TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-148a-5p
miRNA Sequence: AAAGUUCUGAGACACUCCGACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX52950 2776 2544 2245 202 --13245 --
NM_000063chr61277 ------
NM_000067chr81701 ------
NM_000074chrX3925 155 124 ----1214
NM_000081chr111655 --31597 642 487 1356
NM_000084chrX126569 6270 5947 5481 4865 4776 2775 2643 1932 1225 1021 792 1645 34969 780 717 15966
NM_000089chr71217 --1536 --
NM_000090chr21723 ------
NM_000091chr282694 2592 2018 1934 565 536 487 22 ----1943
NM_000092chr284398 4150 4112 1424 1218 1079 862 252 --23864 3612 --
NM_000097chr3--1829 ----
NM_000104chr262707 2478 2198 1032 708 195 --1782 12735
NM_000108chr74636 339 103 45 1303 2361 95 --
NM_000109chrX31696 735 637 --12362 11001
NM_000112chr575197 3616 1623 1487 1187 1082 717 15244 21642 172 24731 4672
NM_000125chr664300 4075 3892 3833 3616 845 13232 --1424
NM_000138chr1552326 2114 1738 1631 56 --12406 --
NM_000153chr1441125 1092 1079 179 ------
NM_000161chr1441598 366 296 109 --11895 --
NM_000163chr572117 2032 2016 794 227 46 24 ------
NM_000165chr631270 1139 549 --21325 1183 1247
NM_000167chrX31265 312 36 --11340 --
NM_000176chr583091 2911 2564 1510 1320 1242 806 339 --12448 --
NM_000188chr101692 ------
NM_000196chr161452 ------
NM_000208chr1964226 3704 1475 978 482 371 14315 21719 461 --
NM_000214chr2041723 1654 1115 701 11550 1582 1555
NM_000216chrX113894 3420 3307 3280 2859 2566 661 322 305 93 53 32828 1104 550 1141 --
NM_000217chr1274460 4219 3905 1990 1943 1547 805 ------
NM_000240chrX72165 2052 1886 1748 1472 794 778 ------
NM_000242chr1041989 1004 951 778 11078 12052 --
NM_000245chr792154 2031 2005 1960 1850 1420 417 274 154 --31693 1395 118 --
NM_000248chr322599 1136 12825 1158 --
NM_000255chr61337 ------
NM_000259chr1576297 5759 5413 5061 4898 1551 1032 --14919 --
NM_000264chr983208 2727 2494 2171 1325 977 83 69 --32429 2211 2139 12698
NM_000266chrX1181 --1657 1369
NM_000267chr1772618 1394 1294 1252 1185 499 365 --12364 --
NM_000289chr12----1280 --
NM_000291chrX1214 ------
NM_000297chr441933 1879 739 532 1444 ----
NM_000314chr1052959 2468 1260 1214 338 --22458 382 --
NM_000321chr1331657 1636 1414 --11649 1709
NM_000332chr6167037 6971 6788 6451 6117 5634 5417 5336 5051 4718 4522 2343 2312 2220 1512 1278 --76878 6858 6741 6090 4784 2416 1768 14801
NM_000337chr586358 5646 4968 4398 1177 945 657 552 14943 16490 --
NM_000362chr22123563 2661 2381 2231 1352 1062 879 604 444 234 168 47 --23360 718 --
NM_000389chr61175 ------
NM_000390chrX53103 1198 1113 405 73 --42806 2630 2580 932 --
NM_000393chr2--21880 664 3855 617 64 --
NM_000408chr223393 3201 11248 ----
NM_000421chr171331 ------
NM_000426chr61161 ------
NM_000430chr1753092 2695 2686 1480 551 1133 22610 1428 1831
NM_000436chr521514 1030 ------
NM_000439chr562553 1954 1777 1656 842 191 --22341 1902 --
NM_000448chr1153050 2472 2283 2174 1068 22685 720 2855 509 --
NM_000452chr1382037 2002 1815 1502 800 777 635 117 11300 21922 348 --
NM_000461chr333434 1733 1171 13556 23951 3141 --
NM_000462chr1551601 1422 1160 497 401 --1671 --
NM_000465chr2134 ------
NM_000484chr212767 163 ----1259
NM_000489chrX52509 789 682 580 81 1883 --12842
NM_000495chrX4978 914 378 266 1232 1723 --
NM_000503chr841618 1218 642 414 --21853 728 195
NM_000507chr9129 ------
NM_000529chr1852340 1828 1580 672 546 --12221 12419
NM_000533chrX31921 1267 296 --11652 --
NM_000555chrX97794 6815 6658 5322 2952 1639 1369 766 647 --37699 7406 894 --
NM_000572chr13928 803 175 ----1947
NM_000601chr7--175 ----
NM_000602chr731546 386 367 --21175 77 --
NM_000610chr1162694 2632 2501 2282 960 765 --22252 232 --
NM_000618chr1286254 5947 5244 4765 4444 1162 1075 524 --25210 2226 24344 4044
NM_000618chr1286254 5947 5244 4765 4444 1162 1075 524 --25210 2226 24344 4044
NM_000619chr12129 --1421 --
NM_000633chr18104099 3609 3332 2048 2007 1606 1108 1020 876 633 23672 3639 24839 4036 --
NM_000684chr1011207 ------
NM_000686chrX31393 995 59 ------
NM_000693chr1521503 1127 ----1697
NM_000719chr12116725 6259 5527 5288 5085 4996 4762 2612 2299 2159 687 --36616 5829 454 --
NM_000721chr182638 2474 2405 2078 2008 689 430 60 ------
NM_000724chr101370 ------
NM_000726chr221132 382 --11311 --
NM_000783chr102517 158 ------
NM_000788chr421489 1343 ------
NM_000792chr111068 ------
NM_000793chr1494446 4125 3628 1825 1443 1437 1419 297 64 14458 23827 3646 123
NM_000813chr585539 5472 4662 1954 1718 1708 973 29 15554 171 --
NM_000814chr1553780 2758 1626 1393 145 --13361 --
NM_000817chr22921 308 --11261 --
NM_000818chr10184 ------
NM_000824chr4189 --181 --
NM_000826chr422516 276 --193 --
NM_000831chr1114783 4756 4462 3806 1977 1601 1269 802 607 559 105 24235 1163 36112 1671 1146 --
NM_000838chr632244 1780 1051 ----12088
NM_000859chr551597 1370 1213 479 50 --1464 --
NM_000864chr151102 1089 201 172 133 --1727 --
NM_000868chrX32013 1685 1608 12428 --1976
NM_000875chr1585641 5290 4501 4296 1985 790 604 121 12513 36361 5033 1143 16929
NM_000876chr621271 887 ------
NM_000885chr292144 1922 1746 1688 1339 469 184 100 89 1643 ----
NM_000891chr1742579 571 469 275 21198 751 13006 --
NM_000899chr12104134 2965 2810 2790 1239 891 536 263 254 240 24366 906 54414 1568 1284 281 225 --
NM_000901chr442545 833 512 371 12052 123 --
NM_000909chr4--1250 ----
NM_000910chr441567 707 612 45 --21495 1414 --
NM_000912chr863356 2807 1155 527 454 392 ----1106
NM_000926chr11128147 7930 7221 7087 6946 6871 6386 5935 5886 3033 718 26 49442 7890 6423 6301 35861 1747 1051 2894 227
NM_000935chr32915 285 ------
NM_000950chrX23327 2659 --3928 409 54 --
NM_000956chr1411075 ------
NM_000959chr183882 3787 3445 2841 2608 793 619 505 1260 33155 2666 1220 11443
NM_000961chr2083702 3659 3531 1439 1017 887 780 311 --1591 --
NM_000963chr132414 1579 267 --1851 --
NM_001001132chr2121079 148 ------
NM_001001323chr1242999 2534 2019 392 --1586 11141
NM_001001330chr10--2859 138 ----
NM_001001331chr352729 2697 2134 1925 420 --21700 584 1544
NM_001001389chr1162694 2632 2501 2282 960 765 --22252 232 --
NM_001001390chr1162694 2632 2501 2282 960 765 --22252 232 --
NM_001001391chr1162694 2632 2501 2282 960 765 --22252 232 --
NM_001001392chr1162740 2678 2547 2328 1006 811 --22298 278 --
NM_001001395chr1252632 2325 972 472 77 --12001 --
NM_001001396chr164078 3553 3363 1187 363 287 11483 ----
NM_001001419chr594853 4185 4154 4115 3438 3253 2018 816 39 33808 913 83 45201 4639 3757 1773 --
NM_001001420chr594853 4185 4154 4115 3438 3253 2018 816 39 33808 913 83 45201 4639 3757 1773 --
NM_001001433chr2011116 1949 11182 2532 214
NM_001001481chr853479 3388 2663 574 78 22409 438 12903 12961
NM_001001556chr1531269 578 326 11551 31513 1340 57 --
NM_001001664chr294025 3805 3355 3302 3016 1341 768 678 389 ----13283
NM_001001668chr1984280 4265 4108 3744 3252 1599 881 431 --23456 1305 --
NM_001001701chr452305 2252 1638 161 88 1881 1104 1927
NM_001001711chr112993 346 ----169
NM_001001890chr2174030 3784 3420 1071 662 584 425 11314 13601 --
NM_001001933chr11455 ------
NM_001001974chr1042088 1711 1543 636 ------
NM_001001995chrX21685 262 ------
NM_001002233chr841666 757 733 716 --169 --
NM_001002243chr2--1703 1612 --
NM_001002814chr8123874 3866 3836 3656 3075 2959 2679 1213 1203 757 733 716 --23197 69 13707
NM_001002838chrX21623 42 --11385 --
NM_001002860chr1483697 3612 3327 2862 1528 1212 368 290 23444 2888 11171 --
NM_001002909chr1732260 1775 124 ------
NM_001002926chr742528 2217 2002 661 --1311 11721
NM_001003407chr10104907 4827 4220 4170 3709 1923 539 348 246 34 11659 192 11619
NM_001003408chr10104907 4827 4220 4170 3709 1923 539 348 246 34 11659 192 11619
NM_001003652chr18138374 7398 7225 7196 7119 6955 6551 6078 3105 2877 1779 995 849 17523 35809 2470 1288 --
NM_001003674chr18126791 6495 6434 6083 4751 2685 2368 2049 2007 1461 617 462 --35107 4301 1231 --
NM_001003675chr18126791 6495 6434 6083 4751 2685 2368 2049 2007 1461 617 462 --35107 4301 1231 --
NM_001003679chr142175 889 599 122 ----1164
NM_001003688chr431006 759 83 1947 1264 --
NM_001003690chr6--1380 1342 --
NM_001003694chr3------1470
NM_001003712chr1222829 176 --24021 3740 1647
NM_001003800chr963339 3179 3032 2781 669 257 --52566 2521 1158 568 168 --
NM_001003895chrY1123 ------
NM_001004023chr11154 ------
NM_001004196chr32456 48 1271 1221 1491
NM_001004317chr6102872 1753 1235 1101 984 576 525 380 128 120 ------
NM_001004330chr121201 --1129 --
NM_001004342chr156038 4231 4129 1934 1293 --24329 937 --
NM_001004419chr1274006 3062 1617 631 437 424 119 1881 21529 1369 1152
NM_001005242chr12----11618 11538
NM_001005353chr111263 ------
NM_001005353chr111263 ------
NM_001005375chrY51522 1224 593 520 175 --1564 --
NM_001005386chr252273 651 549 523 386 --11984 1884
NM_001005463chr1082645 2398 2345 2175 1706 952 223 48 12156 1728 --
NM_001005473chr5126580 6434 6426 6278 5923 5058 2619 2244 1315 683 481 289 22504 1737 24957 4365 12259
NM_001005474chr31238 11465 31155 500 295 --
NM_001005502chr1255248 1791 1151 1048 803 15211 1915 25143 3324
NM_001005527chr331147 901 395 --1349 --
NM_001005609chrX93627 3439 3173 3074 2828 2684 2519 821 56 --1935 --
NM_001005733chr213549 243 171 ------
NM_001005746chr221132 382 --11311 --
NM_001005747chr221132 382 --11311 --
NM_001005845chr871600 1498 1304 1257 753 425 23 1590 11279 --
NM_001005849chr17130 --1423 --
NM_001006600chr551571 607 371 145 100 --22442 2429 --
NM_001006623chr282061 1899 1647 799 780 685 257 223 --22522 911 --
NM_001006684chrX1469 --1557 --
NM_001006944chr11----1169 --
NM_001006945chr12612 264 ------
NM_001007023chr1494446 4125 3628 1825 1443 1437 1419 297 64 14458 23827 3646 123
NM_001007033chr122668 32 1105 ----
NM_001007097chr9104480 4467 4440 4413 3948 3754 3582 1192 965 586 --24072 1373 13918
NM_001007099chr11299 --1572 178
NM_001007100chr11299 --1572 178
NM_001007102chr631363 465 180 --31628 1462 326 --
NM_001007237chr1112801 2556 2434 2425 2135 1017 655 641 550 438 399 ------
NM_001007246chr2141646 1508 1335 145 1226 11528 --
NM_001007257chr131229 1071 1011 1349 --11505
NM_001007466chr644433 1993 1974 1659 --13628 --
NM_001007527chr51133 --2256 82 --
NM_001007559chr1831526 768 275 1348 ----
NM_001007794chr12496 172 ------
NM_001008225chr71296 --1723 --
NM_001008239chr1863638 3606 1434 1169 1136 243 --1206 --
NM_001008388chr41197 ------
NM_001008391chr111669 ----2663 229
NM_001008392chr363386 3087 2487 1435 987 183 ------
NM_001008408chr7125690 5125 4607 4596 3953 2164 1488 1310 1130 895 239 49 --15318 --
NM_001008539chr855230 3707 3386 1917 720 1799 45335 4677 3341 1976 --
NM_001008564chr1362043 1650 1573 1469 140 134 1185 ----
NM_001008660chr1151510 1145 392 364 210 ------
NM_001008661chr11348 1108 ----
NM_001008662chr11348 1108 ----
NM_001008708chr21486 ------
NM_001008723chr103482 130 92 ----1447
NM_001008801chr193668 584 315 ------
NM_001008895chr1311132 ------
NM_001008925chr463142 3021 2917 2815 676 542 --42959 639 207 164 --
NM_001009554chr454501 4269 1105 213 171 13551 --14348
NM_001009554chr454501 4269 1105 213 171 13551 --14348
NM_001009555chr431802 1476 36 --21221 132 --
NM_001009566chr111043 ------
NM_001009881chr1----1439 --
NM_001009882chr1----1439 --
NM_001009894chr1271605 1457 1128 690 632 543 129 21255 485 21633 1283 --
NM_001009899chr365632 4661 4105 1111 1092 613 15795 45478 5188 2540 1304 --
NM_001009909chr1153677 1543 1536 1362 457 11291 1570 --
NM_001009959chr262618 2417 2392 2360 1879 1016 --12561 --
NM_001009993chr274541 4425 4091 3994 2951 1417 461 14399 193 --
NM_001010846chr173550 3195 3169 1793 1510 1078 1031 23181 1428 11142 --
NM_001010862chrX53293 2114 2098 569 131 1695 32470 2091 1146 --
NM_001010870chr61481 --1418 --
NM_001010888chrX53957 2898 2835 1501 937 11389 21792 1627 --
NM_001010891chr576581 4665 1904 1303 266 217 123 34607 4570 4305 12498 16886
NM_001010895chr92305 128 1793 32078 704 675 --
NM_001010897chr131369 ------
NM_001010908chr103634 569 527 ------
NM_001010923chr631542 511 188 --1398 --
NM_001010932chr7--175 ----
NM_001010934chr731072 214 46 ------
NM_001010971chr1----3910 724 110 1340
NM_001010986chrX72319 2007 1721 1612 272 216 183 ------
NM_001011513chr453512 3497 2507 415 32 --22600 481 1299
NM_001011515chr42981 317 --1111 11099
NM_001011516chr42981 317 --1111 11099
NM_001011537chr371913 1786 1710 1575 888 864 592 --21652 492 --
NM_001011663chr104800 242 137 51 --31056 995 783 --
NM_001011666chr796288 6059 5780 5720 1671 946 467 78 34 --35735 5039 4054 --
NM_001011713chr1431151 995 73 ------
NM_001011885chr1531779 650 416 ------
NM_001012393chr1175113 4804 3823 3727 1832 1791 425 14489 34181 1744 1411 13784
NM_001012398chr163954 324 77 ------
NM_001012420chr15112831 2460 2425 2047 1122 781 708 621 556 393 22 ------
NM_001012423chr1592831 2460 2425 2047 1122 708 621 556 393 ------
NM_001012478chr192616 412 ------
NM_001012751chr1071885 1780 1714 761 602 534 71 ------
NM_001012755chrX84482 3461 2003 1943 1004 590 406 390 ------
NM_001013399chr61762 1992 ----
NM_001013406chr721630 610 --11691 11721
NM_001013620chr12115930 3399 2607 2270 2258 2163 2074 362 338 177 89 58068 6722 5731 3338 35 --15396
NM_001013642chr15874 331 313 237 87 --1866 --
NM_001013659chr1954815 3412 3309 386 35 1352 35159 1505 1114 --
NM_001013734chr63684 526 184 --2591 47 1765
NM_001014286chr13159 ------
NM_001014797chr10187777 7368 7163 7019 6923 6836 6632 5813 5296 5170 3279 1901 1788 1425 1250 1044 244 149 15214 47427 6862 2764 1072 --
NM_001015045chr452554 2130 673 539 285 --32023 653 420 --
NM_001015508chr81744 ------
NM_001015877chrX42660 2624 1929 1062 --32734 785 683 --
NM_001017368chr1752816 2677 2548 2273 208 11804 31062 292 282 --
NM_001017369chr45993 973 852 738 156 --1834 --
NM_001017371chr231233 991 427 1266 ----
NM_001017415chr12776 178 --1574 --
NM_001017416chr12776 178 --1574 --
NM_001017424chr11314 --2154 44 --
NM_001017425chr11314 --2154 44 --
NM_001017440chr7148198 7940 7900 6943 6872 6688 6511 6462 6105 5513 2620 1293 644 629 23036 2106 26841 5104 --
NM_001017926chr8166 1150 2425 332 --
NM_001018056chr91237 ------
NM_001018065chr996020 5965 5601 5221 4870 4711 4303 1338 43 --15505 --
NM_001018066chr996020 5965 5601 5221 4870 4711 4303 1338 43 --15505 --
NM_001018067chr194971 4548 3949 2085 1418 1398 1097 161 139 24644 2016 --14668
NM_001018068chr194971 4548 3949 2085 1418 1398 1097 161 139 24644 2016 --14668
NM_001018069chr194971 4548 3949 2085 1418 1398 1097 161 139 24644 2016 --14668
NM_001018074chr583091 2911 2564 1510 1320 1242 806 339 --12448 --
NM_001018075chr583091 2911 2564 1510 1320 1242 806 339 --12448 --
NM_001018076chr583091 2911 2564 1510 1320 1242 806 339 --12448 --
NM_001018077chr583091 2911 2564 1510 1320 1242 806 339 --12448 --
NM_001018100chr15----1715 --
NM_001018111chr7103883 3700 3671 3580 3521 3482 2890 1602 268 38 23935 3687 11497 --
NM_001020658chr141557 1503 1361 1041 --11696 --
NM_001020658chr141557 1503 1361 1041 --11696 --
NM_001023567chr1572223 624 559 541 393 105 22 11922 ----
NM_001024094chr583091 2911 2564 1510 1320 1242 806 339 --12448 --
NM_001024218chr14--1146 1311 --
NM_001024647chr1296673 5961 5676 5663 5577 5551 4735 2256 204 --21981 1099 --
NM_001024649chr552852 2607 2298 1934 1172 --1309 11951
NM_001024808chr1282163 1999 1860 977 807 753 178 103 --22761 553 --
NM_001024947chr51855 --1166 --
NM_001024948chr173223 2807 2572 2316 2129 443 368 --1288 --
NM_001025068chr3177 --11685 134
NM_001025069chr3177 --11685 134
NM_001025076chr1076107 2317 1707 1687 1452 1430 857 --21118 891 --
NM_001025077chr10117465 4963 4821 4746 4621 4585 3045 2810 2788 2215 432 --35018 2476 2249 1354
NM_001025079chr374128 3737 3700 3650 2969 2807 540 --12689 --
NM_001025252chr862896 2467 2422 2344 489 86 12158 13151 --
NM_001025253chr862896 2467 2422 2344 489 86 12158 13151 --
NM_001025266chr374723 4347 1332 1146 1064 531 43 --11948 13349
NM_001025356chr1262873 2748 2568 2540 1904 252 136 --12142
NM_001025366chr621685 495 ----11911
NM_001025366chr621685 495 ----11911
NM_001025367chr621685 495 ----11911
NM_001025367chr621685 495 ----11911
NM_001025368chr621685 495 ----11911
NM_001025368chr621685 495 ----11911
NM_001025369chr621701 511 ----11927
NM_001025369chr621701 511 ----11927
NM_001025370chr621685 495 ----11911
NM_001025370chr621685 495 ----11911
NM_001025580chrX42932 1688 1253 635 --1278 1865
NM_001025595chr451660 1606 1429 659 64 ------
NM_001025780chr94547 482 230 167 --11260 --
NM_001029860chr8----1234 --
NM_001029863chr653136 1108 1102 753 217 --12372 12734
NM_001029870chr4160 ------
NM_001029875chr532319 287 231 --21195 575 --
NM_001030007chr16123977 3442 3369 3293 3186 2775 2459 1351 639 336 119 47 --23704 696 --
NM_001030055chr1443744 3528 3324 1197 13656 1968 22958 1851
NM_001031679chr1293558 3516 3197 3148 1054 982 890 379 191 ------
NM_001031695chr22174877 4528 4418 4371 4315 3979 3668 3631 3328 1689 1532 1282 1211 581 559 402 81 1904 ----
NM_001031710chr74858 406 271 258 ------
NM_001031712chr6167 --2434 38 1356
NM_001031725chr1186 ------
NM_001031732chr483477 3308 2922 1290 1251 1128 866 169 12334 ----
NM_001031804chr1694337 4231 4081 3849 3605 3177 1279 663 352 --32990 1196 535 --
