TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-148a-3p
miRNA Sequence: UCAGUGCACUACAGAACUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr81820 ------
NM_000052chrX23162 465 ----143
NM_000070chr152501 418 ------
NM_000081chr131450 1252 225 ------
NM_000084chrX45160 1515 1042 149 ----15429
NM_000088chr172215 152 ------
NM_000089chr71165 ------
NM_000090chr22736 696 ------
NM_000091chr282851 2483 2441 2131 1916 871 476 279 ------
NM_000093chr91908 ----12164
NM_000096chr33863 678 286 ------
NM_000108chr71203 ------
NM_000109chrX52652 2596 2374 2128 513 12505 ----
NM_000111chr7--1260 ----
NM_000114chr2031276 1149 907 ------
NM_000125chr6104223 4053 3956 3674 3402 1175 999 885 326 44 --13773 --
NM_000129chr611448 ------
NM_000135chr1621009 79 ------
NM_000138chr1512119 --21769 456 --
NM_000141chr1031321 261 38 ------
NM_000142chr4----11430 --
NM_000161chr143350 52 40 ------
NM_000163chr521824 765 1296 1602 --
NM_000165chr641384 1191 626 502 ------
NM_000168chr743234 2660 1314 807 --1562 --
NM_000176chr512592 ------
NM_000183chr22144 69 ------
NM_000194chrX3185 164 141 ------
NM_000208chr1943654 3154 3143 1849 11567 13899 11513
NM_000210chr272150 2051 2040 2023 1720 546 491 ------
NM_000214chr2021219 721 ------
NM_000217chr12104978 3686 3269 2130 1873 1495 1038 998 983 783 ----1155
NM_000219chr2152510 2486 1623 1010 271 12129 12426 --
NM_000222chr411327 1636 11656 --
NM_000240chrX32269 1502 1477 --22294 103 --
NM_000245chr71106 --11567 21844 1654
NM_000248chr373003 2939 2168 2127 1086 486 22 1802 12849 --
NM_000259chr1585872 5645 5300 5029 4725 1283 608 412 2336 104 14834 12548
NM_000264chr9----41290 651 646 299 --
NM_000267chr1773471 2249 1288 1223 1190 980 101 ------
NM_000276chrX52121 569 561 454 418 11399 11847 --
NM_000282chr131210 ------
NM_000284chrX3711 373 171 1396 ----
NM_000291chrX1239 ------
NM_000297chr421679 136 --21974 1846 --
NM_000301chr61216 128 ----
NM_000314chr1042966 2544 1153 418 --12260 13158
NM_000329chr11833 1151 ----
NM_000332chr696935 6929 6465 6444 6043 4634 1179 1005 405 1319 163 2903 684
NM_000335chr311671 1829 ----
NM_000337chr554901 2621 2591 2262 1422 ----11186
NM_000340chr321212 481 11388 ----
NM_000345chr4----1785 --
NM_000346chr1712024 --1458 --
NM_000362chr2213530 ------
NM_000368chr954885 4459 3954 672 594 33947 1725 177 1430 --
NM_000389chr621308 1152 11293 11456 --
NM_000390chrX22144 1032 1537 22288 298 --
NM_000396chr13530 234 66 ------
NM_000399chr102462 139 ------
NM_000408chr233145 1138 176 1697 ----
NM_000430chr1752874 2797 906 243 46 --33466 2477 1074 --
NM_000435chr192802 661 --1979 --
NM_000436chr531632 1439 263 ------
NM_000439chr51302 11679 1654 --
NM_000441chr721887 466 --12010 2413 62
NM_000444chrX1112 ----161
NM_000448chr1153055 2763 2126 2021 579 --12546 22631 59
NM_000461chr353995 3868 3039 2884 186 --13775 --
NM_000462chr1521336 1231 ------
NM_000474chr72632 265 ------
NM_000480chr1141177 1058 576 21 --1145 --
NM_000484chr21----1248 --
NM_000489chrX52455 1087 1012 646 449 ------
NM_000492chr721499 1009 ------
NM_000503chr861775 1402 1395 1296 1239 203 --11904 --
NM_000509chr41176 ------
NM_000522chr711076 ------
NM_000523chr2--1394 ----
NM_000527chr1942167 1848 819 91 --1878 11978
NM_000530chr12868 841 --11042 --
NM_000533chrX11571 1605 ----
NM_000538chr132159 136 ------
NM_000555chrX117469 7159 6664 5908 5676 5649 2517 2325 1902 1773 1205 --11786 --
NM_000560chr11690 ------
NM_000572chr11856 ------
NM_000578chr231646 1595 1263 11778 ----
NM_000596chr71201 ------
NM_000599chr274640 4493 2972 1435 1209 1043 666 11076 23871 3826 --
NM_000602chr731372 1208 527 --1444 --
NM_000609chr1063155 3127 2193 1126 251 108 12501 1882 --
NM_000610chr1172784 869 734 681 469 437 191 ------
NM_000615chr1133004 2886 1954 ------
NM_000618chr1275324 4080 2122 1617 624 425 339 11014 --15918
NM_000618chr1275324 4080 2122 1617 624 425 339 11014 --15918
NM_000627chr2----140 --
NM_000633chr1874863 4567 3697 2031 1760 1724 494 11431 167 --
NM_000635chr1931275 367 356 ------
NM_000681chr1041305 1266 333 97 --1868 --
NM_000684chr1011129 ------
NM_000686chrX2527 464 ------
NM_000701chr1173 ------
NM_000702chr152231 1813 1704 887 96 --11861 --
NM_000719chr1266667 5318 5263 4788 1377 1064 16208 --11546
NM_000721chr152695 2587 901 208 124 ----11791
NM_000722chr7----1285 --
NM_000723chr1741342 382 304 100 ------
NM_000724chr102545 538 --1552 --
NM_000739chr7196 ------
NM_000756chr8281 32 ------
NM_000767chr1921177 367 --11489 --
NM_000788chr411203 11132 ----
NM_000800chr531519 1236 94 21570 1217 ----
NM_000806chr51591 --139 --
NM_000810chr151532 ------
NM_000813chr574760 3670 3472 1903 1343 403 331 13596 ----
NM_000814chr15--12748 --13853
NM_000816chr51184 ------
NM_000817chr21821 ------
NM_000824chr41107 ------
NM_000826chr462535 2412 1948 1885 1855 61 ----11762
NM_000827chr522369 643 --2329 245 --
NM_000828chrX42062 1831 1595 579 --11443 --
NM_000829chr1162219 2064 2001 1511 784 137 ------
NM_000831chr154044 3993 1342 566 87 ----15765
NM_000833chr1611368 --31057 483 308 --
NM_000838chr632433 2182 671 ------
NM_000844chr33403 349 214 ------
NM_000868chrX32053 1903 142 ------
NM_000872chr1021437 567 ------
NM_000875chr1586744 6496 5662 4938 4859 1996 1603 1376 1628 14279 --
NM_000877chr243079 2960 1023 474 --13112 --
NM_000885chr21849 ------
NM_000891chr1763246 3185 2821 1046 491 86 --13641 --
NM_000899chr1254422 4316 3907 3011 1758 33198 692 200 ----
NM_000901chr422006 1757 11681 ----
NM_000902chr311174 11993 --1103
NM_000905chr71170 ------
NM_000912chr843495 2701 2542 503 12946 13519 --
NM_000917chr10135 ------
NM_000918chr173519 259 25 ------
NM_000919chr51102 ------
NM_000921chr121120 1504 ----
NM_000924chr1221223 192 --1946 --
NM_000933chr203403 376 171 ------
NM_000940chr7180 ------
NM_000944chr452052 1937 1913 1476 846 --1328 --
NM_000945chr221335 807 ------
NM_000950chrX23241 457 ----11321
NM_000956chr141345 --11081 1253
NM_000962chr942104 949 550 369 ----1573
NM_000965chr311198 ------
NM_001001323chr1222916 878 --1320 --
NM_001001344chrX22168 726 --11804 1973
NM_001001349chr1721214 454 --11713 --
NM_001001389chr1172784 869 734 681 469 437 191 ------
NM_001001390chr1172784 869 734 681 469 437 191 ------
NM_001001391chr1172784 869 734 681 469 437 191 ------
NM_001001392chr1172830 915 780 727 515 483 237 ------
NM_001001394chr21716 1281 ----
NM_001001396chr134278 4119 3235 --13770 14484
NM_001001419chr553608 1540 852 834 416 1255 35046 1190 538 14821
NM_001001420chr553608 1540 852 834 416 1255 35046 1190 538 14821
NM_001001433chr2042487 2380 2316 317 --1717 --
NM_001001481chr853447 2623 2434 151 135 --22557 527 --
NM_001001484chr1031631 449 316 --22400 1725 --
NM_001001549chr742580 2234 1785 402 ------
NM_001001550chr742580 2234 1785 402 ------
NM_001001555chr742580 2234 1785 402 ------
NM_001001557chr831938 675 101 --11831 --
NM_001001664chr264107 3890 1244 843 303 142 --11413 --
NM_001001668chr1923351 3168 --13873 --
NM_001001669chr532487 2130 260 ------
NM_001001740chr1126 ------
NM_001001740chr1126 ------
NM_001001872chr143585 578 481 ----1157
NM_001001890chr2144123 825 531 290 --14128 --
NM_001001974chr1042271 1584 243 126 ------
NM_001001995chrX21909 1184 ------
NM_001002026chr321858 1535 ----12455
NM_001002032chr172705 147 --121 1203
NM_001002033chr172805 247 --1121 1303
NM_001002233chr822136 2025 ------
NM_001002243chr2------1380
NM_001002255chr6160 ------
NM_001002257chr273418 3061 2213 1432 416 138 76 ----11397
NM_001002259chr121249 ------
NM_001002295chr10163 ------
NM_001002838chrX21852 1480 ------
NM_001002843chr152468 426 ------
NM_001002860chr1464578 4314 3463 1814 391 299 --1422 --
NM_001002909chr1721972 622 ----1810
NM_001003407chr1065078 5020 4209 4026 3315 429 24784 1358 --11914
NM_001003408chr1065078 5020 4209 4026 3315 429 24784 1358 --11914
NM_001003652chr1888036 7679 6790 5518 2556 1898 1129 61 --38340 1903 393 23099 809
NM_001003674chr1865950 4903 4632 1648 939 585 ----11450
NM_001003675chr1865950 4903 4632 1648 939 585 ----11450
NM_001003681chr2222122 1853 ------
NM_001003688chr421099 49 ------
NM_001003694chr31259 ----191
NM_001003712chr1263650 2699 2524 2500 1031 299 ------
NM_001003760chr633669 2848 801 13022 22394 2251 12868
NM_001003792chr32861 102 ------
NM_001003793chr32861 102 ------
NM_001003800chr963505 3488 2299 1473 826 484 ------
NM_001003805chr14159 ------
NM_001003891chr222872 331 ------
NM_001003940chr1513627 1912 ----
NM_001003942chr1513627 1912 ----
NM_001003943chr1513631 1916 ----
NM_001004023chr11207 ------
NM_001004304chr1242730 2375 2012 542 12554 12388 --
NM_001004308chrX21478 64 ------
NM_001004317chr644419 4009 3104 2882 --24014 3278 13789
NM_001004346chr421209 162 ------
NM_001004360chr221497 255 ------
NM_001004439chr1531061 831 117 ----11089
NM_001004720chr22946 269 ------
NM_001004722chr221115 438 --159 --
NM_001005242chr1241583 1409 1249 329 ------
NM_001005335chr191291 ------
NM_001005354chr121444 --176 --
NM_001005360chr194810 230 218 181 ------
NM_001005361chr194810 230 218 181 ------
NM_001005362chr194810 230 218 181 ------
NM_001005366chr123840 688 654 --142 --
NM_001005386chr232409 2104 2036 --1484 --
NM_001005404chr1743366 3246 3041 537 11769 14475 --
NM_001005463chr1052096 1982 793 779 413 12414 ----
NM_001005476chr21624 ------
NM_001005505chr321347 293 ------
NM_001005526chr21119 ------
NM_001005609chrX51296 1247 458 365 319 11362 ----
NM_001005732chr211606 ------
NM_001005733chr211563 ------
NM_001005751chr101135 --1153 --
NM_001005781chr21243 1467 ----
NM_001005782chr22692 270 1916 ----
NM_001005849chr171195 ------
NM_001005914chr31404 ------
NM_001005920chr161770 ------
NM_001006600chr541746 1534 818 693 --22286 1780 --
NM_001006617chr941160 592 410 176 ------
NM_001006618chr92218 74 ------
NM_001006619chr941160 592 410 176 ------
NM_001006620chr941160 592 410 176 ------
NM_001006621chr941160 592 410 176 ------
NM_001006626chr7196 ------
NM_001006627chr7196 ------
NM_001006628chr7196 ------
NM_001006629chr7196 ------
NM_001006630chr7196 ------
NM_001006631chr7196 ------
NM_001006632chr7196 ------
NM_001006635chr21246 ------
NM_001006636chr21704 --1372 --
NM_001006657chr222333 941 ----12983
NM_001006684chrX1433 ------
NM_001007024chr1754375 4346 4289 3293 1492 --1507 --
NM_001007025chr1754375 4346 4289 3293 1492 --1507 --
NM_001007075chr41716 --31102 266 96 --
NM_001007097chr945076 957 318 156 1507 ----
NM_001007099chr12788 219 ------
NM_001007100chr12788 219 ------
NM_001007102chr661646 1506 1328 1284 1222 194 ------
NM_001007156chr15179 ------
NM_001007189chr5--158 124 --
NM_001007226chr171270 --21097 128 --
NM_001007227chr171270 --21097 128 --
NM_001007228chr171270 --21097 128 --
NM_001007229chr171270 --21097 128 --
NM_001007230chr171270 --21097 128 --
NM_001007237chr152853 2622 2543 2219 345 1637 ----
NM_001007246chr2141307 179 125 65 ------
NM_001007257chr131516 422 243 21423 1357 ----
NM_001007466chr695092 4738 4726 4710 4013 1959 1690 1087 463 34089 3897 246 14895 13996
NM_001007527chr51643 1128 --1170
NM_001007553chr13427 358 269 ------
NM_001007559chr1852042 1790 655 470 61 ----11303
NM_001007565chr31352 ------
NM_001007595chr151226 --1286 --
NM_001008222chrX41095 871 522 251 ------
NM_001008225chr74597 589 550 217 --1687 --
NM_001008239chr1873561 2952 2385 1496 1263 1163 489 --23310 29 --
NM_001008388chr441127 1032 420 113 ------
NM_001008392chr372945 2923 2241 1167 1007 215 33 --13342 --
NM_001008407chr7--21212 418 1486 --
NM_001008408chr725050 409 22327 2095 26341 4591 --
NM_001008495chr822275 242 ------
NM_001008529chr1721291 1041 ------
NM_001008541chr1012130 --1677 --
NM_001008541chr1012130 --1677 --
NM_001008564chr1332144 1760 751 11902 12092 11910
NM_001008566chr22152 ------
NM_001008660chr1121395 431 --21274 1156 --
NM_001008701chr1933012 2295 1037 --1512 --
NM_001008707chr1431787 1254 546 1409 11860 --
NM_001008738chr542104 2066 142 70 ------
NM_001008860chr153755 342 274 ------
NM_001008892chr153755 342 274 ------
NM_001008894chr153755 342 274 ------
NM_001008895chr131388 ------
NM_001009552chr81588 ------
NM_001009555chr4178 ------
NM_001009571chr761686 1432 1291 1228 491 390 ------
NM_001009899chr396546 5898 5229 5076 2239 1060 913 764 213 --36555 6404 306 --
NM_001009955chr1137 ------
NM_001009955chr1137 ------
NM_001009958chr71607 ------
NM_001009959chr232112 937 245 ------
NM_001009960chr722833 1920 --188 --
NM_001009993chr254356 3753 3416 1692 1023 1577 1414 14394
NM_001010000chr1833527 1021 138 ------
NM_001010844chr6125 ------
NM_001010861chr12978 795 --130 --
NM_001010888chrX64673 3637 3244 2858 1748 96 12831 24527 294 --
NM_001010891chr555793 5012 344 253 182 15565 1798 --
NM_001010895chr942066 1380 726 386 ----11970
NM_001010908chr101509 ------
NM_001010917chr1031947 611 70 ------
NM_001010924chr1031206 1172 131 ------
NM_001010927chr6----1539 --
NM_001010942chr1231269 1080 970 --1314 --
NM_001010971chr111014 ----1625
NM_001010989chr161415 ------
NM_001010990chr161415 ------
NM_001011513chr463060 2699 1641 1381 1306 770 --14149 --
NM_001011515chr421055 1002 --1879 --
NM_001011516chr421055 1002 --1879 --
NM_001011537chr322303 1974 11620 21470 821 --
NM_001011553chr75956 933 805 700 194 ------
NM_001011663chr101944 ------
NM_001011666chr776557 6226 4681 4481 2498 1057 690 ------
NM_001011708chr232528 2394 1863 ------
NM_001011713chr141155 --11090 --
NM_001011885chr15------11733
NM_001012337chr3148 ------
NM_001012393chr1174074 3961 3443 3238 1872 1315 1297 --14721 --
NM_001012398chr163296 182 29 ------
NM_001012410chr3147 ------
NM_001012426chr62771 477 13321 ----
NM_001012427chr62771 477 13321 ----
NM_001012506chr31153 ------
NM_001012507chr6137 ------
NM_001012514chr2193 ------
NM_001012516chr2193 ------
NM_001012642chr1542053 1935 806 663 --12092 --
NM_001012751chr1041519 1245 655 230 --11405 --
NM_001012755chrX24171 1626 11523 15055 --
NM_001012968chrX42754 2388 556 175 --22732 862 --
NM_001012977chrX2944 930 ------
NM_001012989chrX169 ------
NM_001013031chr1053507 3487 2710 1173 541 13119 ----
NM_001013406chr721118 448 ------
NM_001013415chr41431 ------
NM_001013690chr1231785 391 205 ------
NM_001013693chr112553 ------
NM_001013693chr112553 ------
NM_001013699chr124511 176 103 97 ------
NM_001013746chr762339 2263 1669 1654 1583 209 11827 ----
NM_001013843chr151745 --1763 --
NM_001014286chr13--147 ----
NM_001014797chr1097938 7836 7332 5442 3181 2416 1847 1301 932 17571 27225 2138 25086 697
NM_001014809chr42602 276 ------
NM_001014812chr151444 ------
NM_001015045chr431824 1004 801 --1491 --
NM_001015508chr8----1492 --
NM_001015877chrX32978 2825 1168 12909 ----
NM_001015887chr331838 1354 1227 ------
NM_001015892chr5------153
NM_001017369chr421090 910 ------
NM_001017371chr211052 ------
NM_001017395chr333192 2352 331 ------
NM_001017405chr41178 1820 ----
NM_001017415chr11209 ------
NM_001017416chr11209 ------
NM_001017440chr797710 6681 6341 6060 5605 4982 2572 1432 166 --15255 --
NM_001017523chr12155 11840 21721 752 --
NM_001017923chr1421568 463 ------
NM_001017926chr831496 1146 527 ------
NM_001017930chrX1958 --21302 1190 --
NM_001017962chr10135 ------
NM_001017969chr92518 41 --1457 --
NM_001017999chr11454 --2746 115 --
NM_001017999chr11454 --2746 115 --
NM_001018000chr11454 --2746 115 --
NM_001018000chr11454 --2746 115 --
NM_001018001chr11454 --2746 115 --
NM_001018050chr2272884 2808 889 846 797 706 666 ------
NM_001018052chr2272884 2808 889 846 797 706 666 ------
NM_001018053chr141897 1513 694 368 ------
NM_001018054chr12244 48 11160 ----
NM_001018056chr91145 ------
NM_001018057chr1141327 973 513 151 ------
NM_001018064chr951664 1559 1485 333 162 ------
NM_001018065chr965901 4314 1553 1496 1382 714 11868 26014 5753 --
NM_001018066chr965901 4314 1553 1496 1382 714 11868 26014 5753 --
NM_001018067chr175172 4697 4207 2031 1054 300 259 --11699 --
NM_001018068chr175172 4697 4207 2031 1054 300 259 --11699 --
NM_001018069chr175172 4697 4207 2031 1054 300 259 --11699 --
NM_001018072chr12155 11840 21721 752 --
NM_001018074chr512592 ------
NM_001018075chr512592 ------
NM_001018076chr512592 ------
NM_001018077chr512592 ------
NM_001020658chr131444 1058 202 ------
NM_001020658chr131444 1058 202 ------
NM_001020825chr5167 ------
NM_001023567chr1541581 978 797 718 1530 2723 495 --
NM_001024094chr512592 ------
NM_001024226chr121160 407 ------
NM_001024227chr121160 407 ------
NM_001024228chr121160 407 ------
NM_001024455chrX32644 2152 241 ------
NM_001024457chr221311 560 ------
NM_001024647chr12106366 6238 5379 5104 4971 4670 2970 2095 809 215 --11279 --
NM_001024649chr532857 1864 926 ------
NM_001024660chr321240 684 ------
NM_001024668chr122946 25 --192 --
NM_001024680chr231801 1275 163 ----11337
NM_001024688chr812160 ------
NM_001024847chr352366 916 643 572 272 --22448 1592 --
NM_001024947chr52972 815 ------
NM_001024948chr123350 2551 13053 ----
NM_001024956chr1185196 5188 5018 3758 2264 855 338 141 ------
NM_001025068chr33539 245 182 1711 ----
NM_001025069chr33539 245 182 1711 ----
NM_001025076chr1056020 4622 2468 2381 262 1988 15779 --
NM_001025077chr1087378 5980 4805 4797 4721 1620 1315 421 12346 17137 --
NM_001025079chr353528 3062 1549 850 373 ------
NM_001025105chr551374 1137 441 253 167 ------
NM_001025108chr243600 3557 872 675 2744 127 13522 --
NM_001025201chr2182 ------
NM_001025242chrX11308 11021 ----
NM_001025243chrX11308 11021 ----
NM_001025252chr833221 1024 523 --176 --
NM_001025253chr833221 1024 523 --176 --
NM_001025356chr1242985 2943 2786 2157 --11886 --
