452 606 546 74 ------
NM_015260chr1931520 1363 79 --11578 --
NM_015263chr1511198 1368 ----
NM_015265chr242591 2345 1946 70 ----1504
NM_015267chr121157 --11757 --
NM_015269chr11237 1421 ----
NM_015270chr1212008 ------
NM_015271chr474347 4125 4010 1584 651 233 90 33947 3676 846 ----
NM_015272chr1652164 2047 645 450 151 --21306 224 --
NM_015275chr1232133 2079 1579 ----1130
NM_015277chr1831298 42 30 ------
NM_015278chr6103412 3311 2726 2415 2356 2345 2134 1083 535 207 13266 ----
NM_015282chr251012 962 943 406 304 ------
NM_015288chr533906 3366 150 --11451 --
NM_015289chr1531877 1420 667 ----1537
NM_015291chr152749 2699 1341 873 630 11185 --23007 645
NM_015294chr171884 --2243 212 --
NM_015296chr1321023 448 ----1342
NM_015308chr11170 ----1149
NM_015310chr8147914 7808 7401 6440 5871 5822 5161 2414 2021 1539 1288 1087 402 285 --17787 --
NM_015313chr1163898 3339 3119 1467 787 422 --1167 14565
NM_015314chr7122304 2190 2168 2097 1887 1670 1033 860 754 697 449 109 22537 652 ----
NM_015315chr52960 300 ------
NM_015321chr1964947 3414 3089 3056 1699 1689 --13579 --
NM_015326chr171921 964 922 833 738 116 105 2267 244 ----
NM_015328chr763005 2942 2815 2254 771 680 --33061 2636 375 --
NM_015335chr1252421 2189 2037 940 839 1351 --12013
NM_015336chr1242454 2338 1892 354 2279 235 --12378
NM_015339chr203913 777 176 ------
NM_015344chr81813 ----1454
NM_015346chr1431493 590 404 1661 1237 --
NM_015347chr1242529 1083 713 506 ------
NM_015349chr672589 2476 920 542 494 463 163 1748 ----
NM_015350chr12526 510 ------
NM_015354chr92368 346 ------
NM_015355chr1721546 154 1706 --11448
NM_015358chr2121270 1073 ------
NM_015361chr2--2828 629 ----
NM_015365chrX84280 3738 3091 1226 642 428 370 351 13100 33971 2996 461 --
NM_015379chr7--1260 ----
NM_015382chr143697 515 151 ------
NM_015385chr1052963 2821 2253 1156 716 --1853 --
NM_015387chr241742 501 439 384 12096 ----
NM_015393chr452935 673 473 136 38 ----11327
NM_015394chr1231545 671 430 12016 ----
NM_015397chr941640 1494 1481 192 ----11778
NM_015419chrX2875 419 ------
NM_015423chr1131390 489 104 ------
NM_015428chr1951707 1693 1379 1126 537 1494 1522 --
NM_015436chr463041 1296 720 597 548 246 --3561 419 352 --
NM_015439chr61439 1136 ----
NM_015443chr172190 106 ------
NM_015446chr11318 ------
NM_015455chr543349 3157 2748 680 43138 2620 959 717 ----
NM_015458chr8104868 3825 3683 1816 1718 1681 1281 861 533 55 25236 756 24280 1902 1899
NM_015460chr341704 1322 721 659 11433 11763 --
NM_015461chr182757 647 1486 ----
NM_015464chr74249 187 172 90 1267 ----
NM_015475chr21352 1340 --1332
NM_015483chr7----1802 1422
NM_015508chr32608 171 --11453 --
NM_015509chr1241554 1197 1137 253 ------
NM_015514chr143532 444 379 ------
NM_015525chr61921 --1882 --
NM_015530chr21698 ------
NM_015534chr141069 435 387 137 ----1403
NM_015541chr351257 1056 939 429 367 --121 1228
NM_015542chr101959 ------
NM_015554chr1562949 2833 2387 1007 829 587 12088 ----
NM_015555chr62553 71 --2429 341 --
NM_015564chr533520 3447 130 --1447 --
NM_015567chr1321023 493 ------
NM_015569chr164801 3956 3074 1269 888 123 --1313 --
NM_015571chr642603 2425 2269 2227 1910 1949 --
NM_015576chr322398 29 11975 11872 1168
NM_015577chr521785 546 186 1660 --
NM_015578chr1941865 1766 1733 1359 --21917 780 --
NM_015599chr61274 ------
NM_015601chr102868 257 --1648 --
NM_015602chr131640 1385 36 ------
NM_015622chr71282 ------
NM_015626chr1731234 305 123 ------
NM_015640chr1105305 5252 5208 4955 4255 3245 1473 845 540 201 21528 237 11347 --
NM_015641chr721021 356 1825 ----
NM_015642chr3----1214 --
NM_015652chr10----1254 --
NM_015660chr71247 ------
NM_015686chrX----11774 --
NM_015691chrX52745 2708 2134 418 268 11923 12453 159
NM_015702chr22296 79 ------
NM_015723chr7--122 1574 --
NM_015850chr811675 12030 11795 --
NM_015866chr11541 1953 ----
NM_015874chr42482 246 ------
NM_015878chr862076 2058 1622 680 618 340 ------
NM_015879chr18116933 5980 5648 5452 2777 2101 1423 1139 938 614 159 25812 2983 18296 --
NM_015881chr1121300 176 21208 904 21372 448 11252
NM_015885chr112643 209 ------
NM_015886chr895605 4564 4547 3968 3943 3596 2179 2055 114 12221 11433 1659
NM_015888chr132438 1296 653 22252 314 ----
NM_015891chr621880 486 --1620 --
NM_015904chr21147 ------
NM_015906chr174797 4702 3472 3106 1127 569 461 --2897 833 14865
NM_015920chr153584 166 153 ------
NM_015955chr21366 ------
NM_015975chrX41703 1643 1485 1237 11612 ----
NM_015982chr172343 54 ------
NM_015986chr172918 278 128 ----
NM_015990chr411025 1880 ----
NM_015995chr1524753 2234 --1334 --
NM_015999chr11577 ------
NM_016009chr194558 1754 1620 1285 727 685 526 289 208 34446 3787 815 31705 1160 639 --
NM_016018chr832693 2222 357 1550 1764 1284
NM_016019chr73228 214 158 ------
NM_016022chr121027 994 ------
NM_016023chr862168 2069 1891 843 688 115 ------
NM_016026chr14--21474 85 ----
NM_016037chr131140 93 52 ------
NM_016040chr132518 699 351 ----1408
NM_016045chr2061508 1407 738 628 456 101 ------
NM_016048chr5----1330 --
NM_016057chr123519 370 197 --11193 --
NM_016072chr1251910 1690 669 556 107 ----12030
NM_016073chr152817 324 ------
NM_016076chr162833 2256 2109 1133 737 125 1689 1983 --
NM_016079chr232269 787 109 1165 12061 --
NM_016083chr622759 1468 --11215 --
NM_016087chr711153 ------
NM_016096chr861762 1753 1703 1639 1614 722 --1842 --
NM_016097chr1821008 365 ------
NM_016101chr1641149 1105 1058 330 ------
NM_016103chr51378 ----1465
NM_016107chr521083 128 ------
NM_016115chr22520 79 ------
NM_016120chrX21162 157 --11038 --
NM_016121chr12875 78 --11144 --
NM_016124chr131471 1312 1255 ------
NM_016131chr272226 2094 1521 907 541 144 43 12296 --1283
NM_016132chr1573376 3333 3145 2338 799 449 312 1269 ----
NM_016133chr221380 1214 11442 1107 --
NM_016141chr3132 ------
NM_016144chr54312 201 181 82 ------
NM_016152chr33863 357 91 ----21142 137
NM_016166chr151181 ------
NM_016169chr1033156 833 491 ------
NM_016192chr21242 ------
NM_016200chr7176 ------
NM_016203chr7--1206 --1271
NM_016206chr3138069 7743 6089 5643 5440 2353 1560 1170 735 707 487 283 142 27690 5868 --22090 1722
NM_016213chr15138 ------
NM_016217chr653382 3273 2899 2837 835 --11472 --
NM_016224chr611469 12140 --1381
NM_016227chr12184 46 ------
NM_016231chr1741452 667 439 112 --11052 --
NM_016235chr1631316 1266 945 ------
NM_016239chr171755 ------
NM_016248chr1393961 3896 3602 3596 2755 2617 1401 994 775 32712 1475 283 34015 2745 1137 13613
NM_016255chr633046 1341 990 2927 801 --2762 575
NM_016260chr2127607 7297 7172 6639 5675 4990 2780 1062 875 708 551 476 16704 35802 5169 384 1786
NM_016270chr191486 ------
NM_016271chr1872369 2307 1992 1753 1540 495 125 ------
NM_016272chr2211076 --22560 281 --
NM_016275chr332215 1091 1077 ------
NM_016287chr121837 77 --1686 --
NM_016290chr5197 ------
NM_016300chr3----1441 --
NM_016303chrX1452 ------
NM_016304chr151747 ------
NM_016308chr161976 1928 1893 1734 385 157 --1451 11563
NM_016315chr221890 292 ------
NM_016322chr963117 2825 2355 2177 977 465 12303 ----
NM_016328chr7199 ------
NM_016329chr31388 1351 ----
NM_016337chr141321 ------
NM_016338chr5--11215 ----
NM_016351chr71432 ------
NM_016356chr642941 2855 2846 2749 --12623 1873
NM_016374chr121294 1260 11077 ----
NM_016374chr121294 1260 11077 ----