NM_001032283chr128932 692 401 377 240 183 162 88 ------
NM_001032284chr128932 692 401 377 240 183 162 88 ------
NM_001032394chr632787 1017 480 12382 2987 286 --
NM_001032395chr642654 1062 884 347 12249 2854 153 --
NM_001032999chr2095269 4884 4459 4410 3486 1315 1088 523 495 --31919 1031 866 --
NM_001033045chr273781 3485 3273 2789 2727 1701 289 --23634 1114 --
NM_001033057chr321526 303 21873 380 --11606
NM_001033059chr651880 1873 1778 1458 414 22023 792 21283 440 --
NM_001033112chr53917 601 201 ------
NM_001033117chr394372 4254 4023 3630 3506 1911 1121 576 140 --23958 3425 1591
NM_001033506chr111371 ------
NM_001033518chr7102676 2649 2412 2198 1108 862 700 608 214 79 --157 --
NM_001033519chr7102676 2649 2412 2198 1108 862 700 608 214 79 --157 --
NM_001033520chr7102676 2649 2412 2198 1108 862 700 608 214 79 --157 --
NM_001033557chr241070 1012 480 272 ------
NM_001033559chr15----1365 --
NM_001033566chr173773 683 77 ------
NM_001033568chr173773 683 77 ------
NM_001033578chr822106 180 --22376 1902 --
NM_001033602chr1362734 2389 2175 470 398 269 --22187 283 --
NM_001033659chr171433 11613 21409 362 --
NM_001033723chr882809 2451 2443 1724 993 821 611 299 --42276 2110 1844 78 --
NM_001033756chr631619 713 429 ----11845
NM_001033756chr631619 713 429 ----11845
NM_001034155chr9193 ------
NM_001034954chr1083278 2285 2012 1984 890 676 357 212 ------
NM_001034955chr1083278 2285 2012 1984 890 676 357 212 ------
NM_001034956chr1083278 2285 2012 1984 890 676 357 212 ------
NM_001034957chr1083278 2285 2012 1984 890 676 357 212 ------
NM_001035005chr18----1440 --
NM_001035260chr1031074 595 307 --21667 1541 --
NM_001037132chr741733 1539 603 236 --21778 454 --
NM_001037133chr741733 1539 603 236 --21778 454 --
NM_001037164chr721649 284 ------
NM_001037172chr311132 --21211 404 --
NM_001037174chr231797 304 50 --1313 --
NM_001037277chr121673 328 ------
NM_001037278chr121673 328 ------
NM_001037332chr562405 1704 1009 892 392 280 12421 ----
NM_001037333chr562405 1704 1009 892 392 280 12421 ----
NM_001037334chr1822191 806 11927 32125 2040 73 11941
NM_001037535chrX31292 144 136 --11195 1417
NM_001037536chrX31292 144 136 --11195 1417
NM_001037540chrX31292 144 136 --11195 1417
NM_001037553chr2154184 713 421 275 152 1363 13994 --
NM_001037954chr112770 70 13285 23187 3065 --
NM_001038702chr552003 1104 916 642 176 ------
NM_001039091chrX3908 517 450 1991 ----
NM_001039111chr3188 ------
NM_001039547chr3158051 7591 7137 7029 5671 5322 5093 5054 2244 1486 1443 1341 1188 939 479 22523 543 25167 1394 1899
NM_001039580chr453675 3272 1912 1757 541 11816 2572 510 14904
NM_001039585chr194139 4044 3702 3098 2865 2571 1050 876 762 2517 183 33412 2923 1477 11700
NM_001039590chrX113688 3677 3479 3263 3138 2966 2555 1547 1312 1149 899 --43779 1471 1455 748 --
NM_001039591chrX113688 3677 3479 3263 3138 2966 2555 1547 1312 1149 899 --43779 1471 1455 748 --
NM_001039618chr1165707 4995 4806 3897 3690 3623 --35765 4006 2380 25572 2081
NM_001039649chr131274 --126 --
NM_001039693chr2103608 3552 3302 3112 2926 2789 1411 898 783 525 1860 34063 1544 772 --
NM_001039709chr2095269 4884 4459 4410 3486 1315 1088 523 495 --31919 1031 866 --
NM_001039715chr111068 ------
NM_001039716chr111132 ------
NM_001039840chrX105676 5628 5216 5042 4957 4301 4044 3934 2055 1097 --65871 5325 4370 2031 1326 746 --
NM_001039844chr1042763 2449 1924 21 ----1563
NM_001039937chr1364186 3944 3461 2853 595 346 ----23364 1536
NM_001040057chr74947 597 483 98 --1380 --
NM_001040135chr72720 678 ------
NM_001040152chr7124935 4802 4345 4264 4229 4117 4088 3920 3138 3103 1644 204 ------
NM_001040153chr133676 285 254 ------
NM_001040157chr482591 1833 623 594 380 341 135 64 22192 1804 131 --
NM_001040158chr52562 448 ------
NM_001040284chr1645485 4289 1928 860 25710 5250 25007 1909 13667
NM_001040402chr451964 1003 934 458 227 ------
NM_001040429chr1383352 2832 2267 1413 1077 343 301 226 ------
NM_001040441chr1105200 4306 3976 3925 2039 2033 1363 212 171 23 --12087 --
NM_001040450chr1532027 886 736 22515 602 --12655
NM_001040453chr1532027 886 736 22515 602 --12655
NM_001040455chr1121352 1109 ------
NM_001040610chr15--141 ----
NM_001040665chr784314 4307 4118 3968 1905 1146 788 192 --1347 --
NM_001040708chr82986 407 --1807 --
NM_001040712chr952997 2666 662 596 175 --12914 --
NM_001040876chr431217 672 108 11413 156 --
NM_001042406chr641236 1063 1004 235 ------
NM_001042410chr21180 ------
NM_001042413chr984001 3634 3324 1268 970 232 161 148 1252 ----
NM_001042453chrX11202 ------
NM_001042473chr105689 441 265 188 37 11817 ----
NM_001042492chr1772618 1394 1294 1252 1185 499 365 --12364 --
NM_001042493chr611882 11447 21671 585 11433
NM_001042494chr1553716 2977 776 272 165 --13662 1444
NM_001042495chr1553716 2977 776 272 165 --13662 1444
NM_001042496chr1553716 2977 776 272 165 --13662 1444
NM_001042497chr1553716 2977 776 272 165 --13662 1444
NM_001042510chr822036 403 --11581 --
NM_001042511chr822036 403 --11581 --
NM_001042529chr171290 ------
NM_001042530chr171290 ------
NM_001042531chr171290 ------
NM_001042532chr171290 ------
NM_001042533chr383231 2844 2780 2693 2491 2240 1230 287 --1342 1718
NM_001042552chr11940 ------
NM_001042555chr1223927 1865 44505 2930 1009 299 11834 --
NM_001042599chr287730 6183 5777 5003 4805 1385 1199 422 --25842 3073 1753
NM_001042601chr373058 2995 2714 1290 1236 1210 541 11199 --12684
NM_001042603chr1275316 4927 4556 4014 3562 1817 1446 --11138 --
NM_001042604chr364592 3749 3522 3423 3103 668 --34287 1777 886 11136
NM_001042632chr2092087 2062 1998 1862 1736 836 631 145 58 11585 21877 247 12401
NM_001042633chr2092087 2062 1998 1862 1736 836 631 145 58 11585 21877 247 12401
NM_001042683chr631541 122 27 --11455 11203
NM_001042724chr191264 1836 --1686
NM_001042749chrX31679 1667 468 --2622 568 --
NM_001042750chrX31679 1667 468 --2622 568 --
NM_001042751chrX31679 1667 468 --2622 568 --
NM_001044305chr62601 29 ------
NM_001044385chr2103507 3453 3347 3079 2599 1493 1228 1220 922 742 ------
NM_001046chr562706 2225 952 866 637 545 --1846 --
NM_001048183chr131361 101 74 1679 23804 2615 --
NM_001071775chr1341604 498 180 130 --21815 1506 --
NM_001083620chr422514 275 --193 --
NM_001100108chr1177533 7327 6949 6626 6611 6238 5981 5827 5627 2828 2443 2254 2171 1884 1583 534 419 17232 57975 7176 5318 966 58 --
NM_001106chr3179760 8491 7918 7484 6839 6588 6514 6099 6053 6044 6022 3896 2755 1856 1821 1419 674 23153 543 28745 1468 --
NM_001113490chrX62972 2903 2444 2227 1009 413 1249 1125 --
NM_001117chr1841895 781 748 527 --12477 --
NM_001121chr104542 202 128 120 --1343 --
NM_001123chr103677 636 62 ------
NM_001128chr16123977 3442 3369 3293 3186 2775 2459 1351 639 336 119 47 --23704 696 --
NM_001151chr42256 39 ------
NM_001160chr1242705 1917 1778 29 12821 1323 --
NM_001167chrX126203 5700 4657 4578 4429 2598 2432 2424 2288 862 364 165 15925 1897 --
NM_001172chr14145 --1485 --
NM_001173chr1443744 3528 3324 1197 13656 1968 22958 1851
NM_001186chr2172927 2696 2210 797 752 509 131 --12538 22124 866
NM_001191chr2051301 565 430 357 218 ----1169
NM_001201chr473927 3521 3157 2991 283 177 58 1898 1698 13123
NM_001204chr2126681 6172 5631 5579 5412 2802 1939 1547 990 975 738 643 --26835 2820 15960
NM_001206chr942874 2670 2541 479 1699 41096 1013 746 380 --
NM_001222chr1091743 1519 685 632 587 514 504 427 383 1408 21893 439 --
NM_001233chr752259 1784 1698 1466 217 1301 ----
NM_001235chr112572 172 ----1660
NM_001241chr282382 2255 2133 2067 1999 1988 1795 975 22176 1532 12247 --
NM_001241chr282382 2255 2133 2067 1999 1988 1795 975 22176 1532 12247 --
NM_001248chr331096 1015 330 ------
NM_001254chr173956 128 51 ----1766
NM_001256chr1732640 924 246 11974 1657 --
NM_001259chr796110 5009 4819 2435 2398 2290 1962 982 83 22260 748 22418 1947 --
NM_001289chrX51315 1283 561 519 130 ------
NM_001290chr43967 916 314 ----1726
NM_001304chr1773737 3272 2721 784 605 167 148 42889 2835 1421 273 1108 1689
NM_001310chr1253085 2635 2094 1164 1074 12837 ----
NM_001315chr672238 2137 1979 1677 1651 297 63 --11506 --
NM_001316chr202429 101 ------
NM_001326chr111170 ------
NM_001331chr1152527 2421 462 373 306 12382 11005 12814
NM_001343chr511637 --1507 --
NM_001351chr371655 1544 1496 1193 495 422 87 --1347 --
NM_001356chrX41953 861 405 92 --11594 --
NM_001364chr1194043 3920 3845 3066 3048 598 427 334 317 11808 1570 --
NM_001389chr21--1384 ----
NM_001390chr1843297 2817 2506 1267 --1595 22311 785
NM_001399chrX93627 3439 3173 3074 2828 2684 2519 821 56 --1935 --
NM_001402chr632050 1863 62 --1265 --
NM_001412chrX53266 3039 2886 1340 634 1224 ----
NM_001417chr1221332 197 11587 ----
NM_001418chr11----1650 --
NM_001418chr11----1650 --
NM_001419chr1973996 3546 3432 1460 1213 983 257 ------
NM_001420chr1942870 2769 1921 654 12100 22429 633 --
NM_001429chr2221050 126 --1782 --
NM_001431chr62908 140 21110 101 ----
NM_001438chr142946 1474 1308 540 21100 624 ----
NM_001460chr183327 1337 1050 1027 764 510 349 340 22773 1273 --11116
NM_001490chr942290 1472 1431 1229 2570 336 21098 382 12338
NM_001527chr644652 3697 1498 1044 --23279 702 2963 950
NM_001542chr1112801 2556 2434 2425 2135 1017 655 641 550 438 399 ------
NM_001616chr262854 2677 2597 2289 1218 1119 12924 ----
NM_001619chr112399 47 ------
NM_001634chr651880 1873 1778 1458 414 22023 792 21283 440 --
NM_001650chr1854023 3795 3047 321 41 12921 33426 3328 2836 1992
NM_001655chr1111910 ------
NM_001656chr561924 1646 769 752 565 181 1730 31907 1882 1596 --
NM_001660chr31605 ------
NM_001663chr1431983 1788 107 12621 12563 --
NM_001677chr111006 --1901 --
NM_001682chr1232713 2248 106 --1300 1855
NM_001683chr352729 2697 2134 1925 420 --21700 584 1544
NM_001690chr372204 2005 1862 584 370 341 70 ------
NM_001695chr831660 1596 815 14284 32694 984 759 --
NM_001709chr1152191 1990 1823 627 263 --22892 2163 --
NM_001713chr55972 887 358 141 29 ------
NM_001714chr12--2536 480 ----
NM_001716chr1111486 ------
NM_001730chr13----11583 --
NM_001730chr13----11583 --
NM_001731chr122802 365 192 ----
NM_001742chr771734 1498 1285 708 237 128 115 ------
NM_001746chr552852 2607 2298 1934 1172 --1309 11951
NM_001753chr771488 1440 1346 1226 407 320 201 ------
NM_001754chr2174030 3784 3420 1071 662 584 425 11314 13601 --
NM_001759chr1284971 4442 4112 3389 1574 1407 1140 406 ------
NM_001760chr61283 ------
NM_001769chr12----1335 --
NM_001777chr374128 3737 3700 3650 2969 2807 540 --12689 --
NM_001786chr10--1171 ----
NM_001792chr181211 ------
NM_001799chr51238 ------
NM_001821chr1104491 4142 3678 3580 3483 3088 1813 1600 1271 676 14229 153 --
NM_001842chr91574 ------
NM_001845chr1331271 290 134 1904 ----
NM_001846chr131119 ------
NM_001854chr161289 1036 995 481 473 270 --11464 --
NM_001855chr93812 581 180 ------
NM_001858chr6125148 4715 4279 3433 1988 1939 1923 1404 1281 1143 1085 383 --34009 567 514 13240
NM_001859chr963312 3242 2814 1003 476 357 22954 1414 1930 --
NM_001873chr41674 --1175 --
NM_001874chr1255248 1791 1151 1048 803 15211 1915 25143 3324
NM_001902chr1------1361
NM_001903chr53346 144 74 ------
NM_001904chr331084 748 334 --170 --
NM_001918chr1129122 8847 8065 8027 7381 6476 5686 3153 2548 1814 34 25 23548 698 17416 --
NM_001931chr112310 157 ----2851 473
NM_001938chr151448 479 393 226 106 ------
NM_001942chr1871817 1546 1270 363 219 211 172 ----11716
NM_001945chr551091 902 538 530 524 ------
NM_001949chr682999 2900 2233 2014 1025 988 471 158 ------
NM_001955chr61929 ------
NM_001968chr43807 290 225 ------
NM_001977chr441315 1273 610 458 ------
NM_001981chr132123 942 261 --22200 686 --
NM_002006chr485580 4867 4771 4530 4129 3837 3821 3650 1434 --11215
NM_002009chr1542360 1796 936 146 --11867 11940
NM_002014chr12----187 --
NM_002015chr13113340 2857 2634 2137 1306 618 569 509 491 235 56 1770 ----
NM_002024chrX21411 830 --31949 736 139 --
NM_002025chrX108493 7023 6450 6059 5619 3329 2490 1906 1073 76 18150 58969 6127 5720 624 501 35648 3067 391
NM_002033chr1183849 2783 1446 1421 1176 497 478 335 --13636 1771
NM_002035chr1853978 2904 1424 605 259 --33555 3020 393 1844
NM_002040chr2182861 2788 2653 2435 489 444 155 80 --13034 32516 2448 698
NM_002044chr1531269 578 326 11551 31513 1340 57 --
NM_002048chr921177 205 --1984 11209
NM_002074chr131640 366 273 --1121 --
NM_002076chr1283150 2578 2259 2070 967 847 498 326 1974 ----
NM_002092chr474760 4370 4141 3574 1574 555 68 1845 24874 3422 --
NM_002099chr451552 1500 705 274 263 ----21510 788
NM_002107chr11200 ------
NM_002126chr1754177 3479 3418 1289 384 1367 1803 --
NM_002140chr93866 812 72 ------
NM_002146chr1741375 1352 1344 1249 1386 --1960
NM_002155chr12274 94 --1114 --
NM_002182chr362735 2618 2532 1043 480 262 1349 22357 590 12093
NM_002190chr631251 503 378 ------
NM_002202chr531081 1067 204 --1767 --
NM_002210chr273128 2828 2449 500 343 141 42 --22782 532 --
NM_002211chr10--1801 ----
NM_002214chr7115608 5281 4913 4524 3906 3750 3724 3473 2139 1489 1103 23620 1937 13460 15654
NM_002232chr1----21277 360 --
NM_002239chr21859 ------
NM_002242chr252040 1661 1561 1492 453 1264 ----
NM_002264chr374744 4414 3675 1600 669 410 338 24780 3328 21701 788 13785
NM_002266chr172202 74 ------
NM_002267chr1352068 830 824 527 221 --21547 669 --
NM_002268chr321581 1279 ------
NM_002270chr535561 5150 530 12061 14949 --
NM_002271chr1352271 2047 2040 1892 1501 --11724 --
NM_002290chr631226 1162 1116 ----21457 124
NM_002293chr152625 2296 2144 897 702 1805 12445 --
NM_002310chr5126293 5685 5193 5158 4778 4340 4136 1670 1242 996 249 117 --15059 26431 4733
NM_002313chr10104907 4827 4220 4170 3709 1923 539 348 246 34 11659 192 11619
NM_002334chr1132038 369 300 --32079 1573 417 1210
NM_002336chr1284507 4402 3912 3697 1762 1002 818 712 23931 1328 21851 1513 --
NM_002345chr122526 98 --1494 --
NM_002349chr251606 1538 1246 221 99 --21150 316 --
NM_002356chr642341 2326 717 669 12532 287 34 1241
NM_002358chr41605 1204 ----
NM_002376chr141426 ------
NM_002380chr83916 396 207 1221 ----
NM_002381chr2--1655 ----
NM_002382chr1421286 245 ------
NM_002384chr181874 1855 ----
NM_002392chr12122 155 ----
NM_002395chr641202 993 957 428 --11215 --
NM_002397chr521663 871 11513 21419 834 --
NM_002440chr1------150
NM_002451chr9113929 3911 3748 3523 3466 3346 2726 1563 1531 523 470 1886 11547 1976
NM_002467chr82156 61 --2326 173 --
NM_002480chr1221521 1180 --1142 --
NM_002500chr21265 --1461 --
NM_002508chr13752 505 175 11443 11536 --
NM_002514chr81890 ------
NM_002515chr1431635 1591 1469 --21716 188 --
NM_002518chr25965 826 814 416 128 ------
NM_002519chr1131466 1141 606 ------
NM_002526chr6----31674 1662 1227 --
NM_002545chr1175113 4804 3823 3727 1832 1791 425 14489 34181 1744 1411 13784
NM_002556chr1141965 1946 1836 753 2493 423 21448 770 --
NM_002568chr81376 --1276 --
NM_002577chr333473 1039 437 21305 1050 33341 1276 591 13802
NM_002581chr975216 3493 2247 891 613 153 27 --14217 1798
NM_002585chr1--1347 ----
NM_002601chr2----130 --
NM_002603chr81206 ----178
NM_002612chr761954 1590 1421 800 546 153 --12007 1177
NM_002613chr1695375 4881 4666 4570 4243 3738 1927 1735 458 --24722 1121 15028
NM_002645chr1182933 2622 2201 1160 1027 1007 510 203 --12713 1129
NM_002646chr191793 1768 1761 782 554 493 464 199 59 --1814 --
NM_002655chr8104952 4530 4331 4065 1972 1135 1085 1039 932 166 14774 33591 1784 1258 --
NM_002656chr63998 363 145 2790 299 2838 401 --
NM_002657chr2083886 3627 3424 2566 2548 2402 99 91 --1227 --
NM_002670chr341426 547 511 159 --11396 --
NM_002687chr1421022 99 --1890 --
NM_002709chr233070 579 386 --33468 2782 478 11368
NM_002711chr72836 789 ------
NM_002718chr352431 453 425 210 131 --1713 --
NM_002726chr63372 150 137 ------
NM_002729chr104786 536 311 78 ------
NM_002731chr143097 2594 2531 67 ------
NM_002734chr1712085 12155 1837 --
NM_002737chr1786039 5646 5526 4309 4155 1988 1594 1247 --15449 15539
NM_002745chr2284396 4186 2827 2814 911 519 193 28 --1176 --
NM_002748chr152883 470 --11173 --
NM_002765chrX3908 517 450 1991 ----
NM_002822chr1221797 64 ----11302
NM_002823chr21665 --1184 --
NM_002834chr1284088 3161 2861 1125 1079 1069 542 42 --33054 273 103 --
NM_002837chr1254024 3650 1727 551 315 --12814 --
NM_002838chr131019 928 313 1802 ----
NM_002839chr952997 2666 662 596 175 --12914 --
NM_002858chr151343 1250 1190 1135 337 190 ----
NM_002873chr51507 ------
NM_002874chr962510 2313 2089 1900 1837 1761 ----1396
NM_002886chr385180 4003 3539 3520 1581 1246 1194 1089 14124 14931 14740
NM_002892chr1461617 1587 1517 1067 496 295 11216 ----
NM_002902chr152626 119 --1555 1473
NM_002930chr18137 ------
NM_002940chr431217 672 108 11413 156 --
NM_002956chr124922 218 92 21 --11236 --
NM_002959chr194458 3355 3188 3058 2842 1689 1053 782 751 23517 2775 11094 --
NM_002967chr191126 ------
NM_002968chr162795 693 ------
NM_002979chr11299 --1572 178
NM_002994chr431827 1623 429 --2615 515 --
NM_003002chr11128 ----1150
NM_003010chr1752339 2200 1768 842 794 2625 494 3779 439 61 --
NM_003017chr641348 262 251 214 ------
NM_003022chrX168 ------
NM_003034chr1297391 5150 3195 1990 1963 1507 1373 623 23 1678 15549 21909 734
NM_003037chr13536 64 24 ----1195
NM_003042chr331938 467 397 ----12248
NM_003043chr353112 2973 1496 471 291 --31718 258 81 --