NM_001025389chr1141177 1058 576 21 --1145 --
NM_001025390chr1141177 1058 576 21 --1145 --
NM_001025579chr172992 326 ----1428
NM_001025580chrX32867 2607 1264 23822 3712 13805 --
NM_001025595chr441573 1242 1223 1045 ----1300
NM_001025616chr431814 380 356 --11522 --
NM_001025780chr92255 50 ------
NM_001029858chr652554 2255 922 355 243 --12965 --
NM_001029860chr82293 258 ------
NM_001029875chr52997 533 ------
NM_001029882chr11479 ------
NM_001029882chr11479 ------
NM_001029884chr622577 2152 --1182 12615
NM_001030006chr171399 1465 ----
NM_001030007chr16113971 3653 3128 3010 2702 2696 2603 1471 1195 227 164 11153 33992 3162 594 --
NM_001030055chr1444299 2900 1506 1131 11066 ----
NM_001030272chr112466 45 ----1109
NM_001030273chr112466 45 ----1109
NM_001030287chr121118 974 ------
NM_001031623chr611278 --1358 --
NM_001031679chr1263316 3162 1097 919 668 32 11384 ----
NM_001031680chr192544 2480 2415 2283 1772 754 478 384 102 22200 901 ----
NM_001031684chr221458 1278 ------
NM_001031695chr2285443 5411 4839 4141 3929 1189 283 233 --13725 --
NM_001031700chr482359 2348 1969 1643 913 790 162 43 ------
NM_001031702chr32616 97 1166 ----
NM_001031710chr71824 ------
NM_001031711chr521695 1522 ------
NM_001031716chr2163 1921 ----
NM_001031732chr443003 2601 1463 933 --11354 --
NM_001031804chr1664299 3302 3249 1601 889 738 13189 --22707 1215
NM_001031812chr562246 1603 1562 1542 699 529 1596 --1506
NM_001032221chr931802 137 124 11765 21430 191 11473
NM_001032280chr61428 --21657 1284 --
NM_001032288chr2011400 ------
NM_001032293chr17----1550 --
NM_001032296chr1322383 1090 12057 22750 2675 --
NM_001032363chr122248 143 ------
NM_001032363chr122248 143 ------
NM_001032380chr1041546 815 220 144 1122 ----
NM_001032393chrX2749 207 ------
NM_001032999chr2025222 170 --25308 4967 11821
NM_001033045chr273880 3410 3302 1460 1307 924 594 ------
NM_001033047chr432572 2541 2170 ------
NM_001033049chr2141971 1963 1669 744 ------
NM_001033057chr361828 1460 1406 1397 659 140 --11379 --
NM_001033059chr62628 163 ------
NM_001033081chr11163 --1131 --
NM_001033082chr11163 --1131 --
NM_001033087chr2032872 854 146 ------
NM_001033112chr5----1111 --
NM_001033117chr334547 840 155 13201 11182 --
NM_001033503chr51361 ------
NM_001033506chr111411 ------
NM_001033518chr742026 1864 1753 1140 --166 --
NM_001033519chr742026 1864 1753 1140 --166 --
NM_001033520chr742026 1864 1753 1140 --166 --
NM_001033551chr1743860 3546 478 66 13001 33576 1388 844 --
NM_001033557chr2173 ------
NM_001033561chr171213 ------
NM_001033566chr17----1991 --
NM_001033568chr17----1991 --
NM_001033581chr1------1322
NM_001033581chr1------1322
NM_001033582chr1------1322
NM_001033602chr131491 --1340 --
NM_001033677chr121167 --1104 --
NM_001033723chr832565 1707 1102 ------
NM_001034841chr1675488 2059 1887 1563 728 442 107 --21892 1746 --
NM_001034852chr1471689 842 783 749 391 385 131 --1549 --
NM_001034954chr1052829 2078 958 827 599 ------
NM_001034955chr1052829 2078 958 827 599 ------
NM_001034956chr1052829 2078 958 827 599 ------
NM_001034957chr1052829 2078 958 827 599 ------
NM_001035254chr981930 1863 1692 1586 682 424 311 127 ------
NM_001035260chr1011308 ------
NM_001037131chr2------11138
NM_001037132chr72871 739 --11618 --
NM_001037133chr72871 739 --11618 --
NM_001037164chr731905 1555 1401 11762 ----
NM_001037172chr321389 305 ------
NM_001037174chr232184 2041 624 1500 ----
NM_001037317chr12978 795 --130 --
NM_001037331chr181682 ----1980
NM_001037334chr1832383 1710 254 --1638 --
NM_001037339chr131852 1700 302 --11767 --
NM_001037340chr131852 1700 302 --11767 --
NM_001037341chr131852 1700 302 --11767 --
NM_001037341chr131852 1700 302 --11767 --
NM_001037535chrX11385 ------
NM_001037536chrX11385 ------
NM_001037540chrX11385 ------
NM_001037553chr2164270 4103 1865 1619 1368 1072 13137 13475 --
NM_001037631chr22195 135 ------
NM_001037954chr1142910 2479 2431 428 1950 1707 --
NM_001038493chr21965 --1589 --
NM_001039029chr1241928 160 86 53 ----1393
NM_001039199chr20104979 4938 4854 4464 3710 3339 1863 1835 1697 1502 ------
NM_001039468chr111250 ------
NM_001039469chr111290 ------
NM_001039479chr141560 1830 ----
NM_001039538chr231477 662 289 13344 --13047
NM_001039547chr377620 7534 5724 3218 1528 1460 135 13172 12298 26693 1957
NM_001039570chr2274577 3894 2952 1597 1005 794 210 --13315 --
NM_001039571chr2274577 3894 2952 1597 1005 794 210 --13315 --
NM_001039574chr11815 ------
NM_001039577chr144325 4143 3462 1506 --21116 626 13886
NM_001039580chr464443 4415 3856 1033 599 488 --1495 --
NM_001039590chrX43961 3153 2495 354 ------
NM_001039591chrX43961 3153 2495 354 ------
NM_001039618chr1135094 2249 1699 14380 --13787
NM_001039675chr151231 ------
NM_001039690chr1611613 --12373 --
NM_001039709chr2025222 170 --25308 4967 11821
NM_001039711chr12965 340 ----1955
NM_001039712chr12965 340 ----1955
NM_001039802chr131391 1343 136 ------
NM_001039840chrX65456 4795 942 503 488 200 25757 4310 15888 --
NM_001039888chr11319 ------
NM_001039916chr121965 ------
NM_001039917chr121965 ------
NM_001039918chr121965 ------
NM_001039919chr121965 ------
NM_001039920chr121965 ------
NM_001039937chr1393985 3974 3685 3474 3432 2577 1470 619 79 21449 1179 2689 98 13307
NM_001040001chr621885 458 ------
NM_001040020chr721355 172 --11257 --
NM_001040033chr11690 ------
NM_001040092chr8----1319 1270
NM_001040097chr71154 ------
NM_001040098chr71154 ------
NM_001040099chr71154 ------
NM_001040100chr33794 123 29 ------
NM_001040101chr43329 198 189 --1486 --
NM_001040102chr1042430 2308 66 35 ------
NM_001040103chr1042430 2308 66 35 ------
NM_001040110chr71160 --2429 210 --
NM_001040113chr162258 250 --1940 --
NM_001040142chr221870 1740 ------
NM_001040143chr221870 1740 ------
NM_001040144chr1611613 --12373 --
NM_001040146chr1611613 --12373 --
NM_001040152chr723697 3366 --25116 4577 --
NM_001040153chr135916 865 758 650 168 --1128 --
NM_001040157chr432669 274 142 --1575 1432
NM_001040158chr51218 1190 ----
NM_001040159chr421484 442 ------
NM_001040195chr1--188 ----
NM_001040214chr652385 2323 945 423 69 ------
NM_001040284chr1685889 5602 5411 4489 4410 2186 818 811 1699 12320 --
NM_001040402chr443098 2247 799 173 11093 1104 --
NM_001040409chr21329 ------
NM_001040429chr13124 ------
NM_001040441chr175253 4698 4255 1989 1876 1022 786 --1199 --
NM_001040450chr1542341 2152 939 250 ------
NM_001040453chr1542341 2152 939 250 ------
NM_001040455chr1141357 1330 358 111 ------
NM_001040619chr131568 1424 89 ------
NM_001040633chr71191 --1255 --
NM_001040653chr332358 2307 826 ------
NM_001040665chr754603 4130 1625 1167 433 ------
NM_001040708chr81780 --1286 11142
NM_001040712chr973021 3004 2694 2491 2321 2186 1401 --13029 --
NM_001040876chr441449 688 501 369 ------
NM_001042353chr201157 --1536 --
NM_001042355chr1685193 5057 4698 4566 3957 3576 1157 196 ----2483 277
NM_001042357chr101479 --175 --
NM_001042358chr101479 --175 --
NM_001042360chr101479 --175 --
NM_001042363chr101479 --175 --
NM_001042371chr1631696 705 205 --11767 --
NM_001042383chr363271 3164 2434 2206 904 308 --43179 2583 676 175 --
NM_001042388chr18----1345 --
NM_001042389chr101479 --175 --
NM_001042390chr101479 --175 --
NM_001042392chr101479 --175 --
NM_001042395chr101479 --175 --
NM_001042404chr131982 1747 632 11778 ----
NM_001042410chr23220 214 168 ------
NM_001042412chr1685193 5057 4698 4566 3957 3576 1157 196 ----2483 277
NM_001042413chr933768 2830 620 --23986 2875 --
NM_001042414chr131256 ------
NM_001042424chr442154 1244 1019 541 ----1192
NM_001042425chr61428 --21657 1284 --
NM_001042430chr141148 ------
NM_001042453chrX----11475 --
NM_001042459chr31232 ------
NM_001042465chr1061103 822 778 379 151 39 --1237 --
NM_001042466chr1061103 822 778 379 151 39 --1237 --
NM_001042473chr101162 ------
NM_001042475chr6195 ------
NM_001042481chr1482625 2450 2160 2061 2030 742 256 165 ------
NM_001042486chr2011047 ------
NM_001042492chr1773471 2249 1288 1223 1190 980 101 ------
NM_001042494chr1511014 11147 23852 3739 --
NM_001042495chr1511014 11147 23852 3739 --
NM_001042496chr1511014 11147 23852 3739 --
NM_001042497chr1511014 11147 23852 3739 --
NM_001042506chrX2944 930 ------
NM_001042510chr811338 ----11842
NM_001042511chr811338 ----11842
NM_001042517chr132988 653 --1170 --
NM_001042537chrX3907 201 64 ------
NM_001042539chr16128 ------
NM_001042548chr21697 ----1345
NM_001042555chr1274058 3999 3785 3681 3408 1258 970 ----1616
NM_001042599chr287437 7247 7142 7015 6647 5502 5075 1086 --12148 --
NM_001042601chr353027 2629 629 600 350 ----13106
NM_001042603chr1254326 3522 3464 3406 257 --24074 1848 --
NM_001042604chr374168 4048 3273 1909 264 187 90 11771 14725 --
NM_001042616chr43481 431 166 ------
NM_001042646chr331731 798 86 1331 21463 250 --
NM_001042669chr431814 380 356 --11522 --
NM_001042749chrX41925 1657 1489 370 --21840 247 1147
NM_001042750chrX41925 1657 1489 370 --21840 247 1147
NM_001042751chrX41925 1657 1489 370 --21840 247 1147
NM_001043318chr1483297 3038 3009 2580 1639 1465 672 240 1369 ----
NM_001043351chr112098 ----11956
NM_001044305chr631067 455 401 --1240 21226 153
NM_001044722chr562246 1603 1562 1542 699 529 1596 --1506
NM_001044723chr562246 1603 1562 1542 699 529 1596 --1506
NM_001046chr562831 2482 2349 2149 966 491 ------
NM_001048183chr163703 2486 1414 1102 948 534 --23757 539 --
NM_001066chr121819 857 --12155 --
NM_001068chr32242 202 ------
NM_001070chr171185 ------
NM_001071775chr132432 242 --162 --
NM_001078chr12614 543 ------
NM_001079874chr141899 1694 843 103 1179 ----
NM_001080418chr1152 ------
NM_001083620chr462533 2410 1946 1883 1853 61 ----11760
NM_001096chr171287 ------
NM_001099678chr3116172 6103 5832 5818 5301 4980 4457 3897 2582 1006 863 16220 11051 --
NM_001100108chr1108092 7866 7003 6917 6766 6291 5656 5110 3340 2714 22628 1661 38101 7706 247 --
NM_001106chr3119273 9175 8696 8173 7757 7520 7326 3583 3212 2132 651 --29670 6975 --
NM_001113490chrX73284 3183 2714 877 703 554 144 --12765 --
NM_001116chr1663083 3021 2913 910 874 514 12556 --1663
NM_001117chr1832144 1906 826 ------
NM_001119chr4--21240 286 ----
NM_001127chr222694 197 ------
NM_001128chr16113971 3653 3128 3010 2702 2696 2603 1471 1195 227 164 11153 33992 3162 594 --
NM_001144chr161945 --1107 --
NM_001146chr831554 885 516 ------
NM_001147chr83398 385 83 ----164
NM_001148chr421440 1432 154 ----
NM_001149chr101549 --11184 --
NM_001153chr23917 199 193 --1881 --
NM_001156chr101424 ------
NM_001160chr124902 468 290 116 --22096 264 --
NM_001163chr92748 212 1253 --1960
NM_001167chrX56538 5417 4464 4263 1756 --12247 25399 618
NM_001173chr1444299 2900 1506 1131 11066 ----
NM_001177chr1232375 2314 71 ------
NM_001178chr112466 45 ----1109
NM_001186chr2122068 1108 --1515 --
NM_001189chr431069 1063 405 158 ----
NM_001194chr192678 516 --178 1591
NM_001201chr431510 857 101 13422 191 --
NM_001204chr256300 5070 3003 2140 210 26587 2220 ----
NM_001206chr92794 774 --1159 --
NM_001218chr1552607 2272 1740 413 206 ----12516
NM_001219chr732041 1817 76 ------
NM_001222chr101749 --1656 --
NM_001241chr21934 1823 ----
NM_001241chr21934 1823 ----
NM_001256chr171615 12006 --12866
NM_001257chr1621390 163 ------
NM_001259chr796241 4586 4178 1984 1855 1824 1584 1077 720 ----22277 1870
NM_001260chr131279 --297 28 --
NM_001265chr131281 ------
NM_001270chr5----1198 --
NM_001271chr1563247 2189 1101 1078 781 201 ------
NM_001281chr191141 ------
NM_001282chr171399 1465 ----
NM_001284chr51128 ------
NM_001286chr132214 1065 327 1476 12762 12618
NM_001290chr41732 1242 ----
NM_001298chr221305 852 ------
NM_001304chr1783499 2996 2636 2562 2334 1302 570 73 --13705 --
NM_001310chr1221159 76 ------
NM_001313chr42602 276 ------
NM_001329chr101663 1189 11258 --
NM_001331chr11137 12604 ----
NM_001332chr5----31147 490 442 --
NM_001343chr511694 ------
NM_001346chr322549 1006 --12028 --
NM_001356chrX42436 717 508 267 --1309 --
NM_001358chr4--1424 ----
NM_001364chr1172998 1840 1579 1295 1020 850 96 --23413 3017 --
NM_001379chr192227 197 ----155
NM_001383chr173303 205 92 1153 --1690
NM_001385chr81287 ------
NM_001386chr821925 1871 --11655 --
NM_001389chr211580 ------
NM_001390chr1853255 3072 2839 1239 1108 23155 2582 ----
NM_001396chr212525 360 --12485 1761
NM_001397chr12701 77 ------
NM_001399chrX51296 1247 458 365 319 11362 ----
NM_001400chr12417 285 --1197 1267
NM_001408chr12592 220 ------
NM_001412chrX13310 1702 23103 277 --
NM_001418chr11159 ------
NM_001418chr11159 ------
NM_001419chr1943759 3205 1176 913 13398 --1264
NM_001420chr1933166 2597 2085 ----11273
NM_001422chr11--11268 --11159
NM_001423chr1231976 1951 1421 ----2366 343
NM_001427chr721979 392 ------
NM_001429chr22----1265 164
NM_001432chr463936 3652 3639 1553 1277 124 ----13924
NM_001438chr133402 3201 1282 ----1119
NM_001440chr822575 70 1228 ----
NM_001448chrX2656 268 ----1193
NM_001452chr61669 ------
NM_001463chr2182 --156 --
NM_001490chr933336 486 260 1994 33558 2565 534 --
NM_001494chr102189 120 --1756 --
NM_001498chr631285 335 26 11018 2313 106 --
NM_001527chr674775 4740 3646 1448 1346 781 337 ------
NM_001530chr142962 902 --1240 --
NM_001533chr191291 ------
NM_001542chr152853 2622 2543 2219 345 1637 ----
NM_001543chr564193 3712 3530 3374 1000 655 --14064 13106
NM_001560chrX1759 12566 ----
NM_001564chr41141 ------
NM_001569chrX11308 11021 ----
NM_001587chrX52121 569 561 454 418 11399 11847 --
NM_001610chr111612 ------
NM_001614chr172549 155 ------
NM_001614chr172549 155 ------
NM_001616chr243389 2972 2859 438 --1171 --
NM_001617chr21228 11244 1922 --
NM_001634chr62628 163 ------
NM_001635chr71262 --1737 --
NM_001650chr1824124 4088 --12898 --
NM_001655chr1141743 1704 1418 797 --21808 1570 --
NM_001656chr522037 1326 ------
NM_001658chr121160 407 ------
NM_001662chr72369 308 ------
NM_001663chr1422086 447 ------
NM_001674chr121118 974 ------
NM_001676chr131167 ------
NM_001677chr11140 ------
NM_001681chr122640 565 ------
NM_001682chr1222630 592 --134 --
NM_001684chr133995 3836 2952 --13487 14201
NM_001686chr12----122 --
NM_001690chr322485 353 ------
NM_001693chr821152 68 ------
NM_001695chr864273 3846 2604 494 304 223 ------
NM_001699chr1951710 1519 1449 702 48 ------
NM_001701chr921585 1462 ------
NM_001704chr6------146
NM_001706chr321021 387 ------
NM_001707chr7292 48 1906 ----
NM_001709chr1122856 219 ------
NM_001714chr121427 ------
NM_001718chr621090 415 --11028 --
NM_001730chr1311009 1413 ----
NM_001730chr1311009 1413 ----
NM_001731chr122753 370 ------
NM_001735chr9134 ------
NM_001742chr73583 166 64 ------
NM_001743chr22410 397 --1462 --
NM_001744chr5288 47 ------
NM_001746chr532857 1864 926 ------
NM_001748chr1----1951 --
NM_001753chr711564 ------
NM_001754chr2144123 825 531 290 --14128 --
NM_001755chr1691901 1563 1542 849 790 574 449 231 211 ------
NM_001759chr1245058 3994 1858 944 --23852 1696 --
NM_001762chr7------1188
NM_001769chr12----1131 --
NM_001777chr353528 3062 1549 850 373 ------
NM_001788chr75956 933 805 700 194 ------
NM_001791chr131391 1343 136 ------
NM_001792chr182395 229 1301 ----
NM_001794chr202270 205 1216 ----
NM_001795chr1611571 ------
NM_001797chr16----1760 --
NM_001806chr1952776 2090 1933 742 543 1142 ----
NM_001813chr41163 ------
NM_001822chr2182 ------
NM_001826chr1----1399 --
NM_001827chr91276 ------
NM_001829chr41277 --2636 269 --
NM_001830chrX61437 1206 1143 845 726 485 --195 --
NM_001833chr91253 ------
NM_001839chr16725 652 554 536 303 114 ------
NM_001842chr91112 ------
NM_001844chr12------189
NM_001858chr653866 3652 3505 1634 719 11300 1469 --
NM_001859chr963872 3808 3436 2653 973 756 ------
NM_001862chr2----171 --
NM_001873chr42679 511 ------
NM_001884chr51398 ------
NM_001885chr11122 ------
NM_001892chr551374 1137 441 253 167 ------
NM_001893chr171321 ------
NM_001894chr2211198 1192 ----
NM_001895chr201344 ------
NM_001901chr61418 ------
NM_001904chr3----1340 --
NM_001907chr16163 ------
NM_001918chr188677 8265 3318 2684 2600 1867 1321 540 17322 --13148
NM_001924chr1------139
NM_001935chr21725 --172 --
NM_001938chr131627 355 349 --11729 --
NM_001939chrX33870 2959 2698 ------
NM_001944chr1832343 2298 360 --12155 --
NM_001946chr1221072 125 ------
NM_001949chr622383 1990 --12043 --
NM_001954chr61826 ------
NM_001955chr62938 64 ------
NM_001957chr442171 2124 1968 1609 ------
NM_001967chr31452 --166 --
NM_001968chr44712 654 165 98 ------
NM_001969chr1452988 2738 2691 2463 852 12607 1713 1786
NM_001977chr431382 226 124 11092 ----
NM_001978chr81318 --11054 --
NM_001981chr13911 492 348 --21788 1557 --
NM_001982chr1221065 193 ----11084
NM_001991chr1732211 733 41 --188 --
NM_001993chr12901 735 --142 --
NM_001995chr431522 1328 422 ------
NM_001999chr51979 ------
NM_002009chr1552622 2274 733 178 153 ------
NM_002010chr132404 175 ------
NM_002015chr1363218 3139 2180 2159 1159 472 --12605 --
NM_002017chr1121199 1112 ------
NM_002023chr1122 ------
NM_002024chrX22094 2014 1272 1314 1763
NM_002025chrX99109 7938 7623 7147 7035 1814 1701 1514 234 159 13376 19290
NM_002031chr63649 543 161 ------
NM_002039chr41284 ------
NM_002045chr3----1295 --
NM_002051chr10163 ------
NM_002054chr21345 ------
NM_002061chr121944 1469 ------
NM_002063chrX2829 251 1394 11101 --
NM_002069chr72664 27 ----1391
NM_002074chr11225 --21740 1696 --
NM_002076chr1223261 1010 ----22324 652
NM_002080chr161758 ------
NM_002084chr51737 --1158 --
NM_002105chr1111040 --1711 --
NM_002126chr1743699 3372 2570 841 --1711 --
NM_002129chr41336 ------
NM_002130chr54391 322 226 158 ------
NM_002137chr722384 1613 ------
NM_002139chrX2241 200 ------
NM_002140chr91153 ------