NM_016376chr1764135 3545 2868 2790 1512 1113 1480 ----
NM_016377chr621802 600 ------
NM_016383chrX2750 744 ------
NM_016395chr153365 85 58 ----1347
NM_016396chr1541194 955 603 576 12282 1552 --
NM_016400chr15172 ------
NM_016424chr1742012 1661 799 516 ----11844
NM_016436chr2042735 2478 1793 1673 21966 961 --11996
NM_016441chr252362 2343 898 226 210 11470 11711 11508
NM_016472chr141608 11136 ----
NM_016480chr53784 565 121 ------
NM_016483chr31318 1266 ----
NM_016485chr632211 873 87 ----1179
NM_016486chr11352 ----1446
NM_016507chr1752817 2651 2458 968 388 --159 --
NM_016521chrX2306 81 1255 ----
NM_016522chr1121061 181 --1233 --
NM_016529chr131353 ------
NM_016530chr1573919 3225 3188 2523 1099 623 368 ----23307 1214
NM_016531chr433969 1009 172 1696 2577 326 --
NM_016542chrX31342 1218 1169 ------
NM_016544chr263796 3738 3594 3238 3021 564 13086 22949 81 --
NM_016559chr341503 1090 576 309 --11290 --
NM_016569chr1241524 1159 1046 1040 2603 499 11516 --
NM_016586chr141173 ------
NM_016587chr711132 1336 ----
NM_016592chr20--133 ----
NM_016603chr562263 2130 1525 1379 489 482 ------
NM_016605chr542743 2709 2253 528 --1580 --
NM_016607chrX21631 98 ------
NM_016612chr81473 ------
NM_016613chr432309 703 296 12609 ----
NM_016620chr121273 219 1958 ----
NM_016621chr1194533 4518 3976 1022 1001 651 345 240 112 ------
NM_016623chr82509 67 1152 ----
NM_016626chr1821748 446 ------
NM_016630chr152200 43 1113 ----
NM_016644chr51453 ------
NM_016654chr152345 215 --1150 --
NM_016656chrX1371 ------
NM_016824chr1031176 519 220 ------
NM_016831chr152191 1807 1731 585 517 12163 11516 --
NM_016836chr23169 116 105 128 ----
NM_016839chr23169 116 105 128 ----
NM_016929chr634543 3398 3239 --23341 934 --
NM_016936chr164865 858 713 104 ----2672 125
NM_016948chr161117 ------
NM_016950chr43273 250 191 ------
NM_017412chr81457 ------
NM_017413chrX42340 2241 422 200 22552 558 ----
NM_017420chr14133807 2626 2457 2419 1447 1309 1052 932 802 737 650 319 104 --13303 13533
NM_017423chr411633 ------
NM_017424chr2241955 357 205 68 1525 ----
NM_017426chr41450 ------
NM_017440chr122100 87 ------
NM_017447chr21103840 3589 3102 3030 2836 1685 1188 1156 707 479 1564 --1725
NM_017449chr11289 11138 11446 --
NM_017456chr1731893 1852 1285 21774 1456 ----
NM_017459chr11411 ------
NM_017481chr11130 ------
NM_017491chr42698 171 ------
NM_017519chr66855 488 307 285 71 64 ------
NM_017520chr132219 98 --129 --
NM_017548chr352092 1452 1366 485 233 11620 1850 --
NM_017554chr332092 1376 65 ------
NM_017590chr2211780 ----12212
NM_017594chr972683 2643 2492 2193 2116 898 708 1545 23100 701 --
NM_017599chr1251855 1688 1675 821 475 11971 ----
NM_017610chr1531553 759 528 ------
NM_017612chr12183 ----1595
NM_017626chr1011374 --21257 1094 --
NM_017628chr475030 4999 4632 1215 1157 1040 114 11358 14430 --
NM_017629chr161982 1901 1290 558 549 539 --1660 --
NM_017631chr4147 ------
NM_017632chr42354 113 --1138 --
NM_017633chr623026 279 23360 1157 22453 602 --
NM_017634chr831924 1341 45 ----1631
NM_017635chr1141352 1149 488 326 --11174 --
NM_017637chr9128822 7556 7484 3609 3450 3290 2734 2607 2504 2430 346 221 19079 18815 --
NM_017641chr121187 ------
NM_017643chr172660 619 12601 1838 --
NM_017644chr354074 1669 1041 756 461 15083 14494 11381
NM_017646chr13450 269 164 ----1518
NM_017649chr101388 ------
NM_017650chr795986 5871 5565 5402 5167 4489 1702 1367 709 15946 ----
NM_017655chr161541 1298 1017 356 261 40 --11259 --
NM_017658chr14103927 3757 1751 1341 1329 883 773 285 165 135 --21744 72 --
NM_017661chr1521284 207 1275 11087 --
NM_017666chrX52193 1991 883 518 68 21785 1667 ----
NM_017667chr72490 68 2384 162 ----
NM_017672chr1511112 ------
NM_017691chr152422 36 1143 ----
NM_017693chr1341659 1653 1328 388 1560 2508 138 1459
NM_017697chr81345 ------
NM_017703chr19------137
NM_017705chr15103771 3746 3213 2576 1267 1251 1202 1034 711 659 21333 960 --1628
NM_017709chr1103909 3151 2818 2730 1624 1536 1411 1057 1022 372 ------
NM_017719chr311847 ------
NM_017736chr1692808 2394 2285 2153 2115 452 355 162 92 33107 2868 122 --1337
NM_017737chr162196 1942 1783 1463 636 509 ------
NM_017738chr921260 1024 ------
NM_017742chr1811756 ------
NM_017744chr131951 1851 1598 --1785 12476
NM_017745chrX1191 ----1586
NM_017748chr172897 27 ------
NM_017752chrX22019 871 1509 ----
NM_017753chr93993 754 324 ------
NM_017757chr1821174 358 11103 ----
NM_017769chr1463116 2968 2826 2430 2290 2159 ----13110
NM_017770chr642888 2519 2102 1026 --12812 --
NM_017772chr631730 1422 223 11247 ----
NM_017778chr821137 94 ----1384
NM_017779chr132090 1820 362 2929 330 --22435 637
NM_017791chr1441649 1497 492 428 ------
NM_017798chr201794 1304 ----
NM_017801chr32960 140 22444 1654 ----
NM_017811chr953003 2645 2613 2553 1252 11074 ----
NM_017813chr885716 5436 5162 4360 4189 4174 1655 835 11571 45487 4563 3976 28 15150
NM_017824chr1041777 781 558 376 21716 194 22209 29 --
NM_017845chr43586 318 295 ------
NM_017848chrX23142 202 1578 --13724
NM_017857chr111652 ------
NM_017866chr83946 718 247 1867 ----
NM_017896chr2052988 788 689 544 421 13528 --13549
NM_017919chr955693 5593 4181 3749 983 24390 4268 1764 --
NM_017925chr941961 1872 1319 70 ------
NM_017933chr221217 243 11343 --31505 1180 306
NM_017938chrX51620 841 746 487 108 11549 11342 --
NM_017944chr1163119 2089 1183 1028 977 35 --13019 --
NM_017948chr92477 72 ------
NM_017954chr741555 1353 1112 350 1540 11171 --
NM_017958chr262857 2661 2123 236 103 90 ------
NM_017990chr1683768 2684 1700 1320 1160 590 498 428 23717 3332 13255 --
NM_017994chr762828 2771 771 591 555 378 22866 324 11969 --
NM_018003chr1522398 970 11925 21943 917 --
NM_018004chr3255 21 ------
NM_018008chr31276 ------
NM_018010chr331603 1406 308 1659 ----
NM_018014chr22437 90 ------
NM_018015chrX41151 998 436 132 191 ----
NM_018017chr1082756 2352 1901 808 672 604 524 483 --22342 785 --
NM_018027chr1043033 2962 1103 687 12942 1650 --
NM_018045chr123139 2048 --1106 --
NM_018046chr561505 1464 703 573 342 32 ------
NM_018048chr1252004 1819 1801 482 278 ----1673
NM_018053chr1--1852 ----
NM_018061chr11222 21102 181 1709 --
NM_018078chr431046 929 210 1977 2710 73 --
NM_018084chr233054 1152 293 --1893 --
NM_018086chr261651 1502 1414 610 329 233 ------
NM_018092chr1631638 1552 519 ------
NM_018096chr175707 387 373 347 165 1691 1907 --
NM_018098chr321128 863 ------
NM_018112chr92865 250 --1985 --
NM_018117chr103705 556 501 ------
NM_018120chr83981 231 106 11415 2383 50 --
NM_018126chr441360 1259 252 181 ------
NM_018128chr172430 172 ------
NM_018131chr102878 639 ------
NM_018133chr351861 1814 726 67 50 1123 12222 2546 208
NM_018149chr17191 ------
NM_018155chr363251 2425 1074 971 909 131 12495 ----
NM_018157chr1222219 950 --1837 1655
NM_018177chr41261 ------
NM_018178chr141894 1275 392 69 2413 88 21944 328 --
NM_018179chr121242 ------
NM_018181chr1841833 1255 1229 748 11618 21867 1217 1327
NM_018182chr1731608 1488 906 11396 ----
NM_018184chr331648 1473 610 1358 11455 --
NM_018195chr1191950 1899 1855 1804 1363 1344 681 600 21 ----150
NM_018200chr1551978 1899 1599 744 523 12376 32538 1762 403 --
NM_018202chr12330 180 ------
NM_018208chr121176 132 ------
NM_018214chr631196 1021 395 ------