NM_003046chr855230 3707 3386 1917 720 1799 45335 4677 3341 1976 --
NM_003048chr241983 981 637 280 --32071 957 294 --
NM_003051chr151738 1694 1242 304 176 ------
NM_003079chr171283 1766 --1246
NM_003087chr101233 ------
NM_003095chr121269 ------
NM_003099chr15126418 6080 5328 5202 5128 5122 4223 4193 1996 1815 971 317 1106 14518 --
NM_003108chr2116036 6015 4884 4794 2119 1704 1584 1257 710 567 43 26145 5830 56422 6068 5845 5801 1305 24861 560
NM_003111chr231233 991 427 1266 ----
NM_003112chr752191 1148 982 947 164 1349 12910 --
NM_003114chr84873 824 536 351 1550 1230 --
NM_003137chr641845 1451 324 204 22114 1459 21709 902 --
NM_003143chr7186 ------
NM_003144chr632182 606 540 --1835 21916 1742
NM_003156chr111992 ------
NM_003161chr1712843 23179 25 12422 --
NM_003162chr2------1934
NM_003189chr162777 1035 136 118 112 83 --12143 --
NM_003198chr11200 ------
NM_003199chr1844893 3719 3525 1306 --12070 1947
NM_003211chr1211773 ------
NM_003221chr694120 3952 3040 1266 1117 1024 424 401 102 13604 23663 1039 --
NM_003223chr161570 ------
NM_003236chr263320 2865 1419 389 245 166 --12850 --
NM_003246chr1571885 705 659 512 399 389 63 --11551 --
NM_003253chr2141566 1405 627 187 --1742 --
NM_003257chr1531381 1210 1085 ------
NM_003262chr335153 1596 1122 --13354 13192
NM_003272chr1171 --1102 --
NM_003274chr2142544 2368 2288 944 ------
NM_003286chr203280 243 164 1459 11018 --
NM_003298chr376079 5815 4942 4863 4472 4427 4314 15412 16117 --
NM_003299chr121165 ------
NM_003300chr14------1415
NM_003304chr32173 105 11008 ----
NM_003315chr171231 ------
NM_003338chr1021815 746 11261 11246 --
NM_003340chr431106 1031 507 1520 1251 --
NM_003342chr1782774 2362 2126 1228 784 247 132 98 --12207 --
NM_003344chr721539 500 --11782 --
NM_003348chr1221642 1561 --11062 --
NM_003350chr83389 259 101 ------
NM_003359chr411289 --21112 498 --
NM_003360chr4147 ------
NM_003368chr12776 178 --1574 --
NM_003370chr191313 ------
NM_003374chr51711 --1222 2574 62
NM_003376chr621685 495 ----11911
NM_003376chr621685 495 ----11911
NM_003383chr91237 ------
NM_003385chr25892 884 733 193 138 ------
NM_003387chr2122412 2203 2176 2156 2097 1116 1067 518 501 363 59 36 ----12435
NM_003392chr373995 3675 3291 1593 763 151 110 12945 11233 --
NM_003405chr221313 ------
NM_003406chr82239 128 --11406 --
NM_003409chr1831402 1269 281 1123 ----
NM_003410chrX31053 779 122 --21888 282 --
NM_003411chrY71554 1206 1168 733 504 255 117 11767 21471 1456 --
NM_003412chr351030 968 941 731 372 --12361 --
NM_003423chr191767 1602 1171 --
NM_003435chr193707 45 24 ------
NM_003439chr753508 2566 1264 640 558 --32611 2215 964 13316
NM_003468chr2113579 3479 3284 2883 1254 1141 1012 918 818 812 33 13855 23390 1457 12758
NM_003472chr631269 516 158 ----1122
NM_003473chr103752 248 145 ------
NM_003477chr112637 562 ------
NM_003478chr112271 95 1910 23118 1283 --
NM_003482chr1242347 1939 1893 305 --1918 12274
NM_003489chr2183455 3406 3287 3200 3177 2528 759 53 12426 13142 --
NM_003503chr121294 897 ------
NM_003505chr741771 1276 647 246 --21929 771 11697
NM_003506chr83968 506 430 ------
NM_003557chr151422 594 343 297 86 ------
NM_003558chr92236 78 ------
NM_003566chr1263100 3017 2948 1193 476 251 1549 22741 1148 --
NM_003574chr18125595 3583 2014 2008 1908 1513 1400 1322 1121 650 310 273 24501 4300 21974 505 15263
NM_003582chr11154 ------
NM_003589chr1311132 ------
NM_003590chr233470 1583 180 22595 828 ----
NM_003603chr421760 1412 --11517 --
NM_003615chr363890 3757 1379 1296 964 922 22518 709 13126 --
NM_003617chr163300 3171 1865 1798 812 466 1404 44927 3318 1291 1234 11338
NM_003618chr25971 926 869 850 384 11103 --1285
NM_003622chr1221954 419 12134 42034 793 751 539 --
NM_003631chr105927 864 857 803 755 1202 ----
NM_003651chr12149 ------
NM_003663chr362796 2191 863 762 682 298 --32958 2554 1258 --
NM_003664chr51491 ------
NM_003671chr9113444 3252 2721 2705 2221 1130 761 355 166 41 22 12603 12619 --
NM_003672chr13767 345 251 ------
NM_003677chr1221769 852 11543 1846 1380
NM_003679chr143446 2291 372 342 22628 430 33003 2708 2099 --
NM_003692chr9--1811 --1962
NM_003701chr131239 ------
NM_003702chr82719 44 173 2837 698 --
NM_003713chr11648 ------
NM_003722chr332405 998 217 --12160 1522
NM_003728chr4--1229 1570 --
NM_003750chr103740 326 134 1213 2997 950 --
NM_003759chr473845 3709 1595 911 604 594 49 32745 783 500 185 13184
NM_003763chr2011116 1949 11182 2532 214
NM_003772chr111887 --11173 --
NM_003778chr35536 296 149 121 32 --1248 --
NM_003787chr1851503 1316 1081 354 175 ------
NM_003794chr32708 361 ------
NM_003797chr11156 ------
NM_003799chr18114023 3870 3526 3325 2807 1821 821 637 375 246 173 --1629 --
NM_003800chr62740 122 21619 207 --12030
NM_003816chr841214 1112 367 39 1204 ----
NM_003825chr1521223 538 --11138 11322
NM_003829chr921222 295 1213 11243 --
NM_003831chr1831711 603 159 ------
NM_003848chr3----2345 313 --
NM_003861chr1492623 2528 2174 1975 1847 1802 1031 783 400 --32211 918 656 --
NM_003870chr1511882 12041 ----
NM_003883chr5133 ------
NM_003885chr1772427 1979 955 634 255 246 156 ----22364 52
NM_003887chr271778 837 799 785 709 442 228 ------
NM_003895chr213402 58 49 --22097 694 --
NM_003913chr664020 3781 3457 3253 3146 622 13172 13646 --
NM_003927chr182741 264 11066 3685 675 121 1214
NM_003942chr11----1169 --
NM_003966chr577307 5977 5696 2510 1834 1692 1003 25334 3134 33039 1617 338 --
NM_003968chr3----1165 1497
NM_003972chr10185 1514 2891 382 --
NM_003980chr61484 --3929 298 43 --
NM_003983chr1644220 3280 1290 347 --11273 --
NM_003993chr11304 ------
NM_003994chr12104134 2965 2810 2790 1239 891 536 263 254 240 24366 906 54414 1568 1284 281 225 --
NM_004006chrX31696 735 637 --12362 11001
NM_004007chrX31696 735 637 --12362 11001
NM_004009chrX31696 735 637 --12362 11001
NM_004010chrX31696 735 637 --12362 11001
NM_004011chrX31696 735 637 --12362 11001
NM_004012chrX31696 735 637 --12362 11001
NM_004013chrX31696 735 637 --12362 11001
NM_004014chrX31696 735 637 --12362 11001
NM_004015chrX31696 735 637 --12362 11001
NM_004016chrX31610 649 551 --12276 1915
NM_004017chrX31696 735 637 --12362 11001
NM_004018chrX31610 649 551 --12276 1915
NM_004020chrX31696 735 637 --12362 11001
NM_004021chrX31610 649 551 --12276 1915
NM_004022chrX31610 649 551 --12276 1915
NM_004023chrX31610 649 551 --12276 1915
NM_004028chr1854023 3795 3047 321 41 12921 33426 3328 2836 1992
NM_004035chr1784818 2058 1915 1515 1401 1325 1071 664 1615 --1304
NM_004036chr22506 103 ----2709 44
NM_004056chr82711 432 ------
NM_004067chr71471 1336 1111 --
NM_004073chr11314 ------
NM_004075chr122611 162 --3401 212 199 --
NM_004081chrY51522 1224 593 520 175 --1564 --
NM_004087chr341719 1630 1435 216 --11929 --
NM_004093chr1363256 2937 2727 1044 435 92 ------
NM_004100chr652534 2228 299 144 52 ----1792
NM_004109chr1152270 1670 148 95 33 ------
NM_004113chr351958 1822 1354 373 262 ------
NM_004124chr1453444 1431 610 286 241 13078 ----
NM_004133chr852469 2252 2000 883 830 22416 1722 ----
NM_004136chr1523002 494 --1301 --
NM_004161chr22202 36 ------
NM_004162chr331280 220 136 2369 157 11256 --
NM_004170chr961786 1651 1306 720 656 294 --11198 --
NM_004171chr11139054 8447 7162 7118 7028 6732 3404 3388 2718 2474 2383 1510 371 --12339 18285
NM_004180chr22560 129 ------
NM_004215chr81548 ------
NM_004225chr851130 990 546 232 109 11040 ----
NM_004229chrX62017 2011 1403 869 190 111 22192 782 190 --
NM_004232chr1852765 942 814 808 649 --13621 23873 473
NM_004235chr93865 342 42 1259 ----
NM_004239chr14--1131 ----
NM_004252chr172499 143 ------
NM_004261chr11762 --1999 --
NM_004272chr561854 1801 540 409 320 59 ------
NM_004275chr611426 ------
NM_004281chr10152 ------
NM_004293chr943290 3028 1270 586 1861 43045 2826 1015 521 21424 1203
NM_004301chr32368 309 ------
NM_004302chr1262831 1978 1901 661 242 41 12449 ----
NM_004304chr21334 ------
NM_004323chr932584 2392 311 173 --11882
NM_004330chr151136 1193 2794 457 --
NM_004331chr872526 2298 1910 1826 1008 851 73 --1219 12188
NM_004337chr83771 91 82 --22143 152 --
NM_004338chr18126791 6495 6434 6083 4751 2685 2368 2049 2007 1461 617 462 --35107 4301 1231 --
NM_004342chr731954 1645 932 11555 12066 11838
NM_004369chr2------1606
NM_004370chr642154 2119 2047 1693 ------
NM_004379chr241703 1104 567 379 --2534 139 --
NM_004392chr1392564 2512 1942 1015 760 464 416 111 101 --2566 41 --
NM_004397chr11124337 4125 4070 3674 3664 3637 2875 2707 1688 1631 125 106 11537 1926 1437
NM_004412chr10115623 4642 4624 2363 2312 1691 1245 1231 1183 873 737 14373 1307 --
NM_004415chr6149 1262 ----
NM_004423chr332579 2081 114 12512 32177 821 245 --
NM_004437chr1143499 3395 3231 3070 3002 2879 2867 2680 2552 2333 662 423 380 222 --1198 --
NM_004439chr4----1141 --
NM_004440chr652001 1441 1415 1222 682 1188 31312 705 448 1321
NM_004447chr121204 ------
NM_004456chr72260 204 ------
NM_004457chr231698 1513 388 --1251 31350 1164 1118
NM_004458chrX12596 1932 164 --
NM_004459chr1711842 11482 11966 --
NM_004480chr144817 798 735 149 --1754 --
NM_004492chr15191 ------
NM_004496chr142848 470 --21357 944 --
NM_004501chr183828 3483 3340 2951 1594 1055 613 429 --23498 2562 1342
NM_004504chr272041 1932 1223 1133 510 493 31 --22002 898 13059
NM_004505chr172658 273 --21265 203 --
NM_004514chr1772742 2137 1987 771 666 243 102 22470 2369 22943 2491 --
NM_004516chr196858 802 411 272 262 196 ----1157
NM_004520chr54768 640 200 91 ------
NM_004529chr92951 29 ------
NM_004535chr2041411 1380 610 227 ------
NM_004537chr1231303 977 406 172 11444 --
NM_004540chr211321 1287 1216 --
NM_004576chr51130 ------
NM_004586chrX2746 201 --44797 4203 2164 906 --
NM_004602chr2041294 964 450 80 ----21029 955
NM_004612chr984676 3712 3701 3572 3259 3085 1295 686 11876 ----
NM_004622chr22768 146 --1196 12384
NM_004634chr3------1470
NM_004643chr142832 63 ------
NM_004650chrX51354 1178 474 412 403 --21275 183 --
NM_004654chrY21271 1103 ----1964
NM_004663chr154612 510 447 117 --2479 303 --
NM_004673chr151533 1006 978 508 125 --136 --
NM_004680chrY1123 ------
NM_004685chr1362782 2455 1073 891 588 85 22882 1882 ----
NM_004686chr841480 1328 522 110 ------
NM_004703chr1772265 2053 1703 1019 599 410 358 --21782 388 --
NM_004717chr721454 279 ------
NM_004719chr1262373 2366 2157 2050 1154 261 --12629 --
NM_004723chr131085 961 104 --11025 --
NM_004726chrX75068 4688 4626 4052 3791 1459 229 14365 24167 1467 1338
NM_004734chr1383047 3000 2777 1118 1007 476 461 229 --32504 764 450 --
NM_004736chr11904 --1446 --
NM_004745chr886294 5238 4309 1776 1716 1654 1108 503 34487 2251 775 ----
NM_004748chr15124093 3683 3486 3248 2680 2614 1578 1232 1005 941 377 93 1879 64075 3781 3762 3657 1091 1080 13587
NM_004755chr1421017 462 ------
NM_004772chr51571 --1208 1139
NM_004775chr1882377 1918 1739 1531 569 515 428 255 12350 --1640
NM_004785chr161352 ------
NM_004788chr1141037 1016 745 141 22170 596 2577 182 --
NM_004796chr1462309 1553 1518 906 102 93 12351 --1858
NM_004798chr2053333 1218 1137 1120 98 --42441 1429 1284 481 --
NM_004799chr12438 299 ------
NM_004800chr13193 ------
NM_004804chr272781 2477 1859 1797 1769 197 153 ------
NM_004805chr231397 433 110 ------
NM_004808chr1063378 2676 2536 2211 65 24 23237 1143 22835 1320 --
NM_004815chr1104123 3882 3709 1584 1399 1098 1039 790 381 103 14707 ----
NM_004822chr1783996 3968 3779 3359 3003 2968 437 85 13399 ----
NM_004827chr451695 757 644 605 276 ----21959 547
NM_004834chr242210 1105 688 321 --53025 2518 2199 820 56 --
NM_004837chr121673 328 ------
NM_004856chr154595 469 410 96 ------
NM_004857chr1454393 3230 1192 826 47 --23561 3321 23960 112
NM_004859chr1742227 926 873 272 --22140 123 1199
NM_004863chr1473955 3800 3601 1303 898 370 28 --44342 2013 1404 1317 14477
NM_004866chr574751 4444 4316 3898 3567 1960 624 11672 64398 3877 3813 3447 1237 705 --
NM_004867chrX--2490 241 ----
NM_004890chr171255 ------
NM_004893chr52562 448 ------
NM_004896chr103989 510 222 --31582 1456 601 --
NM_004898chr442636 2392 1900 1100 ------
NM_004902chr20150 ------
NM_004904chr796288 6059 5780 5720 1671 946 467 78 34 --35735 5039 4054 --
NM_004912chr721630 610 --11691 11721
NM_004921chr162430 1997 1644 1637 551 209 21764 976 1697 --
NM_004924chr193766 748 413 ------
NM_004929chr81415 11529 ----
NM_004932chr52383 175 --1527 1488
NM_004934chr5130 ------
NM_004947chr322546 2272 ------
NM_004948chr1831270 952 566 1257 --11220
NM_004956chr764224 4149 4062 1635 923 64 11150 54377 4327 4245 3916 3853 --
NM_004965chr211693 --1717 --
NM_004966chr10--1704 2948 896 --
NM_004972chr92783 205 --21044 1006 --
NM_004985chr1284120 3337 3284 3229 3191 1794 1549 1025 34054 3848 3542 ----
NM_004992chrX198110 8042 7567 7559 7298 7143 6890 5475 5155 3358 3343 3025 2807 2614 2430 1753 1358 1093 973 --26768 1200 --
NM_004992chrX198110 8042 7567 7559 7298 7143 6890 5475 5155 3358 3343 3025 2807 2614 2430 1753 1358 1093 973 --26768 1200 --
NM_004999chr631376 580 146 21137 399 34524 2787 328 --
NM_005010chr741733 1539 603 236 --21778 454 --
NM_005016chr123357 326 254 ------
NM_005032chrX5428 350 207 132 91 --1111 1880
NM_005044chrX74403 3378 3239 1201 325 175 60 1698 ----
NM_005056chr1275560 5171 4800 4258 3806 2061 1690 --11382 --
NM_005057chr131742 256 136 ----11256
NM_005065chr14105381 5226 4387 4247 1913 1615 1541 1319 681 511 14177 34983 4400 461 --
NM_005066chr12825 275 --1188 --
NM_005077chr91400 156 ----
NM_005079chr862896 2467 2422 2344 489 86 12158 13151 --
NM_005080chr222908 606 1713 ----
NM_005093chr2095269 4884 4459 4410 3486 1315 1088 523 495 --31919 1031 866 --
NM_005109chr372541 2021 770 719 691 436 120 ----1465
NM_005116chr2031594 1215 118 13887 24459 3439 --
NM_005121chr1773394 2763 1491 1482 1476 888 359 ------
NM_005124chr64727 714 410 127 1860 1110 --
NM_005126chr352092 1721 1456 536 163 --1874 1355
NM_005135chr1553716 2977 776 272 165 --13662 1444
NM_005141chr4168 --1270 --
NM_005151chr1822191 806 11927 32125 2040 73 11941
NM_005154chr151482 --1650 --
NM_005156chr944293 4206 2071 1022 15073 41657 1642 1436 1392 --
NM_005180chr1041352 1256 580 208 11295 ----
NM_005181chr81648 1674 152 --
NM_005188chr11117902 7817 6864 5903 5648 5526 5272 2117 1775 1540 1519 12668 38307 8181 6468 27233 336
NM_005190chr61762 1992 ----
NM_005197chr14106052 5369 4752 4519 4207 2423 2399 2106 1818 223 32113 1615 29 1192 --
NM_005224chr192538 242 ----1207
NM_005227chr11488 ------
NM_005229chrX2979 139 ------
NM_005230chr123561 216 25 --1489 --
NM_005235chr287730 6183 5777 5003 4805 1385 1199 422 --25842 3073 1753
NM_005238chr1183388 3212 2887 532 493 377 106 72 2905 776 23587 189 11409
NM_005256chr111960 ------
NM_005259chr211232 1447 ----
NM_005277chr411221 ------
NM_005313chr1561169 1097 1060 887 69 33 --21118 389 --
NM_005329chr1612252 --1423 --
NM_005339chr4154302 4230 3689 3376 3332 3187 3117 2985 2737 1148 931 891 796 537 511 1441 ----
NM_005347chr931461 203 49 ----177
NM_005359chr18116531 6147 5955 5022 4882 4261 4215 4189 4064 1464 820 --42617 1645 215 194 11215
NM_005384chr9179 ------
NM_005385chr372378 1011 479 399 386 232 104 ----2677 162
NM_005397chr7103883 3700 3671 3580 3521 3482 2890 1602 268 38 23935 3687 11497 --
NM_005398chr1021454 117 --11383 1158
NM_005399chr164287 4122 3614 3264 2744 1619 1190 21043 171 --
NM_005414chr3------187
NM_005424chr11109 ------
NM_005433chr1872067 1118 954 656 614 333 229 22744 195 2672 50 12798
NM_005436chr1093841 3743 3189 3113 3048 3019 2840 1364 22 23854 2881 31598 551 315 --
NM_005475chr1283091 3036 2832 2807 2774 971 318 62 ------
NM_005493chr61237 ------
NM_005497chr1784884 3882 2234 2204 2013 1840 1385 1349 13987 55932 1363 1306 339 226 --
NM_005502chr933133 1057 42 1237 --12125
NM_005506chr42755 386 --1297 12565
NM_005509chr541444 1229 319 130 1635 ----
NM_005526chr81271 ------
NM_005530chr1551527 1125 1119 952 341 --2480 190 --
NM_005573chr52467 111 1222 ----
NM_005578chr355050 3986 3635 1688 614 13463 21916 226 1557
NM_005593chr121410 ------
NM_005596chr965939 5893 4782 4521 4123 4065 1987 25873 4006 21119 966
NM_005599chr131303 1296 428 11253 ----
NM_005600chr11214 ------
NM_005602chr321219 835 ------
NM_005607chr82910 405 ------
NM_005610chr11223 ------
NM_005611chr162352 75 21234 149 --11021
NM_005627chr6----1105 --
NM_005629chrX--1856 ----
NM_005637chr1831526 768 275 1348 ----
NM_005638chrX41101 595 516 192 ------
NM_005652chr1621039 25 --1419 --
NM_005662chr82124 105 ------
NM_005665chr164878 3726 3315 3204 1689 347 --21192 1139 --
NM_005667chr2------1149
NM_005668chr574510 3578 3469 3197 1668 501 481 11555 14502 --
NM_005669chr542213 2178 2038 52 ------
NM_005697chr151177 ------
NM_005722chr252273 651 549 523 386 --11984 1884
NM_005723chr41177 1241 ----
NM_005725chr162096 859 729 580 465 424 --3948 353 334 1650
NM_005737chr2102835 2749 2229 1822 1055 758 641 271 175 141 ------
NM_005738chr721649 284 ------
NM_005739chr1552322 1586 912 799 80 ----12013
NM_005744chr151129 ------
NM_005746chr762628 2298 2207 2088 587 277 1911 1822 --
NM_005748chr1232492 2153 391 32562 1315 340 42616 1203 535 147 --
NM_005749chr17----176 --
NM_005751chr72459 164 ------
NM_005759chr274665 4499 3771 3603 1583 1441 1162 13148 24790 1490 --
NM_005765chrX2533 269 1341 ----
NM_005776chr141265 --1787 --