NM_002141chr72619 546 ------
NM_002146chr1741236 1159 1021 951 ------
NM_002154chr5----1194 --
NM_002163chr163488 294 122 ------
NM_002166chr22561 541 ------
NM_002181chr2----138 --
NM_002182chr332201 2190 752 ------
NM_002193chr2------11466
NM_002199chr41156 --1279 --
NM_002202chr51697 1263 1874 --
NM_002205chr121284 --1193 1909
NM_002210chr222903 990 13145 13326 --
NM_002214chr753845 2276 2238 2094 367 1296 1400 --
NM_002222chr331338 421 270 ----11203
NM_002226chr142896 853 --1325 --
NM_002227chr141293 849 495 319 --1898 --
NM_002235chr1221189 644 136 11352 --
NM_002239chr22827 253 1792 ----
NM_002241chr122792 2225 --11967 --
NM_002245chr1----1441 --
NM_002247chr1022215 2112 ------
NM_002249chr1------1335
NM_002253chr421365 535 --1553 --
NM_002264chr394961 3571 3387 1999 1350 1247 941 535 120 --14854 --
NM_002267chr1332311 2225 1601 --22347 364 --
NM_002268chr31139 137 11294 --
NM_002269chr61345 ------
NM_002270chr565471 5093 4511 1081 1017 879 --25623 1938 22034 775
NM_002271chr1341871 688 383 152 1231 --11612
NM_002283chr12----1797 159
NM_002285chr243600 3557 872 675 2744 127 13522 --
NM_002290chr61972 147 ----
NM_002293chr132272 756 434 --11020 --
NM_002298chr13133 --11430 --
NM_002310chr575893 5180 2599 2093 1909 259 71 --12570 --
NM_002313chr1065078 5020 4209 4026 3315 429 24784 1358 --11914
NM_002314chr711080 ------
NM_002334chr1131876 374 246 11933 ----
NM_002336chr1253850 1969 1578 1050 243 1805 ----
NM_002349chr261412 1217 1035 479 453 29 ------
NM_002351chrX31470 99 23 --11394 --
NM_002356chr622544 73 ------
NM_002359chr1744236 3178 633 584 13948 --1606
NM_002374chr231477 662 289 13344 --13047
NM_002375chr332238 2205 1421 ------
NM_002380chr81810 1124 1391 --
NM_002381chr2260 45 --2964 938 --
NM_002387chr565000 4935 4626 2004 934 78 ----24964 3764
NM_002390chr1731702 1605 1279 --11714 --
NM_002397chr522240 87 ----11986
NM_002398chr2----1340 --
NM_002399chr151169 ------
NM_002402chr7----1784 --
NM_002406chr52257 106 ------
NM_002408chr142540 282 ------
NM_002428chr1621195 969 --11312 11434
NM_002429chr1241149 530 515 206 ------
NM_002430chr2222342 864 ------
NM_002442chr1221504 1337 ------
NM_002444chrX31951 1402 704 --11793 --
NM_002448chr41708 ------
NM_002451chr933776 1576 1350 ------
NM_002455chr1145 ------
NM_002480chr12----11208 --
NM_002485chr812160 ------
NM_002487chr151591 ------
NM_002499chr1542351 1935 864 299 --1632 --
NM_002500chr21936 --21235 906 --
NM_002501chr1944089 3428 2877 1112 ----13955
NM_002515chr1432016 532 420 1739 166 --
NM_002519chr1121513 102 --21321 1023 1115
NM_002524chr1----11072 152
NM_002527chr121262 ------
NM_002540chr91655 ------
NM_002541chr72743 88 --21037 1032 --
NM_002545chr1174074 3961 3443 3238 1872 1315 1297 --14721 --
NM_002546chr82666 591 ------
NM_002547chrX21653 127 11694 13881 11682
NM_002552chr211130 1375 ----
NM_002556chr1132004 726 471 ------
NM_002572chr11----197 --
NM_002576chr1121151 448 1165 ----
NM_002577chr343880 3683 1236 290 ------
NM_002578chrX1376 --1427 --
NM_002581chr923964 3944 11935 ----
NM_002582chr163900 696 77 --1398 --
NM_002588chr5--21660 600 ----
NM_002590chr131145 ------
NM_002595chr1231612 436 297 ------
NM_002596chr111355 ------
NM_002600chr131852 1700 302 --11767 --
NM_002608chr2231505 1027 371 --1998 --
NM_002613chr1643916 3713 1346 790 13734 ----
NM_002628chr331196 1149 911 ------
NM_002629chr101872 ------
NM_002641chrX51414 1270 776 625 196 --11862 11380
NM_002645chr1153132 2433 2019 740 154 --22151 328 12720
NM_002655chr895242 5030 4971 4939 4624 4245 4221 1273 792 ------
NM_002656chr62922 348 ------
NM_002657chr2022734 862 ------
NM_002660chr201778 --1223 --
NM_002667chr61828 --1325 --
NM_002670chr31396 ------
NM_002674chr121169 ------
NM_002687chr141161 ------
NM_002698chr191974 ------
NM_002699chr121457 31 ------
NM_002706chr2168 ------
NM_002709chr243172 2573 1440 722 --32593 900 70 --
NM_002710chr12----179 --
NM_002711chr72821 322 ------
NM_002714chr61412 1176 1826 --
NM_002715chr52900 517 ------
NM_002716chr1143138 1328 609 525 --1903 11306
NM_002718chr342316 2165 480 124 ------
NM_002729chr101608 --2206 146 --
NM_002731chr163107 2488 1143 1114 196 44 ------
NM_002734chr1721831 1728 ------
NM_002736chr72704 233 ------
NM_002737chr1776119 5433 2039 2010 1729 1449 354 14325 26594 1855 --
NM_002740chr342484 1797 323 303 ------
NM_002742chr143687 266 131 ------
NM_002744chr1------1322
NM_002745chr2261781 1623 1135 699 479 247 --23588 1271 --
NM_002748chr151256 ------
NM_002752chr5--132 ----
NM_002755chr15198 --1318 --
NM_002760chrY105367 5226 5084 4100 2357 2249 2148 1824 1176 681 14441 35256 879 708 11883
NM_002776chr1911325 --1119 1205
NM_002778chr1061103 822 778 379 151 39 --1237 --
NM_002787chr71504 ------
NM_002822chr1251831 1692 1457 1384 108 ------
NM_002823chr22514 504 ------
NM_002825chr7162 ------
NM_002827chr2051679 585 539 439 142 ------
NM_002828chr183686 358 32 ------
NM_002829chr941135 1104 519 503 ------
NM_002830chr22145 138 ------
NM_002836chr20--1171 1402 --
NM_002837chr1221160 830 --24333 450 --
NM_002839chr973021 3004 2694 2491 2321 2186 1401 --13029 --
NM_002841chr33495 449 226 ------
NM_002843chr1133479 3152 213 ----1579
NM_002844chr621244 1077 ------
NM_002845chr181434 --1163 --
NM_002848chr1231206 865 449 ------
NM_002849chr121186 ----1284
NM_002852chr3----1144 --
NM_002858chr131211 1005 224 ----21293 904
NM_002865chr81210 ------
NM_002868chr122968 905 11613 ----
NM_002869chr1122081 303 22177 577 ----
NM_002874chr932319 309 40 --12487 --
NM_002886chr333986 3782 878 --24136 106 --
NM_002890chr51206 ------
NM_002892chr1421650 392 ------
NM_002893chrX178 ------
NM_002894chr181189 ------
NM_002911chr1931633 1077 494 1587 ----
NM_002912chr62652 157 1322 2904 802 --
NM_002922chr12662 227 ------
NM_002923chr11484 --1529 --
NM_002940chr441449 688 501 369 ------
NM_002941chr32344 322 --1349 --
NM_002942chr32363 102 --3521 438 298 --
NM_002945chr172789 742 1669 ----
NM_002956chr125512 451 383 362 69 148 ----
NM_002959chr174369 3819 3789 3739 2878 1752 409 --14404 --
NM_002968chr1621004 403 ------
NM_002971chr31166 ------
NM_002977chr242499 2109 1360 488 11156 --22474 183
NM_002979chr12788 219 ------
NM_002998chr831706 1686 874 ------
NM_003012chr853083 2749 2386 605 94 ------
NM_003016chr1751767 1596 1406 417 271 --1554 1459
NM_003017chr62474 104 ------
NM_003026chr91378 ------
NM_003035chr12643 308 ------
NM_003036chr12975 899 1765 ----
NM_003042chr322185 330 ------
NM_003043chr342910 2754 989 93 --13806 --
NM_003045chr1374445 3599 3447 3315 3055 564 522 --13831 --
NM_003048chr232784 2703 1129 --22713 2624 --
NM_003051chr141444 1254 751 637 ------
NM_003068chr82790 36 ------
NM_003069chrX1744 ------
NM_003070chr92757 90 ------
NM_003072chr191292 ------
NM_003074chr321814 1708 ------
NM_003075chr121333 ------
NM_003076chr12----11597 --
NM_003099chr1566515 6247 4677 2317 1953 1892 ------
NM_003100chr51280 --1293 --
NM_003105chr11183 ------
NM_003106chr32743 690 ------
NM_003107chr612103 --12182 --
NM_003108chr256608 5719 4540 2653 446 --36966 1502 1289 --
NM_003110chr1721076 309 ------
NM_003111chr211052 ------
NM_003112chr722152 36 --1195 --
NM_003128chr232233 2073 904 ------
NM_003136chr142331 116 ------
NM_003139chr111377 --1652 --
NM_003144chr611503 --1165 --
NM_003149chr321168 613 195 ----
NM_003150chr1752303 2285 841 448 53 ------
NM_003155chr842624 2578 2547 659 --2760 77 --
NM_003156chr1121326 133 ------
NM_003161chr1722224 803 --2891 886 --
NM_003173chrX3915 498 216 ----1887
NM_003174chr105741 621 587 280 252 ------
NM_003178chr321723 892 ----22183 1635
NM_003182chr7173 ----1390
NM_003182chr7173 ----1390
NM_003185chr202337 326 ------
NM_003187chr5------153
NM_003188chr61136 1564 ----
NM_003189chr143260 2591 1027 920 --23230 3188 --
NM_003199chr1844884 1463 435 326 21798 734 35327 5255 4619 --
NM_003200chr1922386 699 ----11769
NM_003204chr1731181 611 165 11656 ----
NM_003211chr12----21393 1388 --
NM_003217chr1221939 120 ------
NM_003220chr61428 --21657 1284 --
NM_003221chr673688 3420 3091 1613 1499 1324 1130 ------
NM_003222chr202916 233 1187 ----
NM_003223chr161859 ------
NM_003234chr332287 1601 178 1870 ----
NM_003236chr222282 74 13225 33531 3515 991 13352
NM_003242chr352366 916 643 572 272 --22448 1592 --
NM_003244chr18171 ------
NM_003246chr15--11677 ----
NM_003247chr631974 1668 1605 ------
NM_003253chr2121664 302 ------
NM_003255chr1742533 1965 485 374 ------
NM_003257chr1531186 917 333 ------
NM_003262chr364976 4818 3697 1992 1049 270 ------
NM_003269chr631303 1174 413 11208 --1228
NM_003270chrX21094 390 ------
NM_003272chr11243 ------
NM_003274chr2122990 45 1627 1739 --
NM_003275chr941507 1103 344 128 21344 1302 ----
NM_003286chr2011065 ------
NM_003291chr131802 1115 ----
NM_003295chr132201 153 ------
NM_003298chr396172 5838 5591 4868 4647 4009 3973 1452 1300 --26123 4619 --
NM_003299chr121199 ------
NM_003304chr331478 1372 1105 ------
NM_003305chr42285 174 ------
NM_003314chr51173 ------
NM_003317chr14--1734 ----
NM_003336chrX21074 293 --1202 --
NM_003337chr541580 695 302 170 --11061 --
NM_003338chr10279 35 --1695 1213
NM_003339chr561342 1230 1173 993 530 187 --11381 --
NM_003340chr421269 30 ------
NM_003341chr31666 ------
NM_003342chr1732952 76 63 --13115 --
NM_003344chr71247 1128 ----
NM_003345chr162572 366 ------
NM_003347chr2242007 1943 497 54 ------
NM_003348chr122295 69 --21719 432 --
NM_003349chr2011400 ------
NM_003350chr83999 861 221 ------
NM_003352chr22692 270 1916 ----
NM_003360chr4--1226 ----
NM_003367chr191151 1340 ----
NM_003368chr11209 ------
NM_003369chr1131924 872 64 ----1449
NM_003373chr1021980 652 ------
NM_003383chr91145 ------
NM_003385chr2--1375 ----
NM_003387chr222854 2573 1668 ----
NM_003390chr1111091 --2712 291 --
NM_003392chr384348 3575 3206 1535 1367 1353 970 546 --11321 --
NM_003404chr2021982 1505 ----11705
NM_003405chr222173 131 ------
NM_003409chr1821099 112 ------
NM_003410chrX22985 784 ----12739
NM_003411chrY1578 1514 2697 682 --
NM_003412chr353112 2807 2605 2370 2107 --31921 464 392 1544
NM_003413chrX21605 1371 ------
NM_003418chr32712 167 ------
NM_003430chr1921090 130 ------
NM_003432chr5----1459 --
NM_003442chr112843 770 ------
NM_003452chr9----1874 --
NM_003453chr13----1613 --
NM_003457chr17----1550 --
NM_003458chr373746 3600 3269 3233 2489 1255 1182 12901 13589 --
NM_003463chr642662 1339 1274 723 --12619 --
NM_003466chr232438 1977 121 ------
NM_003468chr254359 3255 3177 3126 283 ------
NM_003469chr21391 ------
NM_003470chr1611325 --1518 1630
NM_003471chr321850 1588 --1238 12001
NM_003473chr101350 ------
NM_003474chr1082199 1938 1926 1872 1630 867 801 44 --1234 --
NM_003478chr1152945 2918 1103 364 234 ----1400
NM_003483chr1212845 12162 1379 --
NM_003488chr171970 --137 --
NM_003489chr2143012 2265 954 331 --13479 --
NM_003490chr2221074 192 ------
NM_003496chr7--1822 ----
NM_003498chr1662521 2351 2106 426 213 50 --2973 78 1145
NM_003506chr82315 100 --31245 113 63 --
NM_003507chr231716 1554 606 ------
NM_003563chr171270 --21097 128 --
NM_003564chr1------1504
NM_003566chr1232871 774 59 --1533 --
NM_003574chr1875432 3838 3544 2274 1548 1369 1219 ----1702
NM_003576chr1322383 1090 12057 22750 2675 --
NM_003580chr8148 ------
NM_003581chr22946 269 ------
NM_003582chr11207 ------
NM_003583chr1253361 3204 2852 2378 836 12985 --23708 1270
NM_003589chr131388 ------
NM_003590chr2123835 3457 3085 2738 2673 2661 1385 992 758 561 401 38 --11576 --
NM_003592chr71463 ------
NM_003595chr22152 ------
NM_003601chr4----174 --
NM_003603chr43677 524 437 ------
NM_003607chr153930 3890 3821 3379 243 1561 ----
NM_003613chr152654 267 ------
NM_003615chr332646 2483 1200 ------
NM_003617chr184949 3261 2000 1890 1612 1151 1080 60 ------
NM_003618chr21300 ------
NM_003620chr171154 ------
NM_003622chr1241759 1062 971 264 ------
NM_003626chr112470 385 11388 1331 --
NM_003628chr21624 ------
NM_003629chr1------1209
NM_003644chr1756595 5996 2383 1116 520 22318 671 ----
NM_003663chr312780 13203 ----
NM_003670chr321134 569 --196 --
NM_003671chr953329 3285 3024 2962 2842 ------
NM_003672chr1------1197
NM_003677chr1242296 2054 1446 465 1413 ----
NM_003679chr142971 2452 407 176 1356 ----
NM_003692chr91117 ------
NM_003705chr21276 194 ----
NM_003713chr1--21546 391 1460 --
NM_003714chr533084 2038 214 12580 1639 --
NM_003716chr32901 318 --1330 --
NM_003718chr71511 1416 ----
NM_003722chr332031 2012 428 1382 12216 --
NM_003728chr42695 104 ------
NM_003735chr5--21660 600 ----
NM_003736chr5--21660 600 ----
NM_003743chr2----12064 --
NM_003749chr1321513 71 --22388 527 --
NM_003750chr101226 ------
NM_003758chr151616 ------
NM_003758chr151616 ------
NM_003760chr11173 ------
NM_003762chr13946 354 346 --11328 --
NM_003763chr2042487 2380 2316 317 --1717 --
NM_003764chr62258 49 1670 ----
NM_003768chr13654 507 363 --11150 --
NM_003774chr1252286 2201 801 780 125 ------
NM_003783chr121208 803 --1909 --
NM_003786chr171435 1475 ----
NM_003787chr1821448 1307 ----11199
NM_003796chr191559 ------
NM_003797chr11----1165 --
NM_003800chr632017 535 173 --1629 --
NM_003822chr132033 859 540 ------
NM_003825chr151311 ------
NM_003829chr91202 --165 --
NM_003831chr1811198 1174 ----
NM_003850chr131151 ------
NM_003858chr141585 --1269 --
NM_003861chr1432658 405 345 12609 2760 553 --
NM_003872chr232395 1158 961 ----12725
NM_003873chr105727 615 545 531 465 --1767 12142
NM_003877chr121618 ------
NM_003884chr3----11839 --
NM_003885chr17140 --22678 2028 12702
NM_003887chr271670 1431 699 541 343 320 208 ------
NM_003895chr212498 439 --11490 1106
NM_003901chr1032584 2201 1983 --22569 2096 --
NM_003902chr12652 294 --1701 --
NM_003906chr21----187 --
NM_003913chr654304 4265 3738 3203 666 --33675 967 757 --
NM_003916chrX31434 1209 965 ------
NM_003921chr131492 345 202 ------
NM_003922chr151282 ------
NM_003932chr2261825 1761 1535 1448 1411 456 ------
NM_003934chr921101 506 ----11141
NM_003936chr231219 1178 372 ------
NM_003939chr1063950 3307 3139 1164 1087 1048 14042 11370 13628
NM_003941chr732346 994 926 --22527 2265 11020
NM_003947chr321271 300 ------
NM_003948chr472652 2637 2569 1040 771 128 39 --12026 1408
NM_003953chr142729 2182 260 121 ------
NM_003958chr653943 3066 2673 2608 2567 ------
NM_003966chr587792 7667 6676 5406 4799 2474 2272 115 27841 7198 37421 7359 5350 27600 3009
NM_003968chr31679 ------
NM_003972chr10----1180 --
NM_003980chr621099 277 ------
NM_003994chr1254422 4316 3907 3011 1758 33198 692 200 ----
NM_003998chr41593 ------
NM_004006chrX52652 2596 2374 2128 513 12505 ----
NM_004007chrX52652 2596 2374 2128 513 12505 ----
NM_004009chrX52652 2596 2374 2128 513 12505 ----
NM_004010chrX52652 2596 2374 2128 513 12505 ----
NM_004011chrX52652 2596 2374 2128 513 12505 ----
NM_004012chrX52652 2596 2374 2128 513 12505 ----
NM_004013chrX52652 2596 2374 2128 513 12505 ----
NM_004014chrX52652 2596 2374 2128 513 12505 ----
NM_004015chrX52652 2596 2374 2128 513 12505 ----
NM_004016chrX52566 2510 2288 2042 427 12419 ----
NM_004017chrX52652 2596 2374 2128 513 12505 ----
NM_004018chrX52566 2510 2288 2042 427 12419 ----
NM_004020chrX52652 2596 2374 2128 513 12505 ----
NM_004021chrX52566 2510 2288 2042 427 12419 ----
NM_004022chrX52566 2510 2288 2042 427 12419 ----
NM_004023chrX52566 2510 2288 2042 427 12419 ----
NM_004028chr1824124 4088 --12898 --
NM_004034chr101424 ------
NM_004035chr1745154 3727 733 572 --13498 15031
NM_004040chr22894 450 ------
NM_004050chr1431924 776 769 ------
NM_004061chr51237 ------
NM_004063chr8187 ------
NM_004067chr721469 145 --1486 --
NM_004074chr11172 ------
NM_004075chr121431 ------
NM_004085chrX1801 ------
NM_004087chr321616 1429 190 ----
NM_004093chr1342388 1056 411 151 --12992 --
NM_004094chr1433000 1967 804 ----1640
NM_004097chr21300 ------
NM_004098chr102504 357 11129 1889 --
NM_004100chr622147 442 ------
NM_004109chr111732 ------
NM_004114chrX21125 495 ------
NM_004117chr652206 1436 880 497 371 ------
NM_004124chr1432878 1388 249 --33575 971 91 --
NM_004136chr1542829 2756 963 370 ------
NM_004156chr81588 ------
NM_004161chr22603 96 --182 --
NM_004162chr331168 903 834 --3976 908 889 --
NM_004170chr941437 1394 757 163 --1611 --
NM_004177chr1121590 323 ----127
NM_004185chr12667 287 ------
NM_004202chrY145 ------
NM_004209chr161235 --1932 --
NM_004226chr21107 ------
NM_004229chrX31887 1870 148 --11935 --
NM_004232chr1832846 331 27 ----13759
NM_004235chr9----1662 --
NM_004236chr152458 166 ------
NM_004247chr17155 ------
NM_004261chr12816 219 ------
NM_004267chr31168 ------
NM_004272chr511258 1814 1488 11449
NM_004276chr121167 --1104 --
NM_004279chr722025 321 ------
NM_004280chr6157 ------
NM_004281chr10167 ------
NM_004293chr952971 780 591 575 170 12788 ----
NM_004302chr1232291 2101 1890 ------
NM_004311chr1032995 1951 421 --1305 --
NM_004323chr9----32275 1979 217 --
NM_004326chr1----1414 --
NM_004329chr1021162 912 1316 ----
NM_004331chr812610 --12018 --
NM_004337chr821568 487 --172 --
NM_004338chr1865950 4903 4632 1648 939 585 ----11450
NM_004342chr731940 414 197 21866 612 1537 --
NM_004346chr431032 492 67 ------
NM_004349chr81476 --11161 --
NM_004350chr192544 2480 2415 2283 1772 754 478 384 102 22200 901 ----
NM_004354chr41737 ------
NM_004358chr201439 11141 ----
NM_004360chr1622007 1511 ------
NM_004370chr61221 --1735 --
NM_004379chr231757 640 161 --11199 --
NM_004380chr1611678 ----153
NM_004384chr562246 1603 1562 1542 699 529 1596 --1506
NM_004385chr51674 ------
NM_004386chr1942287 1553 587 354 1717 ----
NM_004389chr24687 578 268 207 ------
NM_004392chr1322396 1072 1655 ----