NM_018223chr1221018 301 189 --11098
NM_018227chr463223 2662 2491 2021 1062 255 ------
NM_018228chr141268 ------
NM_018237chr101260 ------
NM_018241chr42899 156 ------
NM_018243chr453838 3299 3263 82 75 ------
NM_018246chr862453 2383 2247 2197 286 144 ------
NM_018247chr642962 2010 1965 1090 22689 864 ----
NM_018254chr141592 328 291 120 --11707 --
NM_018257chr2042476 864 233 140 12108 1537 --
NM_018263chr242266 2176 997 635 --12543 --
NM_018264chr7157 2918 882 1933 --
NM_018266chr311122 ------
NM_018279chr1261008 976 768 577 553 316 12838 --32429 385 296
NM_018290chr421282 846 ------
NM_018293chr332295 1190 437 --1218 --
NM_018299chr853495 2927 2203 1234 1048 12887 11370 21333 384
NM_018312chr1151794 586 568 553 326 1409 12046 --
NM_018313chr342262 2092 350 280 22549 2312 ----
NM_018315chr431289 1248 373 1107 ----
NM_018317chr4135 ------
NM_018318chr12190 ------
NM_018319chr1441277 1247 565 480 ------
NM_018323chr451609 1553 1425 1243 156 ------
NM_018325chr931143 1102 668 --1610 1143
NM_018327chr2031622 1496 665 11753 11562 --
NM_018330chr1041551 1338 333 60 ------
NM_018334chr71384 ------
NM_018339chr941524 1164 652 35 11843 11679 --
NM_018362chr1132514 655 589 --53124 448 388 354 51 11484
NM_018364chr194096 3799 2947 2933 2692 979 504 84 61 ------
NM_018374chr775105 3970 3426 1780 1384 1297 679 33626 1202 651 43734 1557 1172 154 13719
NM_018375chr1421622 300 --1753 --
NM_018388chrX11078 ------
NM_018403chr3104141 3157 2703 1507 934 850 784 488 446 143 23566 275 13515 11648
NM_018407chr82878 63 ----1159
NM_018416chr1232666 772 123 --21997 219 --
NM_018429chr562653 2414 2369 2269 2012 1068 ------
NM_018433chr2------1445
NM_018438chr1--2497 171 ----
NM_018440chr8118727 8701 8525 8431 6882 5419 2758 2477 2217 727 144 26474 5391 --27650 2465
NM_018442chr11113 ------
NM_018444chr81679 1496 1508 --
NM_018448chr121870 2792 444 ----
NM_018452chr6_random33674 2495 1447 --1193 --
NM_018482chr8102546 2134 2115 1928 1614 1040 1034 433 427 166 --22332 2154 --
NM_018490chr1121676 286 2657 529 ----
NM_018534chr21587 ------
NM_018553chr1741642 1261 589 207 11730 11841 --
NM_018555chr1911827 ----1430
NM_018557chr241619 1335 140 132 ------
NM_018566chr174958 3971 3467 1478 1182 925 61 --44641 3349 1798 1384 --
NM_018569chr421320 1030 11204 11248 --
NM_018590chr1041486 1437 267 117 ------
NM_018638chr1295704 5408 5373 5013 4342 4196 783 388 379 23913 749 13919 --
NM_018640chr1242072 1819 617 334 12292 ----
NM_018644chr1162246 2140 2065 1667 203 40 11937 ----
NM_018649chr101219 ------
NM_018650chr171984 1789 1595 750 640 354 56 11872 --11737
NM_018657chr32804 246 ------
NM_018667chr1652816 2755 2694 2562 350 ------
NM_018682chr71751 ------
NM_018685chr72749 397 --11046 --
NM_018689chr151634 ----22356 2233
NM_018695chr541789 959 762 718 --12388 12139
NM_018703chr161328 ----1404
NM_018704chr11843 --21618 718 --
NM_018710chr821132 228 1196 147 --
NM_018712chr1111193 1131 1262 --
NM_018718chr751882 1492 421 302 34 ------
NM_018724chr11521 --1648 --
NM_018840chr202362 153 1473 ----
NM_018841chr133633 2834 861 1116 ----
NM_018844chr742040 1827 525 323 ----1371
NM_018846chr72932 83 ------
NM_018847chr921731 411 ----1312
NM_018890chr731324 1154 21 --21110 606 1449
NM_018898chr52372 36 1227 ----
NM_018899chr52372 36 1227 ----
NM_018900chr52372 36 1227 ----
NM_018901chr52372 36 1227 ----
NM_018902chr52372 36 1227 ----
NM_018903chr52372 36 1227 ----
NM_018904chr52372 36 1227 ----
NM_018905chr52372 36 1227 ----
NM_018906chr52372 36 1227 ----
NM_018907chr52372 36 1227 ----
NM_018908chr52372 36 1227 ----
NM_018909chr52372 36 1227 ----
NM_018910chr52372 36 1227 ----
NM_018911chr52372 36 1227 ----
NM_018912chr531737 568 445 ------
NM_018913chr531737 568 445 ------
NM_018914chr531737 568 445 ------
NM_018915chr531737 568 445 ------
NM_018916chr531737 568 445 ------
NM_018917chr531737 568 445 ------
NM_018918chr531737 568 445 ------
NM_018919chr531737 568 445 ------
NM_018920chr531737 568 445 ------
NM_018921chr531737 568 445 ------
NM_018922chr531737 568 445 ------
NM_018923chr531737 568 445 ------
NM_018924chr531737 568 445 ------
NM_018925chr531737 568 445 ------
NM_018926chr531737 568 445 ------
NM_018927chr531737 568 445 ------
NM_018928chr531737 568 445 ------
NM_018929chr531737 568 445 ------
NM_018932chr52665 309 1285 ----
NM_018945chr663656 3565 3118 2483 1059 892 --12654 --
NM_018947chr793815 3723 3699 1946 1481 1138 1020 486 182 ------
NM_018951chr741185 930 799 212 11271 ----
NM_018958chr1533864 3836 3302 23692 3130 22971 1421 11148
NM_018963chr2141280 1205 608 394 ------
NM_018970chr772414 1958 1207 792 706 550 109 ------
NM_018975chr161585 1790 2647 85 --
NM_018976chr122690 126 186 ----
NM_018977chrX------11010
NM_018979chr1232457 717 667 ------
NM_018983chr4------1259
NM_018992chr162335 41 ------
NM_018999chr1074612 4437 3573 3069 1557 1285 1193 --24158 371 13380
NM_019000chr541420 1301 1141 345 ------
NM_019001chr394369 3963 3739 3617 3485 3450 3118 1195 598 --14312 --
NM_019004chr762124 1958 1793 1550 689 552 1917 1405 --
NM_019005chr72265 142 ------
NM_019008chr2273242 3041 2961 2647 1523 1468 1024 1877 ----
NM_019027chr442494 2486 1821 165 12501 --1157
NM_019035chr41356 12014 ----
NM_019044chr244329 251 134 79 14572 --24764 3887
NM_019045chrX2793 240 ------
NM_019049chr11630 ----1745
NM_019050chr462121 1974 1833 1804 1755 1574 ----1692
NM_019063chr25569 526 350 178 129 --21936 1750 --
NM_019071chr71803 ------
NM_019072chr553836 2643 1291 683 388 ----1696
NM_019074chr152892 315 ------
NM_019080chr1331565 611 453 ------
NM_019084chr1021801 1781 1832 --32623 1862 1047
NM_019087chr541508 1208 1156 621 ------
NM_019091chr231073 722 82 ------
NM_019094chr1263324 3142 2645 2389 372 295 1121 --12362
NM_019114chr922150 195 12030 ----
NM_019116chr1683580 3532 3156 2785 2384 1240 575 89 13654 21363 605 11015
NM_019117chrX73336 2369 1322 1085 821 382 85 --23027 1241 1877
NM_019558chr21136 ------
NM_019590chr102262 179 172 1957 --
NM_019592chr93888 625 287 ------
NM_019594chr931534 656 650 --1343 --
NM_019595chr21138 ------
NM_019597chrX1202 ------
NM_019600chr154694 540 298 126 ------
NM_019605chr1185 --1251 --
NM_019606chr7--1517 ----
NM_019610chr142115 1571 454 156 21615 477 ----
NM_019854chr122703 537 ----1113
NM_019862chr1641702 1512 508 320 --1648 --
NM_019891chr111303 1249 ----
NM_019898chr1641702 1512 508 320 --1648 --
NM_019899chr1641702 1512 508 320 --1648 --
NM_019900chr1641702 1512 508 320 --1648 --
NM_019903chr1031176 519 220 ------
NM_020066chr11133 ------
NM_020120chr251151 377 301 64 45 ------
NM_020122chr2116036 5561 4410 4279 1645 1636 1505 1288 1221 780 400 15322 23904 1381 11768
NM_020127chr111220 --11139 1461
NM_020132chr2135074 4473 3806 11018 21494 733 --
NM_020135chr62362 317 --1156 --
NM_020141chr172011 1995 1921 1743 844 622 324 12076 ----
NM_020148chr1833071 2358 733 1903 32327 1096 293 --
NM_020150chr1021584 29 1842 21902 416 11599
NM_020156chr71506 ------
NM_020159chr441705 1603 638 216 --2443 252 --
NM_020168chr1511016 1403 --11311
NM_020177chr531156 613 447 ------
NM_020178chr1741144 935 840 369 ------
NM_020182chr2033042 1002 491 23085 2872 ----
NM_020193chr1161285 1191 1130 1001 414 293 ------