NM_005778chr3----1443 --
NM_005792chr16------1417
NM_005795chr262674 1959 1879 1139 925 896 12730 153 --
NM_005797chr1131817 1320 571 ------
NM_005802chr92718 27 ------
NM_005808chr363386 3087 2487 1435 987 183 ------
NM_005819chr1113352 3313 3249 2961 2704 2672 1322 893 500 448 267 1314 ----
NM_005822chr621893 717 ----12379
NM_005828chr17124854 4813 4721 4612 3300 3171 1822 1349 1290 1014 897 837 --1522 --
NM_005840chrX217636 7447 7327 6834 5995 5930 5552 5183 5059 4822 4680 2969 2475 2164 1817 1704 1346 1273 1237 1154 291 --127 --
NM_005843chr211923 --1488 --
NM_005857chr131184 278 190 ----11168
NM_005868chr782229 2127 1708 811 771 431 129 26 22338 930 ----
NM_005885chr551238 1057 541 440 55 --21476 1435 --
NM_005897chr13427 372 218 ------
NM_005899chr171415 --11115 1182
NM_005900chr431006 759 83 1947 1264 --
NM_005901chr18138374 7398 7225 7196 7119 6955 6551 6078 3105 2877 1779 995 849 17523 35809 2470 1288 --
NM_005903chr594853 4185 4154 4115 3438 3253 2018 816 39 33808 913 83 45201 4639 3757 1773 --
NM_005909chr5103712 3576 3461 3050 3022 2666 1404 1230 769 35 13110 21389 1365 --
NM_005911chr241308 992 444 147 1223 ----
NM_005935chr4115144 5067 5035 1660 1267 967 960 878 543 373 34 13327 21481 783 --
NM_005937chr17103877 3824 3262 3104 2635 1201 545 500 161 145 1710 12853 --
NM_005941chr8113897 3788 3758 2908 2871 2751 1339 1083 1022 501 68 13809 13683 --
NM_005944chr32456 48 1271 1221 1491
NM_005955chr1105398 5314 5152 4134 3912 1296 847 808 281 173 ------
NM_005964chr17----11360 --
NM_005968chr19142 ------
NM_005996chr1231079 1016 483 11376 ----
NM_005999chr161405 1398 1012 495 233 38 ------
NM_006003chr191109 ------
NM_006007chr971684 1608 1052 830 737 415 174 ----14286
NM_006016chr672044 1825 914 852 549 380 26 ------
NM_006022chr134758 688 221 22 --1825 --
NM_006036chr252067 1563 902 619 280 ------
NM_006037chr294171 4068 4024 3910 3490 1746 1585 1544 1299 13864 14570 --
NM_006047chr2083112 2855 2538 2525 2380 2314 613 350 --23332 406 --
NM_006054chr1161624 1268 1086 1076 211 200 ------
NM_006080chr752934 2419 1197 1070 83 --12204 --
NM_006085chr12478 404 ----1532
NM_006089chrX3693 132 124 --21559 439 1458
NM_006090chr12496 172 ------
NM_006094chr822278 942 --32252 1498 53 --
NM_006095chr431547 461 47 23813 1498 23931 1519 --
NM_006106chr1143302 3220 3080 1137 1610 12383 --
NM_006122chr1532639 652 108 22082 1757 12720 11091
NM_006136chr711071 ------
NM_006141chr1652441 1878 835 819 120 ------
NM_006153chr31121 ------
NM_006154chr1562732 1158 873 815 313 79 ------
NM_006158chr831784 1607 167 ------
NM_006167chr842227 2181 1590 711 12046 --1871
NM_006183chr122581 561 ------
NM_006196chr22328 244 ----2322 140
NM_006197chr811676 2302 272 12160 1647
NM_006202chr191253 1481 ----
NM_006203chr5185251 5086 4939 4465 4343 3863 3846 3711 3568 2116 2085 2023 1850 1697 1566 742 328 249 24984 396 24123 649 1592
NM_006206chr452367 481 413 282 182 --3891 341 97 --
NM_006218chr3------1119
NM_006224chr1732466 2256 803 12180 ----
NM_006242chr2031843 1624 1342 --12053 11826
NM_006251chr553102 2866 979 627 387 12897 12594 1892
NM_006252chr1136988 6510 6447 6002 5385 2899 2727 2552 2322 2208 2198 1959 579 --45883 5836 2958 2485 --
NM_006255chr144929 149 132 63 --11110 --
NM_006257chr102952 49 --131 --
NM_006264chr4----1478 --
NM_006275chr203762 389 205 ----11814
NM_006282chr2094704 3561 3343 3017 2931 2924 1218 1206 1095 ------
NM_006283chr874396 4349 3649 3237 1792 1341 577 --44508 4090 1145 660 --
NM_006298chr663193 2759 2507 2476 2383 804 --13180 21352 293
NM_006306chrX75842 5629 4564 3618 1300 708 427 24866 3861 25127 1054 25236 444
NM_006310chr171162 --189 --
NM_006313chr1211139 1395 ----
NM_006315chr481485 1383 1064 906 655 404 368 143 ----14443
NM_006329chr142642 264 --2757 187 --
NM_006335chr131068 717 326 1382 ----
NM_006353chr611263 11332 191 --
NM_006379chr72366 296 ------
NM_006380chr1752882 1629 1506 575 93 13423 23288 1307 --
NM_006390chr1211360 21830 495 21578 1415 11263
NM_006393chr1044416 3794 3243 25 --23896 3638 --
NM_006401chr9129 ----1483
NM_006420chr2053383 2221 1223 1056 646 ------
NM_006421chr83371 344 323 --1836 1976
NM_006434chr1083278 2285 2012 1984 890 676 357 212 ------
NM_006451chr5----1773 --
NM_006457chr453512 3497 2507 415 32 --22600 481 1299
NM_006459chr1021629 612 11238 11659 196
NM_006469chr121556 256 11219 ----
NM_006489chr1431635 1591 1469 --21716 188 --
NM_006516chr121550 1490 ----1164
NM_006520chrX51684 1355 640 423 321 --142 --
NM_006526chr2041867 1520 313 291 21797 234 11738 --
NM_006530chr124367 147 130 103 171 ----
NM_006534chr2053361 1293 819 616 158 11363 ----
NM_006538chr264108 3972 3905 3690 2983 601 --32534 497 190 --
NM_006540chr83974 506 71 --1461 11269
NM_006544chr14135774 5202 5171 4968 4209 2395 2071 1454 1418 1010 989 982 224 ------
NM_006546chr1796370 6158 5308 4953 2674 1874 1213 1114 565 --26272 988 --
NM_006558chr8--1129 --1348
NM_006561chr1076107 2317 1707 1687 1452 1430 857 --21118 891 --
NM_006575chr141144 --1569 --
NM_006577chr241251 1138 826 291 ----1892
NM_006591chr1161758 1493 1443 1420 398 289 11598 ----
NM_006595chr1141960 1836 1503 354 193 ----
NM_006599chr16178162 7799 7007 6953 6232 5770 5226 5192 2778 2769 2525 2291 1853 1281 898 261 70 16990 25311 1328 15973
NM_006601chr12172 --1967 --
NM_006603chrX31679 1667 468 --2622 568 --
NM_006609chr212927 12696 1211 --
NM_006614chr353109 2644 1029 640 394 11340 33578 1289 74 --
NM_006620chr663840 1554 1498 1053 1018 854 14594 24713 3533 34881 4684 1356
NM_006624chr104836 665 387 379 22025 520 2241 88 --
NM_006626chr972234 1944 1799 1787 1690 860 146 --1567 12526
NM_006628chr1554633 3770 1519 1460 508 --1548 11694
NM_006629chr1852732 2676 2107 2005 293 --22723 1056 1734
NM_006633chr5154 ------
NM_006646chr1342408 2012 867 696 12979 21939 1012 --
NM_006654chr1223927 1865 44505 2930 1009 299 11834 --
NM_006667chrX11057 1273 ----
NM_006699chr142707 2627 2136 566 --12263 12331
NM_006713chr51620 --1120 --
NM_006718chr63998 363 145 2790 299 2838 401 --
NM_006720chr10104907 4827 4220 4170 3709 1923 539 348 246 34 11659 192 11619
NM_006721chr103677 636 62 ------
NM_006722chr322599 1136 12825 1158 --
NM_006729chrX65558 5135 3503 1161 983 398 14955 1562 13878
NM_006731chr9145668 4782 4620 4371 4105 4099 3706 3676 1676 1466 1452 1219 1125 173 23657 902 55802 4498 3951 951 26 2620 604
NM_006745chr45993 973 852 738 156 --1834 --
NM_006746chrX31292 144 136 --11195 1417
NM_006750chr1667398 6413 5439 2910 2485 880 25141 497 57516 5253 2316 1902 648 1642
NM_006751chr21180 --2886 311 --
NM_006754chr711242 ------
NM_006756chr821375 527 ------
NM_006761chr172249 196 ----1122
NM_006766chr872680 2435 2133 1784 683 231 122 --22323 328 --
NM_006774chr771722 1699 1152 1106 389 205 159 ------
NM_006775chr613100 12550 12831 --
NM_006777chrX62772 2506 2433 2299 2057 614 --32932 1966 283 --
NM_006805chr531566 1199 344 --1411 --
NM_006806chr211395 ----1327
NM_006810chr3166 ------
NM_006811chr20131 2964 768 ----
NM_006814chr2042087 1986 1073 383 ----11752
NM_006827chr1472326 2071 644 571 187 124 111 ------
NM_006828chr6141 --1511 --
NM_006832chr141202 ------
NM_006838chr1291655 1625 1493 1357 444 196 142 67 42 ------
NM_006861chr121108 ------
NM_006872chr2--1130 ----
NM_006873chr263012 2953 2587 2547 2518 790 33233 2854 2163 23060 1159 --
NM_006885chr1644131 3568 1382 1171 33340 320 35 31615 1197 783 --
NM_006887chr22623 260 ------
NM_006889chr361403 1154 1070 411 387 129 1461 11126 --
NM_006912chr172479 2434 2420 2363 2080 1689 916 1571 22319 224 --
NM_006914chr931360 1292 127 --1297 --
NM_006915chrX31973 827 561 12394 260 23 --
NM_006922chr272208 2134 1926 1789 736 547 75 ----12464
NM_006924chr1774252 3962 3752 3545 3197 1281 737 12997 23145 2787 --
NM_006937chr17130 --1423 --
NM_006939chr142470 146 1376 --1252
NM_006940chr1221373 539 --1680 135
NM_006948chr2152019 1869 1772 1743 32 21977 628 ----
NM_007006chr1662549 1184 664 519 252 165 12437 23437 443 --
NM_007011chr15186310 5573 5356 5108 5097 4498 4434 4201 2759 2593 2383 2369 2115 1516 1506 1002 972 428 16906 14691 --
NM_007018chr91379 ------
NM_007027chr31109 ------
NM_007038chr2174185 2285 2029 1833 1698 523 292 13951 43907 3710 920 552 --
NM_007039chr1452020 1959 1592 797 676 --32008 1719 216 --
NM_007050chr20116500 6345 6225 2921 2706 2439 2279 1891 1389 740 730 13023 11648 --
NM_007054chr533245 2987 1007 13789 2349 154 12448
NM_007078chr1042046 899 273 264 --1466 1347
NM_007106chr1362570 2469 2220 1842 330 118 ----1401
NM_007107chr362148 1856 1686 871 854 475 1885 22394 926 --
NM_007112chr1125 --133 --
NM_007114chr362845 973 953 192 91 68 12505 ----
NM_007118chr52163 60 --1301 --
NM_007137chrX115144 4583 4022 3892 2146 1950 1844 1555 1114 1024 799 --23582 198 --
NM_007146chr1772545 1999 1771 448 437 372 276 --12664 --
NM_007159chr321640 1081 --11705 --
NM_007166chr1151510 1145 392 364 210 ------
NM_007172chr2293137 3014 2170 1191 914 605 291 199 24 ----1103
NM_007175chr831341 1030 470 23506 136 32958 1416 669 --
NM_007187chr13----1926 --
NM_007191chr122610 113 ------
NM_007212chr141600 642 302 31 1581 1689 --
NM_007217chr31289 ----1249
NM_007222chr8166 1150 2425 332 --
NM_007246chr44919 901 404 219 --1965 1247
NM_007249chr13137229 7041 6868 6133 2751 2538 2474 1971 1919 1862 1297 1050 33 38939 7332 3063 69098 8383 7977 7805 1705 1025 --
NM_007269chr12429 137 --1640 --
NM_007279chr192616 412 ------
NM_007292chr1784818 2058 1915 1515 1401 1325 1071 664 1615 --1304
NM_007308chr43698 642 545 ------
NM_007315chr241055 435 398 150 ------
NM_007324chr12438 299 ------
NM_007350chr1274551 4276 3870 3110 3096 1590 261 --34570 969 39 1470
NM_007361chr141440 --1236 --
NM_007363chrX2658 65 ------
NM_007373chr1021827 208 --4664 575 431 159 --
NM_007375chr182445 1989 775 642 362 313 182 172 --198 --
NM_012080chrX1971 --1897 --
NM_012082chr8--1848 ----
NM_012095chr1043189 2893 1032 169 --1649 --
NM_012096chr393619 3605 3397 2877 715 455 300 153 36 1765 32591 503 279 13668
NM_012097chr231797 304 50 --1313 --
NM_012104chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_012104chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_012108chr43136 130 77 ------
NM_012120chr632223 647 58 2726 158 11004 12421
NM_012129chr741967 220 187 65 --11889 --
NM_012137chr192749 2481 2048 1941 920 882 680 662 237 ------
NM_012141chr1364186 3944 3461 2853 595 346 ----23364 1536
NM_012158chr1321641 219 ------
NM_012161chr43867 852 782 1815 ----
NM_012164chr9127191 6891 6580 5616 5437 5062 4810 2738 1971 1856 1747 778 --27127 2824 --
NM_012175chr112840 322 1604 ----
NM_012193chr1155249 5024 2063 1224 966 1914 44725 4535 771 551 --
NM_012199chr194264 1866 1732 1678 1634 1596 952 805 480 13551 24070 3424 --
NM_012207chr1021085 763 --2396 91 --
NM_012214chr2165734 5230 5196 5114 4715 4687 4397 4382 4361 4243 4220 1983 1729 1656 1473 37 --12405 15562
NM_012224chr43909 123 48 11137 ----
NM_012234chr373504 3407 1298 1252 665 373 166 ----12945
NM_012238chr10148 11501 1649 --
NM_012243chr11648 --3916 722 74 --
NM_012247chr101227 11027 ----
NM_012249chr2103164 2957 2817 2723 2380 2179 1310 319 307 135 12777 12476 --
NM_012250chr1121394 417 --11038 --
NM_012252chr7125006 4956 4638 4426 4182 3920 3567 1998 1315 749 329 150 13979 65301 5231 1990 1619 1510 571 --
NM_012255chr202452 346 ------
NM_012257chr7--1357 ----
NM_012262chr144780 3941 3917 1112 1272 15027 13515
NM_012281chr762048 1865 1653 489 280 28 ------
NM_012287chr364513 3676 3106 3057 2871 535 ------
NM_012290chr251645 657 499 133 35 --11380 --
NM_012294chr773866 3831 3316 2948 1582 1270 557 13100 11630 --
NM_012297chr42226 219 1270 1696 --
NM_012301chr71821 12064 2771 335 --
NM_012302chr121269 160 ------
NM_012307chr181133 --1958 1721
NM_012309chr11114642 4444 4015 3948 3868 3673 3070 1895 1556 1435 921 --34474 3928 1925 --
NM_012316chr174060 3943 2044 1626 1302 1220 309 --24224 4096 13956
NM_012322chr72381 62 ------
NM_012329chr1741436 231 163 67 ----1425
NM_012334chr583864 3612 1814 1243 710 484 350 100 --23851 1275 --
NM_012345chr1361482 1184 699 693 309 141 --1241 --
NM_012382chr554300 3578 3434 3098 1222 21754 1338 23091 2761 --
NM_012388chr15103159 3145 2510 2443 2423 1173 890 585 502 315 ------
NM_012414chr1184 ------
NM_012416chr94914 359 140 88 11092 21113 380 --
NM_012417chr17------1613
NM_012467chr16--1120 ----
NM_013229chr1242705 1917 1778 29 12821 1323 --
NM_013231chr1444198 1348 924 890 1678 33430 2975 2919 --
NM_013232chr51343 1362 ----
NM_013233chr231172 544 373 ------
NM_013250chr1141319 186 138 44 31229 1102 64 ----
NM_013255chr7218827 8706 8565 8199 8121 6964 6385 6250 5641 5353 3423 3000 2438 2405 1860 1158 888 639 605 281 102 17696 57414 6605 2141 1854 970 15371
NM_013257chr822106 180 --22376 1902 --
NM_013261chr4113397 3325 2959 2949 2931 2612 1377 1024 732 379 96 11270 33447 2481 462 --
NM_013262chr641457 1437 406 23 --1420 --
NM_013269chr1273933 2989 1544 558 364 351 46 1808 21456 1296 179
NM_013282chr1921019 208 1183 --1960
NM_013296chr1------2312 79
NM_013301chr191369 ------
NM_013302chr1653579 2990 2889 1473 1406 13771 11619 13071
NM_013309chr1562615 2543 2428 914 393 325 --11067 --
NM_013322chr711347 1312 ----
NM_013336chr361522 509 354 199 113 93 --1573 --
NM_013372chr1553246 2567 2225 2137 976 --12276 13351
NM_013380chr191306 1235 2175 62 --
NM_013381chr1251758 1682 1612 867 127 1813 ----
NM_013410chr111263 ------
NM_013446chr731251 1103 308 1242 1126 --
NM_013448chr142714 564 ------
NM_013943chr163188 2685 2231 2074 814 449 13033 3865 562 339 --
NM_013989chr1494446 4125 3628 1825 1443 1437 1419 297 64 14458 23827 3646 123
NM_014011chr262634 2522 2199 1860 307 195 22133 1982 42043 1932 1000 655 1945
NM_014016chr34661 452 151 52 ----11558
NM_014021chr162660 2406 2189 793 640 126 12911 ----
NM_014028chr653075 2956 2831 2445 1171 12142 41322 1305 144 119 --
NM_014033chr1242262 1791 820 22 ----141
NM_014034chr621351 51 11390 2511 102 --
NM_014043chr341612 1359 661 215 ----11214
NM_014048chr16104300 3908 3727 3562 3475 3401 1563 1177 917 188 --34446 1526 1281 --
NM_014058chr42585 78 --1305 --
NM_014089chr1362043 1650 1573 1469 140 134 1185 ----
NM_014112chr865305 4609 4305 3462 1333 309 --34480 1175 350 --
NM_014117chr1642218 1894 1717 828 --1632 --
NM_014149chr71582 ------
NM_014154chr32465 282 1629 ----
NM_014155chr11136884 6739 6427 5278 2423 2244 2162 2023 1918 983 516 250 126 --47074 6290 5486 400 15266
NM_014171chr23633 218 55 --2210 122 --
NM_014176chr1171 ------
NM_014178chr14170 1536 ----
NM_014181chr242944 2693 680 665 --12357 --
NM_014217chr11314 --2154 44 --
NM_014240chr383481 3178 3135 2533 1623 1212 927 352 --44123 1184 751 498 13050
NM_014243chr441836 646 409 201 --21859 1775 --
NM_014253chrX51915 1904 809 239 88 ----1379
NM_014264chr4--1243 1117 --
NM_014268chr18159 --11136 --
NM_014270chr19--137 ----
NM_014271chrX3240 157 66 ------
NM_014283chr131543 1181 593 --11496 --
NM_014289chrX21038 903 --11147 --
NM_014294chr81478 ------
NM_014309chr22174867 4518 4408 4361 4305 3969 3658 3621 3318 1679 1522 1272 1201 571 549 392 71 1894 ----
NM_014317chr10----155 --
NM_014325chr1271703 1481 787 309 267 215 163 --144 --
NM_014329chr161267 ------
NM_014331chr4177728 7389 6995 6712 6391 6187 6057 5459 2601 2457 2420 2279 1931 1895 1536 1021 87 46764 5089 2083 1760 57127 6646 6374 5851 2205 22256 673
NM_014333chr1172229 2049 845 764 709 407 73 ----1555
NM_014342chr112342 51 ------
NM_014344chr111693 ----1832
NM_014363chr1331013 496 129 ------
NM_014372chr152009 1922 1665 842 647 ------
NM_014376chr562405 1704 1009 892 392 280 12421 ----
NM_014382chr31705 --194 --
NM_014386chr5163 --1118 --
NM_014397chr931479 1170 1033 --1928 --
NM_014398chr341713 1671 421 42 135 31633 1332 1153 --
NM_014423chr584881 4668 4641 1836 1130 1069 481 435 21943 573 35260 4339 1870 11294
NM_014445chr342383 2222 798 40 --11690 --
NM_014447chr451659 1605 1428 659 64 ------
NM_014454chr63354 331 202 --21094 388 --
NM_014456chr1031623 1217 153 --1480 11161
NM_014494chr161385 11679 21481 621 --
NM_014517chr311317 ------
NM_014562chr21113 --1799 --
NM_014575chr31365 ----137
NM_014577chr221846 ------
NM_014583chr32464 458 ------
NM_014584chr1451238 1068 489 131 57 11446 1422 --
NM_014585chr23353 127 71 ------
NM_014586chr2174500 4125 1506 1071 1055 548 53 --11802 11784
NM_014607chr242029 1509 1373 331 ----1431
NM_014612chr911400 --21217 120 11233
NM_014615chr1663138 2916 2451 2317 1345 677 11419 --11048
NM_014616chr362887 2733 2675 719 502 434 22927 1334 12154 12721
NM_014620chr122655 616 1732 1765 180
NM_014628chr6--1380 1342 --
NM_014630chr15113883 3576 2862 1371 1355 1288 1056 575 483 390 207 --13197 --
NM_014635chr241473 1295 448 322 1364 ----
NM_014636chr973782 3744 3617 2721 1464 1431 804 12962 24174 3769 --
NM_014637chr831447 995 909 --11025 1544
NM_014647chr1661749 1716 1630 887 681 22 --1228 --
NM_014653chr1212026 --21587 824 --
NM_014660chr741127 969 342 244 3868 439 409 ----
NM_014667chr3101614 1579 904 777 535 498 465 309 211 51 ------
NM_014670chr211514 ------
NM_014676chr141557 1503 1361 1041 --11696 --
NM_014677chr861287 1162 1154 1136 212 202 --11190 --