NM_004393chr332368 2249 2127 --1393 --
NM_004395chr5183 ------
NM_004396chr171198 ------
NM_004397chr1173695 3410 2778 1485 717 389 234 --41709 1677 1234 208 --
NM_004414chr2131563 1388 292 ------
NM_004415chr62641 545 ------
NM_004417chr51459 1505 ----
NM_004419chr101237 ------
NM_004420chr1142244 1960 633 347 --11796 --
NM_004427chr12802 247 ------
NM_004430chr812368 --22702 1734 --
NM_004432chr942412 2068 448 243 12225 --11783
NM_004434chr1431787 1254 546 1409 11860 --
NM_004436chr11572 ------
NM_004437chr133515 3202 938 ------
NM_004438chr253307 2813 2406 74 55 12977 31290 1184 1085 22489 1074
NM_004439chr4142 158 ----
NM_004440chr631653 1428 52 ------
NM_004441chr31116 --184 --
NM_004454chr332095 1789 1697 --22288 878 --
NM_004456chr7164 ------
NM_004457chr22530 234 ------
NM_004458chrX52659 2568 2199 1857 1039 1901 ----
NM_004459chr1721903 1443 --21826 1369 --
NM_004460chr21224 ------
NM_004464chr453433 1515 1494 582 191 --13695 1449
NM_004474chr11909 ----1944
NM_004475chr17----21175 854 --
NM_004480chr141230 ------
NM_004481chr122593 558 --11760 --
NM_004482chr21122 ------
NM_004491chr1974305 2664 1520 1306 1129 556 195 --12900 --
NM_004497chr193700 216 173 ------
NM_004499chr51422 ------
NM_004500chr1431515 1319 762 ------
NM_004501chr163255 1304 734 674 452 213 --23770 466 --
NM_004504chr232387 1023 283 --2130 69 --
NM_004505chr17------21914 1854
NM_004514chr1732771 2451 794 1118 ----
NM_004530chr162392 198 ------
NM_004537chr121517 --137 --
NM_004540chr212589 280 ------
NM_004550chr11150 ------
NM_004566chr102951 812 ------
NM_004567chr331808 637 36 ------
NM_004571chr2193094 2615 2562 2542 2493 2463 872 313 102 ------
NM_004575chr421141 526 --11314 --
NM_004576chr5------191
NM_004578chr1----2863 274 --
NM_004586chrX95250 5039 5028 3602 3347 1790 1728 873 424 34750 3748 1193 1493 --
NM_004593chr31171 ------
NM_004596chr192177 139 ------
NM_004598chr553321 3145 825 478 63 ------
NM_004600chr131191 623 426 ------
NM_004612chr974038 3998 1774 1404 929 636 199 --33508 3359 465 --
NM_004615chrX1310 ----2936 808
NM_004622chr242447 1641 497 108 --11544 1315
NM_004627chr211225 --1630 --
NM_004631chr12244 48 11160 ----
NM_004634chr31259 ----191
NM_004636chr31404 ------
NM_004637chr31331 --11259 --
NM_004642chr121191 1239 ----
NM_004654chrY138 ------
NM_004655chr1741323 1271 1070 531 1196 ----
NM_004660chrY62307 1932 1422 511 307 265 ------
NM_004663chr1531429 1142 1133 ------
NM_004667chr153654 591 240 ------
NM_004671chr181208 ------
NM_004684chr42351 324 ----1275
NM_004686chr821497 510 ------
NM_004687chr1761834 1593 1523 616 532 525 --21319 774 --
NM_004690chr62659 600 ------
NM_004703chr172275 30 ----12535
NM_004709chrX31216 1139 1125 ------
NM_004714chr19------1131
NM_004719chr1252345 2332 2133 1015 373 --32747 345 169 --
NM_004721chr3----1310 --
NM_004725chr103952 343 209 ------
NM_004726chrX95593 5312 4864 3929 2206 2133 1346 532 150 ------
NM_004730chr562117 2023 1619 1416 444 132 --2686 644 --
NM_004734chr1322625 1065 ----22346 818
NM_004736chr142153 2106 480 330 1358 ----
NM_004741chr101546 --11516 --
NM_004742chr321743 1600 --21183 247 21343 1189
NM_004745chr821571 1506 ------
NM_004748chr1543889 3459 1583 525 ------
NM_004751chr15----1421 --
NM_004755chr1431217 1003 167 --2816 798 --
NM_004757chr41102 ------
NM_004760chr721856 364 --21604 87 --
NM_004762chr171490 --2507 75 --
NM_004768chr11905 ----1396
NM_004770chr82191 165 ------
NM_004772chr531546 1394 465 --21500 1342 --
NM_004774chr1732389 2314 437 ----12073
NM_004775chr1811996 ------
NM_004776chr201227 13144 22758 2170 13229
NM_004779chr521219 64 ----1122
NM_004781chr151734 1701 1147 550 164 11360 ----
NM_004781chr151734 1701 1147 550 164 11360 ----
NM_004787chr41154 ------
NM_004788chr1111686 --12565 --
NM_004792chr2----1187 --
NM_004796chr1422412 2295 ------
NM_004798chr2033237 2483 2281 --13389 12667
NM_004799chr12424 69 ------
NM_004800chr131262 ------
NM_004801chr21529 ------
NM_004808chr1083210 3150 2938 2701 2345 957 630 387 11164 1565 --
NM_004824chr631141 314 172 11162 ----
NM_004830chr61883 ------
NM_004831chr193433 163 26 --2871 99 --
NM_004834chr253293 1368 912 844 800 ----1986
NM_004836chr21608 ------
NM_004841chr121094 337 ------
NM_004842chr621772 156 --11549 --
NM_004850chr231753 1169 582 ------
NM_004856chr151461 ------
NM_004857chr1444100 1832 879 538 ----14792
NM_004859chr1762321 2286 1072 1057 407 312 22295 40 ----
NM_004866chr554345 3276 1554 1195 507 --1645 --
NM_004867chrX2190 102 ------
NM_004871chr1754375 4346 4289 3293 1492 --1507 --
NM_004887chr521111 1064 --11069 --
NM_004893chr51218 1190 ----
NM_004896chr1011223 ------
NM_004902chr201621 ------
NM_004904chr776557 6226 4681 4481 2498 1057 690 ------
NM_004906chr61555 ----1671
NM_004912chr721118 448 ------
NM_004921chr132292 2237 214 ------
NM_004929chr821512 59 ------
NM_004936chr952522 1862 1202 1050 935 1377 ----
NM_004938chr931269 1159 1001 ------
NM_004939chr2----171 --
NM_004945chr194810 230 218 181 ------
NM_004946chr51421 ------
NM_004947chr34638 461 413 111 ------
NM_004948chr1821436 1144 --2572 462 --
NM_004949chr181669 1739 12009 1804
NM_004954chr111250 ------
NM_004956chr771516 1044 932 561 174 145 34 11413 ----
NM_004958chr1148 ------
NM_004963chr121116 ----150
NM_004965chr21------1764
NM_004969chr10138 ------
NM_004973chr651737 1661 1595 176 97 ----11442
NM_004976chr1135083 1973 1851 23379 1183 ----
NM_004978chr111478 --1232 --
NM_004979chrX21132 227 ------
NM_004982chr122484 59 ------
NM_004984chr123173 130 31 ------
NM_004985chr1234508 4197 1181 --11086 24377 3897
NM_004992chrX108201 8123 7832 6195 5764 3305 1120 982 246 176 18404 ----
NM_004992chrX108201 8123 7832 6195 5764 3305 1120 982 246 176 18404 ----
NM_004995chr143961 314 186 ------
NM_004998chr154827 807 705 245 ------
NM_004999chr634074 3543 469 --24487 1234 --
NM_005010chr72871 739 --11618 --
NM_005011chr71160 --2429 210 --
NM_005020chr7----1460 --
NM_005023chr521446 1357 21236 367 ----
NM_005028chr1051672 1538 1471 649 267 11487 1682 --
NM_005032chrX1996 ------
NM_005045chr71965 ------
NM_005054chr251562 1338 521 351 144 ------
NM_005056chr1254570 3766 3708 3650 501 --24318 2092 --
NM_005063chr1023848 3709 ------
NM_005065chr1485087 4668 4593 3864 1381 940 738 65 1127 44370 4002 1506 1101 --
NM_005066chr12760 74 ------
NM_005069chr2111694 ----11172
NM_005079chr833221 1024 523 --176 --
NM_005080chr221626 ------
NM_005088chrX2888 325 ------
NM_005093chr2025222 170 --25308 4967 11821
NM_005095chr111565 ------
NM_005096chrX1209 --11031 --
NM_005097chr101290 ------
NM_005102chr21697 ----1345
NM_005109chr312223 ----1994
NM_005120chrX--1157 128 --
NM_005121chr1753198 3113 2832 1404 908 --12507 --
NM_005124chr63686 69 21 ----1346
NM_005126chr322173 1645 ------
NM_005134chr18----1345 --
NM_005135chr1511014 11147 23852 3739 --
NM_005137chr2241829 744 316 109 --11788 1538
NM_005140chrX4771 379 91 31 ------
NM_005151chr1832383 1710 254 --1638 --
NM_005153chr161659 ----1549
NM_005154chr151594 ------
NM_005156chr9105407 5370 5162 4875 4725 4436 4272 4153 1868 367 --13733 --
NM_005157chr951902 1737 1555 591 468 --1768 --
NM_005168chr231679 451 325 ------
NM_005171chr121359 --21271 1172 --
NM_005180chr102466 318 ------
NM_005184chr191260 ------
NM_005188chr1197401 7223 7207 6988 2218 2084 830 768 213 --11297 --
NM_005197chr1476091 6084 5209 4632 2435 2280 1689 15296 11676 --
NM_005204chr101290 137 ----
NM_005214chr22158 98 ------
NM_005215chr181236 ------
NM_005219chr521690 531 11823 ----
NM_005230chr121117 ------
NM_005233chr322062 503 ----12316
NM_005235chr287437 7247 7142 7015 6647 5502 5075 1086 --12148 --
NM_005238chr1122203 989 ----1480
NM_005241chr321359 1103 1355 ----
NM_005243chr221125 ----128
NM_005249chr141740 --149 --
NM_005252chr142754 60 --2580 529 --
NM_005254chr1511331 1909 ----
NM_005257chr181327 --21366 519 197
NM_005259chr231472 1420 947 ------
NM_005277chr461960 1951 1559 1432 633 349 --138 11393
NM_005281chr11973 --1760 --
NM_005296chrX1884 ------
NM_005297chr221290 2591 346 ----
NM_005302chr71416 ------
NM_005311chr742580 2234 1785 402 ------
NM_005313chr15----1170 --
NM_005316chr113858 778 153 ----1387
NM_005324chr1761974 643 512 179 106 100 ------
NM_005328chr81241 --1504 --
NM_005329chr1612357 1635 12050 --
NM_005333chrX181 --1152 --
NM_005338chr733688 2874 2766 ------
NM_005339chr433019 1027 457 22746 2662 13578 --
NM_005342chrX42816 1764 762 280 --1510 --
NM_005358chr1371771 1721 731 707 410 152 25 ------
NM_005359chr1845173 1851 1361 1037 --16224 --
NM_005370chr1911291 ------
NM_005375chr661149 983 897 845 757 144 11125 ----
NM_005378chr2----1568 --
NM_005380chr151157 1077 807 384 100 ------
NM_005382chr81369 ------
NM_005385chr342589 2262 2100 1763 --1663 --
NM_005386chr202801 566 ----1784
NM_005388chr921501 396 ------
NM_005400chr232826 1203 140 --13045 --
NM_005402chr721678 60 11759 ----
NM_005406chr1811360 11420 ----
NM_005407chr141353 ------
NM_005414chr32302 208 ------
NM_005430chr12----1267 1694
NM_005433chr1842300 963 885 464 ----1759
NM_005436chr1033791 3653 1238 11051 --1109
NM_005438chr111225 ------
NM_005440chr1752982 2038 1191 947 446 --13276 --
NM_005450chr17----1178 --
NM_005455chr121781 1693 ------
NM_005458chr941824 894 603 274 --12155 --
NM_005461chr2041698 1683 1289 633 --21465 1355 21626 1375
NM_005465chr1--11250 11846 --
NM_005475chr12----23235 639 --
NM_005476chr91380 --11237 --
NM_005477chr1532448 2206 975 --1722 --
NM_005477chr1532448 2206 975 --1722 --
NM_005487chr2222122 1853 ------
NM_005493chr6----1102 --
NM_005494chr72658 239 ------
NM_005497chr1775765 5712 5621 5371 4630 4466 1581 ------
NM_005499chr191663 ----1457
NM_005502chr932288 2096 1036 --13118 22711 127
NM_005504chr12106069 5954 5881 2452 1988 1184 599 580 295 70 15384 11753 16216
NM_005509chr521651 1312 ----1147
NM_005513chr321335 1058 --11471 --
NM_005517chr131185 1049 29 ------
NM_005521chr101792 ------
NM_005522chr71447 ------
NM_005537chr131702 ------
NM_005542chr741933 1863 1395 211 ------
NM_005544chr21356 --1236 --
NM_005563chr11290 --4891 611 272 59 --
NM_005569chr2241534 1463 1171 45 ------
NM_005573chr51676 --1236 1463
NM_005578chr354888 4858 4131 3255 272 128 ----
NM_005591chr1132641 2227 2090 22423 151 ----
NM_005595chr11656 1374 ----
NM_005596chr954927 1980 1624 1575 1187 15580 25086 4604 12018
NM_005598chr121287 1154 ------
NM_005600chr11273 1280 ----
NM_005602chr311293 --11211 --
NM_005603chr183690 451 92 ------
NM_005604chr631826 896 713 1326 1528 --
NM_005605chr81111 ------
NM_005614chr71756 ------
NM_005618chr62226 201 ------
NM_005627chr62797 660 --1907 --
NM_005637chr1852042 1790 655 470 61 ----11303
NM_005638chrX21245 1193 ------
NM_005639chr1261888 1685 1205 452 103 25 --11563 --
NM_005644chr11372 ------
NM_005647chrX83370 3248 3101 2349 1372 1353 801 112 ------
NM_005655chr831312 810 375 ------
NM_005665chr124113 1570 13706 14482 13938
NM_005668chr584461 3265 1754 1742 1542 1300 278 29 --14111 --
NM_005688chr34431 378 229 40 --11130 --
NM_005708chr13131 1471 ----
NM_005715chr632524 586 101 11855 ----
NM_005721chr211079 ------
NM_005722chr232409 2104 2036 --1484 --
NM_005734chr11----1529 --
NM_005737chr24903 673 531 462 --21014 1007 --
NM_005738chr731905 1555 1401 11762 ----
NM_005746chr742731 973 673 177 --1741 --
NM_005748chr1243049 2581 2350 1158 ------
NM_005751chr72343 180 1484 ----
NM_005759chr274782 4603 4095 3596 2926 556 379 14277 21762 729 --
NM_005765chrX------2336 284
NM_005766chr132400 220 ------
NM_005776chr143682 307 270 ------
NM_005786chr1851187 1133 413 56 36 --1848 --
NM_005789chr1741707 1453 478 329 ------
NM_005808chr372945 2923 2241 1167 1007 215 33 --13342 --
NM_005813chr272245 2188 1875 843 750 569 140 1534 ----
NM_005822chr652228 1813 1601 1580 1568 --1926 --
NM_005826chr11486 ------
NM_005832chr3----1237 --
NM_005833chr91156 ------
NM_005840chrX35808 4685 2367 17302 22641 2510 12110
NM_005841chr411101 ------
NM_005842chr13195 ------
NM_005859chr531103 1062 977 ------
NM_005862chr341042 1025 809 783 ------
NM_005868chr722471 1681 1807 ----
NM_005870chr1311182 --1239 --
NM_005871chr104943 863 315 156 ------
NM_005880chr16----11130 --
NM_005882chr41178 1820 ----
NM_005885chr511068 --1264 --
NM_005898chr1163002 2150 1255 740 578 468 2903 500 ----
NM_005900chr421099 49 ------
NM_005901chr1888036 7679 6790 5518 2556 1898 1129 61 --38340 1903 393 23099 809
NM_005902chr1544550 2835 1354 955 --13669 --
NM_005903chr553608 1540 852 834 416 1255 35046 1190 538 14821
NM_005904chr1821370 1191 ------
NM_005906chr631403 175 30 --1494 --
NM_005909chr554042 3911 980 519 272 ------
NM_005911chr2------1336
NM_005917chr21184 ------
NM_005920chr111426 ----1626
NM_005922chr6------1391
NM_005924chr71778 ----3441 377 288
NM_005926chr152361 201 ------
NM_005933chr1132564 2328 388 --22694 2493 12590
NM_005934chr193517 141 98 11034 2568 522 --
NM_005937chr172700 212 13244 11423 --
NM_005941chr833217 1459 1398 ----12925
NM_005955chr155468 3839 2170 1581 926 --31612 367 249 14692
NM_005962chr1012130 --1677 --
NM_005962chr1012130 --1677 --
NM_005963chr17172 ------
NM_005964chr171477 --11409 --
NM_005966chr222396 1835 --11540 --
NM_005968chr19------1173
NM_005977chr13156 ----11016
NM_005986chr1311874 1203 1653 --
NM_006003chr192202 81 ------
NM_006007chr963348 1099 1086 1039 742 706 11448 1681 --
NM_006010chr31196 ------
NM_006011chr1534204 1153 1146 --1957 --
NM_006016chr621973 1542 ------
NM_006030chr321347 293 ------
NM_006033chr1831611 336 126 --1181 1511
NM_006037chr274655 4285 3882 3149 1573 1426 1222 24384 3599 ----
NM_006038chr2022032 104 181 1743 --
NM_006047chr2042993 2630 2453 140 ------
NM_006054chr1131363 108 70 --11159 --
NM_006064chrX1383 --1266 --
NM_006067chr161799 ------
NM_006070chr31352 ------
NM_006073chr631779 1406 555 ------
NM_006076chr72990 332 23000 2986 ----
NM_006080chr782921 2832 2213 2057 1909 1098 1036 478 ------
NM_006094chr842412 1867 951 690 ------
NM_006095chr433572 2837 168 --44389 3146 3137 181 --
NM_006100chr3184 --2222 52 --
NM_006106chr1142734 2558 1039 700 ----12604
NM_006108chr1142349 1483 248 29 1550 ----
NM_006113chr141899 1694 843 103 1179 ----
NM_006133chr1132377 2340 806 1859 ----
NM_006135chr111369 ------
NM_006141chr1662497 2228 995 748 640 533 ------
NM_006143chr121125 ------
NM_006147chr1----1454 --
NM_006148chr1742666 2582 2060 2053 ------
NM_006154chr1552721 2588 2263 429 192 ------
NM_006157chr111350 ------
NM_006159chr121578 ------
NM_006161chr52476 245 --1662 --
NM_006164chr23360 157 43 ------
NM_006166chr1222567 2277 --1273 --
NM_006167chr82808 675 ------
NM_006178chr171223 1550 ----
NM_006180chr951664 1559 1485 333 162 ------
NM_006183chr121142 ------
NM_006195chr941226 1204 1045 47 ------
NM_006202chr1911373 ------
NM_006203chr574526 3729 3672 3505 1758 892 381 14717 --1545
NM_006206chr462761 2382 2271 528 444 349 ----1904
NM_006209chr8----1319 1270
NM_006212chr145272 4904 4144 535 --13630 --
NM_006216chr22663 648 ----1208
NM_006226chr221255 334 ------
NM_006237chr1331861 1498 114 ------
NM_006246chr1421142 132 ------
NM_006251chr523030 2484 --12782 12076
NM_006252chr187171 6041 5461 5372 4690 2557 824 31 --16008 --
NM_006255chr1431134 750 694 ------
NM_006256chr162726 2248 1087 782 208 187 ------
NM_006265chr8--1960 --1348
NM_006267chr23446 231 217 ------
NM_006268chr111265 11052 ----
NM_006277chr2167 ----1493
NM_006281chr81186 1327 21094 316 11000
NM_006281chr81186 1327 21094 316 11000
NM_006282chr2044445 4007 562 476 11844 ----
NM_006283chr8104116 3666 3479 1920 1676 1464 1417 1267 1198 34 --11090 --
NM_006284chr11121 ------
NM_006285chr91213 ------
NM_006292chr111172 ------
NM_006298chr662316 2261 1243 1200 539 77 --12118 --
NM_006306chrX64200 2177 1968 1555 700 128 11141 ----
NM_006313chr1231669 1498 424 ------
NM_006315chr453876 3239 3148 2834 1131 ------
NM_006317chr51355 ----1876
NM_006320chr42943 926 ------
NM_006321chr331956 1925 400 --1474 --
NM_006322chr132787 190 --2225 46 --
NM_006323chr4----1620 --
NM_006330chr81287 ------
NM_006333chr22657 541 1185 ----
NM_006334chr93289 219 96 ------
NM_006335chr14984 739 433 212 --2785 733 --
NM_006352chr142044 1507 839 132 --1314 --
NM_006353chr62946 27 11304 ----
NM_006359chrX3907 201 64 ------
NM_006364chr1441166 1109 846 487 1339 ----
NM_006367chr131073 936 282 ------
NM_006371chr333650 3312 1979 34560 4199 1082 24757 1372 --
NM_006373chr17180 --11053 --
NM_006375chrX1303 ----11306
NM_006379chr71156 ------
NM_006380chr1764374 4358 3397 2856 1685 356 ----21724 100
NM_006382chr17--2238 196 ----
NM_006386chr2252352 2171 1825 1804 577 ------
NM_006389chr1111355 ------
NM_006390chr1261842 1732 1558 1140 479 39 11514 2606 405 --
NM_006393chr1024232 4024 --1812 --
NM_006400chr121375 ------
NM_006405chr141103 ------
NM_006413chr1031025 447 217 ------
NM_006416chr62701 46 ------
NM_006420chr2043310 2975 2698 2117 --1938 --
NM_006431chr121223 ------
NM_006434chr1052829 2078 958 827 599 ------
NM_006454chr433018 2086 146 --1984 --
NM_006457chr463060 2699 1641 1381 1306 770 --14149 --
NM_006460chr172447 276 ------
NM_006463chr2----151 --
NM_006464chr254135 1244 430 233 146 13574 2442 370 23256 1498
NM_006465chr1521863 169 ------
NM_006471chr18194 ------
NM_006472chr11514 11226 ----
NM_006482chr1253361 3204 2852 2378 836 12985 --23708 1270
NM_006483chr19------1131
NM_006484chr19------1131
NM_006489chr1432016 532 420 1739 166 --
NM_006496chr121530 294 ------
NM_006520chrX1471 ------
NM_006526chr2041948 1653 1546 331 --21389 125 --