NM_020194chr24618 605 267 209 ------
NM_020198chr1731186 479 24 --11018 --
NM_020204chr12269 24 ------
NM_020205chr173478 3321 3292 2581 2555 1377 1093 1386 1407 --
NM_020216chr11379 ----1415
NM_020225chr41106 ------
NM_020226chr42295 266 ------
NM_020228chr1152369 1878 1769 1732 125 2933 48 1690 1472
NM_020231chr31125 --1562 --
NM_020239chr172194 1924 1710 1602 807 680 21 --1292 --
NM_020240chr542761 2704 1077 249 --1158 --
NM_020245chr654500 840 457 267 206 23974 594 34477 1779 900 --
NM_020311chr23583 199 68 --1751 --
NM_020317chr1--1334 ----
NM_020336chr2073401 3188 2975 2898 1340 1084 371 --13157 --
NM_020337chr452954 2714 2047 1201 47 22722 2181 ----
NM_020341chr201465 --11630 --
NM_020342chr272049 1988 1710 932 731 695 166 ------
NM_020346chr112663 588 ------
NM_020348chr1022511 336 21965 1831 ----
NM_020353chr341921 647 563 505 11434 21476 1328 1311
NM_020357chr3------11470
NM_020361chr8--2259 76 ----
NM_020374chr1241862 1686 677 517 1799 11391 --
NM_020379chr11373 172 ----
NM_020381chr63595 556 141 ----1201
NM_020390chr3104726 4581 4552 4164 3579 1823 856 728 143 62 33279 236 123 13114 13835
NM_020418chr31565 --1159 1541
NM_020420chrY61597 1180 418 283 254 231 --1151 --
NM_020425chr661621 1586 660 522 410 40 11993 ----
NM_020432chr742313 1873 1647 1437 ------
NM_020440chr13663 234 157 1541 23138 374 --
NM_020443chr1106638 5926 5728 5444 5087 4381 2169 1516 983 153 1845 ----
NM_020445chr72706 538 ------
NM_020449chrX1300 --1783 --
NM_020455chr652457 2325 1129 1055 131 ----12341
NM_020456chr1321612 754 21938 918 ----
NM_020457chr16----1422 1650
NM_020463chr231403 1099 152 --1596 --
NM_020466chr643919 3743 3275 1245 --23820 1453 34403 4281 211
NM_020473chrX3349 327 44 --1393 --
NM_020474chr1831327 751 732 1650 ----
NM_020475chr822337 928 ------
NM_020476chr822337 928 ------
NM_020477chr822337 928 ------
NM_020478chr822400 991 ------
NM_020480chr822337 928 ------
NM_020528chr211115 ------
NM_020529chr14155 ------
NM_020532chr2--1702 ----
NM_020546chr5102816 2586 2380 1953 1207 735 650 585 340 131 ----12047
NM_020548chr21187 ------
NM_020640chr321996 1680 1321 ----
NM_020647chr8----2315 56 12308
NM_020651chr261427 1378 448 222 85 59 --11696 --
NM_020654chr331051 108 32 ------
NM_020666chr51734 ------
NM_020673chr2097364 5768 5418 5373 3027 2748 300 150 144 27624 358 35905 5141 3056 21012 86
NM_020686chr1642419 2382 2298 291 180 12508 --
NM_020689chr2041755 1719 1505 496 ------
NM_020697chr83515 385 155 ----11292
NM_020699chr135023 570 213 25286 1606 1243 --
NM_020711chr232464 1725 754 ------
NM_020715chr1441715 1440 898 662 ------
NM_020718chr1676229 5800 4779 4611 2379 1665 1321 46338 5909 1927 1184 26098 1512 15587
NM_020726chr53610 127 85 ------
NM_020727chr2183433 3405 2911 2904 2874 1250 390 204 23449 414 13803 13772
NM_020728chr742410 2052 903 128 22538 1130 --1487
NM_020732chr66855 488 307 285 71 64 ------
NM_020734chr1232892 1198 1017 11228 ----
NM_020739chr1543795 3519 2571 884 11273 14178 --
NM_020742chrX52668 2512 1694 565 191 1698 ----
NM_020747chr53970 830 788 ------
NM_020748chr1741923 1808 1524 776 ----1543
NM_020749chr831648 715 362 11794 --1391
NM_020754chr32474 370 --1488 --
NM_020755chr61207 --11136 --
NM_020760chr241434 799 763 126 --1238 11750
NM_020766chrX134579 4553 3756 3615 3353 2907 2845 1619 1611 1320 921 651 90 11626 ----
NM_020771chr661516 1175 402 354 173 144 ----11413
NM_020772chr17137865 7424 7303 5664 5302 2922 2230 1611 1584 955 693 342 285 56665 6516 5573 3248 1124 12341 --
NM_020773chr452551 2261 2254 460 419 ------
NM_020774chr18125957 4684 3984 2148 2004 1484 1441 920 851 623 404 80 12211 14922 --
NM_020782chr12114459 4297 3966 3922 3655 3232 3166 1525 508 407 42 34630 3213 1154 11494 24870 907
NM_020783chr1822378 1996 12064 ----
NM_020791chr1711309 ------
NM_020792chr342401 540 332 237 --1348 12110
NM_020794chr12237 201 --11415 --
NM_020796chr562768 2469 2329 2218 2175 1116 22010 73 ----
NM_020801chr512315 ------
NM_020802chr1152640 1285 1064 999 196 ------
NM_020806chr14----184 --
NM_020808chr11331 ------
NM_020809chr1121486 649 12253 ----
NM_020810chr1463086 2932 1432 754 570 497 2490 462 ----
NM_020824chr104547 539 514 312 ------
NM_020830chr293264 3244 3178 2713 2561 2549 444 397 294 11017 22832 2394 --
NM_020834chr141123 11405 1657 --
NM_020839chr31607 1487 ----
NM_020841chr1273845 3506 3091 1593 1090 628 433 ------
NM_020844chr887359 7303 5033 2655 2642 1718 1711 563 3632 406 152 27074 4964 1526
NM_020854chr1851500 293 244 104 96 ------
NM_020856chr1931398 1303 86 1100 ----
NM_020860chr421018 466 1280 ----
NM_020861chr621365 113 1478 182 11351
NM_020866chr13--2856 691 ----
NM_020868chr241924 1828 279 250 ------
NM_020870chr442102 804 557 358 --21561 544 --
NM_020872chr321289 677 21199 251 --11270
NM_020873chr31811 --1859 --
NM_020890chr32228 192 ------
NM_020918chr1043658 2295 1318 479 --32994 954 908 --
NM_020919chr23907 842 823 --1232 --
NM_020921chr1493658 3549 3350 846 465 459 299 288 138 31403 423 68 --13438
NM_020926chrX130 ------
NM_020940chr1052185 1030 726 648 209 32704 1839 187 ----
NM_020948chr163627 3478 3254 2929 2376 1432 12328 13559 --
NM_020952chr9167 ------
NM_020962chr1542025 2003 802 752 --12309 --
NM_020971chr191668 ------
NM_020975chr10--31759 1650 639 11611 --
NM_020977chr42703 441 --1318 1187
NM_020981chr23822 308 115 --1136 --
NM_020983chr1212008 ------
NM_020987chr102484 32 ------
NM_020988chr16--11046 ----
NM_020993chr1211850 1467 ----
NM_021005chr153475 463 420 --1868 --
NM_021007chr2----11533 --
NM_021012chr1711051 ----13146
NM_021025chr51347 ------
NM_021033chr1353054 2776 2630 1357 1196 23160 1294 --1192
NM_021063chr6--165 ----
NM_021069chr422114 387 ----1644
NM_021072chr532485 819 791 --1347 --
NM_021076chr221427 ------
NM_021079chr1733101 2352 219 ------
NM_021097chr253039 1156 976 914 648 23077 304 11202 --
NM_021102chr191372 ------
NM_021110chr81604 --1754 --
NM_021115chr221145 ------
NM_021120chrX82953 2619 2610 1266 1085 175 157 105 1299 1144 --
NM_021132chr1011070 1841 --1540
NM_021136chr142527 300 ------
NM_021140chrX4893 862 743 59 1332 1847 --
NM_021144chr91557 ------
NM_021151chr721077 962 ------
NM_021155chr1972305 2296 2263 1864 1163 924 77 11009 ----
NM_021159chr41222 ----1683
NM_021163chr72451 237 --43557 2740 685 588 1762
NM_021165chr12835 780 ------
NM_021183chrX22056 800 21778 736 11033 2983 273
NM_021188chr14------2432 350
NM_021190chr141318 1090 538 429 --21186 1013 --
NM_021192chr21368 ------
NM_021194chr11232 ------
NM_021202chr2012451 ------
NM_021203chr3146 1697 3854 343 185 --
NM_021204chr43801 699 345 1679 ----
NM_021205chr162727 2381 2284 2166 325 256 12844 --1449
NM_021220chr201452 165 ----
NM_021222chr11178 1122 --1489
NM_021224chr91409 ------
NM_021227chr4156 ------
NM_021238chr1261678 655 590 359 251 102 ----11688
NM_021239chr1431276 1014 198 21444 1120 ----
NM_021240chr9------1542
NM_021249chr1431326 645 60 --11637 --
NM_021252chr1062059 1369 1287 736 653 203 --11752 --
NM_021255chr1473844 3455 3409 1618 1364 1054 300 --13360 --
NM_021572chr62939 856 ------
NM_021619chr9------11147
NM_021622chr101763 21629 253 ----
NM_021627chr33965 958 38 1105 1992 --