NM_014679chr1111405 ------
NM_014682chr842153 1494 575 497 --1684 --
NM_014689chr22156 46 --2139 37 --
NM_014701chr1582867 2286 1289 1047 893 422 364 194 ------
NM_014702chr652510 2251 1281 898 554 33479 2937 830 1189 --
NM_014705chr74861 755 476 207 22039 2028 ----
NM_014707chr722156 2080 22141 2097 --1403
NM_014720chr1031566 725 701 --11243 --
NM_014721chr6107337 6798 6155 5760 5427 2862 2471 1723 1040 808 1517 1680 1497
NM_014729chr851991 1958 1829 1563 134 ------
NM_014730chr12205181 4618 4593 4096 4030 3875 3413 3362 3341 3253 2096 1801 1689 1558 1375 1245 1232 748 609 315 14833 23489 489 --
NM_014730chr12205181 4618 4593 4096 4030 3875 3413 3362 3341 3253 2096 1801 1689 1558 1375 1245 1232 748 609 315 14833 23489 489 --
NM_014732chr1675585 5228 5173 4051 303 134 30 --24065 2141 12067
NM_014733chr522082 1938 --2678 571 --
NM_014739chr634032 2922 1459 --135 --
NM_014746chr264246 2916 2784 999 383 117 11346 --11298
NM_014748chr2--143 ----
NM_014751chr82671 153 --1753 --
NM_014752chr1121386 412 ----2496 80
NM_014755chr274140 3979 3473 3028 1350 1315 1192 --33021 1509 1295 --
NM_014764chr1251261 985 898 362 344 ------
NM_014765chr131869 873 692 --22465 202 12424
NM_014774chr163233 3205 2781 2388 2381 997 --1985 --
NM_014776chr1263136 2933 2829 840 445 71 --21009 509 --
NM_014781chr851290 1137 1062 858 458 1351 ----
NM_014787chr182617 2515 2303 1895 1032 565 547 215 ------
NM_014795chr231377 1222 301 ------
NM_014802chr124758 112 92 22 --2907 157 --
NM_014803chr1072663 2648 2439 2295 808 426 410 --1755 22758 718
NM_014807chr11--1835 ----
NM_014810chr133399 2864 2837 13250 23095 629 12708
NM_014824chr1161839 1769 757 670 661 437 1567 --11357
NM_014827chr131351 1304 1271 2307 51 1105 11185
NM_014828chr1452381 1918 1904 603 179 --1325 11878
NM_014839chr162151 1729 1675 984 139 121 11711 ----
NM_014840chr1233189 2797 481 --2405 211 --
NM_014846chr82308 65 ------
NM_014850chr394372 4254 4023 3630 3506 1911 1121 576 140 --23958 3425 1591
NM_014864chr194296 4161 3799 3516 3238 3072 967 546 434 11111 ----
NM_014871chr123246 167 57 ------
NM_014872chr942245 1996 138 49 ------
NM_014873chr164218 3180 1835 1035 814 467 --13925 --
NM_014877chr17116865 5244 5195 5009 2145 2090 1244 1175 925 73 58 26645 846 ----
NM_014883chr452554 2130 673 539 285 --32023 653 420 --
NM_014892chr62628 103 --1404 --
NM_014893chrY22185 304 22024 1527 2697 503 --
NM_014897chr1743228 1281 1183 283 --1117 --
NM_014899chr542854 2748 2501 1242 13130 21174 1149 --
NM_014900chr2----2231 124 21058 167
NM_014903chr1231987 312 145 22357 1974 12158 --
NM_014904chr1062874 2683 1192 1040 355 251 21407 834 44030 3556 3291 1145 --
NM_014906chr1753948 3798 1536 1521 653 ------
NM_014912chr1063286 1377 1265 1008 197 125 --22697 2353 --
NM_014920chr6113708 3573 3422 3164 3085 2772 2487 935 653 600 312 13292 11126 --
NM_014923chr1352102 1898 944 771 720 12287 11514 1402
NM_014924chr1443096 3054 2544 2386 1800 22855 1096 12352
NM_014932chr331785 311 246 22019 1436 21571 134 --
NM_014934chr1343119 3030 2490 328 --13746 --
NM_014936chr621098 434 ----22660 111
NM_014944chr111043 ------
NM_014946chr2142931 2885 2861 2733 2425 2406 2212 2101 1988 1923 1051 990 923 846 1831 1104 --
NM_014947chr143116 2394 903 646 --22036 592 22449 1235
NM_014951chr1022606 1826 --1184 1154
NM_014952chr1541613 1355 496 210 21832 1572 11899 --
NM_014961chr461685 1476 1419 451 137 128 11552 ----
NM_014962chr2072692 2598 2309 622 401 337 205 12772 1934 --
NM_014964chr1762404 1926 1702 892 646 548 --1338 1720
NM_014974chr1071555 1453 1347 1198 409 201 26 1190 2216 147 --
NM_014982chr14124679 4673 4625 4544 4419 4156 3804 2118 1315 1161 693 134 33815 2068 976 --11749
NM_014988chr422570 394 ------
NM_014989chr661915 1852 1667 1426 1416 1290 ------
NM_014991chr453159 3096 1108 1067 332 --12328 1462
NM_014992chr142872 558 ------
NM_014999chr1251545 1469 1242 189 111 11614 11222 --
NM_015000chr1242391 1926 886 34 2946 855 42336 2146 1134 797 23052 585
NM_015009chr31740 --2697 224 --
NM_015020chr1673481 2472 1441 1153 975 898 55 --22508 630 --
NM_015025chr252667 2554 2099 533 103 1492 42520 1974 957 481 11673
NM_015026chr1253871 1644 1179 784 486 1293 1422 11468
NM_015032chr13--12829 32836 692 374 --
NM_015035chr2086201 5619 1957 1818 1643 1360 1269 26 16486 34957 4885 127 --
NM_015039chr143655 3581 3226 1411 1917 33590 3495 521 --
NM_015040chr293385 3221 2969 2362 1263 548 418 409 172 --1466 --
NM_015042chr1574094 3824 3047 2774 1609 531 213 23418 1451 14186 13011
NM_015045chr1022010 536 ------
NM_015049chr283333 3062 3019 2753 2530 2504 1172 330 ------
NM_015057chr131556 ------
NM_015061chr93684 661 612 --1563 --
NM_015064chr12103433 3253 2646 2507 788 743 646 618 421 271 --33333 3003 62 --
NM_015068chr7123787 3654 3197 3116 3081 2969 2940 2772 1381 1241 941 496 --1997 --
NM_015071chr5125918 5369 5332 4444 4221 2556 2529 2481 1610 1366 894 29 --15200 --
NM_015074chr1104845 4186 4111 3490 3256 3077 1263 795 688 631 ------
NM_015076chr663768 1421 755 706 665 153 11575 23514 809 --
NM_015090chr1136205 5903 5076 4960 2498 2178 2072 1928 1316 1210 952 351 220 16159 35602 4526 849 --
NM_015091chr143796 328 58 ------
NM_015092chr16134233 4142 3923 3841 3781 3167 2959 1779 1730 885 577 551 349 --13812 22993 609
NM_015093chr631447 341 154 --1484 --
NM_015110chr971794 638 538 342 215 30 21 ----1960
NM_015115chr451964 1003 934 458 227 ------
NM_015137chr872567 2318 2182 1637 1606 961 63 --1398 1699
NM_015138chr1562132 2126 2079 1796 1765 1043 --22456 979 --
NM_015144chr16103478 3210 3056 1325 1188 1161 1072 370 207 195 21301 91 ----
NM_015147chr263170 2894 2279 2115 731 658 --11099 --
NM_015153chr6--1215 1786 --
NM_015154chr1573394 2519 956 614 579 158 48 12539 ----
NM_015156chr1463990 3812 2695 2495 1518 202 --1971 11530
NM_015161chr1611203 11280 ----
NM_015170chr83635 513 507 11714 21726 562 --
NM_015172chr141449 1151 476 54 --21250 118 1254
NM_015192chr2032545 289 158 22781 2254 ----
NM_015198chr72424 21 ------
NM_015199chr382868 2337 2012 1995 714 680 233 181 --22434 855 --
NM_015200chr482499 2358 2324 2302 2254 2240 922 824 --12423 --
NM_015208chr1874021 3601 2883 2795 2743 1425 165 13208 ----
NM_015215chr163100 2593 847 836 368 247 12426 ----
NM_015216chr55617 570 427 135 22 --11168 --
NM_015230chr421432 1210 11778 31531 608 99 1494
NM_015233chr1362734 2389 2175 470 398 269 --22187 283 --
NM_015236chr421159 569 ------
NM_015250chr941641 1481 1334 487 --1823 --
NM_015251chr1632264 2191 849 --11987 --
NM_015263chr15----1116 --
NM_015265chr21368 --12675 11878
NM_015267chr1242220 2162 1981 94 1362 ----
NM_015269chr1----1439 --
NM_015270chr1221760 1701 ------
NM_015271chr473931 3660 3074 1658 1452 966 118 --1368 1589
NM_015275chr1252058 1401 591 226 43 11856 ----
NM_015277chr1851815 1490 1435 720 546 --1598 1247
NM_015288chr583189 1503 1432 962 905 575 319 312 --11314 --
NM_015291chr183249 3211 2598 2551 2533 2505 1201 72 11019 12993 --
NM_015299chr1463904 3882 3825 3789 3117 2682 11335 13972 11153
NM_015310chr8197532 6888 6778 6762 6655 6004 5896 5209 3338 3148 2944 2795 2315 2107 1883 1690 1485 1311 471 25510 3370 36965 5409 1413 37621 626 363
NM_015313chr1173716 3272 2926 1903 1436 1422 1232 --23223 283 --
NM_015314chr731945 601 141 --22294 2089 --
NM_015315chr543351 2420 985 877 12537 23205 2384 --
NM_015317chr252271 948 875 847 437 --149 --
NM_015319chr12----1478 --
NM_015328chr751186 612 567 76 40 22035 937 2846 25 --
NM_015329chr1952686 1996 896 604 474 --1113 11867
NM_015335chr1262641 2469 2427 2295 1871 452 11023 11864 --
NM_015336chr121128 22489 2415 21959 1065 1802
NM_015344chr862116 1892 1866 1847 365 33 1260 11452 1697
NM_015349chr642664 2595 2533 724 --12142 --
NM_015352chr20113942 3902 3169 2772 2631 1380 1320 1245 978 387 247 --1186 13449
NM_015355chr1721678 68 --1323 --
NM_015365chrX42932 1688 1253 635 --1278 1865
NM_015375chr1114739 4308 4129 3749 3583 3467 1393 1243 565 421 109 1438 34462 3352 71 --
NM_015385chr1083278 2285 2012 1984 890 676 357 212 ------
NM_015387chr211336 11889 22102 340 1254
NM_015393chr433554 1219 66 ------
NM_015436chr462961 2840 2736 2634 495 361 --32778 458 26 --
NM_015443chr17--3297 126 117 --1588
NM_015446chr131629 1429 1410 11397 ----
NM_015455chr573600 3331 3239 3193 1560 744 115 1442 11042 --
NM_015458chr874395 3730 1807 1776 1386 734 717 --35076 4120 3749 14811
NM_015460chr332111 1941 1854 ----1714
NM_015461chr183255 164 27 --1602 --
NM_015481chr1211108 ------
NM_015520chr332224 1001 165 22571 1078 --12304
NM_015525chr62244 182 1412 1460 1352
NM_015530chr21234 ------
NM_015535chr273484 3157 2800 2778 2613 1235 366 --14149 2799 422
NM_015541chr321301 530 1394 21250 142 --
NM_015550chr772506 2377 1078 782 716 635 401 ----12364
NM_015554chr151411 22334 2123 32289 2031 796 --
NM_015560chr332877 2809 2514 --22238 2153 --
NM_015565chr2161788 670 589 413 315 308 1719 1753 --
NM_015567chr1331010 950 25 ----1879
NM_015568chr2084310 3486 2980 2738 1662 1488 989 126 --1435 --
NM_015569chr144768 1328 1104 539 11597 21567 615 1962
NM_015571chr642012 741 344 75 2859 847 --12143
NM_015575chr272904 2743 2544 970 912 829 518 32976 2932 2365 23271 3197 --
NM_015578chr1921422 33 1288 2648 537 --
NM_015601chr103831 727 271 1846 --1703
NM_015602chr171358 514 205 94 79 72 43 11285 ----
NM_015610chr7102676 2649 2412 2198 1108 862 700 608 214 79 --157 --
NM_015640chr194971 4548 3949 2085 1418 1398 1097 161 139 24644 2016 --14668
NM_015642chr3------184
NM_015678chr1331743 1566 629 ----11304
NM_015711chr192824 808 ------
NM_015713chr873087 3044 2892 2631 844 543 99 --23476 2594 --
NM_015723chr73521 193 181 1728 ----
NM_015844chr181874 1855 ----
NM_015845chr181652 1633 ----
NM_015846chr181874 1855 ----
NM_015847chr181874 1855 ----
NM_015852chr742288 618 534 198 12874 23483 244 13073
NM_015866chr131229 1071 1011 1349 --11505
NM_015885chr111655 --168 --
NM_015886chr885471 5377 4661 4434 1631 988 593 495 25149 950 35447 1142 76 --
NM_015888chr162475 2278 1104 1068 453 184 12216 ----
NM_015892chr107269 241 199 175 154 111 79 2750 414 1854 --
NM_015902chr81377 ------
NM_015906chr133113 3062 588 --11548 11280
NM_015912chr852151 1785 724 418 214 --151 --
NM_015915chr14--1290 ----
NM_015939chr20125 --1662 --
NM_015948chr6----130 --
NM_015975chrX21796 633 11862 11343 11378
NM_015984chr11458 ----174
NM_015994chr14--1220 2622 105 1229
NM_016002chr11213 --1724 --
NM_016003chr7102676 2649 2412 2198 1108 862 700 608 214 79 --157 --
NM_016009chr174597 4187 3095 1510 1314 437 283 1905 43754 1524 473 189 21176 178
NM_016018chr852438 2337 1041 457 435 12062 1290 --
NM_016021chr663015 2704 2616 2382 981 74 --11012 --
NM_016023chr851574 1343 675 468 191 --12094 --
NM_016025chr1621376 1354 1129 21712 735 --
NM_016057chr123839 433 61 1858 11118 --
NM_016070chr172218 188 ------
NM_016072chr1241894 1770 1496 317 ------
NM_016073chr152827 416 --1906 --
NM_016083chr643146 2680 1545 714 --2687 36 --
NM_016090chr1111011 ------
NM_016096chr822036 403 --11581 --
NM_016107chr511347 --1936 1101
NM_016120chrX2936 777 ----11030
NM_016121chr17919 881 867 425 136 111 63 ------
NM_016125chr17----1408 1129
NM_016131chr252057 1605 529 383 352 ------
NM_016132chr1573347 2795 2763 2644 1024 614 109 ------
NM_016138chr1631555 727 108 11707 11609 --
NM_016206chr3138962 7833 7796 7298 7011 6800 6072 5994 5670 2395 1794 1680 1483 58123 3013 2334 2053 1936 37757 6658 500 26445 1198
NM_016218chr521148 61 --2360 191 --
NM_016224chr642201 1710 817 808 --2829 263 --
NM_016227chr131543 1181 593 --11496 --
NM_016231chr1721419 281 1242 ----
NM_016248chr1353877 3518 3391 2606 1451 --33398 3303 852 23411 3063
NM_016252chr2--2727 607 ----
NM_016255chr652844 2738 2688 2626 2502 1778 2295 167 --
NM_016258chr12144 76 --183 1164
NM_016260chr2157324 6507 4945 2346 2323 1964 1944 1827 1810 1489 1301 1230 844 353 41 2576 252 52933 2897 2650 1649 396 --
NM_016271chr1832225 1935 292 --22085 751 --
NM_016275chr322609 619 22768 2122 21768 1010 12647
NM_016289chr232309 720 229 --2625 460 11930
NM_016304chr152582 60 --1622 1783
NM_016308chr13654 432 409 ------
NM_016315chr231559 1343 244 --11615 --
NM_016338chr52962 779 ----1201
NM_016357chr1231279 873 135 1391 ----
NM_016374chr131563 1470 1325 ------
NM_016374chr131563 1470 1325 ------
NM_016376chr1773402 3359 3284 2724 808 603 462 14323 33110 2716 1225 --
NM_016395chr1511476 1153 11411 11587
NM_016396chr1552902 2108 353 279 223 --1512 --
NM_016422chr1173062 2887 2811 2105 1133 703 593 12905 ----
NM_016441chr252385 1838 1795 774 508 --173 --
NM_016462chr6136 ------
NM_016467chr221237 42 ------
NM_016480chr53917 601 201 ------
NM_016485chr631875 337 43 1892 ----
NM_016507chr1722102 427 --22914 2595 --
NM_016513chr6113708 3573 3422 3164 3085 2772 2487 935 653 600 312 13292 11126 --
NM_016519chr4----1546 --
NM_016530chr1544104 1602 1067 816 33785 2743 121 23391 600 23752 1278
NM_016531chr443061 2994 2983 1536 21281 131 24115 819 --
NM_016542chrX11202 ------
NM_016559chr361354 1244 557 355 223 80 ------
NM_016569chr1231079 1016 483 11376 ----
NM_016570chr121469 ------
NM_016577chr394153 3967 3793 2787 1706 1647 1584 1344 684 11726 ----
NM_016578chr113564 511 171 ------
NM_016603chr572110 1982 1425 860 732 702 296 --22254 319 --
NM_016605chr542378 2211 2156 321 --1364 --
NM_016620chr111129 --11057 --
NM_016621chr1164216 4072 3225 1755 1400 101 13892 --13169
NM_016626chr1821737 254 --11184 --
NM_016631chr213988 970 776 1344 1921 --
NM_016639chr16------1531
NM_016651chr142841 362 ------
NM_016652chr2071699 1638 1426 1260 1254 569 55 --1186 1709
NM_016823chr1731246 1015 529 ------
NM_016824chr104542 202 128 120 --1343 --
NM_016831chr162341 2323 1943 1523 1487 74 --1738 --
NM_016929chr6104308 3528 3447 1758 1573 1403 1250 505 140 38 --14484 --
NM_016936chr161769 ------
NM_016946chr172715 2499 1344 1036 960 384 219 12572 33438 1336 650 --
NM_016953chr265300 4034 3991 2294 617 532 14712 25441 508 --
NM_017412chr851419 482 399 332 198 --2562 448 1508
NM_017415chr584139 3237 1644 1621 1360 1157 724 604 --21409 1371 --
NM_017420chr1472721 976 904 682 602 309 177 13825 22945 2784 22618 1111
NM_017423chr451769 684 610 527 55 1654 1576 --
NM_017431chr24732 521 67 59 1684 ----
NM_017437chr1462314 1767 698 400 210 70 ------
NM_017440chr122646 185 --1589 --
NM_017447chr21104384 4010 3978 3541 3225 1694 1596 1265 655 222 34206 1650 1023 1843 --
NM_017452chr2041294 964 450 80 ----21029 955
NM_017453chr2041294 964 450 80 ----21029 955
NM_017454chr2041294 964 450 80 ----21029 955
NM_017516chr112837 21 ----195
NM_017544chrX3972 276 150 --1808 --
NM_017548chr352175 1385 614 363 190 ------
NM_017563chr356260 5376 5032 1898 1660 --46383 6120 1947 1371 22554 512
NM_017569chr13196 ------
NM_017577chr341635 263 257 225 140 11080 --
NM_017580chr1032300 2054 1846 --2241 191 --
NM_017594chr952588 1154 335 302 243 12435 22302 2155 --
NM_017599chr1241587 1335 654 524 --21740 314 --
NM_017610chr1521960 384 1109 2739 333 --
NM_017626chr1031774 1616 444 --2689 53 --
NM_017628chr495139 5105 4914 4814 4178 2131 1792 310 126 15087 44049 982 619 97 --
NM_017633chr653904 3144 2425 1542 489 ----21581 622
NM_017635chr1111010 --11397 11082
NM_017637chr9159402 9007 8855 8543 7854 7350 7223 6888 3741 3331 2802 2253 477 452 198 --16863 --
NM_017641chr123990 909 259 ------
NM_017643chr1772504 2086 2005 686 638 286 48 --32277 2213 239 11022
NM_017644chr374473 1950 1782 1434 1398 600 72 --44438 4090 3968 2088 --
NM_017650chr7115474 5175 4868 4783 3745 1581 983 469 375 314 131 11215 ----
NM_017657chr2--1703 1612 --
NM_017658chr1474590 4322 3635 3618 2837 1515 1304 22938 710 ----
NM_017666chrX31955 1814 697 ----11980
NM_017672chr152194 116 ----1855
NM_017676chr531867 1334 214 --21489 448 --
NM_017680chr93406 337 165 ------
NM_017686chr111013 ------
NM_017693chr1361624 1578 1473 1354 1243 55 ------
NM_017694chr232024 1555 431 1691 2281 242 --
NM_017705chr15103680 3531 2843 2826 2616 1137 524 400 373 329 --13069 13807
NM_017709chr1133772 3579 3205 1291 1249 1158 1141 1131 892 828 757 609 105 12625 34277 3639 336 11668
NM_017719chr332456 936 861 ------
NM_017736chr1653158 2683 2634 2144 592 12273 1628 1937
NM_017741chr442259 908 771 468 ------
NM_017753chr93935 776 399 --3900 391 216 --
NM_017754chr6114853 4761 4151 4047 3872 3466 3190 1600 1131 817 469 --23223 433 --
NM_017761chr13453 365 91 ------
NM_017762chr1532114 1629 121 ----1505
NM_017769chr1452774 2709 2347 739 621 1779 ----
NM_017772chr631770 667 576 ------
NM_017784chr3--1184 2883 21 --
NM_017799chr1411418 --11804 --
NM_017811chr982887 2443 1962 1203 1157 755 601 349 ------
NM_017813chr8115284 5094 5086 4939 4383 4086 3951 3689 1897 356 111 23785 1875 11689 --
NM_017831chr1853891 1565 1185 940 804 14596 --14726
NM_017832chr921185 1171 11143 ----
NM_017848chrX114073 3844 3306 2922 1703 1679 1546 1514 1484 807 170 --23280 3134 --
NM_017902chr10105571 5179 5033 4459 4150 3638 1388 1204 497 192 ----25425 4234
NM_017919chr975066 3880 3819 3757 1887 1333 1062 --35760 647 304 --
NM_017922chr141255 ------
NM_017935chr42773 70 --1140 --
NM_017945chr361384 1253 921 437 219 192 ------