NM_006530chr122349 152 ------
NM_006534chr2052587 920 843 718 53 ------
NM_006537chr152622 94 ------
NM_006538chr233844 3578 1170 14002 23352 1035 24101 640
NM_006540chr83993 542 241 ------
NM_006544chr1484696 4673 3990 2251 1626 1430 1221 347 --14780 --
NM_006546chr1764142 4054 1462 1299 1094 937 --1530 --
NM_006547chr742053 1912 550 271 176 ----
NM_006549chr1242857 2394 423 260 ------
NM_006554chr21246 ------
NM_006557chr921654 297 ------
NM_006559chr12927 166 ------
NM_006561chr1056020 4622 2468 2381 262 1988 15779 --
NM_006565chr1621168 1161 --11179 --
NM_006570chr91373 ------
NM_006574chr31294 ------
NM_006575chr1431208 131 84 11226 ----
NM_006577chr211208 ------
NM_006595chr1121312 82 ------
NM_006597chr112174 26 ------
NM_006599chr1657043 6498 5817 5488 993 38126 5765 1807 22857 399 27755 2007
NM_006601chr1211060 --1719 --
NM_006603chrX41925 1657 1489 370 --21840 247 1147
NM_006605chr221131 ------
NM_006614chr31252 23142 2692 ----
NM_006622chr51481 ------
NM_006624chr1022079 249 11648 ----
NM_006625chr121025 204 ------
NM_006625chr121025 204 ------
NM_006625chr121025 204 ------
NM_006628chr1543606 1144 688 267 13255 1186 14535
NM_006633chr51598 --1227 --
NM_006636chr21329 ------
NM_006654chr1274058 3999 3785 3681 3408 1258 970 ----1616
NM_006660chr15188 ------
NM_006662chr161263 ------
NM_006664chr9133 ------
NM_006675chr1243334 2402 274 81 1296 23348 2233 --
NM_006681chr4------156
NM_006682chr731083 572 167 ------
NM_006698chr2031221 502 73 2169 54 ----
NM_006700chr121804 ------
NM_006702chr19------1159
NM_006706chr5180 ------
NM_006710chr22920 707 ------
NM_006713chr52286 151 --131 --
NM_006717chr943310 3141 2414 1047 --42953 2796 2406 2113 --
NM_006718chr62922 348 ------
NM_006720chr1065078 5020 4209 4026 3315 429 24784 1358 --11914
NM_006722chr373003 2939 2168 2127 1086 486 22 1802 12849 --
NM_006724chr6------1391
NM_006729chrX85155 4659 4118 533 145 104 76 53 ----11321
NM_006732chr1932049 1379 508 --12139 --
NM_006734chr63638 630 413 --11077 --
NM_006735chr7----1328 --
NM_006738chr1532948 1717 1235 --13484 --
NM_006745chr421090 910 ------
NM_006746chrX11385 ------
NM_006750chr1658028 5980 2571 1550 354 12615 ----
NM_006754chr7--1946 ----
NM_006756chr821286 1243 ------
NM_006761chr171796 ------
NM_006766chr822527 965 --11890 --
NM_006772chr61330 --11488 --
NM_006775chr623014 761 1281 1444 2905 238
NM_006777chrX42845 2794 1871 1859 ------
NM_006788chr1852031 2010 1600 394 196 --11309 --
NM_006790chr51349 ------
NM_006791chr15----1586 --
NM_006800chrX3563 504 426 ------
NM_006805chr51631 ------
NM_006806chr211171 ------
NM_006807chr172381 240 ------
NM_006811chr2031027 781 402 ------
NM_006813chr61904 2800 347 ----
NM_006815chr121377 1918 ----
NM_006823chr851215 1169 523 443 67 --1115 --
NM_006826chr221203 201 --11153 --
NM_006832chr1441072 709 675 150 --1949 --
NM_006839chr21119 ------
NM_006852chr1712182 1760 1305 --
NM_006854chr742005 1426 432 383 ------
NM_006857chr2182 --1759 --
NM_006861chr1211461 --131 --
NM_006874chr421068 393 146 ----
NM_006885chr1633723 1445 1308 13809 33358 872 392 --
NM_006888chr1483515 3403 2971 2926 1100 989 554 239 --22782 633 --
NM_006892chr2011154 ------
NM_006892chr2011154 ------
NM_006895chr231550 371 109 --21945 1427 --
NM_006902chr143325 2213 432 91 ------
NM_006906chr113630 161 33 ------
NM_006908chr711031 1365 2542 340 --
NM_006910chr161114 ------
NM_006912chr162533 2358 961 346 255 195 172 ----
NM_006914chr92460 117 --1533 --
NM_006915chrX42488 2478 985 504 ------
NM_006918chr1185196 5188 5018 3758 2264 855 338 141 ------
NM_006920chr231742 579 361 ------
NM_006922chr242410 2012 1761 383 ------
NM_006930chr52163 95 --1752 --
NM_006931chr1211941 --11482 --
NM_006936chr2131024 135 39 ------
NM_006937chr171195 ------
NM_006939chr141203 --1263 1307
NM_006940chr12--1279 --1732
NM_006948chr2162393 2340 1712 774 593 307 ------
NM_006951chr102778 264 1714 ----
NM_006955chr1073421 3214 2779 2540 2279 2178 651 --32784 2321 768 --
NM_006965chr1841069 1057 1024 481 ----1345
NM_006981chr932931 2257 224 ------
NM_006990chr112296 1459 ----
NM_006996chr151859 1596 1188 683 103 --11819 --
NM_006997chr102398 110 ------
NM_006999chr541880 1791 606 295 ------
NM_007005chr9----11518 1352
NM_007006chr1622542 2159 --12555 --
NM_007008chr21262 --3923 382 145 1901
NM_007010chr1711527 ------
NM_007011chr1545946 5908 5626 1476 26701 2581 1216 --
NM_007013chr82789 34 ------
NM_007019chr201171 ------
NM_007023chr22892 143 ------
NM_007030chr534843 82 26 24943 3982 24517 3537 --
NM_007034chr131024 869 721 140 ----
NM_007035chr123682 644 184 ------
NM_007038chr2185946 5613 5447 4756 4619 4426 1268 1035 150 1172 --
NM_007040chr1911030 ------
NM_007042chr31319 1245 ----
NM_007045chr61115 ------
NM_007050chr2077883 7800 7001 5042 2387 2293 2136 16034 ----
NM_007052chrX2146 30 ------
NM_007054chr543237 1412 525 219 --2424 239 --
NM_007064chr321240 684 ------
NM_007067chr171280 1255 ----
NM_007078chr1042770 1220 243 169 ----21953 1208
NM_007084chr133574 293 65 ------
NM_007096chr91253 ------
NM_007106chr132688 363 --1564 --
NM_007107chr332196 2162 1876 ------
NM_007111chr13------1843
NM_007118chr53812 224 124 --1176 --
NM_007124chr631275 756 307 --11631 --
NM_007125chrY2434 191 ------
NM_007145chr1921234 450 ----1154
NM_007146chr1762860 2393 912 701 520 504 --1487 --
NM_007150chrX22110 857 ------
NM_007158chr13427 358 269 ------
NM_007159chr311733 ------
NM_007166chr1121395 431 --21274 1156 --
NM_007170chr11269 ------
NM_007174chr1222143 242 ------
NM_007175chr822822 577 ------
NM_007185chr121000 332 ------
NM_007187chr133770 746 349 --1199 1340
NM_007189chr721205 158 --2608 102 --
NM_007190chr1031157 756 23 --11049 --
NM_007191chr12----1619 --
NM_007197chr121178 ------
NM_007198chr821520 33 ------
NM_007200chr1532948 1717 1235 --13484 --
NM_007202chr172753 662 ------
NM_007212chr132288 1735 867 --168 --
NM_007217chr3126 ------
NM_007220chrX84660 4649 3243 3157 1094 770 115 91 ------
NM_007222chr831496 1146 527 ------
NM_007231chrX32080 572 285 ------
NM_007249chr13109342 8989 8375 8059 7017 3760 3693 2552 2185 247 26782 1135 39268 5950 1447 --
NM_007270chr711518 --1259 11481
NM_007271chr631339 743 588 ------
NM_007275chr321098 417 ------
NM_007276chr71174 ------
NM_007285chr162323 108 ------
NM_007286chr542120 1937 1325 554 ------
NM_007287chr311174 11993 --1103
NM_007288chr311174 11993 --1103
NM_007289chr311174 11993 --1103
NM_007292chr1745154 3727 733 572 --13498 15031
NM_007313chr951902 1737 1555 591 468 --1768 --
NM_007315chr231430 1394 1120 ----11050
NM_007324chr12424 69 ------
NM_007325chrX42062 1831 1595 579 --11443 --
NM_007331chr44478 168 94 26 --12607 --
NM_007345chr1831768 502 195 ------
NM_007347chr1521205 375 --23236 2200 13074
NM_007349chr73449 376 76 ------
NM_007358chr121562 31 ------
NM_007359chr1711730 ------
NM_007361chr142555 513 ------
NM_007363chrX3980 223 123 --11001 --
NM_007372chr171879 ------
NM_007373chr1041314 1170 1148 117 ------
NM_007375chr192785 2674 2465 2451 2158 1724 1077 979 90 --12117 --
NM_012072chr2063966 3091 1445 1358 712 520 --11034 1809
NM_012081chr543294 2962 2440 166 --13452 13098
NM_012082chr8----1317 --
NM_012089chr111505 1221 ----
NM_012092chr221264 189 21648 361 ----
NM_012095chr1051280 1041 600 572 531 --13243 --
NM_012096chr362815 2494 1490 1088 565 203 11027 3852 614 315 1174
NM_012097chr232184 2041 624 1500 ----
NM_012104chr111360 1922 13006 --
NM_012104chr111360 1922 13006 --
NM_012118chr41461 ------
NM_012120chr632556 883 703 ------
NM_012137chr122786 2216 --12964 12893
NM_012141chr1393985 3974 3685 3474 3432 2577 1470 619 79 21449 1179 2689 98 13307
NM_012156chr2032817 1321 115 --1207 --
NM_012158chr132751 356 --11236 --
NM_012161chr431103 1087 59 ------
NM_012175chr112689 664 ------
NM_012193chr1184930 4561 3600 1527 1112 997 635 564 --35381 779 534 1900
NM_012197chr921382 1324 ------
NM_012199chr184512 4502 4381 3452 1497 1002 920 277 --11488 24296 3737
NM_012213chr161691 ------
NM_012214chr2116107 5943 5295 2325 1688 1503 1266 957 927 818 249 15597 25955 605 --
NM_012215chr1051604 1507 1458 620 599 ------
NM_012218chr1921908 35 22612 2211 22977 1202 --
NM_012219chr322835 2281 12147 --174
NM_012234chr352337 2315 766 694 454 --12284 --
NM_012238chr102693 177 ------
NM_012242chr10----1274 1766
NM_012243chr12762 297 ------
NM_012244chr1421386 1142 --1391 --
NM_012247chr10----11005 --
NM_012248chr162489 169 ------
NM_012249chr22694 650 13160 ----
NM_012252chr745310 4816 1212 320 --11150 14395
NM_012255chr201428 ------
NM_012257chr73858 835 694 1127 ----
NM_012259chr631400 1285 1084 ------
NM_012262chr1105160 5087 5037 4692 3197 1186 932 878 457 168 --13443 --
NM_012264chr221752 --1219 --
NM_012264chr221752 --1219 --
NM_012281chr742411 950 796 578 ------
NM_012282chrX2352 243 1336 ----
NM_012286chrX1573 ------
NM_012297chr462325 1879 1713 476 462 55 --11804 --
NM_012300chr522278 374 --12403 11721
NM_012301chr721863 1468 ------
NM_012302chr111002 --1375 --
NM_012304chr531848 992 253 2726 675 ----
NM_012308chr1122217 694 --1331 --
NM_012309chr1163532 3434 3364 534 503 365 ------
NM_012316chr144856 3914 3579 3434 25547 4531 21738 651 --
NM_012317chrX2797 722 --1663 --
NM_012319chr182987 81 ------
NM_012325chr2021137 139 ------
NM_012328chr731217 944 541 ------
NM_012329chr1711107 ----1106
NM_012330chr102494 483 ------
NM_012333chr11293 --1606 --
NM_012343chr52780 419 ------
NM_012345chr1321290 718 ------
NM_012382chr554337 3290 1672 755 409 --1800 --
NM_012399chr2231700 1665 317 --11609 --
NM_012402chr1131383 1051 866 ------
NM_012416chr921189 1018 ------
NM_012419chr61442 ------
NM_012420chr1062291 2024 1949 913 158 136 11676 ----
NM_012425chr1022710 2071 --11977 12410
NM_012428chr151962 --1358 1738
NM_012431chr72468 87 22311 1001 1210 --
NM_012434chr61108 1360 ----
NM_012446chr5----1615 --
NM_012454chr6----1539 --
NM_012479chr722167 641 --1975 --
NM_012482chr11634 ------
NM_013229chr124902 468 290 116 --22096 264 --
NM_013230chrY11301 ----11792
NM_013231chr1464173 3146 260 148 119 111 ------
NM_013233chr221287 567 ------
NM_013237chr5168 ------
NM_013253chr1141327 973 513 151 ------
NM_013261chr443501 3332 2352 631 --11158 --
NM_013262chr621303 46 ------
NM_013275chr162733 129 --1800 --
NM_013277chr123909 83 61 132 ----
NM_013281chr201370 --31289 253 120 --
NM_013283chr51140 --1777 --
NM_013296chr12420 87 ------
NM_013300chr122245 211 ------
NM_013305chr182802 137 ------
NM_013313chr2253142 3116 2256 1379 767 12815 22796 2201 --
NM_013316chr72863 383 ------
NM_013326chr18154 ------
NM_013330chr11209 --2214 175 --
NM_013336chr321233 187 ------
NM_013341chr232528 2394 1863 ------
NM_013354chr81430 1342 ----
NM_013364chrX2705 560 ------
NM_013371chr1------1321
NM_013372chr1523203 424 ------
NM_013374chr362291 841 444 236 101 70 ------
NM_013382chr1451684 1645 869 167 67 --12042 --
NM_013386chr121514 104 11784 1287 --
NM_013396chr2121369 368 --11494 --
NM_013423chrX11014 ------
NM_013427chrX11014 ------
NM_013436chr21162 ------
NM_013438chr961525 508 421 374 225 130 --21730 1590 --
NM_013444chrX61161 1080 1024 439 356 141 ------
NM_013448chr142229 119 ------
NM_013449chr1231037 998 945 --21932 428 --
NM_013450chr2--1309 ----
NM_013943chr143021 1214 824 532 ------
NM_013951chr232438 1977 121 ------
NM_013986chr221125 ----128
NM_013993chr61826 ------
NM_013994chr61826 ------
NM_013995chrX42024 971 499 403 12225 ----
NM_013996chr7173 ----1390
NM_013996chr7173 ----1390
NM_013997chr7173 ----1390
NM_013997chr7173 ----1390
NM_013998chr7173 ----1390
NM_013998chr7173 ----1390
NM_014000chr1021980 652 ------
NM_014010chr91603 ------
NM_014011chr222614 586 ------
NM_014016chr3----11700 --
NM_014021chr152379 2310 1350 627 360 --11326 --
NM_014023chr1012705 ------
NM_014028chr663146 2777 2422 2387 2319 412 ------
NM_014031chr52301 108 ------
NM_014034chr611255 ------
NM_014038chr71319 ------
NM_014048chr1645297 4653 4010 447 --25178 92 --
NM_014071chr201346 ------
NM_014089chr1332144 1760 751 11902 12092 11910
NM_014112chr8114396 4317 4238 3946 2203 2012 1993 1703 1590 1352 387 --21424 271 --
NM_014117chr161795 --1464 --
NM_014153chr16--140 1664 1577
NM_014154chr331442 1432 243 --1493 --
NM_014155chr1166783 6764 2990 2393 2355 1541 1854 15891 17319
NM_014181chr232929 370 362 ----12092
NM_014189chr4--21240 286 ----
NM_014191chr1221051 423 --1729 --
NM_014212chr121927 ----1641
NM_014223chr13705 578 133 ------
NM_014231chr1242154 451 255 157 ------
NM_014233chr1741991 1982 509 289 --1448 --
NM_014240chr353918 3215 1588 1360 536 --21461 796 11442
NM_014243chr431782 1502 1342 ----22133 185
NM_014249chr151517 ------
NM_014250chr2222122 1853 ------
NM_014253chrX42449 2368 2178 1589 ------
NM_014263chr1041193 1142 1059 56 ------
NM_014264chr41500 ------
NM_014271chrX1101 ------
NM_014278chr42350 157 1436 ----
NM_014279chr91963 ------
NM_014280chr14717 705 646 294 ------
NM_014282chr931148 464 132 --136 --
NM_014290chr91195 ------
NM_014294chr82925 135 ------
NM_014300chr152131 122 ------
NM_014305chr132176 92 ------
NM_014309chr2285433 5401 4829 4131 3919 1179 273 223 --13715 --
NM_014319chr123761 633 559 ------
NM_014325chr1242131 883 514 100 ------
NM_014331chr4127557 7353 7257 7097 4873 4754 2815 2809 2491 1589 1037 867 17473 26679 496 27719 6577
NM_014333chr1121781 573 --12491 --
NM_014335chr1511037 --1290 --
NM_014342chr1121440 947 ------
NM_014344chr112775 675 ------
NM_014350chr52402 53 ------
NM_014351chr2221419 69 ------
NM_014363chr133517 266 63 --11113 --
NM_014372chr142016 1547 1357 687 ------
NM_014382chr341771 1710 368 293 11429 ----
NM_014392chr43329 198 189 --1486 --
NM_014393chr831544 1516 441 --11727 1882
NM_014399chr73773 369 252 ------
NM_014410chr181363 ------
NM_014415chr341457 1444 366 336 ----1307
NM_014421chr43800 491 56 ------
NM_014423chr5105357 5155 4841 4032 3462 1170 755 746 680 652 14520 ----
NM_014445chr332043 1816 1574 --12419 --
NM_014447chr441572 1241 1222 1044 ----1300
NM_014452chr631203 856 339 ------
NM_014454chr62857 789 ------
NM_014456chr1011172 ----1300
NM_014458chr121250 1115 ------
NM_014491chr71759 ------
NM_014494chr1642379 1984 696 489 ----1400
NM_014515chr121879 --1385 --
NM_014517chr321393 624 11870 ----
NM_014554chr1231437 852 142 ------
NM_014572chr1331194 654 223 --11606 --
NM_014574chr1411195 --1235 --
NM_014577chr224919 715 633 177 --2688 683 --
NM_014585chr221136 347 --164 --
NM_014586chr2144545 4445 4396 4029 --13258 --
NM_014587chr1641355 556 415 375 --11246 --
NM_014591chr1021311 417 ------
NM_014593chr18133 ------
NM_014600chr221646 1459 11045 ----
NM_014612chr941294 1080 1002 416 ------
NM_014613chr543054 2538 2283 2059 --13008 --
NM_014614chr23964 584 152 ------
NM_014615chr1623549 1121 12962 3978 785 489 --
NM_014621chr21101 ------
NM_014630chr1533519 1084 717 --1796 --
NM_014634chr2243411 2510 2434 1221 --1183 12816
NM_014635chr231306 483 315 ------
NM_014636chr974119 4055 3749 3173 2778 1223 538 --11029 --
NM_014637chr831236 1169 427 --11305 --
NM_014646chr1852844 2785 2638 1283 975 1854 ----
NM_014647chr1621975 831 --12167 --
NM_014655chr121643 497 12230 22319 903 --
NM_014660chr721091 281 --1308 --
NM_014665chr853407 683 270 190 98 12268 ----
NM_014666chr511138 ------
NM_014667chr382445 2339 2326 2019 1594 960 484 164 --11711 12192
NM_014670chr22585 232 ------
NM_014674chr353746 1571 1552 1141 842 --12884 1599
NM_014676chr131444 1058 202 ------
NM_014678chr22--1548 1122 --
NM_014679chr1121039 266 ----1257
NM_014682chr892231 2124 1871 1685 502 352 258 127 102 --177 12149
NM_014683chr1721501 597 ----11336
NM_014685chr161415 ------
NM_014686chr1942399 1834 1684 887 --11894 2901 520
NM_014701chr1522924 824 --184 --
NM_014702chr643367 801 449 167 ------
NM_014705chr731711 761 29 ------
NM_014706chr1221022 803 --175 --
NM_014707chr721814 643 ------
NM_014711chr1651806 1764 732 649 632 ------
NM_014713chr21339 ------
NM_014721chr6136959 6898 6649 5934 5624 5310 5251 5016 4615 2265 1771 1416 1063 1378 36848 5098 80 --
NM_014723chr2023119 1028 11183 ----
NM_014727chr191256 ------
NM_014729chr832114 1874 275 --21811 709 --
NM_014730chr1265000 4735 4668 4579 1948 404 ----15107
NM_014730chr1265000 4735 4668 4579 1948 404 ----15107
NM_014733chr542136 1877 787 306 ------
NM_014735chrX11678 --1328 --
NM_014739chr644181 3202 3017 1611 11080 1268 1189
NM_014740chr17147 ------
NM_014741chr1112183 ------
NM_014743chr452941 2249 2232 1194 356 12266 ----
NM_014746chr254279 1514 711 621 567 --22755 681 11341
NM_014750chr14----1214 --
NM_014751chr81872 --31756 1528 418 12077
NM_014755chr271379 1059 939 895 688 682 510 1866 ----
NM_014758chr1111836 --12493 --
NM_014759chr821519 144 ------
NM_014764chr1231324 1246 869 --1821 --
NM_014772chr1863371 2710 1082 779 683 443 --22726 1155 --
NM_014774chr162611 2578 2238 609 467 387 ------
NM_014779chr331111 257 180 ------
NM_014781chr81416 --1296 --
NM_014787chr132700 2097 1037 ------
NM_014790chr51192 ------
NM_014795chr25945 877 477 306 191 ------
NM_014803chr1032373 1910 188 ------
NM_014807chr111646 ------
NM_014810chr173355 3082 1280 988 756 643 109 --23472 3467 --
NM_014812chr131982 1747 632 11778 ----
NM_014813chr12612 52 ------
NM_014820chr311764 11341 --12027
NM_014822chr42255 30 ------
NM_014824chr112581 352 ------
NM_014826chr153930 3890 3821 3379 243 1561 ----
NM_014827chr11383 ------
NM_014829chr52608 360 ------
NM_014830chr1242897 2757 2376 1410 13773 ----
NM_014835chr2021938 645 ------
NM_014836chr1041546 815 220 144 1122 ----