NM_021629chr394753 4100 3588 3477 1578 1256 727 386 23 15028 24332 3184 11225
NM_021637chrX31341 1323 979 ------
NM_021644chr103953 308 164 2749 118 1826 --
NM_021647chr484566 4423 3949 3869 3410 2874 492 439 ------
NM_021648chr642241 674 355 129 12774 ----
NM_021705chr651580 1337 1309 497 129 ----11302
NM_021722chr71391 ------
NM_021723chr71432 ------
NM_021738chr10----1334 1118
NM_021783chrX32025 1844 48 2629 316 11833 --
NM_021813chr665024 4287 869 818 409 51 --11564 45790 5595 5443 1273
NM_021815chr272915 2716 819 359 293 234 56 ------
NM_021818chr1421228 26 --11370 --
NM_021830chr102871 308 ------
NM_021908chr71166 1904 1701 --
NM_021911chr575284 5256 4954 4122 3632 1837 201 ----14500
NM_021912chr1564116 3869 1311 596 313 70 1580 ----
NM_021914chr145872 694 657 556 417 ------
NM_021935chr31806 1229 ----
NM_021940chr61460 --21530 280 --
NM_021942chr42939 713 ------
NM_021943chr632151 2145 881 135 ----
NM_021946chrX21448 423 ----1186
NM_021947chr1731130 386 131 ----11272
NM_021951chr91349 ----1269
NM_021954chr1363281 2654 2636 2512 1056 1033 1181 ----
NM_021956chr621182 1123 ------
NM_021957chr121507 ------
NM_021959chr6--3915 348 265 1877 --
NM_021960chr162680 2242 2179 1061 847 758 ----11037
NM_021961chr11117047 6812 6097 5537 4799 2542 1719 1659 1084 253 208 17392 56145 4853 2863 2454 406 14622
NM_021963chrX2761 158 1176 ----
NM_021964chr3136563 6246 5974 5747 4209 2516 2379 2217 1955 1863 1461 802 375 36334 2321 1733 24247 1882 11917
NM_021971chr3135 ------
NM_021980chr1011221 185 ----
NM_021998chrX21216 503 ------
NM_022037chr21345 ----1833
NM_022048chr1546047 5790 4464 760 34605 1656 666 14810 --
NM_022062chr1111383 11974 ----
NM_022066chr17----1992 --
NM_022079chr102868 257 --1648 --
NM_022080chr2072492 1927 1727 1054 406 236 45 1359 12532 1753
NM_022093chr12922 358 ------
NM_022114chr134220 3906 1210 14292 ----
NM_022116chr72171 108 ----1687
NM_022117chrX----1435 1168
NM_022118chr13--1402 ----
NM_022130chr53207 74 51 ------
NM_022136chr212535 498 ------
NM_022137chr1422040 251 --2567 371 --
NM_022154chr4--21261 194 ----
NM_022166chr1655947 5848 5512 4992 4762 56329 5825 5678 5585 5305 ----
NM_022169chr111595 ------
NM_022170chr72451 276 1562 ----
NM_022173chr21345 ----1833
NM_022351chr883747 3568 3518 2767 1388 956 769 754 23489 51 --11349
NM_022373chr74744 721 699 184 ------
NM_022443chr3129 ------
NM_022459chr13106036 6030 5689 4697 4611 4385 2423 2222 1889 552 --14048 --
NM_022461chr31172 --11092 --
NM_022462chr19103081 2740 2495 1487 1389 1363 1307 1241 789 373 21275 269 33190 2377 2350 --
NM_022465chr1243052 2937 473 87 11182 --1726
NM_022469chr122862 2562 ------
NM_022473chr1563376 2945 971 542 452 276 1380 43364 1086 504 183 11040
NM_022474chr1472511 2412 1927 929 893 634 215 31962 291 129 11876 --
NM_022475chr4--1620 ----
NM_022476chr164838 713 143 125 ------
NM_022491chr1253464 2976 1393 1170 68 12731 --1776
NM_022496chr122498 351 --1335 --
NM_022553chr6----197 --
NM_022566chr151588 ------
NM_022650chr52958 346 ------
NM_022726chr621116 188 ------
NM_022733chr11878 1455 ----
NM_022753chr142364 1909 243 69 --12828 12471
NM_022756chr12443 351 21501 979 ----
NM_022763chr363059 2138 2053 984 752 265 22851 301 11263 --
NM_022780chr22550 405 ------
NM_022781chr943156 2723 2347 537 --11239 --
NM_022782chr122379 111 ------
NM_022802chr1041475 1229 1193 244 ----11163
NM_022818chr161650 1233 21191 425 --
NM_022824chr51239 ------
NM_022826chr2--1830 ----
NM_022828chr541479 1457 678 596 ----1316
NM_022832chr431873 1769 696 ------
NM_022838chrX296 36 ------
NM_022841chr151955 12780 12736 1169
NM_022845chr163781 370 227 ------
NM_022893chr263106 2751 2326 1007 759 517 1249 ----
NM_022894chr2------1311
NM_022898chr1473519 3063 1571 1163 1033 1021 567 ------
NM_022909chr51527 ------
NM_022912chr263043 2764 1954 565 480 431 ------
NM_022918chr111453 21782 834 ----
NM_022965chr421362 1306 ------
NM_022970chr1011205 1533 ----
NM_022977chrX32642 188 178 151 11652 --
NM_023000chr1431384 1341 1187 ----1692
NM_023001chr1431384 1341 1187 ----1692
NM_023002chr1932084 1998 1772 ----11387
NM_023010chrX4594 588 576 334 ------
NM_023012chr121679 ------
NM_023016chr252802 2390 2277 636 361 --1141 1792
NM_023037chr1331106 368 107 --1988 --
NM_023039chr5163 1387 ----
NM_023073chr531090 348 56 ------
NM_023075chr182788 216 1174 ----
NM_023079chr1731889 1871 1284 ------
NM_023105chr811675 12030 11795 --
NM_023106chr811675 12030 11795 --
NM_023110chr811675 12030 11795 --
NM_023111chr811675 12030 11795 --
NM_023929chr842614 1895 513 433 ------
NM_024007chr512830 22347 1238 11193 --
NM_024050chr191172 ------
NM_024052chr1751122 983 954 785 205 22595 872 ----
NM_024076chr1932257 2079 837 --12057 11647
NM_024077chr91591 ------
NM_024090chr411940 ------
NM_024095chr1231569 350 205 ------
NM_024295chr841961 1289 581 462 ------
NM_024312chr1241223 1107 569 404 ------
NM_024334chr331864 1248 693 11781 1747 --
NM_024341chr1922580 1599 1471 23849 198 --
NM_024345chr936023 5500 396 31890 1335 119 24086 259 16042
NM_024408chr152595 2576 1410 892 697 31352 638 135 ----
NM_024415chr5267 53 ------
NM_024416chr921317 499 ------
NM_024422chr1881969 1648 1546 752 683 644 565 432 --11573 --
NM_024424chr111344 ------
NM_024425chr111344 ------
NM_024426chr111344 ------
NM_024429chr7--1206 --1271
NM_024430chr1841910 1193 192 184 1269 1549 --
NM_024519chr161291 ------
NM_024524chr362689 2625 2486 2187 932 339 32061 903 487 ----
NM_024525chr11652 ------
NM_024529chr11232 ----1893
NM_024539chrX1862 ------
NM_024546chr134993 950 188 85 --2910 882 --
NM_024548chr31643 ----1171
NM_024551chr1231805 784 353 --21701 1004 --
NM_024551chr1231805 784 353 --21701 1004 --
NM_024556chr112381 181 --1451 --
NM_024561chr133375 208 145 ------
NM_024569chr132872 648 637 ----12530
NM_024582chr41881 1737 11018 --
NM_024590chr411544 1119 --142
NM_024594chr521829 1595 --11479 11792
NM_024612chr17--1318 1744 --
NM_024624chr281640 1548 1444 1113 597 388 272 244 ------
NM_024626chr161643 1372 1359 1337 364 87 ------
NM_024639chr642608 1959 1907 888 1828 ----
NM_024646chr143997 3937 3916 283 11344 ----
NM_024657chrX3624 184 47 ------
NM_024665chr3124150 4038 3934 3824 3564 2860 1143 987 466 324 259 182 ----24502 3041
NM_024670chr103505 416 96 ----11151
NM_024674chr141189 320 215 43 1786 ----
NM_024675chr16165 ------
NM_024680chr11--1144 ----
NM_024692chr231757 497 189 11836 1149 --
NM_024713chr1511429 ----11585
NM_024721chr842512 1821 799 605 --1256 --
NM_024740chr1163591 3294 1519 955 719 377 12693 22805 1414 --
NM_024751chr452119 1758 1389 420 72 11633 ----
NM_024755chr154860 194 173 101 1719 ----
NM_024761chr9104986 4733 4491 3867 1745 1319 899 634 467 305 13381 24024 1268 --
NM_024798chr1522820 2656 ----12370
NM_024813chr1197 ------
NM_024814chr71346 ------
NM_024817chr1575954 5821 5145 5067 2255 2070 525 1500 ----
NM_024824chr1431661 678 125 11668 1594 146
NM_024828chr921209 430 ------
NM_024834chr101404 11438 1412 --
NM_024847chr162977 454 ----1936
NM_024852chr1--1262 ----
NM_024871chr31268 ------
NM_024896chr982341 1990 1026 1002 779 770 690 677 11936 ----
NM_024909chr611621 ------
NM_024917chrX1838 --1882 --
NM_024920chr441421 1409 1245 293 ------