NM_017952chr2104530 3924 3440 3405 3390 1459 704 363 121 62 --13276 13500
NM_017953chr12207 107 ------
NM_018004chr3--1153 ----
NM_018017chr1052802 2796 2763 2390 662 1541 ----
NM_018025chr191242 ------
NM_018027chr1053216 2214 1265 465 50 --13263 --
NM_018046chr551953 1907 527 313 95 --21222 48 --
NM_018048chr1241987 1661 660 378 --11856 --
NM_018061chr121485 1296 ----1594
NM_018084chr232826 2507 871 1382 11316 1249
NM_018085chr1188033 7519 7207 6784 6752 6624 6292 5894 5818 5075 3193 2997 2868 2824 2480 2327 1373 1062 26421 912 37410 2504 414 15857
NM_018089chr21180 ------
NM_018098chr32777 456 1376 11208 --
NM_018133chr321745 265 --1773 --
NM_018137chr121402 1329 11082 ----
NM_018151chr21504 ----2591 285
NM_018155chr373298 3112 2720 2587 2479 900 793 --1894 --
NM_018157chr1293011 2622 2326 1062 713 459 417 258 194 ------
NM_018172chr1141272 1097 1067 49 --173 11167
NM_018181chr1851691 1584 1503 491 443 --1291 --
NM_018184chr361955 1762 795 703 667 48 1825 1254 --
NM_018195chr1182144 2104 1639 774 716 379 339 105 ------
NM_018199chr1441187 894 801 303 11000 21163 965 --
NM_018206chr16----1556 --
NM_018211chr1101992 1949 1937 1777 1636 1583 1521 453 285 125 --21668 442 --
NM_018214chr61314 ------
NM_018221chr2151 --1381 --
NM_018222chr1181850 1683 1357 1338 1165 775 504 418 ------
NM_018241chr41296 1699 --1780
NM_018243chr493880 3704 3182 2774 2764 2544 1244 1179 586 --13743 13240
NM_018247chr693149 2915 2224 2157 2033 1266 776 658 612 --13027 --
NM_018254chr13904 892 586 22296 1720 --21753 786
NM_018257chr2082356 2336 2080 1973 689 527 480 113 ------
NM_018266chr32925 27 --1993 --
NM_018270chr201584 --1790 --
NM_018272chr12----1198 --
NM_018279chr1283023 2860 2306 2253 1196 1158 493 198 12532 1675 1209
NM_018287chr1021110 256 --11194 --
NM_018293chr322630 2492 ------
NM_018294chr101711 --174 --
NM_018299chr853479 3388 2663 574 78 22409 438 12903 12961
NM_018307chr173773 683 77 ------
NM_018313chr382538 2482 2339 2269 1970 1644 1015 306 11675 ----
NM_018314chr112738 182 --1700 --
NM_018318chr123983 151 110 2765 722 ----
NM_018323chr441627 411 300 37 --1493 --
NM_018325chr951125 503 486 411 98 --11666 --
NM_018327chr202677 596 ----1350
NM_018328chr2----1340 --
NM_018330chr1011597 ------
NM_018351chr1261403 929 659 633 225 45 --11624 --
NM_018361chr821310 1247 23508 86 33366 720 137 --
NM_018362chr1163754 3302 2943 1423 1163 1102 --13896 --
NM_018364chr121438 286 13137 23012 466 --
NM_018368chr61299 ------
NM_018370chr1251933 1634 807 291 130 12218 2913 124 --
NM_018371chr81103 ------
NM_018372chr12612 264 ------
NM_018373chr14105912 4697 4334 2228 2149 1914 1825 1469 1217 559 --35969 4488 250 24074 628
NM_018374chr724888 4213 --14680 --
NM_018375chr1421670 708 1295 1319 --
NM_018383chr262030 1349 786 716 545 400 --150 --
NM_018413chr12164 ------
NM_018424chr93762 679 672 1713 1339 --
NM_018429chr552572 2430 2036 1786 135 --1897 --
NM_018444chr852108 1677 1510 942 546 --11559 --
NM_018448chr1231285 998 355 11105 ----
NM_018452chr6_random32737 2411 76 13255 1433 11187
NM_018465chr9137 ------
NM_018476chrX--155 1185 --
NM_018482chr862146 1922 1756 767 354 301 --12429 --
NM_018490chr1131397 555 491 ------
NM_018553chr1751875 1511 563 364 358 --1751 --
NM_018557chr23325 260 207 --1568 --
NM_018566chr174667 3674 3459 2021 1275 716 586 21836 961 34877 4540 1670 --
NM_018569chr41174 --11575 --
NM_018593chr63741 43 30 ------
NM_018638chr1294707 4661 4292 4061 3561 1969 1841 1817 638 13886 25336 1752 --
NM_018640chr1252632 2325 972 472 77 --12001 --
NM_018650chr152166 2056 1526 738 430 --1113 --
NM_018657chr33692 618 297 --1201 --
NM_018662chr184227 3858 3720 3693 2832 1751 479 216 13836 --11686
NM_018665chr6129 ------
NM_018695chr551571 607 371 145 100 --22442 2429 --
NM_018698chrX61935 1920 1624 1614 1232 730 11695 1178 --
NM_018710chr821187 1083 --11296 --
NM_018712chr1151523 1358 1171 1121 313 ------
NM_018713chr131064 856 170 11103 2361 73 --
NM_018717chr431771 616 553 12769 --11023
NM_018846chr73858 271 258 ------
NM_018898chr521667 1509 ------
NM_018899chr521667 1509 ------
NM_018900chr521667 1509 ------
NM_018901chr521667 1509 ------
NM_018902chr521667 1509 ------
NM_018903chr521667 1509 ------
NM_018904chr521667 1509 ------
NM_018905chr521667 1509 ------
NM_018906chr521667 1509 ------
NM_018907chr521667 1509 ------
NM_018908chr521667 1509 ------
NM_018909chr521667 1509 ------
NM_018910chr521667 1509 ------
NM_018911chr521667 1509 ------
NM_018963chr2131520 580 116 --2941 344 --
NM_018976chr1242512 1920 505 150 ------
NM_018983chr41279 ------
NM_018993chr2031459 219 79 --11180 --
NM_018999chr1021695 412 14001 14885 13932
NM_019001chr364592 3749 3522 3423 3103 668 --34287 1777 886 11136
NM_019004chr72732 184 ------
NM_019015chr7189 ------
NM_019022chr1832461 903 465 165 32715 2543 33 11266
NM_019036chr641236 1063 1004 235 ------
NM_019045chrX2830 658 ------
NM_019050chr42639 513 1709 1727 --
NM_019072chr523234 589 ----12653
NM_019083chr141040 617 181 105 --1429 --
NM_019084chr1062268 725 700 489 393 110 ------
NM_019094chr1293647 3635 3387 2776 1092 762 595 210 104 ------
NM_019095chr20----2231 188 --
NM_019098chr831733 629 422 ----1143
NM_019114chr951976 1611 1586 514 381 ----1626
NM_019117chrX23193 505 22252 1378 22809 1225 --
NM_019555chr351544 1232 589 499 436 1406 ----
NM_019590chr1041117 591 393 298 --1335 --
NM_019891chr14526 384 279 100 1903 11142 --
NM_019903chr104542 202 128 120 --1343 --
NM_020066chr11159 --1209 1700
NM_020122chr275372 4887 3817 1849 1514 985 847 --25280 1309 --
NM_020130chr85491 397 318 165 122 ----1381
NM_020132chr2154184 713 421 275 152 1363 13994 --
NM_020135chr61310 ------
NM_020144chr761985 659 630 583 465 208 --11324 --
NM_020152chr213881 799 232 ------
NM_020157chr201839 --1108 --
NM_020159chr431565 1421 535 1548 ----
NM_020177chr593078 2890 2716 2322 2144 1042 674 489 345 13040 33145 2243 944 --
NM_020184chr252097 1816 1663 715 324 12321 1259 --
NM_020193chr1111314 ------
NM_020240chr552003 1104 916 642 176 ------
NM_020245chr644339 1899 1880 1565 --13534 --
NM_020336chr2093634 3206 3025 2725 2581 1380 1091 1002 42 ----1110
NM_020337chr443151 2937 2170 665 ------
NM_020341chr2071812 1380 1328 686 597 441 273 11496 11541 --
NM_020342chr262627 2421 2316 666 512 384 21626 548 ----
NM_020344chr91132 ------
NM_020346chr1121297 534 --11242 --
NM_020347chr341596 1480 250 135 --11723 --
NM_020348chr1072522 2040 1871 1812 951 812 377 --3534 522 45 11070
NM_020357chr331459 1198 280 11501 ----
NM_020379chr1----1233 --
NM_020386chr3136 ------
NM_020390chr344693 1302 1281 199 --33351 1568 741 --
NM_020420chrY51522 1224 593 520 175 --1564 --
NM_020425chr611882 11447 21671 585 11433
NM_020432chr732252 1672 358 ----11815
NM_020443chr1116410 6250 6230 6131 4887 2643 1930 1821 1214 650 211 --36173 4771 176 --
NM_020445chr72720 678 ------
NM_020449chrX4684 669 86 37 --1727 --
NM_020455chr632787 1017 480 12382 2987 286 --
NM_020463chr231067 610 178 197 1373 --
NM_020465chr1651841 1683 1545 1504 815 ------
NM_020466chr664973 4700 3645 1273 1196 1161 13471 11483 1836
NM_020474chr1862028 1757 547 458 416 322 --21857 1540 --
NM_020640chr372210 1805 806 736 684 525 375 ------
NM_020645chr111449 ------
NM_020651chr241479 587 189 22 --1120 --
NM_020654chr31161 11020 11102 --
NM_020662chr671675 1576 481 408 346 168 149 --21776 1631 --
NM_020666chr51814 ----1922
NM_020673chr20157130 6985 5585 5450 4972 2900 2786 1963 1710 1555 1530 1291 740 510 187 27416 5834 37120 6292 2429 16409
NM_020699chr164618 4565 3493 3298 2078 1783 2753 730 14316 --
NM_020711chr262618 2417 2392 2360 1879 1016 --12561 --
NM_020717chrX74874 4420 3444 3082 1688 1273 444 14603 11677 --
NM_020718chr16146242 5554 5502 5279 5207 5116 4957 4749 4687 4658 1761 1208 853 309 16184 25758 419 16515
NM_020727chr2153702 3207 3121 990 825 --22671 1143 --
NM_020728chr762959 2802 2442 883 690 179 ------
NM_020734chr1232837 2228 442 ----12075
NM_020739chr15124093 3683 3486 3248 2680 2614 1578 1232 1005 941 377 93 1879 64075 3781 3762 3657 1091 1080 13587
NM_020747chr51960 ------
NM_020748chr176702 453 389 289 235 161 --21783 151 --
NM_020752chr1092740 2612 2592 2219 1882 1124 869 775 304 ----1421
NM_020766chrX31149 1112 58 23497 295 1113 --
NM_020768chr572943 2253 2079 1041 834 658 417 --12752 12058
NM_020772chr17127645 7536 7325 7135 7031 6610 5898 3221 2331 2060 1146 756 16089 47403 7380 3012 2794 --
NM_020774chr1885563 5535 5447 4771 3866 2224 1957 1596 16164 22408 2272 14425
NM_020775chr11135 ------
NM_020781chr792751 2576 2370 2087 1209 1155 997 166 120 --11991 --
NM_020782chr1254835 3594 1842 1836 1133 ----33754 3028 1924
NM_020792chr382265 1927 526 398 293 286 175 124 --1568 12610
NM_020794chr161507 1355 1236 1089 977 409 11434 ----
NM_020796chr572481 2191 2065 2036 888 738 512 ------
NM_020803chr432372 1501 168 2486 242 ----
NM_020806chr14--1146 1311 --
NM_020810chr1463305 2515 994 783 699 583 --53505 2949 2225 1191 55 --
NM_020813chr1952797 2791 2384 1779 1136 11940 ----
NM_020824chr103684 562 85 ----1726
NM_020825chr1683785 3629 3249 2458 1197 738 684 138 ------
NM_020830chr242726 2120 1043 646 2474 170 ----
NM_020834chr141105 --1647 11634
NM_020839chr31519 ------
NM_020841chr1222829 176 --24021 3740 1647
NM_020845chr1211004 ------
NM_020850chr1663257 2975 2966 760 743 718 12287 1990 --
NM_020854chr1821256 1131 ------
NM_020859chr453513 2787 572 263 190 23995 1572 12475 --
NM_020865chr3----1403 --
NM_020866chr13----3872 848 77 --
NM_020870chr462219 1835 1615 1379 336 87 11775 ----
NM_020871chrX52469 1592 928 661 173 ------
NM_020872chr311355 1212 1326 --
NM_020873chr32795 578 ------
NM_020899chr1792444 2273 2142 2091 2085 1752 881 635 117 ------
NM_020918chr1083546 3471 2575 1422 657 620 364 321 11402 11367 --
NM_020921chr1443066 898 625 566 33617 2241 218 41232 1175 1019 956 12409
NM_020922chrX21623 42 --11385 --
NM_020925chr12560 488 --21079 522 --
NM_020927chr1662259 1931 1914 1855 1801 391 --12336 --
NM_020935chr274577 4339 4116 1760 1740 1337 660 13292 183 --
NM_020940chr1062429 2316 910 458 257 34 ------
NM_020943chr2284 73 ------
NM_020947chr1642261 2246 1972 1695 --11941 21767 1637
NM_020948chr153680 2611 2434 971 842 12394 12426 --
NM_020951chr193965 589 148 --12373 12030
NM_020975chr1031898 1773 220 11810 --11399
NM_020980chr1531599 649 630 ------
NM_020983chr1221760 1701 ------
NM_020988chr16----1216 --
NM_020993chr1282163 1999 1860 977 807 753 178 103 --22761 553 --
NM_021005chr153836 185 152 1777 --1137
NM_021032chr351958 1822 1354 373 262 ------
NM_021033chr13133226 2938 2932 2926 2743 2346 1182 738 605 440 354 131 112 --41060 679 460 80 --
NM_021038chr343149 2857 2322 1250 ------
NM_021061chr864515 4017 3324 1410 1117 957 23770 304 34453 4220 248 --
NM_021064chr62510 470 --1551 2371 92
NM_021069chr421760 1412 --11517 --
NM_021072chr542083 848 683 476 ----1786
NM_021083chrX83579 2661 912 779 685 416 158 141 13329 1480 --
NM_021090chr2294234 4140 4007 3734 3389 2011 1444 1252 458 --13453 13961
NM_021097chr222601 2522 --22745 2347 --
NM_021101chr342521 2141 1828 906 --2736 86 22440 720
NM_021116chr7188829 8466 8450 8338 8293 7979 7893 7455 7093 6947 6435 3358 2788 2743 2049 1040 614 580 18328 28068 7873 --
NM_021140chrX2325 181 --1357 1997
NM_021151chr71248 --11046 --
NM_021156chr2021123 1054 ------
NM_021163chr733169 3002 1261 33284 1448 701 12443 12424
NM_021176chr261914 1889 1180 645 338 304 11254 1507 --
NM_021183chrX21790 100 --179 --
NM_021219chr212233 156 ------
NM_021222chr131105 572 367 11416 --1309
NM_021229chr1251206 880 864 454 89 --1932 --
NM_021238chr124801 697 542 48 11430 ----
NM_021239chr1441379 336 129 66 --21237 59 --
NM_021255chr1483546 3394 3255 2947 2795 2579 758 667 1633 33569 3060 1197 13185
NM_021622chr1042088 1711 1543 636 ------
NM_021629chr375005 4135 3373 2023 1241 817 792 14277 34683 4223 3785 --
NM_021638chr4124972 4951 4648 3840 3492 3212 2013 1707 1565 987 971 503 --21177 397 --
NM_021644chr1021085 763 --2396 91 --
NM_021645chr131172 --12115 11733
NM_021647chr454501 4269 1105 213 171 13551 --14348
NM_021648chr632442 807 772 --12682 --
NM_021813chr695821 5205 5074 5006 4067 3841 1231 586 353 --15696 --
NM_021815chr223026 1156 ------
NM_021911chr585539 5472 4662 1954 1718 1708 973 29 15554 171 --
NM_021912chr1553780 2758 1626 1393 145 --13361 --
NM_021914chr1431982 1562 37 --1959 11622
NM_021940chr62601 29 ------
NM_021949chrX52861 1105 997 735 617 --22234 304 --
NM_021954chr1373192 3183 3015 2310 1304 948 481 --11361 --
NM_021960chr182152 2105 2001 1852 1699 778 445 354 1748 2541 265 --
NM_021961chr1166310 5311 4632 4559 2219 962 17191 27243 2206 12954
NM_021964chr395998 5580 5321 5148 4918 4747 2254 2047 1066 34812 4348 437 46082 4644 2154 668 11925
NM_021977chr653211 2970 1322 1099 1022 12646 23084 693 --
NM_021998chrX2578 571 ----1193
NM_021999chr131262 1572 ----
NM_022048chr15106281 6146 5500 4142 2224 1855 1191 994 316 223 --25014 4106 --
NM_022051chr1----1284 --
NM_022073chr1441561 1146 1137 505 ------
NM_022079chr103831 727 271 1846 --1703
NM_022080chr2072182 1747 1044 727 660 614 335 --12699 --
NM_022114chr154729 4248 4122 3685 2899 24769 1398 ----
NM_022123chr14----1513 1526
NM_022130chr511421 --11125 --
NM_022131chr351508 1362 1304 523 463 --21380 214 --
NM_022143chr761604 1058 512 470 456 419 ------
NM_022351chr873664 3093 2990 2516 1000 962 173 12900 ----
NM_022456chr1296673 5961 5676 5663 5577 5551 4735 2256 204 --21981 1099 --
NM_022459chr1396181 5483 5364 4291 4113 3868 1423 875 823 11231 26120 354 --
NM_022475chr42488 475 ------
NM_022476chr163954 324 77 ------
NM_022488chr3152 ------
NM_022494chr102405 71 ------
NM_022566chr151492 ------
NM_022720chr222591 333 --1578 --
NM_022726chr651737 1610 1283 625 344 --21364 89 --
NM_022728chr71504 --2181 144 --
NM_022763chr352364 2329 1011 875 861 ------
NM_022776chr351210 1186 652 615 344 1590 ----
NM_022777chr741695 1174 491 302 --21406 235 --
NM_022781chr933278 2406 211 172 ----
NM_022828chr521120 133 ----11645
NM_022831chr14191 157 35 24 --11510 --
NM_022840chr182984 175 --21154 117 --
NM_022898chr1454584 4538 4071 3495 675 --14129 --
NM_022900chr72989 432 --1970 --
NM_022901chr911402 ----11611
NM_022910chr1651841 1683 1545 1504 815 ------
NM_022912chr282906 2675 2038 1100 933 860 544 119 11019 ----
NM_022915chr21638 --1569 --
NM_022918chr1131693 1537 90 --11323 --
NM_022977chrX12596 1932 164 --
NM_023000chr1461617 1587 1517 1067 496 295 11216 ----
NM_023001chr1461617 1587 1517 1067 496 295 11216 ----
NM_023076chr1662985 2873 2348 1938 930 762 2490 403 1922 --
NM_023923chr131361 101 74 1679 23804 2615 --
NM_023928chr1221054 936 ------
NM_023929chr892776 2765 2518 2152 2084 690 621 181 72 12133 12843 22713 316
NM_023934chrX51661 853 822 411 175 ----11460
NM_024007chr592894 2707 2541 2241 2155 1250 1209 898 84 --1832 --
NM_024052chr1773112 2659 2399 1021 855 471 37 --152 --
NM_024089chr13----2185 67 --
NM_024312chr1231419 1101 620 --21583 234 --
NM_024345chr9115892 5113 5066 4654 3988 3786 2206 1172 796 430 26 1718 46117 5571 2038 1369 --
NM_024423chr1864272 3754 2927 2637 1712 679 --23100 914 --
NM_024430chr1841694 1254 577 226 ------
NM_024491chr31111 --2666 634 --
NM_024496chr142315 110 1829 ----
NM_024511chr462972 2898 2372 1253 1161 942 --2810 639 --
NM_024512chr373181 2951 2708 2239 1211 291 188 ------
NM_024513chr3113705 3377 3213 2963 2556 2549 2337 1404 1193 874 606 12389 2919 150 --
NM_024522chr171467 207 186 174 168 162 150 ------
NM_024524chr352911 2258 1981 1058 516 --2948 256 --
NM_024529chr111200 152 --163
NM_024539chrX31059 1005 45 --11110 11133
NM_024548chr311778 --2369 121 --
NM_024551chr1232290 1611 597 --21790 553 --
NM_024551chr1232290 1611 597 --21790 553 --
NM_024570chr131242 ------
NM_024573chr62816 238 2844 292 ----
NM_024580chr15--141 ----
NM_024582chr421145 812 2841 201 1330 --
NM_024583chr23879 869 807 ------
NM_024604chr121164 ------
NM_024607chr874349 4155 3908 3776 1405 831 100 11167 21250 942 13707
NM_024613chr821241 106 ------
NM_024617chr91892 --2934 755 --
NM_024624chr241432 1419 1137 579 --11239 1562
NM_024626chr141295 1203 377 59 11386 ----
NM_024630chr62543 198 --1182 --
NM_024639chr6102648 2106 2024 1803 671 347 158 100 93 54 --2860 310 --
NM_024646chr173869 3419 3119 3106 2660 1486 591 1258 ----
NM_024665chr324160 3498 21654 438 24486 1275 --
NM_024686chr11193 ------
NM_024689chrX31280 601 162 --143 --
NM_024700chr141099 991 728 308 ------
NM_024704chr201750 ----2898 858
NM_024713chr1541599 1310 298 88 ----1366
NM_024721chr852321 2164 1874 264 183 22647 849 1375 --
NM_024744chr252291 954 820 801 411 21883 262 2692 437 124
NM_024749chr142100 357 105 76 11965 21558 97 11585
NM_024759chr84855 742 569 232 ----1647
NM_024761chr975338 4948 4655 4645 3250 1910 440 --45172 5068 4211 2120 14418
NM_024766chr2----1324 --
NM_024770chr285542 5304 4405 4237 4231 1869 52 36 22493 229 35389 552 104 14523
NM_024798chr1562796 2778 2726 2473 2293 1835 --32233 184 151 22045 102
NM_024824chr1421375 240 21548 528 176 --
NM_024829chr12179 ------
NM_024841chr1182290 2275 1667 890 800 745 564 471 11691 ----
NM_024852chr11573 ------