NM_014838chr223642 404 386 ----1847
NM_014839chr122427 773 ------
NM_014841chr61177 ------
NM_014846chr81104 --1243 --
NM_014847chr11442 --1497 --
NM_014848chr1532272 2158 475 1528 ----
NM_014850chr334547 840 155 13201 11182 --
NM_014864chr174319 4137 3470 3455 3015 762 490 --13357 --
NM_014868chr124925 878 775 330 ------
NM_014871chr121105 ------
NM_014872chr95704 567 524 407 165 ------
NM_014873chr1124779 4492 3864 3584 3085 1936 1716 1625 950 728 602 63 ------
NM_014876chr2231990 1893 213 ------
NM_014877chr1787225 7141 6608 5708 5327 1677 551 186 --27084 5613 --
NM_014883chr431824 1004 801 --1491 --
NM_014887chr132799 37 ------
NM_014888chr721355 172 --11257 --
NM_014890chr31232 ------
NM_014891chr741597 1482 1052 43 ------
NM_014897chr1763257 3190 3016 951 372 237 --12851 --
NM_014900chr2126 ------
NM_014901chr542200 432 176 118 1303 ----
NM_014902chr2011047 ------
NM_014904chr1063978 3732 3375 2719 1469 1167 1271 --12950
NM_014905chr22461 337 --1226 --
NM_014912chr105395 227 100 64 29 1219 12968 13145
NM_014913chr1811438 --1505 --
NM_014914chr2------11138
NM_014916chr71792 --3609 486 270 --
NM_014918chr1511581 ------
NM_014920chr633195 2933 2584 --23456 3451 --
NM_014921chr1933012 2295 1037 --1512 --
NM_014923chr13299 50 1106 ----
NM_014925chr121165 ------
NM_014926chr31946 ------
NM_014932chr311477 ------
NM_014935chr133880 1508 120 13857 ----
NM_014937chr10----180 --
NM_014939chr1811177 ------
NM_014942chr632588 2436 2346 ------
NM_014945chr5128 11518 1129 --
NM_014946chr223056 2850 ------
NM_014947chr132302 756 712 --22964 2929 --
NM_014949chr1159 ------
NM_014950chr1431663 1614 460 ------
NM_014951chr1021770 884 ------
NM_014952chr1531956 1421 61 1543 ----
NM_014961chr412158 --1378 --
NM_014962chr2012381 11925 12846 12688
NM_014964chr1721592 1518 1226 --12274
NM_014969chr13912 318 271 --21118 945 --
NM_014974chr1051617 1567 1290 1178 677 ----11301
NM_014978chr1031709 1454 637 --1680 --
NM_014982chr14105273 4948 3677 3640 1982 1756 726 579 558 53 --24249 297 --
NM_014988chr43955 469 206 ------
NM_014989chr661931 1924 1533 1261 787 84 ----11345
NM_014991chr432794 2585 869 177 ----
NM_014992chr141262 ------
NM_014994chr1572358 1927 1831 901 652 485 462 ----12383
NM_014999chr1211645 --1287 --
NM_015000chr1252709 2665 2173 695 238 --2752 275 --
NM_015002chr1252114 1859 400 356 227 ------
NM_015008chr333192 2352 331 ------
NM_015017chr1----21149 822 --
NM_015020chr1663697 3115 3064 1468 918 553 --1535 --
NM_015024chr841464 1240 1036 192 ------
NM_015025chr242577 2193 1716 648 ------
NM_015026chr1284704 3734 1875 1744 1582 538 439 328 11813 ----
NM_015027chr16------130
NM_015032chr1312610 --12526 1779
NM_015039chr143955 3677 2813 2678 --1269 --
NM_015040chr262877 2427 2211 1316 740 177 --13401 --
NM_015042chr1553987 3788 3518 1298 415 --11387 --
NM_015045chr1042017 1984 1814 159 11917 ----
NM_015049chr233121 2623 1005 ----160
NM_015051chr932588 2209 313 --2481 161 --
NM_015053chr112245 --2935 339 --
NM_015056chr2172626 1711 955 913 804 363 48 ------
NM_015057chr131276 ------
NM_015061chr91886 ------
NM_015062chr101210 ------
NM_015068chr712549 --23968 3429 --
NM_015071chr546273 4806 4002 196 24761 412 14196 --
NM_015072chr142385 250 ------
NM_015074chr194884 4202 4086 3710 3282 1316 595 346 176 ------
NM_015075chrX42233 1796 1720 1520 ------
NM_015076chr674516 3528 1651 1549 1325 862 144 --14069 21227 65
NM_015080chr111869 ----1716
NM_015082chr522163 107 12561 1164 --
NM_015090chr156057 1571 1119 911 563 21348 837 12431 1801
NM_015091chr143815 281 89 ------
NM_015092chr16114647 4002 1846 1759 1389 963 898 499 459 176 146 23592 1403 13352 --
NM_015093chr621623 1432 --1593 --
NM_015094chr2254363 1420 754 518 505 --14510 --
NM_015097chr321848 283 11448 12347 --
NM_015100chr141280 1255 782 390 ------
NM_015107chrX----1111 --
NM_015115chr443098 2247 799 173 11093 1104 --
NM_015116chr1341656 1139 1114 623 ----11631
NM_015124chr222887 604 11838 12410 --
NM_015125chr192483 420 ------
NM_015130chr421124 342 ------
NM_015132chr711998 ------
NM_015137chr822376 1899 12220 ----
NM_015138chr1522658 705 ------
NM_015141chr362728 2464 2199 2174 751 595 --21691 177 --
NM_015143chr421204 49 --11017 --
NM_015144chr1643727 2617 498 296 33707 3450 2876 --14010
NM_015151chr213865 329 277 --1317 --
NM_015153chr61553 ------
NM_015155chr1083379 3186 2446 2347 2079 1082 1061 34 --1647 --
NM_015156chr1483285 3243 2728 1408 1365 1148 1029 739 --12505 --
NM_015161chr162563 66 ----11289
NM_015163chr141779 ------
NM_015169chr81369 ------
NM_015170chr82623 341 --1151 --
NM_015172chr131593 1517 1075 ------
NM_015176chr121208 214 --31249 712 679 --
NM_015184chr3177 ------
NM_015185chrX52908 1918 814 725 81 11128 ----
NM_015192chr2082791 2769 2516 2063 2005 761 518 436 --12800 --
NM_015198chr711230 ----1922
NM_015199chr332615 1863 294 ------
NM_015200chr421673 980 --12592 11970
NM_015206chr1533508 2892 623 11063 12786 --
NM_015208chr1844050 1123 298 240 ------
NM_015209chr11454 --2746 115 --
NM_015210chr18138 --1970 --
NM_015215chr152690 2362 2107 203 197 --22897 1166 --
NM_015216chr521504 70 --31177 1037 315 --
NM_015225chr972700 2645 2598 855 393 185 104 11154 23050 1185 --
NM_015231chr112129 76 ------
NM_015233chr131491 --1340 --
NM_015236chr431285 1246 90 ------
NM_015238chr5--193 ----
NM_015239chr91205 1219 ----
NM_015247chr1685193 5057 4698 4566 3957 3576 1157 196 ----2483 277
NM_015250chr941807 1790 601 347 ------
NM_015251chr1631475 413 146 ------
NM_015252chr22897 116 ------
NM_015262chr101135 --1153 --
NM_015265chr231968 883 326 --12658 --
NM_015267chr1212056 ----11748
NM_015270chr1231859 726 496 292 47 ----
NM_015271chr464085 2614 1663 1535 1483 39 23256 2836 1800 --
NM_015272chr162565 290 ----12012
NM_015275chr1221535 527 ------
NM_015277chr1841279 430 59 51 --11338 --
NM_015278chr643211 2739 2160 942 --23100 317 --
NM_015284chr121482 590 ------
NM_015285chr1832347 2203 345 12284 12300 --
NM_015288chr513865 1540 ----
NM_015291chr153387 2421 2145 771 731 13494 12774 --
NM_015294chr1731147 943 365 ------
NM_015296chr1321101 893 ----1479
NM_015299chr1442945 982 878 785 ------
NM_015305chr1431683 1597 722 --11585 --
NM_015308chr112880 764 ------
NM_015310chr8108325 7945 7758 6866 6490 5353 3080 2275 1671 115 16732 ----
NM_015313chr1164677 3679 1477 1100 308 187 ----11160
NM_015314chr741804 1658 1646 316 ------
NM_015315chr522788 461 --12207 --
NM_015320chr221006 157 ------
NM_015328chr712870 --12863 --
NM_015331chr11578 ------
NM_015332chr743198 2489 1247 78 --12578 --
NM_015335chr1232549 2171 2127 --1125 --
NM_015336chr1252526 2010 1835 1788 436 12429 --1336
NM_015338chr2031931 484 339 ------
NM_015339chr203897 102 88 ------
NM_015344chr832041 1912 549 --32032 1960 348 12135
NM_015347chr1282344 2288 2094 1909 1901 1152 688 256 --32248 851 342 --
NM_015349chr632604 925 638 ------
NM_015355chr1751738 493 332 221 107 --1728 --
NM_015358chr2121056 134 1204 ----
NM_015361chr24870 783 746 172 ------
NM_015365chrX32867 2607 1264 23822 3712 13805 --
NM_015374chr2241464 1442 1278 1227 11351 ----
NM_015375chr194915 4641 4361 3926 3782 3714 1979 1672 936 --13077 24339 3884
NM_015378chr13804 616 419 ----1255
NM_015379chr71208 ------
NM_015381chr221751 ------
NM_015382chr141492 ------
NM_015385chr1052829 2078 958 827 599 ------
NM_015387chr212114 --21932 50 126
NM_015393chr422328 764 189 --1879
NM_015396chr321368 473 ------
NM_015409chr1262715 1921 772 299 205 105 12743 1665 --
NM_015416chr122946 25 --192 --
NM_015424chr11162 ------
NM_015429chr321066 382 --11032 --
NM_015435chr831426 205 149 --21492 1168 --
NM_015443chr171617 11319 1280 --
NM_015446chr141658 1567 1175 433 ------
NM_015455chr5104039 3541 3175 3087 1160 969 650 622 496 346 23807 1094 13488 --
NM_015458chr845230 4908 4149 3374 --34941 907 880 --
NM_015460chr341464 805 185 81 --11783 --
NM_015464chr71224 ------
NM_015477chr153880 386 62 ------
NM_015483chr741128 1010 979 444 ------
NM_015497chr152797 134 ------
NM_015508chr32217 93 ----11323
NM_015520chr352526 2158 2104 2095 838 --12077 --
NM_015523chr111234 ------
NM_015525chr6124 1404 ----
NM_015530chr22840 398 --1265 --
NM_015534chr11988 ------
NM_015535chr252693 1627 1228 496 409 14064 1549 --
NM_015542chr1011124 ------
NM_015548chr62987 956 --2770 244 --
NM_015550chr752964 2529 542 387 125 --13306 --
NM_015554chr15102263 2180 2065 1870 1135 544 450 164 97 22 ------
NM_015555chr611278 --1358 --
NM_015557chr153631 2575 1116 452 329 1406 22224 1414 --
NM_015560chr31219 --12798 --
NM_015564chr543177 827 815 213 ------
NM_015565chr2132301 1696 50 ------
NM_015567chr1341135 929 820 32 --11156 --
NM_015568chr2043926 1561 1399 1332 14179 13527 --
NM_015571chr642630 1757 983 685 11722 ----
NM_015575chr233689 1233 991 --1541 --
NM_015576chr31496 --1825 11913
NM_015578chr191118 --11412 --
NM_015601chr101719 ------
NM_015607chr11145 ------
NM_015609chr112437 --3171 125 71 --
NM_015610chr742026 1864 1753 1140 --166 --
NM_015622chr7189 ------
NM_015626chr1711197 --1129 --
NM_015630chr231114 862 258 ------
NM_015640chr175172 4697 4207 2031 1054 300 259 --11699 --
NM_015641chr741239 1219 1056 52 ----1330
NM_015646chr1231269 1080 970 --1314 --
NM_015649chr19----1155 --
NM_015652chr10160 ------
NM_015675chr191563 ------
NM_015678chr1331430 678 570 11448 --11164
NM_015680chr2122 ------
NM_015686chrX32326 1984 812 --22486 2466 --
NM_015691chrX1522 --22926 1089 --
NM_015702chr2127 ------
NM_015711chr191749 --1771 --
NM_015714chr13366 299 239 --1244 --
NM_015718chr6126 ------
NM_015726chr141826 1737 618 599 ------
NM_015833chr2141971 1963 1669 744 ------
NM_015850chr842456 1680 1525 286 ------
NM_015855chr113686 608 280 ------
NM_015866chr131516 422 243 21423 1357 ----
NM_015878chr821484 697 --11794 --
NM_015879chr18188557 8427 8218 8003 6865 6673 6436 5867 1947 1519 1205 923 858 837 816 596 590 230 48611 7623 6628 6369 1143 22759 187
NM_015881chr1141327 973 513 151 ------
NM_015885chr112355 164 ------
NM_015886chr824334 1578 ------
NM_015889chr222872 331 ------
NM_015898chr191408 11883 --12078
NM_015902chr82761 736 ------
NM_015906chr133433 2984 757 ----1519
NM_015912chr821983 109 1829 ----
NM_015913chr1----1739 --
NM_015932chr13--190 158 --
NM_015938chr31276 ------
NM_015939chr204671 613 223 173 ------
NM_015948chr61100 ------
NM_015955chr21423 ------
NM_015975chrX51832 1182 1172 740 26 ------
NM_015980chr531320 620 89 ------
NM_015990chr41716 --31102 266 96 --
NM_015995chr1564846 3682 1997 757 720 323 --25095 2114 --
NM_016003chr742026 1864 1753 1140 --166 --
NM_016021chr632939 2891 1997 11151 42969 2038 491 57 --
NM_016025chr1621788 1381 ------
NM_016032chrX41095 871 522 251 ------
NM_016040chr142492 618 256 187 12790 22007 1875 --
NM_016061chr231658 1514 1141 ----11027
NM_016073chr15--1782 11097 --
NM_016075chr1312581 ------
NM_016076chr133185 2729 2052 --13121 --
NM_016078chr172884 340 ------
NM_016083chr693777 3539 2826 2809 2414 1520 1179 747 555 --13335 --
NM_016084chr172552 133 ------
NM_016090chr11----11073 --
NM_016096chr811338 ----11842
NM_016098chr6141 ------
NM_016103chr51361 ------
NM_016107chr5----1311 --
NM_016120chrX1748 ------
NM_016131chr262156 2115 1867 1509 257 238 1873 ----
NM_016133chr21249 ------
NM_016141chr31815 --1218 --
NM_016144chr5------157
NM_016151chr16--138 ----
NM_016152chr311198 ------
NM_016156chr1132287 1808 911 ------
NM_016162chr121905 ------
NM_016169chr1043283 2342 1226 412 ------
NM_016185chr172805 247 --1121 1303
NM_016190chr1127 ----1250
NM_016192chr21106 ------
NM_016195chr10193 ------
NM_016201chr321961 1466 --11547 11862
NM_016203chr71191 --1255 --
NM_016205chr441338 964 504 139 ------
NM_016206chr388476 6432 5491 2735 2625 1818 941 518 38461 3535 432 --16058
NM_016213chr15145 ------
NM_016217chr653559 2263 1176 458 221 --1808 --
NM_016220chr762339 2263 1669 1654 1583 209 11827 ----
NM_016221chr571485 1463 453 424 303 156 111 --1331 --
NM_016230chr6--1511 1405 --
NM_016231chr17----191 --
NM_016239chr17--1750 ----
NM_016248chr1363888 3439 3353 3078 974 292 11492 13813 1343
NM_016250chr142635 78 ------
NM_016258chr12767 689 ------
NM_016260chr286878 6870 5367 5089 5033 2525 693 63 --27508 5004 --
NM_016271chr182327 262 --12137 --
NM_016272chr2232186 2094 1726 12587 ----
NM_016275chr332782 2294 34 1951 --185
NM_016277chr671558 1521 1502 1439 554 478 45 1494 ----
NM_016279chr5269 39 ------
NM_016281chr1231101 1021 465 ------
NM_016284chr162359 187 ------
NM_016287chr131868 661 66 1428 ----
NM_016289chr222117 739 1319 ----
NM_016297chr273150 2655 2359 904 451 316 185 ------
NM_016315chr221631 1205 ------
NM_016322chr982190 2117 2031 1193 1044 1032 843 735 1294 1945 --
NM_016374chr141267 1206 151 29 ------
NM_016374chr141267 1206 151 29 ------
NM_016376chr1783876 3831 3777 3483 3056 1455 796 780 --1814 --
NM_016377chr621772 156 --11549 --
NM_016396chr1563014 2154 2120 691 523 95 ------
NM_016422chr1142741 1186 601 79 --23080 2081 12900
NM_016424chr172577 536 ------
NM_016436chr2072652 2467 2393 2385 2140 2090 588 --22607 1663 --
NM_016441chr22768 80 --1429 11705
NM_016447chr71184 ------
NM_016451chr11175 ------
NM_016453chr3--1588 --183
NM_016467chr21344 --176 --
NM_016472chr1421247 310 11091 1997 --
NM_016480chr5----1111 --
NM_016485chr62910 901 --1300 --
NM_016486chr11196 ------
NM_016507chr1731180 313 107 11955 ----
NM_016513chr633195 2933 2584 --23456 3451 --
NM_016520chr91320 ------
NM_016525chr91243 ------
NM_016530chr1553724 2602 1657 1343 691 ----14057
NM_016531chr453555 3371 3310 3049 3035 --13705 --
NM_016538chr17----3475 399 159 --
NM_016542chrX----11475 --
NM_016559chr331130 582 384 --11114 151
NM_016577chr353762 2875 2850 863 235 14330 11211 --
NM_016578chr11----1495 --
NM_016584chr121276 ------
NM_016587chr71174 ------
NM_016603chr552208 1880 262 121 67 --11822 --
NM_016604chr51189 --11165 --
NM_016605chr532284 1066 437 ------
NM_016620chr11483 ----11342
NM_016621chr1173958 3389 3340 3285 2962 1201 664 ------
NM_016623chr81520 --2250 245 --
NM_016626chr18--21710 1107 31525 1473 525 --
NM_016628chr103788 650 79 ------
NM_016644chr53349 178 112 ------
NM_016654chr1511331 1909 ----
NM_016656chrX1383 --1266 --
NM_016733chr2241534 1463 1171 45 ------
NM_016823chr171972 ------
NM_016830chr121516 ------
NM_016930chr4167 --1926 --
NM_016936chr16----3693 516 277 --
NM_016946chr153640 2624 1426 335 32 ----1412
NM_016950chr421484 442 ------
NM_016953chr255532 4777 4746 1720 360 24076 844 1118 --
NM_017409chr12----1572 --
NM_017410chr1221124 296 ----11226
NM_017420chr1453762 3007 2929 1360 182 21045 423 33675 3559 3044 --
NM_017423chr422077 463 ------
NM_017426chr42426 264 ------
NM_017447chr2152740 1311 1042 836 539 --11675 --
NM_017455chr151962 --1358 1738
NM_017456chr171490 --2507 75 --
NM_017483chr21228 11244 1922 --
NM_017490chr111250 ------
NM_017519chr631374 326 264 ------
NM_017522chr12244 48 11160 ----
NM_017545chr201466 ------
NM_017548chr361996 1908 1897 815 351 137 ------
NM_017558chr161453 ------
NM_017563chr376390 5937 5482 4268 2259 330 24 16253 ----
NM_017567chr21118 ------
NM_017569chr13147 184 ----
NM_017575chr1711611 ------
NM_017577chr3----1494 --
NM_017582chr111235 --11780 11203
NM_017590chr2252714 2504 1678 1012 887 --1509 --
NM_017593chr42134 74 ------
NM_017594chr942916 1101 672 113 ------
NM_017595chr1721214 454 --11713 --
NM_017602chrX3766 257 162 --1703 --
NM_017610chr1561895 1476 711 424 262 54 1104 ----
NM_017617chr931405 162 60 --21375 205 --
NM_017626chr10------170
NM_017628chr454281 2056 1842 1404 690 11888 ----
NM_017629chr141788 1278 627 154 --1228 1134
NM_017632chr41309 ------
NM_017633chr663297 2813 2752 1562 1555 1426 ------
NM_017634chr831805 1662 353 ------
NM_017635chr1121469 1157 --1524 --
NM_017637chr9129338 9134 8454 7935 3486 2437 1939 819 795 119 84 76 --23633 1806 --
NM_017640chr61247 ------
NM_017641chr122168 77 ------
NM_017643chr1722048 1241 --22443 274 --
NM_017644chr341927 1901 888 440 ------
NM_017650chr795893 4996 4299 4243 3910 2246 1046 170 151 --15158 --
NM_017657chr2------1380
NM_017658chr1484440 3087 1482 1246 1217 1019 279 254 --34017 93 45 --
NM_017661chr152468 426 ------
NM_017667chr72435 78 132 ----
NM_017668chr16156 ------
NM_017679chr17----1279 1624
NM_017680chr9----1343 --
NM_017694chr241596 1579 1472 107 --21761 1601 --
NM_017700chr42542 129 ------
NM_017709chr153411 3325 3282 1351 650 12712 11243 --
NM_017714chr201665 --1124 --
NM_017719chr332329 1818 315 ----1541
NM_017736chr162458 110 --1759 --
NM_017737chr112059 21762 786 ----
NM_017738chr92887 275 --169 --
NM_017739chr1134 ------
NM_017742chr1841803 1300 1214 495 --21915 1840 11256
NM_017752chrX22115 824 ------
NM_017753chr9------1254
NM_017754chr633610 282 76 --15029 --
NM_017761chr131465 470 179 --2433 134 --
NM_017762chr1522305 126 --22180 605 --
NM_017778chr831247 1102 1066 ------
NM_017780chr81192 --1676 --
NM_017786chr82607 126 ------
NM_017787chr1041878 1867 1857 145 1520 ----
NM_017798chr202165 155 ------
NM_017799chr142658 144 11914 1280 --
NM_017801chr3----145 --
NM_017811chr942593 2193 528 221 --126 --
NM_017824chr1052393 2355 935 209 78 ----1887
NM_017831chr1864635 3972 3018 1690 1285 147 11125 ----
NM_017848chrX54020 1869 1801 1214 690 --2724 661 --
NM_017849chr242963 1272 519 208 11054 ----
NM_017851chr151304 --1814 --
NM_017857chr11------1684
NM_017869chr161626 ------
NM_017893chr102982 547 ------
NM_017902chr1053594 2048 1056 255 103 ----11698
NM_017910chr21368 ------
NM_017913chr9190 1131 ----
NM_017915chr121143 1414 1985 --
NM_017921chr1732323 1957 1907 --21685 617 --