NM_024930chr552468 2066 1921 606 536 ------
NM_024947chr3149208 9157 8216 6673 5925 2798 2744 2528 2428 2338 683 639 628 34 53828 2715 1529 916 668 26006 408 12031
NM_024949chr444474 4389 1460 1067 24040 1846 24360 3864 14949
NM_024953chr1272530 2162 1802 1011 622 611 402 ------
NM_024956chr151476 1522 ----
NM_024969chr2----1703 --
NM_024971chr9167 ------
NM_024979chr131418 --11647 --
NM_024989chr2117539 7348 6400 5737 3221 3023 1431 1326 599 517 145 16076 46193 2821 1547 1279 26969 2845
NM_024991chr1052963 2821 2253 1156 716 --1853 --
NM_024993chr251514 1324 1180 485 338 11451 ----
NM_025047chr31326 ------
NM_025054chr863971 3930 3679 3341 3275 1575 13351 1266 --
NM_025065chr11874 --1221 --
NM_025073chr1104683 4294 3681 3499 3162 3108 2913 1022 831 809 1275 34588 1752 281 1168
NM_025076chr22524 258 ------
NM_025077chr11233 ------
NM_025106chr111882 ------
NM_025126chr121766 ------
NM_025133chr22895 804 ------
NM_025134chr162794 361 1643 --12133
NM_025137chr15124 ------
NM_025138chr1331189 1179 1077 ------
NM_025146chr3112645 2542 2412 1925 1672 927 395 253 199 152 115 ------
NM_025147chr2--2829 79 ----
NM_025154chr741557 1207 463 336 11173 --11148
NM_025160chr134342 1234 618 21016 990 ----
NM_025164chr1152154 323 239 166 157 ------
NM_025181chr23767 158 69 --1121 --
NM_025187chr1621042 86 ------
NM_025191chr163570 3110 2818 2752 2708 2394 --22883 662 --
NM_025208chr1122391 2170 22360 2082 --12044
NM_025211chr92240 99 ------
NM_025214chr1842680 2570 671 662 1290 ----
NM_025235chr103890 356 182 ------
NM_025248chr1743219 3151 1123 1098 11296 ----
NM_025251chr831054 961 772 ------
NM_025268chr141396 ------
NM_030571chr541389 1368 1248 423 11380 ----
NM_030579chr1663739 1431 1199 894 667 390 ------
NM_030594chr1531361 896 182 1199 1258 --
NM_030621chr1453728 658 479 205 199 --21369 624 --
NM_030625chr1052055 786 530 227 219 ------
NM_030627chr583896 3788 3719 3047 2936 2629 433 230 ------
NM_030629chr1611708 ------
NM_030636chr732154 903 490 12055 1837 --
NM_030637chr14----1106 1166
NM_030647chr785863 5790 5691 5073 4751 2363 2131 984 --14421 11408
NM_030648chr485477 5218 4619 3430 1865 1323 653 256 --13969 --
NM_030650chr263981 3495 2890 1509 1440 301 11696 22746 365 13730
NM_030652chr61282 ------
NM_030660chr1481501 1230 1015 976 550 537 484 361 1583 2503 232 --
NM_030664chr101418 ----11554
NM_030670chr1241738 1633 1433 574 --21803 1728 --
NM_030671chr1241738 1633 1433 574 --21803 1728 --
NM_030674chr1255878 5848 1968 1953 162 23698 674 45128 4794 4250 2022 --
NM_030751chr1071893 1702 1640 1602 1510 1355 728 ----1245
NM_030751chr1071893 1702 1640 1602 1510 1355 728 ----1245
NM_030755chr1462807 2235 2167 1157 608 292 11902 32544 565 214 22909 1066
NM_030756chr101318 ------
NM_030762chr1211859 ----21902 489
NM_030766chr12--1133 ----
NM_030774chr1121286 1065 ------
NM_030784chr62150 40 1278 ----
NM_030791chr1451846 1392 658 638 253 ------
NM_030806chr1158834 7704 6730 5877 5854 5823 3747 3666 3239 2439 2278 2165 1361 395 83 12016 23782 1916 --
NM_030809chr1252473 2443 1687 1014 602 1667 ----
NM_030811chr201370 ------
NM_030816chr132279 1341 952 23407 479 33520 2742 177 --
NM_030820chr621055 300 ------
NM_030877chr201101 ------
NM_030881chr2282460 2322 2117 1830 1554 1508 890 697 ------
NM_030885chr342030 618 602 310 2444 390 2913 143 --
NM_030915chr232314 1553 154 ------
NM_030918chr165235 4133 1803 1585 489 171 --24725 552 --
NM_030920chr131496 593 556 11299 12004 --
NM_030934chr13382 182 83 2462 23 272 53 --
NM_030937chr121157 973 ------
NM_030938chr1741010 391 217 44 --11063 --
NM_030939chr63998 62 49 ------
NM_030940chr921370 544 ----11146
NM_030949chr63961 472 175 1538 1356 --
NM_030958chr83421 394 27 ------
NM_030963chr6----1232 --
NM_030964chr573611 3260 2874 2550 2432 799 45 1757 23687 3120 --
NM_030965chr11538 ------
NM_031208chr161983 ------
NM_031216chr1841518 1504 1456 702 ------
NM_031217chr113405 219 162 ------
NM_031229chr202530 451 ------
NM_031243chr752073 2044 1848 915 388 --11992 --
NM_031244chr641141 1126 1047 914 --1865 --
NM_031262chr91828 ------
NM_031263chr92885 52 ------
NM_031267chr72564 393 ------
NM_031292chr1211725 ----11196
NM_031296chr462317 2276 1986 692 652 584 2383 192 ----
NM_031305chr441325 640 568 233 --11340 --
NM_031314chr1471857 1717 1421 1289 570 205 118 --1334 --
NM_031369chr41633 ----1178
NM_031370chr41633 ----1178
NM_031371chr121294 1260 11077 ----
NM_031371chr121294 1260 11077 ----
NM_031411chr52372 36 1227 ----
NM_031419chr331391 1303 1243 ------
NM_031427chr1475889 4972 4436 2205 2162 2082 977 --25552 1857 12250
NM_031431chr1381769 1656 1514 1206 1167 664 297 180 11630 ----
NM_031435chr1283148 3000 2439 2345 2188 839 491 98 ------
NM_031438chr531677 265 123 11740 ----
NM_031439chr81379 --3661 365 242 --
NM_031442chrX11017 12548 13165 12242
NM_031443chr71327 ------
NM_031445chr243288 3203 2770 978 23307 2832 --1891
NM_031452chr15183 ------
NM_031453chr1052357 2301 1741 755 650 12505 1785 --
NM_031463chr1631884 929 26 ------
NM_031468chr798272 8185 7621 7447 7382 5321 2468 2443 231 21314 610 22341 1678 16216
NM_031476chr1642719 2590 754 325 ------
NM_031483chr2073553 3454 2314 2267 994 588 480 1135 11397 13131
NM_031492chr111144 ------
NM_031844chr144085 3697 250 64 13325 22650 960 --
NM_031845chr283357 2462 2300 2257 1453 1295 920 475 --13212 --
NM_031847chr283357 2462 2300 2257 1453 1295 920 475 --13212 --
NM_031849chr52372 36 1227 ----
NM_031857chr52372 36 1227 ----
NM_031858chr1741603 1512 1083 226 11136 ----
NM_031860chr52372 36 1227 ----
NM_031862chr1741603 1512 1083 226 11136 ----
NM_031866chr101934 ----1882
NM_031892chrX1864 ------
NM_031904chr1122042 2021 12122 11527 --
NM_031922chr61199 1470 ----
NM_031953chr41127 ------
NM_031992chr72451 276 1562 ----
NM_032012chr964749 4244 1409 1093 765 587 25201 5137 34834 4031 1235 44664 1740 1329 869
NM_032042chr542776 907 606 102 32732 1971 618 11098 --
NM_032047chr31315 3810 509 26 11738 1265
NM_032088chr531737 568 445 ------
NM_032092chr531737 568 445 ------
NM_032102chr1133132 1001 665 ------
NM_032116chr1395465 5169 4028 1795 1547 1320 1098 341 107 2929 761 ----
NM_032125chr12927 254 ------
NM_032132chr12438 130 --135 --
NM_032144chr221212 693 1280 ----
NM_032145chr681906 1888 1863 1816 1646 1407 1352 341 1289 ----
NM_032153chr332368 2320 940 ------
NM_032154chr102915 817 --1315 --
NM_032160chr1854326 2766 1368 645 307 24209 3523 ----
NM_032165chr121247 ------
NM_032182chr1051389 1276 1088 1081 297 ------
NM_032186chr121273 219 1958 ----
NM_032199chr1053783 3380 2818 1435 971 11309 ----
NM_032208chr23982 912 561 22698 2478 ----
NM_032221chr2042058 1809 1638 1437 ------
NM_032228chr1162973 2484 2369 2235 887 482 1558 1769 --
NM_032229chr1321113 1103 ------
NM_032233chr14--1862 ----
NM_032236chr131109 884 336 --1923 --
NM_032239chr431343 366 214 1136 ----
NM_032246chr1541298 1275 1076 311 --1363 --
NM_032256chr122686 162 ----1828
NM_032271chr1611437 --11238 --
NM_032281chr1952470 2242 2224 2115 1191 ------
NM_032288chr321454 709 31894 1880 209 --12173
NM_032291chr121560 283 ------
NM_032312chr21581 ------
NM_032321chr263221 3086 3020 985 870 801 --12806 --
NM_032343chr3--1197 ----