NM_024881chr1923593 992 --33490 3368 2505 --
NM_024896chr962269 1812 1673 1607 894 99 --1124 --
NM_024913chr741496 1121 1084 587 11386 ----
NM_024930chr542674 2439 2052 804 --2205 106 12519
NM_024945chr921178 165 --156 --
NM_024947chr3127649 6966 6859 6131 5918 3399 2938 2666 2097 2062 1434 843 19344 58988 7251 6227 3140 607 17133
NM_024949chr484847 4121 4050 3385 1882 903 799 277 --54508 1592 1502 1226 129 --
NM_024953chr1252285 1750 1079 762 139 --2126 102 --
NM_024979chr1321631 1103 ------
NM_024989chr2116931 5966 5903 5563 5395 5319 3149 2597 1998 411 262 47180 7075 6749 2005 45059 4965 2027 575 35624 1818 1164
NM_024991chr1083278 2285 2012 1984 890 676 357 212 ------
NM_024993chr221523 1468 1285 ----
NM_025040chr1972267 2005 1789 1631 1597 1567 893 21717 417 1912 11641
NM_025047chr34440 394 356 184 ------
NM_025054chr8124116 4103 3752 3640 3577 3053 2714 1694 1314 1217 443 199 --14156 1818
NM_025073chr1134673 4603 4268 4203 3508 1737 1329 1194 688 532 461 201 138 24351 4081 33659 1483 1449 --
NM_025074chr4113079 3064 2869 2582 2337 2156 2091 2069 2039 655 331 ------
NM_025076chr22483 121 --1497 --
NM_025080chr11189 --11079 --
NM_025133chr211125 ------
NM_025134chr1642479 2358 2294 999 1715 1904 --
NM_025138chr134496 464 53 42 1555 ----
NM_025146chr322707 2596 --2734 169 --
NM_025151chr841666 757 733 716 --169 --
NM_025154chr751299 1293 1116 599 490 --21447 380 --
NM_025160chr184265 4069 3664 3358 2912 2874 1115 251 13705 54283 2727 1359 948 453 14208
NM_025179chr1124128 4114 4032 3721 3663 3378 1426 1386 764 737 699 141 13495 3709 355 101 --
NM_025191chr152833 1420 1172 1020 175 12524 --13200
NM_025211chr92198 187 ------
NM_025222chr372868 2757 2444 998 220 193 66 --23059 2002 --
NM_025233chr171290 ------
NM_025235chr1051822 1770 727 471 328 --1414 1665
NM_025238chr1531576 447 213 ------
NM_030579chr1653715 3480 3392 1474 1323 --11033 --
NM_030583chr83916 396 207 1221 ----
NM_030621chr1453960 2998 2708 1621 187 23679 371 --1120
NM_030627chr543884 2919 853 717 23265 1313 ----
NM_030637chr141665 2490 132 ----
NM_030640chr122930 888 ------
NM_030647chr7165749 5642 5291 5243 4658 4487 4223 3923 3822 2092 1252 1046 794 322 269 66 15001 11853 11630
NM_030648chr4115356 4610 4298 4180 3914 3398 2228 1957 1855 1399 1018 1787 ----
NM_030661chr741517 1439 613 346 11616 1682 --
NM_030674chr1285798 5731 4235 3912 3651 2030 1477 1314 --43669 1216 1109 316 11581
NM_030751chr102672 44 --1498 11582
NM_030751chr102672 44 --1498 11582
NM_030762chr123719 548 481 1555 ----
NM_030769chr1288 77 ------
NM_030786chr121319 747 ----1479
NM_030791chr1451728 1482 729 680 85 1104 11694 11557
NM_030796chr752099 1965 1955 1518 774 ------
NM_030806chr1199439 9088 9009 8092 7800 7617 6907 6901 6838 6787 6416 6072 5817 2029 1970 655 498 212 164 --58157 7217 7015 6812 5955 13608
NM_030809chr1272264 1875 1856 1810 968 734 274 11716 1344 --
NM_030816chr173316 3246 3048 2791 2615 2472 471 13231 23371 165 11278
NM_030817chr1273460 3020 2850 1146 975 463 205 --33076 448 63 --
NM_030820chr6----1986 --
NM_030885chr352320 2297 1918 516 480 11911 32228 736 95 --
NM_030917chr41154 ------
NM_030918chr185393 4759 3711 3542 1158 1150 976 476 13568 44688 4316 1413 351 13882
NM_030925chr1362085 1990 1435 729 358 339 ------
NM_030927chr10----11060 --
NM_030939chr631197 1010 276 --1784 1175
NM_030958chr82443 361 --1372 122
NM_030962chr1121344 38 --21390 1307 --
NM_030979chr131401 --1305 --
NM_031203chr19142 ------
NM_031262chr92809 755 ------
NM_031263chr93866 812 72 ------
NM_031268chr1695375 4881 4666 4570 4243 3738 1927 1735 458 --24722 1121 15028
NM_031275chr112155 136 ----130
NM_031284chr156872 778 706 220 55 39 1173 ----
NM_031291chr4------1150
NM_031296chr411947 12005 --22540 2289
NM_031362chr272620 2518 1944 1860 491 462 413 ----1869
NM_031365chr282756 2654 2080 1996 627 598 549 84 ----11005
NM_031366chr282756 2654 2080 1996 627 598 549 84 ----11005
NM_031371chr131563 1470 1325 ------
NM_031371chr131563 1470 1325 ------
NM_031411chr521667 1509 ------
NM_031419chr31238 11465 31155 500 295 --
NM_031427chr1485327 5114 5038 5001 4557 4461 4455 4325 22139 631 15348 11154
NM_031431chr1331867 1158 270 11371 2610 349 --
NM_031453chr1072568 2280 2081 2007 825 493 42 --1109 11998
NM_031461chr842287 2262 1638 58 --21959 715 --
NM_031468chr7148198 7940 7900 6943 6872 6688 6511 6462 6105 5513 2620 1293 644 629 23036 2106 26841 5104 --
NM_031469chr674062 3854 3235 1462 1408 647 164 12739 11526 --
NM_031483chr2031131 917 911 --12572 137
NM_031844chr183828 3483 3340 2951 1594 1055 613 429 --23498 2562 1342
NM_031849chr521667 1509 ------
NM_031857chr521667 1509 ------
NM_031858chr171415 --11115 1182
NM_031860chr521667 1509 ------
NM_031862chr171415 --11115 1182
NM_031889chr431935 1460 1287 --11792 --
NM_031905chr721152 832 --1190 --
NM_031922chr61448 ------
NM_031989chr123357 326 254 ------
NM_032042chr552694 2238 1919 974 816 --31138 1123 1007 --
NM_032047chr332378 1979 645 --21644 204 --
NM_032102chr1143009 2993 2775 529 1879 32900 2891 38 --
NM_032105chr187535 6362 6171 3049 2396 1345 700 60 25670 5291 26501 5212 --
NM_032132chr11494 --1183 --
NM_032139chr193930 397 82 ----1861
NM_032144chr22461 411 11496 11318 --
NM_032154chr104800 242 137 51 --31056 995 783 --
NM_032160chr1832669 998 552 13061 --23139 2944
NM_032182chr1031380 1136 87 11553 2438 139 171
NM_032186chr111129 --11057 --
NM_032199chr1023092 1129 --146 2924 302
NM_032217chr4------1921
NM_032228chr111362 12174 32556 1112 917 --
NM_032233chr141308 --1678 --
NM_032236chr1192 11096 ----
NM_032239chr431044 358 103 11038 1392 --
NM_032246chr1541035 1001 206 151 11145 ----
NM_032268chr1652983 2501 2019 92 86 --1623 --
NM_032281chr1942870 2769 1921 654 12100 22429 633 --
NM_032288chr371913 1786 1710 1575 888 864 592 --21652 492 --
NM_032291chr131894 1539 45 11849 --11392
NM_032312chr21622 --1203 --
NM_032315chr1----154 --
NM_032352chr1431048 510 449 ------
NM_032373chr10125635 5382 5144 4508 4457 4324 2176 2061 1961 1530 1085 560 25882 1830 11894 24228 1783
NM_032408chr741265 1248 866 46 ----1357
NM_032435chr132107 720 349 --2891 485 --
NM_032437chr1134 ------
NM_032438chr631363 465 180 --31628 1462 326 --
NM_032439chr1031611 1387 451 ------
NM_032440chr1042957 919 420 241 12646 32555 2167 765 --
NM_032446chr5133451 2752 2679 2618 1519 1034 962 648 508 291 283 232 44 23131 2700 33167 2952 2472 12462
NM_032457chr433304 3103 2482 ------
NM_032458chrX42990 2954 2259 2131 --33064 1115 1013 --
NM_032466chr821555 1512 1305 ----
NM_032468chr831733 1555 1512 1305 ----
NM_032505chr332394 2223 2210 --2573 414 --
NM_032509chr882323 2294 1042 968 909 635 43 29 11973 ----
NM_032521chr2043180 3057 2977 285 1193 22619 45 --
NM_032547chr42270 227 --11103 --
NM_032557chr42949 368 ------
NM_032560chr142957 299 1979 ----
NM_032590chr1251120 1082 783 471 280 1312 ----
NM_032632chr1452001 1276 732 400 350 --1449 --
NM_032663chr1251494 756 415 280 26 ----1678
NM_032682chr353657 2241 1383 242 218 --1377 1417
NM_032689chr1941586 1053 575 149 ----1217
NM_032727chr1051571 1534 1500 1458 458 ----1603
NM_032765chr52966 243 --1840 --
NM_032778chr383231 2844 2780 2693 2491 2240 1230 287 --1342 1718
NM_032810chr1021179 1153 ------
NM_032813chr1331111 931 304 1311 ----
NM_032828chr1931963 1584 1519 13465 11096 --
NM_032839chr3171 ------
NM_032846chr1451507 1135 474 418 334 --1147 --
NM_032857chr151169 ------
NM_032859chr13102994 2881 2607 1404 1198 1106 1018 890 778 617 --42446 813 747 122 --
NM_032864chr1101590 1580 1559 1498 1451 1354 1218 1161 1000 372 ------
NM_032866chr1543230 2920 2334 945 --22474 185 1361
NM_032870chr6--152 ----
NM_032873chr1194477 4155 3943 3899 3423 3175 1086 417 236 34092 3671 2993 22859 777 --
NM_032892chr151291 ------
NM_032900chr1073790 3328 2714 818 683 540 87 --43444 1542 1250 38 1604
NM_032932chr1796106 4763 4080 2489 2412 1940 1458 627 308 14361 35760 1776 1626 --
NM_032961chr41202 1955 11106 --
NM_032966chr1111486 ------
NM_032968chrX21152 867 1216 11193 --
NM_032969chrX21152 867 1216 11193 --
NM_032973chrY21152 867 1216 11193 --
NM_032975chr1843297 2817 2506 1267 --1595 22311 785
NM_032980chr1843297 2817 2506 1267 --1595 22311 785
NM_032993chr41279 ------
NM_033012chr131239 ------
NM_033020chr133113 3062 588 --11548 11280
NM_033030chr211675 ------
NM_033031chrX160 ------
NM_033036chr1181734 1662 1310 1183 1159 1153 282 127 ------
NM_033055chr161018 941 878 850 338 140 1158 1918 --
NM_033067chr1--1275 ----
NM_033083chr363120 2194 736 244 235 133 --12142 --
NM_033105chr8198 --1187 1419
NM_033121chr1231482 730 432 ------
NM_033132chr1332050 1651 242 ----1416
NM_033136chr531871 302 77 ------
NM_033137chr531871 302 77 ------
NM_033138chr731954 1645 932 11555 12066 11838
NM_033139chr731954 1645 932 11555 12066 11838
NM_033140chr731954 1645 932 11555 12066 11838
NM_033143chr453794 1589 1477 1390 67 13012 44190 1117 598 205 --
NM_033157chr731954 1645 932 11555 12066 11838
NM_033181chr643146 2680 1545 714 --2687 36 --
NM_033211chr561894 1790 1487 1312 823 601 --1451 --
NM_033222chr921308 1272 --11444 --
NM_033224chr7147722 7497 7489 7077 6903 6496 6458 6450 1349 1210 1095 706 206 58 --35946 2009 1247 --
NM_033225chr853018 2677 2487 1081 22 --12937 --
NM_033227chr52454 176 --3437 412 126 --
NM_033228chr52494 216 --3477 452 166 --
NM_033284chrY136 ------
NM_033285chr884030 3306 2978 2924 1721 1708 1250 526 --13841 --
NM_033331chr9113444 3252 2721 2705 2221 1130 761 355 166 41 22 12603 12619 --
NM_033360chr1274241 3458 3405 3350 3312 1670 1146 34175 3969 3663 ----
NM_033379chr10--1171 ----
NM_033380chrX4978 914 378 266 1232 1723 --
NM_033381chrX4978 914 378 266 1232 1723 --
NM_033421chr2061431 1406 1342 1206 597 180 --11221 11745
NM_033425chr112770 70 13285 23187 3065 --
NM_033427chr73747 303 207 ------
NM_033429chr1553165 2921 2588 808 777 12791 --23133 911
NM_033495chrX21028 766 ----1847
NM_033496chr101692 ------
NM_033497chr101692 ------
NM_033498chr101692 ------
NM_033500chr101692 ------
NM_033505chr2106438 4440 1887 1697 1428 1231 866 557 392 148 --46462 6317 2321 654 14821
NM_033512chr862693 2083 966 809 705 113 --1492 --
NM_033535chr43867 852 782 1815 ----
NM_033540chr32862 749 ------
NM_033551chr543351 2420 985 877 12537 23205 2384 --
NM_033656chr21105498 5015 5002 4204 3783 2085 1753 1736 1299 356 45958 5726 4346 661 23747 1777 --
NM_052839chr221972 ------
NM_052851chr133770 410 97 11761 3232 174 164 --
NM_052862chr121281 246 --11549 1266
NM_052867chr1331184 530 24 1487 --1448
NM_052879chr1253598 3082 3055 1529 1000 22666 1193 23012 1043 13671
NM_052882chr193535 216 63 ----1118
NM_052886chr8------22067 1838
NM_052888chr17----1126 --
NM_052905chr231694 406 60 --1142 --
NM_052923chr6169 ------
NM_052927chr561926 1867 1659 278 267 62 11530 ----
NM_052934chr172208 1923 1817 1637 693 485 51 --32147 1866 116 --
NM_052937chr842361 965 779 83 12259 1760 --
NM_052954chr2161606 790 683 428 422 85 --11422 --
NM_052978chr1461795 1707 1678 1245 745 447 --1670 --
NM_053016chr9117384 6991 6283 6102 5625 5617 5359 4968 4864 2444 1243 --44985 1625 633 208 --
NM_053023chr1121237 473 --11173 12858
NM_053025chr341337 1148 441 45 --11408 --
NM_053026chr341337 1148 441 45 --11408 --
NM_053027chr341337 1148 441 45 --11408 --
NM_053028chr341337 1148 441 45 --11408 --
NM_053031chr341337 1148 441 45 --11408 --
NM_053032chr341337 1148 441 45 --11408 --
NM_053043chr7125690 5125 4607 4596 3953 2164 1488 1310 1130 895 239 49 --15318 --
NM_053064chr1463099 3011 2859 2826 2187 1228 ----12405
NM_054026chr82326 185 ----1852
NM_057157chr102517 158 ------
NM_057164chr2------1606
NM_057165chr2------1606
NM_057166chr2------1606
NM_057167chr2------1606
NM_057169chr1263136 2933 2829 840 445 71 --21009 509 --
NM_057170chr1263136 2933 2829 840 445 71 --21009 509 --
NM_057175chr492470 2188 2112 2007 1682 997 886 828 718 ------
NM_057178chr1752816 2677 2548 2273 208 11804 31062 292 282 --
NM_057749chr84859 556 333 50 --1213 --
NM_058191chr21----2846 74 1310
NM_058229chr83203 191 52 1178 ----
NM_058237chr141433 11064 --1681
NM_058241chr282282 2155 2033 1967 1899 1888 1695 875 22076 1432 12147 --
NM_058241chr282282 2155 2033 1967 1899 1888 1695 875 22076 1432 12147 --
NM_078467chr61175 ------
NM_080546chr982251 2119 2018 2006 1988 1753 1463 579 ------
NM_080617chr203414 314 273 ------
NM_080629chr161289 1036 995 481 473 270 --11464 --
NM_080630chr161289 1036 995 481 473 270 --11464 --
NM_080645chr642154 2119 2047 1693 ------
NM_080678chr22263 182 ------
NM_080683chr4----1478 --
NM_080684chr4----1478 --
NM_080685chr4----1478 --
NM_080725chr2052021 1920 1815 1700 764 --21759 1354 --
NM_080743chr632558 2427 285 --1656 --
NM_080759chr1392564 2512 1942 1015 760 464 416 111 101 --2566 41 --
NM_080760chr1392564 2512 1942 1015 760 464 416 111 101 --2566 41 --
NM_080764chr2293212 3097 3026 2834 1179 656 428 379 169 --1666 12108
NM_080867chr1464883 3377 3246 1129 1029 760 24655 189 23533 1986 --
NM_080872chr833572 3270 2721 22758 2746 24035 3299 1531
NM_080921chr131019 928 313 1802 ----
NM_080927chr362997 2775 2434 2242 1317 1159 12850 21009 616 13284
NM_130385chr1172643 2507 2433 2187 457 300 249 1602 1418 --
NM_130391chr952997 2666 662 596 175 --12914 --
NM_130392chr952997 2666 662 596 175 --12914 --
NM_130393chr952997 2666 662 596 175 --12914 --
NM_130395chr61310 ------
NM_130434chr153844 244 81 1336 1908 1779
NM_130798chr1521223 538 --11138 11322
NM_130830chr383883 3679 3525 3228 1561 823 91 55 11103 33540 3479 816 13452
NM_130831chr332877 2809 2514 --22238 2153 --
NM_130832chr332877 2809 2514 --22238 2153 --
NM_130833chr332877 2809 2514 --22238 2153 --
NM_130834chr332877 2809 2514 --22238 2153 --
NM_130835chr332877 2809 2514 --22238 2153 --
NM_130836chr332877 2809 2514 --22238 2153 --
NM_130837chr332877 2809 2514 --22238 2153 --
NM_130838chr1551601 1422 1160 497 401 --1671 --
NM_130839chr1551601 1422 1160 497 401 --1671 --
NM_130847chr11125499 5231 4761 4640 4496 3767 3683 1838 1255 1016 751 272 ----15917
NM_130902chr4128 ------
NM_133170chr20116500 6345 6225 2921 2706 2439 2279 1891 1389 740 730 13023 11648 --
NM_133265chrX62972 2903 2444 2227 1009 413 1249 1125 --
NM_133329chr251434 1172 702 471 178 1368 21232 713 --
NM_133338chr51507 ------
NM_133339chr51507 ------
NM_133340chr51507 ------
NM_133341chr51507 ------
NM_133342chr51507 ------
NM_133343chr51507 ------
NM_133344chr51507 ------
NM_133370chr483477 3308 2922 1290 1251 1128 866 169 12334 ----
NM_133433chr52635 35 ------
NM_133446chr10----172 --
NM_133496chr174300 4040 3893 3619 3365 2925 203 --44427 3601 1550 374 --
NM_133638chr52523 435 ------
NM_133646chr2125559 5484 5303 5120 4705 4594 4239 4216 1551 1386 699 193 --33593 787 275 --
NM_133647chr1553716 2977 776 272 165 --13662 1444
NM_134442chr241703 1104 567 379 --2534 139 --
NM_138270chrX52509 789 682 580 81 1883 --12842
NM_138333chr951778 890 455 303 71 --1153 --
NM_138357chr1011175 ------
NM_138394chr2------125
NM_138423chr154924 595 171 123 --11860 --
NM_138444chr1353694 3273 1845 1508 1287 --14825 13881
NM_138455chr8----1353 --
NM_138459chr673296 3123 3062 2736 2672 367 293 --23547 3443 --
NM_138473chr1255111 1594 1308 1141 964 --11659 13794
NM_138479chr15543 524 341 128 37 ----1609
NM_138555chr154595 469 410 96 ------
NM_138571chr62680 664 1635 ----
NM_138576chr1454584 4538 4071 3495 675 --14129 --
NM_138578chr2051301 565 430 357 218 ----1169
NM_138609chr52562 448 ------
NM_138610chr52562 448 ------
NM_138621chr264108 3972 3905 3690 2983 601 --32534 497 190 --
NM_138638chr1431982 1562 37 --1959 11622
NM_138694chr693622 3229 2563 2485 2411 1385 796 371 80 --33503 3179 1149 23558 508
NM_138713chr16178162 7799 7007 6953 6232 5770 5226 5192 2778 2769 2525 2291 1853 1281 898 261 70 16990 25311 1328 15973
NM_138714chr16178162 7799 7007 6953 6232 5770 5226 5192 2778 2769 2525 2291 1853 1281 898 261 70 16990 25311 1328 15973
NM_138731chr1463802 2997 1524 1456 1037 561 --14022 23084 933
NM_138771chr721033 146 --1233 11318
NM_138773chr51620 ------
NM_138779chr131280 ------
NM_138782chr521522 121 11767 22256 1843 --
NM_138811chr73917 361 228 1141 21015 63 --
NM_138927chr212827 752 --1184 --
NM_138959chr175786 5650 5048 4171 2453 252 227 15841 36307 4651 4414 22617 2147
NM_138966chr183391 128 23 ------
NM_138970chr1462309 1553 1518 906 102 93 12351 --1858
NM_138971chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_138971chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_138972chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_138972chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_138973chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_138973chr1173780 2767 2664 1402 1042 855 796 --23622 3598 --
NM_139012chr672238 2137 1979 1677 1651 297 63 --11506 --
NM_139014chr672318 2217 2059 1757 1731 377 143 --11586 --
NM_139015chr123462 114 76 --3594 422 357 --
NM_139048chr32195 162 --2264 150 --
NM_139136chr123223 211 105 190 --149
NM_139168chr521726 386 --1517 11247
NM_139169chr101285 --12100 11851
NM_139182chr421432 1210 11778 31531 608 99 1494
NM_139207chr1221977 1651 2746 657 22118 502 --
NM_139244chr61923 ------