NM_017922chr142270 240 ------
NM_017925chr931366 322 156 --21827 1305 --
NM_017933chr251637 1609 1367 1028 34 ------
NM_017935chr42255 224 ------
NM_017938chrX42036 1485 761 267 12082 ----
NM_017944chr1162908 2790 2557 2235 692 194 1119 1210 --
NM_017952chr232948 2908 2865 14353 12917 13876
NM_017953chr12474 219 ----21166 61
NM_017954chr761686 1432 1291 1228 491 390 ------
NM_017955chr142928 54 141 1954 --
NM_017964chr2------176
NM_017969chr21170 ------
NM_017974chr231040 462 134 ------
NM_017987chr1031378 509 362 ------
NM_017988chr122867 699 1192 ----
NM_017994chr742884 2604 441 344 ------
NM_018010chr311470 ------
NM_018011chr13----1426 --
NM_018025chr19178 ------
NM_018030chr185906 880 839 214 132 ------
NM_018032chr161209 --2392 241 --
NM_018046chr521719 1383 11779 21459 602 --
NM_018048chr1222030 1618 ------
NM_018056chr11137 ------
NM_018061chr13497 227 118 --1172 1386
NM_018070chr1137 ------
NM_018078chr4----2840 796 --
NM_018084chr283078 2992 2075 1283 1052 935 854 487 12120 1264 11182
NM_018085chr1127167 6987 5381 5348 2633 2128 1837 1745 1416 1279 1069 80 25487 2315 27594 5044 --
NM_018086chr221865 110 --1685 --
NM_018089chr23220 214 168 ------
NM_018092chr1631087 607 252 ------
NM_018103chr1187 ------
NM_018105chr82911 375 ------
NM_018113chr122423 140 ------
NM_018115chr4--1315 ----
NM_018116chr12517 118 --1508 --
NM_018117chr101694 ------
NM_018120chr82458 134 21497 1095 ----
NM_018121chr1073051 2774 2657 2129 983 961 560 ----22573 2343
NM_018128chr1711018 ------
NM_018133chr321633 871 ------
NM_018151chr21614 ------
NM_018155chr373409 3380 3174 2556 2474 2192 761 --22226 22 --
NM_018156chr13804 616 419 ----1255
NM_018157chr1252697 2234 2049 1097 751 --12245 --
NM_018159chrX21486 186 --1646 --
NM_018171chr121244 --1296 --
NM_018176chr41171 1116 21550 1119 --
NM_018181chr1851777 1421 1264 562 95 --1305 --
NM_018182chr1731412 899 587 --11990 --
NM_018184chr342024 1976 1899 1410 --31525 618 139 --
NM_018191chr1322073 43 ------
NM_018192chr311047 ------
NM_018200chr1552364 1998 1989 753 732 --1544 11684
NM_018202chr12884 48 ------
NM_018208chr121186 151 ------
NM_018211chr141857 1831 424 393 ------
NM_018216chr11101 ------
NM_018237chr10----1226 --
NM_018240chr13571 246 80 ------
NM_018243chr452817 1447 1268 911 409 13230 13206 --
NM_018246chr812700 32116 1766 749 ----
NM_018247chr632341 2210 2167 ------
NM_018254chr122056 1639 ----1660
NM_018257chr2022433 1829 21009 513 ----
NM_018263chr242463 672 651 235 ------
NM_018266chr31942 ------
NM_018270chr202698 42 --1612 --
NM_018287chr1061044 1005 953 353 241 112 ------
NM_018293chr342888 2795 2754 1185 1627 12971 --
NM_018299chr853447 2623 2434 151 135 --22557 527 --
NM_018307chr17----1991 --
NM_018313chr321874 111 ------
NM_018314chr113754 710 651 ------
NM_018315chr41431 ------
NM_018325chr9----21578 1456 --
NM_018327chr2011770 --11530 11397
NM_018330chr1051675 1488 1276 1266 693 1177 ----
NM_018334chr71213 ------
NM_018351chr1264723 4659 3295 1518 1128 917 ------
NM_018361chr832977 1175 320 ------
NM_018362chr1151517 1300 527 520 315 1709 13066 --
NM_018364chr123760 3390 ------
NM_018368chr6153 ------
NM_018383chr21672 ------
NM_018387chr91389 ------
NM_018388chrX11087 ------
NM_018398chr31323 ------
NM_018403chr322993 670 --11279 1924
NM_018413chr121273 ------
NM_018416chr1222343 935 --12568 --
NM_018426chr6----1568 --
NM_018433chr21580 ------
NM_018440chr8108042 6385 5397 2696 2571 2261 2150 2120 369 333 18166 --12504
NM_018441chr2165 ------
NM_018445chr151224 ------
NM_018448chr12------149
NM_018457chr121444 --176 --
NM_018464chr101359 ------
NM_018465chr91221 ------
NM_018469chr1761460 1419 1114 1023 554 82 --31500 1310 74 --
NM_018471chr21435 ------
NM_018475chr4--1111 ----
NM_018477chr1421024 136 ------
NM_018482chr832555 1914 803 11831 ----
NM_018486chrX--1449 ----
NM_018488chr172583 69 ------
NM_018489chr121650 356 --1777 --
NM_018490chr1111871 --11537 --
NM_018557chr251492 662 364 338 212 ------
NM_018566chr124693 4260 11828 --15087
NM_018571chr2----1115 --
NM_018638chr1254904 4675 4392 4126 1397 25253 1134 24954 456 --
NM_018644chr1111575 1309 ----
NM_018650chr11675 --31545 1540 67 --
NM_018657chr33844 796 289 ------
NM_018671chr151231 ------
NM_018682chr73704 596 544 ------
NM_018683chr2021646 119 ------
NM_018685chr72822 84 1453 ----
NM_018689chr1522690 658 --1812 --
NM_018695chr541746 1534 818 693 --22286 1780 --
NM_018696chr18------1134
NM_018698chrX31206 644 164 11656 11842 --
NM_018700chr51457 --11285 --
NM_018703chr161114 ------
NM_018704chr11676 ------
NM_018710chr841115 924 439 160 ------
NM_018712chr1121532 1140 186 ----
NM_018715chr132086 861 117 12135 162 --
NM_018717chr442736 2460 2353 2111 --12384 1505
NM_018718chr722072 599 ------
NM_018719chr721035 340 ------
NM_018728chr152537 22 ------
NM_018834chr52824 106 ------
NM_018841chr133851 3719 2959 --13916 --
NM_018846chr71824 ------
NM_018847chr92450 164 --11686 --
NM_018890chr711031 1365 2542 340 --
NM_018912chr5--21660 600 ----
NM_018913chr5--21660 600 ----
NM_018914chr5--21660 600 ----
NM_018915chr5--21660 600 ----
NM_018916chr5--21660 600 ----
NM_018917chr5--21660 600 ----
NM_018918chr5--21660 600 ----
NM_018919chr5--21660 600 ----
NM_018920chr5--21660 600 ----
NM_018921chr5--21660 600 ----
NM_018922chr5--21660 600 ----
NM_018923chr5--21660 600 ----
NM_018924chr5--21660 600 ----
NM_018925chr5--21660 600 ----
NM_018926chr5--21660 600 ----
NM_018927chr5--21660 600 ----
NM_018928chr5--21660 600 ----
NM_018929chr5--21660 600 ----
NM_018945chr673018 1440 1127 910 873 543 330 ------
NM_018951chr731159 810 42 1405 ----
NM_018970chr742856 859 483 349 22100 666 ----
NM_018975chr161738 --191 --
NM_018976chr1232479 2271 1850 --12811 --
NM_018979chr1262586 2569 2551 861 533 103 ----1151
NM_018993chr2011431 --11327 --
NM_018999chr1064512 4352 4342 4290 3988 665 ------
NM_019001chr374168 4048 3273 1909 264 187 90 11771 14725 --
NM_019004chr752304 1678 934 764 194 ------
NM_019006chr151617 ------
NM_019022chr1843158 2986 2832 597 --12081 --
NM_019027chr431973 348 268 ------
NM_019034chr121360 132 ----
NM_019035chr461940 1559 1277 342 102 87 ------
NM_019041chr632628 2266 167 --22135 1913 --
NM_019042chr731116 378 64 ------
NM_019044chr234462 881 289 1384 13543 13294
NM_019045chrX2786 328 ------
NM_019046chr101773 --1211 --
NM_019049chr11112 ----1162
NM_019055chr111622 1519 ----
NM_019057chr51264 ------
NM_019058chr101213 --2651 190 --
NM_019059chr72518 154 ------
NM_019063chr242275 703 458 410 ----1311
NM_019071chr73272 198 95 ------
NM_019072chr554194 3598 2905 447 257 --1790 14310
NM_019074chr151262 1969 160 --
NM_019084chr1022597 730 --12434 --
NM_019091chr221165 102 ------
NM_019095chr20------1155
NM_019102chr71362 124 ----
NM_019102chr71362 124 ----
NM_019106chr2232555 2229 2167 ------
NM_019116chr1643211 3008 1084 160 --23710 429 12478
NM_019117chrX22655 1361 ------
NM_019555chr331409 157 58 --1580 11375
NM_019557chr11334 ------
NM_019558chr21360 ------
NM_019590chr101548 ------
NM_019593chr2053167 2802 2496 440 74 --1447 --
NM_019595chr2167 ----1493
NM_019596chr2131848 714 667 --12125 --
NM_019597chrX2749 207 ------
NM_019600chr152784 515 --1204 --
NM_019606chr72465 396 ------
NM_019610chr111691 ------
NM_019848chrX3161 69 62 ------
NM_019854chr121697 ------
NM_019859chr1021468 598 ------
NM_019885chr222923 2534 --11124 1677
NM_020066chr11289 ------
NM_020116chr421397 50 ------
NM_020122chr264940 3738 2349 2001 1963 932 ----15976
NM_020123chr1021552 977 ------
NM_020132chr2164270 4103 1865 1619 1368 1072 13137 13475 --
NM_020137chrX1351 ------
NM_020141chr111888 ------
NM_020144chr752099 2079 1686 1639 420 --2728 547 --
NM_020148chr1862982 2056 1159 1089 581 113 ----1214
NM_020156chr73600 64 41 ----147
NM_020163chr362300 2149 2062 2014 1445 835 11661 ----
NM_020168chr1511356 --1918 --
NM_020177chr543307 904 67 24 ------
NM_020178chr1731108 965 880 ------
NM_020180chr1811150 ------
NM_020182chr2033327 1196 618 ------
NM_020190chr11465 ------
NM_020193chr1131303 192 22 ------
NM_020194chr22610 589 --185 --
NM_020198chr1711098 ------
NM_020199chr531215 1160 173 ------
NM_020205chr163445 3248 3130 2275 802 205 12876 ----
NM_020210chr151976 ------
NM_020226chr41496 ------
NM_020228chr111438 --11614 --
NM_020245chr694998 4644 4632 4616 3919 1865 1596 993 369 33995 3803 152 14801 13902
NM_020310chr173955 906 185 ----12821
NM_020317chr12107 41 ------
NM_020319chr72932 682 --171 --
NM_020336chr2033365 2349 1485 23696 2610 1328 --
NM_020337chr442686 1172 1138 532 --1441 --
NM_020338chr1053286 3268 3060 1329 497 ------
NM_020340chr652281 878 638 167 73 ------
NM_020341chr2022044 96 ------
NM_020342chr292353 1921 1819 1734 965 554 534 161 106 11742 168 --
NM_020346chr112370 218 --11536 1519
NM_020357chr3----1547 --
NM_020381chr641874 1615 1315 106 ------
NM_020382chr121242 ------
NM_020390chr3114944 4634 4596 4396 4183 4140 3220 1524 1414 450 398 23594 639 13273 13784
NM_020403chr133567 304 259 --11672 --
NM_020405chr1764485 4005 3633 1435 1204 925 23991 364 13027 --
NM_020416chr422618 1757 1103 ----
NM_020423chr12236 207 ------
NM_020428chr1921139 1016 ------
NM_020432chr731638 718 220 2214 50 --1403
NM_020443chr165487 4588 2745 1290 1074 91 14269 17035 --
NM_020449chrX2487 180 ------
NM_020452chr1------12076
NM_020456chr1322273 1490 --135 --
NM_020463chr211450 --11211 --
NM_020466chr694804 3688 3453 3107 1729 1216 543 177 52 --23984 449 13248
NM_020473chrX51414 1270 776 625 196 --11862 11380
NM_020474chr1821871 1291 ------
NM_020478chr81820 ------
NM_020482chr61234 ------
NM_020532chr21262 --3923 382 145 1901
NM_020546chr553176 2101 1173 657 249 12183 1194 --
NM_020640chr342307 1524 792 694 --21863 491 --
NM_020647chr852194 2156 927 379 322 ------
NM_020648chr1822781 1928 --1754 --
NM_020651chr241293 1173 334 106 ------
NM_020655chr1611320 --21440 963 --
NM_020673chr2056725 5486 2441 2385 2377 25798 1419 ----
NM_020689chr20--11476 11700 --
NM_020692chr142995 390 --136 --
NM_020693chr11178 ------
NM_020699chr143856 2166 579 504 1685 45236 4024 1591 92 --
NM_020703chr11587 ------
NM_020711chr232112 937 245 ------
NM_020713chr2052948 2685 2097 2077 841 12757 ----
NM_020718chr16136497 6129 5824 4174 2482 1874 1862 1616 1262 1112 961 514 95 --1860 --
NM_020726chr52537 208 ------
NM_020728chr752855 2208 1239 986 812 12298 11075 --
NM_020732chr631374 326 264 ------
NM_020734chr1253364 2464 2063 1066 731 13074 ----
NM_020739chr1543889 3459 1583 525 ------
NM_020740chr172357 32 ------
NM_020750chr6----31410 984 85 --
NM_020752chr1052253 2001 1078 856 449 ------
NM_020755chr6------1172
NM_020760chr261988 1862 1848 1647 1605 1390 ------
NM_020765chr1175 --1102 --
NM_020766chrX54603 4091 4066 3935 455 ------
NM_020772chr17127826 7807 7779 7674 7119 7101 6825 5720 5638 5332 3038 1951 32071 687 258 11297 --
NM_020774chr1854934 4121 841 611 296 ------
NM_020779chr222333 941 ----12983
NM_020783chr1831782 1505 896 --22208 2147 --
NM_020792chr362464 2384 1868 468 453 69 --1683 --
NM_020794chr111389 1141 1227 --
NM_020796chr522747 2566 ------
NM_020800chr321392 229 --11406 --
NM_020801chr532260 2186 1617 1495 1892 --
NM_020805chr1851982 1783 468 441 84 --1351 --
NM_020809chr1132212 1614 1511 12262 ----
NM_020810chr1442891 2876 2595 108 ------
NM_020815chr41301 --127 --
NM_020818chr141100 ------
NM_020819chr621125 1097 ------
NM_020820chr2051543 1414 470 373 71 --11550 --
NM_020824chr101153 --1131 --
NM_020825chr1673365 3072 2738 2552 970 665 380 12962 ----
NM_020830chr263183 2363 1152 597 589 80 ------
NM_020841chr1263650 2699 2524 2500 1031 299 ------
NM_020843chr151133 ------
NM_020850chr1623288 3136 --13122 --
NM_020854chr183540 109 63 1966 1145 --
NM_020856chr192413 288 --21171 1129 --
NM_020858chr1532385 401 190 ------
NM_020860chr421187 457 --2937 737 --
NM_020861chr62426 170 --1906 --
NM_020868chr221497 255 ------
NM_020870chr41467 --1227 --
NM_020871chrX22533 2408 --1561 --
NM_020872chr331725 506 271 ------
NM_020888chr141608 447 189 24 ------
NM_020909chr234090 809 438 --41582 1439 1086 608 14144
NM_020917chr1933934 2789 1146 ----1583
NM_020918chr1083560 3431 3049 3029 2886 2831 2523 1433 11417 21003 985 --
NM_020921chr1473338 2978 2736 2709 2342 643 33 22548 781 12876 --
NM_020922chrX21852 1480 ------
NM_020925chr111195 ----1433
NM_020935chr223802 3742 12857 21618 32 --
NM_020940chr1032718 2255 1145 --32172 1126 802 --
NM_020948chr142912 2362 1143 1014 --22694 2450 --
NM_020960chr984763 3901 3757 3563 1621 834 162 26 --13526 --
NM_020962chr1542403 1827 579 264 22478 2019 ----
NM_020967chr202191 96 ------
NM_020975chr1011327 21390 785 ----
NM_020977chr421440 1432 154 ----
NM_020980chr1531139 694 343 ------
NM_020983chr1231859 726 496 292 47 ----
NM_020987chr101549 --11184 --
NM_021005chr153429 322 199 ------
NM_021007chr221870 1740 ------
NM_021012chr1753213 2933 2776 2475 2111 11257 ----
NM_021020chr8139 13067 ----
NM_021033chr1333380 3183 286 1436 ----
NM_021038chr353192 2451 1346 1162 295 --1932 --
NM_021044chr12--1160 ----
NM_021061chr823755 415 ------
NM_021064chr6--11784 ----
NM_021069chr43677 524 437 ------
NM_021072chr531705 584 552 ------
NM_021090chr2244647 1761 513 87 ----14204
NM_021097chr252927 2686 924 245 138 --12763 --
NM_021109chrX145 --127 --
NM_021109chrX145 --127 --
NM_021116chr7119066 8483 8285 7816 7241 6488 5643 844 775 288 136 25940 5924 ----
NM_021136chr143726 718 163 ------
NM_021137chr1712134 --1598 --
NM_021139chr41376 ------
NM_021140chrX3803 205 165 ------
NM_021149chr1611205 --11175 --
NM_021159chr411228 --1346 --
NM_021160chr62204 176 ------
NM_021168chr1631573 1548 1168 --2480 381 --
NM_021180chr12773 94 ------
NM_021183chrX21879 1736 1764 12419 --
NM_021189chr14960 859 241 165 ------
NM_021190chr131244 842 338 --21076 975 --
NM_021205chr152876 2400 991 802 413 ------
NM_021215chr2061746 873 828 742 585 324 ------
NM_021222chr121448 466 ------
NM_021224chr91146 ------
NM_021238chr1252052 2011 1613 1529 771 --11995 --
NM_021239chr142341 163 --1359 11186
NM_021240chr93491 474 170 ------
NM_021242chrX3364 280 240 ------
NM_021252chr1031841 1785 1534 22070 586 ----
NM_021255chr1421443 1000 ------
NM_021260chr141238 ------
NM_021614chr51256 ------
NM_021622chr1042271 1584 243 126 ------
NM_021627chr31150 1115 170 --
NM_021629chr354783 3426 1960 328 261 1525 11426 --
NM_021643chr22739 372 ------
NM_021648chr632640 1720 441 11040 21768 212 --
NM_021722chr71209 ------
NM_021728chr14175 1730 --1770
NM_021738chr105741 621 587 280 252 ------
NM_021785chrX1367 --151 --
NM_021807chr7----1484 11065
NM_021809chr2031891 770 529 --2572 165 12295
NM_021813chr6115722 5587 5196 4812 4704 4469 4440 3714 1243 758 70 --15872 1864
NM_021871chr4146 ------
NM_021872chr201439 11141 ----
NM_021873chr201439 11141 ----
NM_021907chr21251 ------
NM_021911chr574760 3670 3472 1903 1343 403 331 13596 ----
NM_021912chr15--12748 --13853
NM_021913chr1951710 1519 1449 702 48 ------
NM_021914chr141501 --1944 11833
NM_021940chr631067 455 401 --1240 21226 153
NM_021943chr61147 11604 188 --
NM_021945chr631432 653 475 ------
NM_021947chr1761144 955 483 447 381 348 1288 ----
NM_021949chrX22463 1021 --12099 --
NM_021950chr1122228 1443 ------
NM_021956chr611373 ------
NM_021961chr1187141 6591 6004 4988 4927 1500 788 658 --36944 6208 1008 16317
NM_021964chr3126546 5924 4020 2311 2070 1998 1293 751 560 394 221 155 14039 26385 4139 --
NM_021973chr42577 114 ------
NM_021976chr62671 302 ------
NM_021979chr141363 ------
NM_021988chr2011400 ------
NM_021994chr72436 176 ----1831
NM_021998chrX31531 1206 981 ------
NM_022006chr191371 ------
NM_022037chr22677 355 ------
NM_022041chr162449 329 ------
NM_022048chr1575880 5712 5414 4088 2317 2058 751 --11956 --
NM_022051chr1----1180 --
NM_022058chr221389 580 132 ----
NM_022060chr1411353 ------
NM_022062chr1111760 21954 23 11434 1360
NM_022079chr101719 ------
NM_022080chr2052629 2431 1896 670 374 ------
NM_022097chr163268 252 155 ------
NM_022098chr2261407 1006 566 306 105 93 ------
NM_022114chr184657 4628 4465 4055 3849 3582 1689 610 --34045 3698 557 --
NM_022118chr132186 68 ------
NM_022130chr521182 87 ------
NM_022137chr1471689 842 783 749 391 385 131 --1549 --
NM_022138chr661088 383 315 264 106 99 ------
NM_022143chr711322 --1518 --
NM_022166chr1646116 5482 2313 534 --24152 221 --
NM_022170chr721559 1082 ------
NM_022171chr341322 621 207 182 ----11499
NM_022173chr22677 355 ------
NM_022346chr42345 124 ------
NM_022374chr21199 ------
NM_022442chr2011400 ------
NM_022444chr731949 768 528 --1444 --
NM_022456chr12106366 6238 5379 5104 4971 4670 2970 2095 809 215 --11279 --
NM_022457chr1126 ------
NM_022459chr1375730 4690 4533 4350 4265 1809 1439 11990 36151 4639 1884 24914 49
NM_022465chr1252410 1933 664 591 183 156 23063 3058 --
NM_022469chr121066 382 1332 1317 --
NM_022470chr311246 --2482 381 1398
NM_022474chr1442768 2486 2066 935 --32788 1024 454 --
NM_022475chr41714 ------
NM_022476chr163296 182 29 ------
NM_022484chr721392 249 11096 ----
NM_022485chr3------1363
NM_022488chr31130 ------
NM_022491chr1233508 406 132 ----1630
NM_022497chr383107 2636 1207 1199 826 677 432 123 --33654 3286 3112 --
NM_022566chr15----1604 --
NM_022650chr51206 ------
NM_022652chr1221072 125 ------
NM_022658chr1231129 466 457 ----11175
NM_022716chr133169 2057 276 ------
NM_022719chr2263692 3376 2941 2861 1285 717 --43790 3216 3128 599 --
NM_022726chr611566 --11724 --
NM_022728chr72562 212 ------
NM_022733chr1--1483 1779 --
NM_022739chr172851 452 ------