NM_032352chr1411224 ------
NM_032354chr175908 820 280 225 92 ------
NM_032368chr1--169 ----
NM_032373chr10105449 5404 5311 5263 4818 2166 1759 1459 1219 498 --15126 34880 1328 374
NM_032379chr113843 808 323 ------
NM_032403chr531737 568 445 ------
NM_032410chr84946 781 508 450 1441 ----
NM_032429chr10--1589 ----
NM_032433chr1931554 1358 534 --11275 --
NM_032434chr231455 340 196 --11039 --
NM_032435chr141923 1778 1703 1636 2303 95 --1618
NM_032439chr102171 88 --1227 --
NM_032440chr1011158 12076 11798 --
NM_032445chr1511919 2490 185 1952 --
NM_032446chr553422 1255 714 226 57 13837 ----
NM_032449chr1--1252 12240 12370
NM_032457chr453888 3077 2996 1500 1447 --128 --
NM_032458chrX63263 3057 2908 2668 2498 403 21303 901 ----
NM_032466chr821536 649 1376 ----
NM_032482chr1942229 1751 448 193 12780 ----
NM_032485chr202662 148 ------
NM_032491chr1231274 1104 411 ------
NM_032499chr151171 ------
NM_032505chr362561 1858 1775 1052 625 102 1502 1640 --
NM_032507chr61228 ------
NM_032508chrX11340 31244 1085 919 ----
NM_032510chr1842322 2211 2164 1951 --12486 11554
NM_032511chr61317 ----1116
NM_032521chr2033014 2606 2240 2831 22 12411 --
NM_032536chr91477 ------
NM_032539chrX2727 92 --1171 --
NM_032547chr421416 1137 ------
NM_032552chr91239 ------
NM_032558chr921229 946 1998 ----
NM_032560chr144995 849 829 47 ----1813
NM_032582chr1721299 446 ----11489
NM_032598chr17----142 --
NM_032603chr2------1151
NM_032622chr431044 194 81 ------
NM_032632chr1441840 823 751 436 ----11896
NM_032682chr343550 3071 641 87 13364 1692 --
NM_032689chr192270 117 ------
NM_032737chr1932664 2329 1737 1565 32481 651 82 --
NM_032777chr821564 403 ------
NM_032784chr631028 894 370 1338 ----
NM_032786chr121166 ------
NM_032800chr12689 42 1498 31972 780 217 --
NM_032804chr1042158 1649 419 340 --11866 12168
NM_032826chr744739 3405 286 216 11724 11450 --
NM_032859chr1383496 2696 1160 1128 1072 675 408 154 ------
NM_032864chr171387 633 502 351 192 160 107 ------
NM_032873chr1123033 198 1512 14109 1141
NM_032876chr141583 ------
NM_032880chr1--155 ----
NM_032900chr1023749 2446 11143 --13839
NM_032905chr1021315 350 ------
NM_032918chr123508 319 153 ------
NM_032932chr1754653 4341 1727 854 730 25375 3940 11244 --
NM_032943chr113843 808 323 ------
NM_032949chr131529 ------
NM_032961chr421122 467 ------
NM_032968chrX54253 4238 3460 2857 587 1495 11359 13368
NM_032969chrX54253 4238 3460 2857 587 1495 11359 13368
NM_032973chrY54245 4230 3456 2852 587 1495 11359 13363
NM_032975chr1833008 860 753 1233 23201 2297 --
NM_032978chr18135 ------
NM_032979chr18135 ------
NM_032980chr1833008 860 753 1233 23201 2297 --
NM_032981chr18135 ------
NM_032983chr742654 2380 639 402 12363 --12436
NM_032991chr41384 ------
NM_032993chr4------1259
NM_032999chr72421 159 --2843 414 11021
NM_033000chr72421 159 --2843 414 11021
NM_033001chr72421 159 --2843 414 11021
NM_033008chr31565 --1159 1541
NM_033009chr31565 --1159 1541
NM_033010chr31565 --1159 1541
NM_033014chr921317 499 ------
NM_033020chr174797 4702 3472 3106 1127 569 461 --2897 833 14865
NM_033027chr3--1136 ----
NM_033030chr231505 1459 1344 1591 11159 --
NM_033055chr1161 11039 1174 150
NM_033082chr12238 28 ------
NM_033083chr383333 3259 2261 2200 1037 686 496 345 ------
NM_033089chr2011487 ------
NM_033107chr731652 500 450 --11758 --
NM_033135chr1122391 2170 22360 2082 --12044
NM_033136chr511832 ------
NM_033137chr511832 ------
NM_033138chr732054 1530 376 1880 ----
NM_033139chr732054 1530 376 1880 ----
NM_033140chr732054 1530 376 1880 ----
NM_033143chr494226 3962 3421 3244 3075 1710 963 759 400 24410 24 ----
NM_033157chr732054 1530 376 1880 ----
NM_033181chr622759 1468 --11215 --
NM_033207chr1052425 2220 1717 1656 635 --1745 12455
NM_033211chr5--1766 ----
NM_033222chr931376 389 77 31433 1261 52 ----
NM_033224chr7108051 7093 5574 2413 2394 2237 1612 811 712 536 21836 1471 --11625
NM_033225chr853205 1255 953 414 219 1202 11989 --
NM_033285chr894425 4345 4275 3920 3907 3885 2956 1336 119 11622 --24474 3381
NM_033305chr921076 228 --1505 --
NM_033315chr1712203 ------
NM_033326chr1122527 179 --1153 --
NM_033331chr943353 3089 2822 2803 12981 23293 2269 --
NM_033360chr12104479 3519 3124 2849 1740 1649 1433 1042 322 288 14297 34082 3082 1459 --
NM_033364chr331418 1273 334 ------
NM_033389chr1764866 4010 3505 3249 896 632 --13552 --
NM_033393chr462908 2127 1073 680 352 337 ------
NM_033394chr261594 1527 1045 497 486 70 1624 ----
NM_033396chr112445 290 ------
NM_033425chr1153470 2988 1318 1183 664 13417 22517 716 --
NM_033426chr1452913 2595 2386 574 36 ------
NM_033427chr74699 561 270 245 197 ----
NM_033429chr1563236 3002 2754 2020 1214 72 ------
NM_033430chr484121 3579 1626 1582 1524 968 838 354 --13640 --
NM_033437chr484121 3579 1626 1582 1524 968 838 354 --13640 --
NM_033480chr612992 --1180 --
NM_033481chr612992 --1180 --
NM_033495chrX132 --1402 --
NM_033505chr264360 2505 2128 1741 1545 259 2542 381 24918 1000 --
NM_033512chr852135 1049 753 283 149 13040 ----
NM_033515chr621029 294 1992 --1256
NM_033516chr991617 1514 1291 571 508 343 291 105 45 ------
NM_033540chr351026 989 790 374 193 ------
NM_033551chr52960 300 ------
NM_033631chr143469 3285 3260 1508 11518 43292 2887 1460 521 --
NM_033632chr431289 1248 373 1107 ----
NM_033642chrX51087 984 470 454 367 --11182 --
NM_033644chr552170 1789 682 115 32 ------
NM_033645chr552170 1789 682 115 32 ------
NM_033656chr2195971 5636 5283 4990 4410 4398 4050 982 898 25838 1946 24728 3678 14795
NM_044472chr12479 146 ------
NM_052811chr1394331 4292 3676 3529 3335 3327 2016 1992 333 12004 32077 1633 25 1948
NM_052832chr852592 2185 1903 757 239 21080 617 1657 --
NM_052867chr132508 45 ------
NM_052868chr12249 197 ------
NM_052879chr1243839 2649 1475 888 24077 2900 13282 12785
NM_052885chr12124637 4423 4415 3877 3677 1812 1331 1280 873 740 110 93 1679 2614 453 --
NM_052896chr11715 22430 1698 ----
NM_052897chr121823 ------
NM_052900chr831586 506 190 ------
NM_052904chr641295 1207 1090 1078 ------
NM_052905chr251798 1716 1476 1356 671 ----1287
NM_052913chr62456 135 11161 21023 301 --
NM_052917chr253139 1349 1233 516 95 ------
NM_052918chr1043296 3112 2819 1175 42699 2677 1411 1052 13377 --
NM_052923chr61194 ------
NM_052925chr192304 145 ------
NM_052927chr572212 1755 1677 1569 1456 1445 80 ----2808 328
NM_052965chr1--1135 ----
NM_053002chr32840 834 1963 ----
NM_053016chr9137633 7616 7498 5517 5165 5157 5120 5090 2258 1890 1747 1543 1327 15740 12530 --
NM_053024chr321217 1183 ------
NM_053025chr341708 560 449 367 ------
NM_053026chr341708 560 449 367 ------
NM_053027chr341708 560 449 367 ------
NM_053028chr341708 560 449 367 ------
NM_053031chr341708 560 449 367 ------
NM_053032chr341708 560 449 367 ------
NM_053043chr796201 4947 2566 2282 1333 367 299 248 128 1267 --1379
NM_053053chr11684 ------
NM_053056chr1192598 2443 2259 2141 2094 2056 983 918 544 --22101 1081 --
NM_053064chr1472337 2042 1897 969 808 657 57 ------
NM_053280chr111187 ------
NM_053281chrX187 ------
NM_054016chr131941 1860 1336 --1117 --
NM_054016chr131941 1860 1336 --1117 --
NM_054016chr131941 1860 1336 --1117 --
NM_054025chr1162246 2140 2065 1667 203 40 11937 ----
NM_057157chr10152 ------
NM_057159chr911051 ------
NM_057168chr711153 ------
NM_057169chr1252591 2227 647 154 30 --22951 2482 12767
NM_057170chr1252591 2227 647 154 30 --22951 2482 12767
NM_057175chr43664 651 115 --12538 11915
NM_057178chr172948 234 ------
NM_057749chr84496 456 348 75 ------
NM_058172chr42396 139 --1677 --
NM_058191chr212196 42 --1170 --
NM_058237chr141360 --1877 1857
NM_078469chr10--1144 1186 --
NM_078470chr1072700 1890 1779 1773 344 315 233 --12313 12524
NM_078625chr611080 ------
NM_080544chr321033 407 11336 ----
NM_080546chr932133 1867 1619 1264 1514 --
NM_080591chr942793 2702 2090 598 41130 360 259 231 ----
NM_080594chr164751 529 213 54 ------
NM_080599chr101959 ------
NM_080607chr201719 ------
NM_080629chr12398 80 1934 11030 --
NM_080630chr12398 80 1934 11030 --
NM_080632chrX4594 588 576 334 ------
NM_080645chr62832 290 ------
NM_080664chr1421754 31 1281 1787 --
NM_080676chr2042860 2648 2333 1010 22286 1292 1915 --
NM_080723chr661295 973 889 564 491 388 11270 267 22 --
NM_080738chr12142 124 --11270 --
NM_080759chr1352076 1880 1816 553 128 1732 32483 1830 167 1241
NM_080760chr1352076 1880 1816 553 128 1732 32483 1830 167 1241
NM_080764chr2263239 2659 2380 1323 915 459 22973 200 23087 684 --
NM_080792chr2012029 ------
NM_080798chr10------168
NM_080799chr10------168
NM_080800chr10------168
NM_080801chr10------168
NM_080802chr10------168
NM_080803chr10------168
NM_080804chr10------168
NM_080805chr10------168
NM_080806chr10------168
NM_080807chr10------168
NM_080808chr10------168
NM_080809chr10------168
NM_080810chr10------168
NM_080811chr10------168
NM_080812chr10------168
NM_080813chr10------168
NM_080814chr10------168
NM_080815chr10------168
NM_080867chr1454129 3294 1974 1565 1008 24766 4548 --14941
NM_080872chr843433 3415 3095 1623 --33706 3282 414 1629
NM_080874chr441285 462 353 283 ----11619
NM_080911chr122846 840 ------
NM_080927chr382991 2492 2313 2202 2115 2080 1323 385 --11111 --
NM_130391chr953384 2730 1001 781 505 --23569 986 --
NM_130392chr953384 2730 1001 781 505 --23569 986 --
NM_130393chr953384 2730 1001 781 505 --23569 986 --
NM_130395chr62362 317 --1156 --
NM_130434chr1521015 799 ------
NM_130436chr2122441 2366 ------
NM_130438chr2123018 2943 ------
NM_130439chr1032269 1794 1583 ------
NM_130439chr1032269 1794 1583 ------
NM_130440chr131586 665 659 11238 ----
NM_130442chr731108 999 988 ------
NM_130787chr19164 ------
NM_130798chr1551289 573 485 285 161 2258 236 2612 83 --
NM_130809chr583122 2393 2323 2083 2070 2064 341 107 2999 542 22431 1233 --
NM_130838chr15----1586 --
NM_130839chr15----1586 --
NM_130846chr121808 ------
NM_130847chr1165275 4855 4146 3748 1560 1319 24219 3846 ----
NM_133170chr2088119 6695 6302 5999 5763 1516 694 678 --11630 --
NM_133265chrX53053 2605 1390 535 70 23303 296 22476 2422 --
NM_133326chr1------1242
NM_133329chr241647 1577 644 248 ------
NM_133334chr434696 545 516 25040 446 25841 1838 --
NM_133367chr663270 2597 1082 959 421 161 11069 1603 --
NM_133370chr472987 2436 2375 1380 1276 1150 1056 1286 11177 --
NM_133372chr562933 2498 2371 2180 448 391 1806 ----
NM_133378chr24789 278 240 107 --1930 --
NM_133432chr24789 278 240 107 --1930 --
NM_133433chr52332 92 2715 319 ----
NM_133437chr24789 278 240 107 --1930 --
NM_133443chr1652202 1941 1834 868 248 12217 ----
NM_133445chr932821 1519 599 1396 13439 11268
NM_133465chr91314 ------
NM_133468chr722542 396 22533 2025 1356 --
NM_133493chr684581 4383 3719 2925 1296 272 104 66 14040 23461 1777 --
NM_133496chr163642 3518 3479 1444 526 310 41604 1211 595 326 13766 --
NM_133631chr32504 315 31668 1562 1166 ----
NM_133638chr511005 --1290 --
NM_133647chr1552950 1059 896 820 33 23745 1344 23872 3785 --
NM_134265chr1731234 305 123 ------
NM_134269chr22--1325 ----
NM_134270chr22--1154 ----
NM_134424chr1211036 ------
NM_134428chr92365 274 ------
NM_134442chr231268 1242 686 21366 625 ----
NM_138270chrX113459 2878 2736 2433 2238 1276 1233 1112 897 495 134 22567 246 --1413
NM_138326chr2--1165 ----
NM_138333chr952325 1827 1041 852 331 --22003 536 --
NM_138344chr143390 381 375 ------
NM_138350chr111050 21034 334 ----
NM_138373chr1941904 1611 101 46 21602 245 2170 61 --
NM_138385chr411397 ------
NM_138389chr42212 77 ------
NM_138415chr2221700 68 --11885 --
NM_138423chr1542329 1629 1493 434 --12006 --
NM_138426chr722269 174 12252 ----
NM_138437chrX2332 301 1322 --1243
NM_138443chr18----164 1186
NM_138444chr13114907 4861 4352 4170 3991 3923 3349 1946 1280 616 538 21852 1802 ----
NM_138448chr21494 2179 50 ----
NM_138459chr682706 1421 1227 1199 894 733 643 508 --33375 3133 945 23250 2395
NM_138473chr12105195 4982 3658 3540 1754 1501 1382 1357 1245 1176 11347 --13608
NM_138554chr942213 1855 384 318 22632 2081 12572 1647
NM_138558chr1------1776
NM_138559chr22427 80 ------
NM_138569chr6140 ------
NM_138576chr1473519 3063 1571 1163 1033 1021 567 ------
NM_138578chr2011205 --1160 1368
NM_138609chr53416 399 111 ------
NM_138610chr53416 399 111 ------
NM_138621chr254038 3727 3470 309 107 1898 1588 --
NM_138633chr621802 600 ------
NM_138638chr145872 694 657 556 417 ------
NM_138694chr621310 262 12889 ----
NM_138713chr16168151 7466 6792 6432 6395 5705 2829 1917 1753 1710 1590 1367 1357 812 516 377 57965 6315 6198 6184 1819 1670 11903
NM_138714chr16168151 7466 6792 6432 6395 5705 2829 1917 1753 1710 1590 1367 1357 812 516 377 57965 6315 6198 6184 1819 1670 11903
NM_138727chr131951 1851 1598 --1785 12476
NM_138728chr131951 1851 1598 --1785 12476
NM_138730chr61344 ------
NM_138732chr112925 297 ------
NM_138734chr112925 297 ------
NM_138735chr211094 1240 ----
NM_138766chr5178 1643 ----
NM_138771chr71272 21562 414 ----
NM_138779chr132256 101 ------
NM_138782chr552286 2206 454 258 64 11976 ----
NM_138786chr31405 ------
NM_138799chr241804 1741 1520 567 ------
NM_138821chr5178 1643 ----
NM_138822chr5178 1643 ----
NM_138931chr31308 ----2854 797
NM_138959chr1106474 6429 5272 5089 4203 2716 2041 1088 532 516 34972 2686 1830 45118 2272 1000 899 --
NM_138966chr181225 1425 ----
NM_138970chr1442448 2166 1525 557 ----132
NM_138971chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_138971chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_138972chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_138972chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_138973chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_138973chr1173119 3095 1530 1484 1440 735 675 1727 ----
NM_139035chrX1166 ------
NM_139045chr91644 ------
NM_139062chr171455 ------
NM_139071chr1241623 654 648 545 ------
NM_139072chr21699 ----1110
NM_139076chr41994 --11373 --
NM_139168chr54652 592 550 496 --11601 --
NM_139201chr121679 --1635 --
NM_139207chr1232139 246 178 11476 --1845
NM_139215chr17160 ------
NM_139241chr121195 ------
NM_139242chr1521491 1349 ------
NM_139244chr61114 1830 149 --
NM_139280chr1711363 ------
NM_139283chr1252406 685 626 574 252 12055 ----
NM_139316chr71675 11063 --1748
NM_139319chr1221866 597 ------
NM_139321chr2072966 2949 2601 1525 843 399 327 23420 440 1655 --
NM_139323chr2022011 218 ----11372
NM_144563chr21232 ------
NM_144563chr21232 ------
NM_144567chr152620 2054 1110 1063 441 --1375 167
NM_144571chr4116614 6561 4575 4441 2475 2163 1799 1584 1371 1292 655 -