NM_022751chr18189 ------
NM_022753chr152578 2451 2224 2082 1736 ------
NM_022763chr362562 2206 732 685 577 424 ------
NM_022771chr122872 307 ----1125
NM_022776chr3------21584 80
NM_022780chr251560 587 492 264 52 --11162 --
NM_022781chr942418 2274 589 250 1661 1132 --
NM_022782chr12141 --185 --
NM_022802chr101663 1189 11258 --
NM_022818chr161268 ------
NM_022823chr2132 --1439 --
NM_022824chr53723 562 388 ------
NM_022828chr531609 1486 1420 ----161
NM_022832chr491833 1022 923 828 619 613 408 382 50 ------
NM_022841chr1542586 1989 672 618 12515 --12140
NM_022843chr1331037 524 395 --11336 --
NM_022844chr162258 250 --1940 --
NM_022845chr1691855 1517 1496 803 744 528 403 185 165 ------
NM_022893chr253151 2603 2017 797 291 1585 ----
NM_022894chr221134 259 1479 21269 551 --
NM_022898chr1464481 4233 4096 3849 3707 1400 --14488 --
NM_022900chr711109 --1227 --
NM_022918chr1132191 1653 693 ------
NM_022965chr4----11430 --
NM_022970chr1031321 261 38 ------
NM_022977chrX52659 2568 2199 1857 1039 1901 ----
NM_023000chr1421650 392 ------
NM_023001chr1421650 392 ------
NM_023009chr11672 ------
NM_023012chr121756 ----1106
NM_023037chr13----11044 --
NM_023076chr1672468 2416 2165 774 721 313 161 --1482 --
NM_023079chr172193 81 ------
NM_023105chr842456 1680 1525 286 ------
NM_023106chr842456 1680 1525 286 ------
NM_023110chr842456 1680 1525 286 ------
NM_023111chr842456 1680 1525 286 ------
NM_023112chr1422760 48 ------
NM_023923chr163703 2486 1414 1102 948 534 --23757 539 --
NM_023925chr121249 ------
NM_023927chr511053 ------
NM_023929chr852106 1081 902 422 33 ------
NM_023940chr43955 292 237 1382 ----
NM_023948chr71154 ------
NM_024007chr552978 2556 2509 1989 577 ------
NM_024017chr171619 ------
NM_024019chr41162 ------
NM_024052chr1721997 992 12041 32223 610 595 --
NM_024054chr71341 ------
NM_024060chr112220 64 ------
NM_024061chr71607 ------
NM_024071chr141563 ------
NM_024085chr21289 --2992 912 --
NM_024089chr131163 ------
NM_024102chr131195 954 296 ------
NM_024107chr173734 671 593 ------
NM_024117chr941160 592 410 176 ------
NM_024295chr8161 1321 ----
NM_024324chr221149 ------
NM_024325chr2021240 1071 ------
NM_024344chr152501 418 ------
NM_024348chr91251 ------
NM_024429chr71191 --1255 --
NM_024491chr31620 ------
NM_024494chr12667 287 ------
NM_024501chr21494 ------
NM_024511chr432783 2716 828 ------
NM_024524chr323178 2661 ------
NM_024539chrX41190 1085 1074 971 ------
NM_024541chr1021730 1581 --1488 --
NM_024546chr1321289 896 --11229 11205
NM_024548chr331163 291 240 ------
NM_024551chr1222264 2014 ------
NM_024551chr1222264 2014 ------
NM_024554chr121204 185 ------
NM_024556chr111386 ------
NM_024561chr1321086 72 ----11072
NM_024569chr142806 2259 337 198 ------
NM_024574chr42112 106 ------
NM_024582chr4----2393 218 --
NM_024583chr24854 248 242 191 ------
NM_024595chr121220 914 ------
NM_024607chr864446 1696 1614 1195 583 234 ----13232
NM_024612chr171352 ----1365
NM_024613chr831351 507 303 ------
NM_024635chr9------1230
NM_024643chr141120 ------
NM_024646chr143627 2977 2475 142 ------
NM_024659chr21704 --1372 --
NM_024665chr394382 4250 4211 3505 3343 1331 1300 961 587 11812 24675 75 --
NM_024674chr162675 1288 698 667 440 101 --33151 778 85 --
NM_024692chr21292 --21565 1235 --
NM_024700chr131146 795 782 ------
NM_024704chr202909 741 ------
NM_024721chr872382 2080 1053 983 896 211 205 --1339 --
NM_024742chr1631388 519 59 1762 ----
NM_024749chr141988 1624 844 51 1627 ----
NM_024751chr43741 655 449 ------
NM_024755chr151745 --1763 --
NM_024759chr81768 ------
NM_024761chr963417 2147 1976 1235 1228 285 ------
NM_024769chr1131115 406 125 ------
NM_024770chr266439 5613 4618 4464 888 147 16687 25715 4936 --
NM_024786chr58912 791 770 749 705 682 661 617 1639 ----
NM_024824chr1441408 466 408 330 1480 1278 154
NM_024834chr101446 --1517 --
NM_024835chr171295 ------
NM_024841chr1132142 1848 124 --1953 --
NM_024850chr51219 ------
NM_024852chr1--135 ----
NM_024881chr1941288 986 920 352 13700 12592 --
NM_024887chr11300 1585 ----
NM_024893chr205848 805 790 206 179 ------
NM_024896chr962291 2254 1643 511 348 243 1840 2983 650 --
NM_024899chr181167 --1457 --
NM_024900chr441725 1700 1684 526 ------
NM_024900chr441725 1700 1684 526 ------
NM_024911chr1----1205 --
NM_024930chr5179 ------
NM_024946chr16----2591 448 --
NM_024947chr3118493 7714 6791 6501 3300 2852 2826 2507 2364 867 176 --19247 11149
NM_024949chr453724 3419 836 804 266 --34303 435 322 --
NM_024953chr1232616 2181 1838 124 11843 --
NM_024960chr203450 435 93 ------
NM_024969chr23875 169 47 ------
NM_024991chr1052829 2078 958 827 599 ------
NM_024993chr2--11464 ----
NM_025040chr1952036 1541 1522 975 741 --12471 --
NM_025054chr811132 ----13060
NM_025057chr1421259 199 ------
NM_025069chr81191 ------
NM_025073chr153921 3801 720 350 70 ------
NM_025076chr21197 1461 ----
NM_025126chr121525 ------
NM_025133chr21947 1310 1773 --
NM_025134chr1621827 200 --1503 --
NM_025137chr151109 --274 32 --
NM_025138chr132912 158 ------
NM_025146chr322457 28 ------
NM_025151chr822136 2025 ------
NM_025152chr142436 241 21358 35 ----
NM_025160chr164255 4172 3669 1555 623 418 ----12796
NM_025164chr1141977 1904 1348 866 --1486 --
NM_025180chr363270 3164 2434 2206 904 308 --43178 2583 676 175 --
NM_025184chrX2834 189 ------
NM_025191chr143374 646 516 240 --13458 --
NM_025195chr831537 1531 635 --11502 --
NM_025201chr1511312 --21531 1435 --
NM_025203chr231329 381 98 ----1343
NM_025208chr1152210 2102 705 608 214 ------
NM_025216chr21501 1559 ----
NM_025235chr1031616 421 249 --12227 1296
NM_025238chr151586 ----11530
NM_025244chr2180 ------
NM_025248chr1722482 723 11030 12383 --
NM_025250chr732860 797 58 --12903 12711
NM_030576chr1742229 1847 1663 641 --12302 --
NM_030583chr81810 1124 1391 --
NM_030594chr1541323 865 161 134 --11237 --
NM_030621chr1483953 3574 3386 2900 1644 1509 1388 749 --11454 13814
NM_030625chr1012582 ------
NM_030627chr583870 3646 3190 3077 1637 1584 795 45 --11220 --
NM_030629chr1631867 1472 661 ------
NM_030637chr141678 ------
NM_030640chr122663 173 ------
NM_030647chr784878 2341 1703 1025 874 718 568 146 15504 ----
NM_030648chr485587 3648 3537 2031 1962 800 697 54 ----1978
NM_030650chr284252 3947 3339 3282 3257 735 589 526 --13867 --
NM_030664chr1031631 449 316 --22400 1725 --
NM_030665chr1741419 560 476 110 ------
NM_030667chr1231206 865 449 ------
NM_030668chr1231206 865 449 ------
NM_030669chr1231206 865 449 ------
NM_030670chr1272238 1897 1580 1481 786 566 187 ------
NM_030671chr1272238 1897 1580 1481 786 566 187 ------
NM_030674chr1275658 5424 4084 4012 1482 881 541 11787 11840 15019
NM_030751chr1031346 505 357 --11295 11520
NM_030751chr1031346 505 357 --11295 11520
NM_030755chr1453053 2286 2067 995 321 ------
NM_030756chr10196 ------
NM_030759chr103661 536 141 --1177 --
NM_030761chr131869 947 802 ------
NM_030762chr1241571 1366 1269 682 ------
NM_030780chr841732 1505 1407 330 ------
NM_030791chr1421358 147 1725 ----
NM_030799chr532116 815 638 --12224 --
NM_030802chr171804 ------
NM_030803chr231040 462 134 ------
NM_030806chr1128752 8698 8540 8443 7933 7731 6587 6516 2937 2621 2488 1449 15758 13254 1849
NM_030808chr172906 240 ----1342
NM_030815chr202738 559 ------
NM_030881chr2252352 2171 1825 1804 577 ------
NM_030884chr332238 2205 1421 ------
NM_030885chr332339 803 470 ------
NM_030911chr13149 ------
NM_030917chr41187 ------
NM_030918chr124107 1130 14655 11173 --
NM_030922chr153755 342 274 ------
NM_030926chr2193 ------
NM_030937chr131289 1107 426 ------
NM_030938chr1711021 ----1153
NM_030939chr62472 123 --1239 --
NM_030949chr621100 57 ------
NM_030962chr1151484 1231 1109 220 204 ------
NM_030963chr62615 92 ------
NM_030964chr522584 689 ----13730
NM_031203chr19------1173
NM_031205chr121167 --1104 --
NM_031216chr181183 ------
NM_031243chr722384 1613 ------
NM_031262chr9196 ------
NM_031263chr91153 ------
NM_031266chr51422 ------
NM_031267chr71511 1416 ----
NM_031268chr1643916 3713 1346 790 13734 ----
NM_031296chr452671 1968 1762 930 523 ------
NM_031305chr431814 380 356 --11522 --
NM_031314chr1431515 1319 762 ------
NM_031362chr282777 2409 2367 2057 1842 797 402 205 ------
NM_031365chr282913 2545 2503 2193 1978 933 538 341 ------
NM_031366chr282913 2545 2503 2193 1978 933 538 341 ------
NM_031371chr141267 1206 151 29 ------
NM_031371chr141267 1206 151 29 ------
NM_031407chrX1408 ----1343
NM_031412chr1211126 --1487 --
NM_031418chr1131963 1065 740 --1682 --
NM_031424chr201157 --1536 --
NM_031427chr14105383 5312 5075 4378 4139 3876 2035 1921 1768 261 ------
NM_031435chr1253411 2894 1154 448 358 ------
NM_031438chr521691 1312 1450 --1784
NM_031442chrX22904 1109 --23015 2200 1385
NM_031445chr222512 1359 ----1705
NM_031453chr101325 ------
NM_031457chr112368 125 ------
NM_031461chr842114 1545 547 380 --1726 --
NM_031468chr797710 6681 6341 6060 5605 4982 2572 1432 166 --15255 --
NM_031469chr693441 2944 2882 1268 1177 765 456 272 32 13464 --14058
NM_031483chr2053417 2953 2626 1386 1140 13055 ----
NM_031844chr163255 1304 734 674 452 213 --23770 466 --
NM_031845chr231477 662 289 13344 --13047
NM_031847chr231477 662 289 13344 --13047
NM_031866chr101332 1193 ----
NM_031886chr1942113 1700 915 459 --1387 11678
NM_031890chr2252749 2625 2185 861 203 --12412 1817
NM_031892chrX1970 ------
NM_031935chr11969 ------
NM_031992chr721559 1082 ------
NM_032021chr1121100 938 ------
NM_032042chr552816 879 323 233 152 1670 1869 --
NM_032047chr3--12120 ----
NM_032088chr5--21660 600 ----
NM_032092chr5--21660 600 ----
NM_032102chr1152959 2494 2260 1091 748 ----13021
NM_032120chr71108 ------
NM_032121chrX42757 2402 1728 35 ------
NM_032124chr1851068 956 831 416 134 11125 ----
NM_032138chr131435 ------
NM_032142chr181189 ----1230
NM_032144chr21153 1426 ----
NM_032145chr62441 156 ------
NM_032146chr31117 ------
NM_032153chr332757 1807 717 1163 --1680
NM_032154chr101944 ------
NM_032156chr121249 ------
NM_032160chr1824296 28 11593 ----
NM_032174chr1------11490
NM_032177chr51410 ----188
NM_032182chr1031051 375 31 ------
NM_032186chr11483 ----11342
NM_032189chr1364840 1223 1160 906 202 121 14317 13667 24307 1895
NM_032193chr112788 584 11413 1733 11386
NM_032199chr1063868 3794 3722 3220 2910 990 11178 12736 --
NM_032217chr431199 993 304 ------
NM_032226chr94832 815 775 71 ------
NM_032228chr1132830 2387 962 --11369 --
NM_032229chr131444 ------
NM_032231chr151320 ------
NM_032233chr143759 670 330 ------
NM_032236chr11705 ----1182
NM_032242chr352068 1272 1189 1047 243 ------
NM_032246chr1531153 322 233 ------
NM_032268chr1663045 2950 2772 2153 1017 280 ----1130
NM_032272chr82125 108 ----1451
NM_032281chr1933166 2597 2085 ----11273
NM_032288chr322303 1974 11620 21470 821 --
NM_032289chr541907 1899 1684 1311 ------
NM_032291chr141626 385 248 103 ------
NM_032299chr11191 1175 ----
NM_032312chr21254 ------
NM_032320chr11153 --170 --
NM_032321chr221156 157 --12740 1682
NM_032329chr252778 2732 870 512 130 14073 ----
NM_032352chr1431209 1132 424 ------
NM_032373chr1085299 4788 4135 2199 1992 878 154 39 --15846 --
NM_032382chr161463 ------
NM_032403chr5--21660 600 ----
NM_032408chr711284 11075 ----
NM_032424chr1131468 1380 1020 ------
NM_032431chr1111098 ------
NM_032433chr1931341 1256 557 ------
NM_032437chr12148 122 ------
NM_032438chr661646 1506 1328 1284 1222 194 ------
NM_032439chr102360 52 11492 ----
NM_032440chr1022876 154 --11861 1125
NM_032445chr1522410 418 ------
NM_032446chr5----11091 --
NM_032457chr433113 1307 1264 13317 22453 1168 --
NM_032458chrX23308 3155 13239 ----
NM_032482chr1962736 2683 2098 738 602 483 --1182 --
NM_032491chr1211024 1819 1470 --
NM_032499chr1541451 537 463 445 --170 --
NM_032505chr362776 2708 2446 2342 941 307 --21864 496 1512
NM_032509chr832471 873 586 ----1110
NM_032511chr61443 ------
NM_032521chr2033039 2386 1164 ------
NM_032523chr21156 ------
NM_032532chr61655 ------
NM_032539chrX1286 ------
NM_032547chr42361 285 ------
NM_032557chr41776 --125 --
NM_032558chr91990 ----11375
NM_032576chrY------124
NM_032580chr171233 ------
NM_032582chr17------11866
NM_032595chr171500 ----1626
NM_032603chr21119 --1685 --
NM_032632chr1451981 1560 1462 370 218 --2498 314 --
NM_032646chr1711807 ------
NM_032682chr352776 1456 864 452 223 21310 1112 1233 --
NM_032711chr1744236 3178 633 584 13948 --1606
NM_032727chr10148 --11387 --
NM_032765chr52995 800 ------
NM_032772chr101366 ------
NM_032781chr113630 161 33 ------
NM_032784chr61228 ------
NM_032801chr1122513 88 1702 ----
NM_032802chr151239 ------
NM_032806chr3----1360 --
NM_032812chr10130 ------
NM_032815chr1642502 2494 1797 637 --12449 --
NM_032829chr1231163 1088 1050 ------
NM_032837chr1742166 2127 174 41 11831 --1477
NM_032844chr101250 ------
NM_032859chr1333451 505 419 --126 13978
NM_032867chr112593 124 ------
NM_032870chr61400 --1539 --
NM_032873chr1143699 1236 834 608 1393 44219 3759 2978 1117 --
NM_032875chr171796 ------
NM_032883chr202689 42 ------
NM_032885chr191260 --1272 --
NM_032900chr102376 106 --33890 2746 2666 --
NM_032905chr101316 1999 1889 --
NM_032906chr43795 745 203 ------
NM_032918chr1221257 84 ------
NM_032932chr17105815 5714 5513 4451 1864 1536 687 331 255 222 14932 76443 6097 5859 5771 1934 1610 1103 --
NM_032949chr131145 ------
NM_032961chr42898 358 1889 ----
NM_032971chrY2942 848 ------
NM_032972chrY2942 848 ------
NM_032975chr1853255 3072 2839 1239 1108 23155 2582 ----
NM_032980chr1853255 3072 2839 1239 1108 23155 2582 ----
NM_032991chr431032 492 67 ------
NM_032998chr12965 340 ----1955
NM_033016chr2231505 1027 371 --1998 --
NM_033020chr133433 2984 757 ----1519
NM_033055chr1194 ------
NM_033132chr1322152 441 --21804 558 --
NM_033133chr1733702 2781 2641 ------
NM_033135chr1152210 2102 705 608 214 ------
NM_033136chr531700 1417 275 21751 1398 ----
NM_033137chr531700 1417 275 21751 1398 ----
NM_033138chr731940 414 197 21866 612 1537 --
NM_033139chr731940 414 197 21866 612 1537 --
NM_033140chr731940 414 197 21866 612 1537 --
NM_033143chr453764 1846 1825 913 522 --14026 1780
NM_033147chr21251 ------
NM_033148chr21251 ------
NM_033150chr12------189
NM_033157chr731940 414 197 21866 612 1537 --
NM_033181chr693777 3539 2826 2809 2414 1520 1179 747 555 --13335 --
NM_033207chr1042430 2308 66 35 ------
NM_033211chr5170 ----1525
NM_033222chr931277 1011 173 ------
NM_033224chr778020 7705 5319 4882 3106 2140 387 15630 27457 2129 --
NM_033227chr51567 ------
NM_033228chr51607 ------
NM_033254chr31125 ------
NM_033272chr21124 ------
NM_033285chr874454 4447 4395 3723 3229 3113 2898 --33413 2850 2845 --
NM_033290chrX43107 2689 2415 1391 12978 ----
NM_033300chr12244 48 11160 ----
NM_033326chr1132407 1757 83 12155 12382 --
NM_033331chr953329 3285 3024 2962 2842 ------
NM_033337chr31786 --1290 --
NM_033360chr1244629 4318 1302 135 --11207 24498 4018
NM_033387chr942635 2616 2135 435 ------
NM_033389chr1734193 1394 77 11844 ----
NM_033394chr221616 1482 ----11078
NM_033425chr1142910 2479 2431 428 1950 1707 --
NM_033426chr1432576 2235 2091 ------
NM_033427chr71636 --1311 --
NM_033430chr423116 257 1888 1278 1306
NM_033437chr423116 257 1888 1278 1306
NM_033449chr5----21984 1375 --
NM_033503chr1513627 1912 ----
NM_033505chr286559 6543 5257 4333 2344 2078 1324 30 14722 12227 --
NM_033512chr832880 2606 96 --12896 --
NM_033535chr431103 1087 59 ------
NM_033540chr32426 100 ------
NM_033551chr522788 461 --12207 --
NM_033624chr1252114 1859 400 356 227 ------
NM_033632chr41431 ------
NM_033637chr1063950 3307 3139 1164 1087 1048 14042 11370 13628
NM_033642chrX21125 495 ------
NM_033644chr522278 374 --12403 11721
NM_033645chr522278 374 --12403 11721
NM_033656chr2175142 4982 3922 2108 757 546 165 ------
NM_033666chr102792 109 1894 ----
NM_052828chr61503 --11539 --
NM_052832chr832993 2964 1996 12262 --1249
NM_052834chr1832347 2203 345 12284 12300 --
NM_052845chr1253255 2837 2745 832 255 ------
NM_052869chr1711807 ------
NM_052880chr2221461 979 1439 11160 --
NM_052896chr122544 759 --22615 963 --
NM_052897chr121839 ------
NM_052898chr811424 1628 ----
NM_052900chr831470 501 209 ------
NM_052904chr631022 385 300 ------
NM_052905chr231604 664 587 ------
NM_052911chr181372 ----1880
NM_052918chr1053706 3686 2909 1372 740 13318 ----
NM_052923chr6--156 ----
NM_052927chr521578 92 ------
NM_052937chr842117 950 391 272 ------
NM_052950chr1321994 1932 --1260 --
NM_052958chr8------1735
NM_052971chr52327 77 ------
NM_052978chr14174 --11769 --
NM_053001chr81345 ------
NM_053002chr32476 69 ----142
NM_053016chr9137986 7901 7882 6486 5904 5250 1783 1500 1255 1020 576 344 39 25642 5473 26229 5401 --
NM_053023chr1163073 2987 2890 2411 2305 807 ------
NM_053024chr351518 1471 1233 229 220 ------
NM_053043chr725050 409 22327 2095 26341 4591 --
NM_053044chr4----1921 --
NM_053056chr1183084 2623 2088 1216 1112 1049 559 334 --11964 --
NM_053064chr1452935 2677 2357 1991 1872 1450 --1348
NM_053067chr92225 130 ------
NM_053279chr812581 --11863 --
NM_053281chrX1409 ------
NM_054025chr1111575 1309 ----
NM_054027chr541714 1485 911 23 11822 ----
NM_057161chr61511 ------
NM_057175chr431749 747 407 --32303 793 78 --
NM_058172chr441705 1382 704 87 ------
NM_058175chr212551 140 ------
NM_058191chr213781 561 52 ------
NM_058237chr143807 717 318 ------
NM_058240chr14----190 11540
NM_058241chr21834 1723 ----
NM_058241chr21834 1723 ----
NM_078467chr621308 1152 11293 11456 --
NM_078629chrX3563 504 426 ------
NM_078630chrX3563 504 426 ------
NM_079420chr2125 ------
NM_079422chr2125 ------
NM_079837chr161626 ------
NM_080390chrX----1152 --
NM_080422chr18----1287 --
NM_080423chr18----1287 -