NM_139283chr1252326 2024 1811 926 874 --12521 --
NM_139321chr20124163 4100 3876 3612 3540 2705 1681 1660 1207 1108 542 289 --44204 3079 1302 940 --
NM_144571chr486435 6207 5880 4383 2786 1892 823 448 12297 14465 --
NM_144578chr1485423 5361 5203 4557 3544 1491 784 591 --24276 285 14405
NM_144586chr241091 480 196 157 ----11126
NM_144595chr133676 285 254 ------
NM_144599chr1585373 5049 4904 4263 4175 2174 1748 104 --14285 --
NM_144600chr1641611 1468 1131 1057 --11259 --
NM_144610chr17182 ------
NM_144628chr20102915 2905 2490 2394 1220 857 841 559 485 76 --12945 --
NM_144643chr4----2389 28 1360
NM_144660chr101155 ------
NM_144664chr113848 522 229 1488 ----
NM_144684chr1932194 1026 828 ----2155 35
NM_144721chr462606 2424 2269 1753 401 278 ------
NM_144726chr541087 1053 405 399 ------
NM_144778chr1352660 2552 2210 718 94 ------
NM_144949chr262634 2522 2199 1860 307 195 22133 1982 42043 1932 1000 655 1945
NM_144963chr862076 1900 1766 859 689 414 11812 12029 22362 751
NM_144967chrX3924 426 146 ------
NM_144969chrX5656 221 180 144 36 ------
NM_144973chr12105208 4493 4421 4134 1835 1390 835 807 653 67 25162 183 13999 13419
NM_144988chr12309 113 --128 --
NM_145044chr331608 1201 710 11506 ----
NM_145055chr1863638 3606 1434 1169 1136 243 --1206 --
NM_145112chr1421286 245 ------
NM_145113chr1421558 517 ------
NM_145117chr1183092 2851 2253 571 521 389 209 113 ------
NM_145176chr652373 2337 1346 629 108 --11276 1578
NM_145243chr1------1156
NM_145259chr2137122 6389 5842 5604 5405 5004 4798 4742 4665 4364 2388 1127 717 --36752 4682 469 26876 5890
NM_145261chr3181 ----1896
NM_145284chrX32278 2143 2104 22032 670 174 --
NM_145290chr4----1111 --
NM_145291chr4------1410
NM_145303chr63451 196 52 ------
NM_145307chr10103899 3357 1728 1485 1472 1328 1311 1257 877 595 23397 764 34159 1157 390 14171
NM_145320chr772506 2377 1078 782 716 635 401 ----12364
NM_145321chr772506 2377 1078 782 716 635 401 ----12364
NM_145322chr772506 2377 1078 782 716 635 401 ----12364
NM_145341chr1031623 1217 153 --1480 11161
NM_145349chr1742226 2054 1625 1407 ------
NM_145686chr242210 1105 688 321 --53025 2518 2199 820 56 --
NM_145687chr242210 1105 688 321 --53025 2518 2199 820 56 --
NM_145690chr82239 128 --11406 --
NM_145698chr105689 441 265 188 37 11817 ----
NM_145725chr14------1415
NM_145726chr14------1415
NM_145808chr731969 936 618 ------
NM_145859chr31289 ----1249
NM_145860chr31289 ----1249
NM_147156chr1021331 49 ------
NM_147164chr91574 ------
NM_147166chr7--1712 ----
NM_147171chr72459 164 ------
NM_147185chr72459 164 ------
NM_148177chr83203 191 52 1178 ----
NM_148571chr1721486 427 1414 --1715
NM_148921chr1762404 1926 1702 892 646 548 --1338 1720
NM_148955chr15126418 6080 5328 5202 5128 5122 4223 4193 1996 1815 971 317 1106 14518 --
NM_148957chr1352442 2135 1740 993 747 22635 847 ----
NM_152261chr1242567 2338 2001 1608 22249 313 21906 761 --
NM_152267chr2252407 2148 2027 1863 156 --2865 149 11917
NM_152271chr84937 777 475 276 --2411 189 --
NM_152272chr831294 1093 915 1511 21255 162 --
NM_152277chr521581 1349 --21635 370 --
NM_152282chr311132 --21211 404 --
NM_152295chr52342 96 --1284 --
NM_152332chr1462766 1968 1012 970 786 172 1797 22151 31 --
NM_152347chr17--1484 1119 --
NM_152373chr14672 451 100 68 ------
NM_152387chr21231 1870 ----
NM_152388chr2103507 3453 3347 3079 2599 1493 1228 1220 922 742 ------
NM_152409chr522571 1088 23502 2722 ----
NM_152414chr861402 1275 1030 639 161 131 ------
NM_152417chr82139 77 31219 1152 995 ----
NM_152423chrX1116 --11278 --
NM_152424chrX74595 4511 4374 4148 2991 955 727 24061 2923 34094 1487 1334 11159
NM_152437chr1262411 2230 1922 1526 820 746 --22172 804 --
NM_152440chr1241017 433 426 111 ------
NM_152446chr143935 653 614 ------
NM_152451chr15----1715 --
NM_152529chr273781 3485 3273 2789 2727 1701 289 --23634 1114 --
NM_152556chr732340 1821 543 12142 ----
NM_152563chr1141272 1097 1067 49 --173 11167
NM_152574chr9123 ------
NM_152581chrX2526 402 1496 ----
NM_152594chr1532040 332 134 2349 26 ----
NM_152622chr5112971 2770 2556 2468 1342 1011 729 656 213 133 22 12909 12534 --
NM_152624chr5136769 5592 4970 4821 4522 2954 2827 1582 1555 1426 1247 434 50 ------
NM_152629chr984001 3634 3324 1268 970 232 161 148 1252 ----
NM_152630chrX31506 1046 542 11548 11570 --
NM_152641chr12112884 2522 2504 2163 1845 1180 1089 907 841 302 222 12034 32429 1053 1042 --
NM_152665chr12210 136 1890 ----
NM_152678chr3----22584 2273 --
NM_152685chr51398 ------
NM_152688chr61341 ------
NM_152699chr332903 771 82 ----13704
NM_152704chr132927 235 ----1344
NM_152705chr13--2554 473 --1298
NM_152707chr1051085 427 421 272 164 ------
NM_152713chr111243 ------
NM_152716chr1121051 525 ------
NM_152721chr181196 ------
NM_152737chr641322 748 630 451 11681 11372 --
NM_152754chr7123232 3169 3110 3024 2906 2768 1240 538 495 320 222 28 33767 373 281 ----
NM_152756chr5103702 3276 2702 2665 1551 1209 841 798 508 153 1601 13024 --
NM_152758chr842952 2818 326 201 --12946 --
NM_152787chrX73773 3523 3286 2545 1428 626 281 --21310 1205 --
NM_152789chr74947 597 483 98 --1380 --
NM_152793chr7104629 3815 3407 1649 846 477 334 305 195 173 33581 1034 257 --23684 1414
NM_152826chr15126418 6080 5328 5202 5128 5122 4223 4193 1996 1815 971 317 1106 14518 --
NM_152835chr142141 863 341 264 12515 --12890
NM_152838chr2083112 2855 2538 2525 2380 2314 613 350 --23332 406 --
NM_152902chr151839 1712 682 505 82 ----1623
NM_152903chr1332716 716 339 1984 ----
NM_152924chr15186310 5573 5356 5108 5097 4498 4434 4201 2759 2593 2383 2369 2115 1516 1506 1002 972 428 16906 14691 --
NM_152989chr1221373 539 --1680 135
NM_152991chr111586 1229 ----
NM_152996chr141698 681 467 330 ----11380
NM_152998chr72260 204 ------
NM_152999chr784314 4307 4118 3968 1905 1146 788 192 --1347 --
NM_153028chr162643 52 --1678 --
NM_153050chr2294234 4140 4007 3734 3389 2011 1444 1252 458 --13453 13961
NM_153051chr2294234 4140 4007 3734 3389 2011 1444 1252 458 --13453 13961
NM_153181chr183391 128 23 ------
NM_153182chr383231 2844 2780 2693 2491 2240 1230 287 --1342 1718
NM_153184chr311259 --21851 1396 --
NM_153188chr535561 5150 530 12061 14949 --
NM_153207chr1293953 3475 3309 2890 2617 1575 1375 703 561 --13646 23835 2528
NM_153240chr33298 239 71 --1198 --
NM_153262chr162780 2245 2043 750 627 88 12019 43076 821 354 196 12137
NM_153332chr871313 1200 1077 1071 571 510 251 ------
NM_153333chrX1469 --1557 --
NM_153341chr1158 ------
NM_153343chr431633 628 536 11925 ----
NM_153354chr51225 ------
NM_153357chr17----139 --
NM_153365chr452429 2115 2068 1712 337 12031 ----
NM_153367chr1073553 3509 2634 2539 2506 1476 1047 --44008 2883 2790 926 --
NM_153374chr151393 ------
NM_153377chr12299 49 ------
NM_153456chr1396290 5876 5718 5705 5654 5053 4334 2378 1752 25209 1030 11335 --
NM_153498chr102760 119 ----1532
NM_153607chr572592 1058 752 503 401 223 132 --12461 --
NM_153613chr15188 ------
NM_153631chr741517 1439 613 346 11616 1682 --
NM_153632chr741517 1439 613 346 11616 1682 --
NM_153633chr122655 616 1732 1765 180
NM_153645chr2293137 3014 2170 1191 914 605 291 199 24 ----1103
NM_153686chr452410 1687 1567 240 193 22449 543 ----
NM_153689chr241537 753 209 24 ------
NM_153694chr121236 --122 --
NM_153746chr62543 198 --1182 --
NM_153748chr123223 211 105 190 --149
NM_153809chr91516 ------
NM_153810chr10104584 4447 4424 1820 1744 1603 940 608 383 137 --54557 1961 1343 563 347 --
NM_153831chr82910 405 ------
NM_170587chr82719 44 173 2837 698 --
NM_170606chr781852 1816 1612 1352 1174 738 560 71 --11207 --
NM_170665chr1253139 2966 1169 218 85 --24133 939 --
NM_170672chr241321 1199 544 168 --11173 1527
NM_170686chr792751 2576 2370 2087 1209 1155 997 166 120 --11991 --
NM_170706chr143655 3581 3226 1411 1917 33590 3495 521 --
NM_170709chr822106 180 --22376 1902 --
NM_170710chr442408 1215 259 142 12536 ----
NM_170719chr134496 464 53 42 1555 ----
NM_170731chr1152191 1990 1823 627 263 --22892 2163 --
NM_170732chr1152191 1990 1823 627 263 --22892 2163 --
NM_170733chr1152191 1990 1823 627 263 --22892 2163 --
NM_170734chr1152191 1990 1823 627 263 --22892 2163 --
NM_170735chr1152191 1990 1823 627 263 --22892 2163 --
NM_170740chr6123450 3197 3046 3012 2932 2376 1214 657 558 116 107 99 --23483 1166 --
NM_170754chr12----1478 --
NM_170783chr61175 ------
NM_171998chrX62258 1902 1747 1709 655 88 12210 ----
NM_172037chr891520 1344 1305 1122 1004 921 519 418 353 1194 ----
NM_172058chr841618 1218 642 414 --21853 728 195
NM_172059chr841618 1218 642 414 --21853 728 195
NM_172060chr841618 1218 642 414 --21853 728 195
NM_172070chr221759 607 148 32021 530 448 --
NM_172071chr1167176 6950 6857 6178 5750 5534 5492 5210 2829 1731 1664 812 705 570 494 269 25433 985 16534 26682 5577
NM_172097chr151283 ------
NM_172103chr652534 2228 299 144 52 ----1792
NM_172105chr652534 2228 299 144 52 ----1792
NM_172127chr452097 1302 731 421 372 --11379 --
NM_172128chr442053 687 377 328 --11335 --
NM_172169chr1091743 1519 685 632 587 514 504 427 383 1408 21893 439 --
NM_172170chr1091743 1519 685 632 587 514 504 427 383 1408 21893 439 --
NM_172171chr1091743 1519 685 632 587 514 504 427 383 1408 21893 439 --
NM_172173chr1091743 1519 685 632 587 514 504 427 383 1408 21893 439 --
NM_172193chr1421364 1219 --1326 --
NM_172218chr84873 824 536 351 1550 1230 --
NM_172240chr1231289 203 174 --2989 548 11310
NM_172311chr2--1130 ----
NM_172344chr251434 1172 702 471 178 1368 21232 713 --
NM_172373chr1351305 1092 501 374 194 ----1341
NM_173075chr431866 1787 1646 --11163 1118
NM_173172chr231384 337 91 11117 21437 197 --
NM_173214chr16178162 7799 7007 6953 6232 5770 5226 5192 2778 2769 2525 2291 1853 1281 898 261 70 16990 25311 1328 15973
NM_173355chr2--1155 ----
NM_173359chr331871 749 146 --41724 1666 1486 1364 --
NM_173468chr4155771 5581 5548 4942 4776 4584 4352 3869 2314 1948 1824 1628 1123 860 427 11117 24065 563 --
NM_173470chrX52058 1158 965 440 40 --12511 12459
NM_173473chr1041694 708 479 56 12655 12666 12564
NM_173494chrX----1624 --
NM_173495chrX42605 2450 765 211 --21848 450 12409
NM_173500chr151323 ------
NM_173510chr2252831 2583 2323 2214 83 ----12248
NM_173511chr273652 3614 3507 2636 2574 2439 842 --53962 3773 2697 2599 1258 13478
NM_173519chr831882 1682 1514 11961 1336 --
NM_173552chr342211 1843 1746 945 12220 --1935
NM_173576chr1042253 849 722 378 --1532 --
NM_173582chr1195720 5680 4901 4553 4128 1676 1427 918 58 24588 982 36254 2196 1164 11902
NM_173591chr122738 50 ------
NM_173595chr1264917 1569 1356 860 841 565 --11489 --
NM_173602chr1272798 2610 2596 1161 600 502 442 1333 2654 319 1991
NM_173632chr1983183 2470 2114 1372 1321 365 340 256 --12326 --
NM_173642chr1218935 8752 8498 8033 7953 7883 7090 6766 6756 6656 6629 6603 6502 6468 6439 6083 2876 2541 2084 816 545 1673 18063 --
NM_173645chr2--2584 391 ----
NM_173648chr211062 1926 1364 --
NM_173654chr362251 1919 1828 1551 746 62 --22154 795 --
NM_173667chr521617 182 --12265 11971
NM_173683chr841675 1482 1150 157 ------
NM_173694chrX72385 2073 1787 1678 338 282 249 ------
NM_173797chr521188 931 --1352 --
NM_173808chr134283 3244 137 --23146 796 --
NM_173826chr341737 1364 1148 575 145 ----
NM_173829chr5106081 5740 5562 5378 4605 4441 1620 1094 871 71 22381 1008 31102 648 567 --
NM_173830chr62741 32 ------
NM_173854chr1102355 2339 2195 2100 1948 1903 1866 1855 1519 147 --3872 182 107 --
NM_174900chr4184 --2235 210 --
NM_174911chr8103712 3459 3442 3196 2971 2764 1592 280 35 22 ------
NM_174916chr1522087 449 1240 22126 683 --
NM_174938chr9----1367 --
NM_175056chr352076 1904 1656 470 80 ----1256
NM_175061chr722132 109 ------
NM_175607chr341379 1321 1252 623 --31087 304 21 --
NM_175610chr1531381 1210 1085 ------
NM_175612chr341379 1321 1252 623 --31087 304 21 --
NM_175623chr1296673 5961 5676 5663 5577 5551 4735 2256 204 --21981 1099 --
NM_175624chr12106768 6056 5771 5758 5672 5646 4830 2351 299 91 --22076 1194 --
NM_175625chr12106768 6056 5771 5758 5672 5646 4830 2351 299 91 --22076 1194 --
NM_175736chr12117279 6885 6570 6462 5967 5806 5762 2021 1951 1425 1011 25191 913 ----
NM_175748chr1451673 727 673 588 361 12119 1734 --
NM_175834chr121282 ------
NM_175854chr1392802 2363 2095 2020 1899 1051 331 184 72 --42211 1782 1027 426 1222
NM_175856chr51682 --1526 --
NM_175862chr361403 1154 1070 411 387 129 1461 11126 --
NM_175866chr161419 1322 1065 562 516 73 ------
NM_175876chr162696 2506 2262 2149 957 769 ----145
NM_175884chr731104 1095 391 ----1424
NM_176081chr10115623 4642 4624 2363 2312 1691 1245 1231 1183 873 737 14373 1307 --
NM_176083chr10115623 4642 4624 2363 2312 1691 1245 1231 1183 873 737 14373 1307 --
NM_176823chr1133840 3086 2929 2830 2678 2365 1553 1458 1358 838 825 711 218 --1141 13123
NM_176824chr44995 248 177 64 ------
NM_177414chr11648 ------
NM_177422chr11573 ------
NM_177424chr162116 2031 1876 1786 773 472 --12059 --
NM_177438chr1453960 2998 2708 1621 187 23679 371 --1120
NM_177538chr277602 5412 3552 2880 2375 1823 1015 --38151 8084 1236 12618
NM_177553chr111960 ------
NM_177966chr311339 --31747 671 648 --
NM_177968chr252088 1705 470 403 251 ------
NM_177974chr154924 595 171 123 --11860 --
NM_177985chr231797 304 50 --1313 --
NM_177989chr32368 309 ------
NM_177990chr2071812 1380 1328 686 597 441 273 11496 11541 --
NM_178006chr133770 410 97 11761 3232 174 164 --
NM_178007chr133770 410 97 11761 3232 174 164 --
NM_178010chr1221373 539 --1680 135
NM_178011chr1052520 2238 1147 1101 471 --43136 1242 1192 567 --
NM_178014chr61957 --180 --
NM_178037chr12103433 3253 2646 2507 788 743 646 618 421 271 --33333 3003 62 --
NM_178038chr12103433 3253 2646 2507 788 743 646 618 421 271 --33333 3003 62 --
NM_178042chr32368 309 ------
NM_178123chr241059 976 663 222 ----1806
NM_178151chrX97794 6815 6658 5322 2952 1639 1369 766 647 --37699 7406 894 --
NM_178152chrX97794 6815 6658 5322 2952 1639 1369 766 647 --37699 7406 894 --
NM_178153chrX97794 6815 6658 5322 2952 1639 1369 766 647 --37699 7406 894 --
NM_178154chr144817 798 735 149 --1754 --
NM_178155chr144817 798 735 149 --1754 --
NM_178156chr144817 798 735 149 --1754 --
NM_178157chr144817 798 735 149 --1754 --
NM_178505chr1063219 2452 1317 363 173 146 ------
NM_178509chr1764147 2730 2702 1232 522 136 2463 444 13273 --
NM_178539chr1262050 1912 1564 800 725 186 --31442 469 249 --
NM_178554chr363211 2847 2437 1082 768 390 --23280 2634 --
NM_178568chr1711393 --1663 156
NM_178578chr2042087 1986 1073 383 ----11752
NM_178585chr453159 3096 1108 1067 332 --12328 1462
NM_178812chr8----21046 402 --
NM_178815chr1021879 379 11054 --1489
NM_178868chr3188 ------
NM_180989chr1351912 1733 1724 1546 807 --12188 --
NM_181077chr1572216 624 559 541 393 105 22 11920 ----
NM_181265chr442408 1215 259 142 12536 ----
NM_181354chr81614 --1248 --
NM_181356chr611056 ------
NM_181358chr154039 3495 1671 971 948 23253 1206 23326 3038 --
NM_181443chr2072692 2598 2309 622 401 337 205 12772 1934 --
NM_181453chr241473 1295 448 322 1364 ----
NM_181481chr18126791 6495 6434 6083 4751 2685 2368 2049 2007 1461 617 462 --35107 4301 1231 --
NM_181482chr18126791 6495 6434 6083 4751 2685 2368 2049 2007 1461 617 462 --35107 4301 1231 --
NM_181483chr18126791 6495 6434 6083 4751 2685 2368 2049 2007 1461 617 462 --35107 4301 1231 --
NM_181504chr543665 1255 1247 995 --1136 1683
NM_181521chr1667283 4417 2220 1908 1012 101 ------
NM_181523chr543665 1255 1247 995 --1136 1683
NM_181524chr543665 1255 1247 995 --1136 1683
NM_181532chrX1312 ------
NM_181581chr72822 314 ------
NM_181598chr14--1290 ----
NM_181659chr2053361 1293 819 616 158 11363 ----
NM_181659chr2053361 1293 819 616 158 11363 ----
NM_181670chr12----11494 --
NM_181671chr172611 173 1263 123 1924
NM_181672chrX81860 1609 1542 1276 513 386 64 22 --21536 220 --
NM_181673chrX81860 1609 1542 1276 513 386 64 22 --21536 220 --
NM_181674chr51130 ------
NM_181675chr51130 ------
NM_181676chr51130 ------
NM_181677chr51130 ------
NM_181678chr51130 ------
NM_181706chr1141832 1611 1510 64 11727 41945 1625 292 253 --
NM_181714chr631988 1822 1392 ----11286
NM_181723chr841999 479 224 149 1433 1717 --
NM_181836chr522200 199 ----178
NM_181842chr6175 ------
NM_181861chr1242705 1917 1778 29 12821 1323 --
NM_181868chr1242705 1917 1778 29 12821 1323 --
NM_181869chr1242790 2002 1863 114 12906 1408 --
NM_181886chr431106 1031 507 1520 1251 --
NM_181887chr431106 1031 507 1520 1251 --
NM_181888chr431106 1031 507 1520 1251 --
NM_181889chr431106 1031 507 1520 1251 --
NM_181890chr431106 1031 507 1520 1251 --
NM_181891chr431106 1031 507 1520 1251 --
NM_181892chr431153 1078 554 1567 1298 --
NM_181893chr431106 1031 507 1520 1251 --
NM_181897chr352431 453 425 210 131 --1713 --
NM_182472chr4----1141 --
NM_182485chr461496 1466 1377 1247 1111 778 ------
NM_182505chr92513 495 ------
NM_182515chr1934191 1092 994 56368 5431 5331 5006 1244 --11405
NM_182522chr331147 901 395 --1349 --
NM_182540chrX3797 311 139 1690 ----
NM_182641chr1711842 11482 11966 --
NM_182643chr822278 942 --32252 1498 53 --
NM_182646chr461496 1466 1377 1247 1111 778 ------
NM_182648chr142714 564 ------
NM_182697chr721539 500 --11782 --
NM_182715chr711242 ------
NM_182757chr6103367 3313 2565 2292 1115 780 320 231 198 131 ------
NM_182758chr1541338 1158 641 29 11379 12904 --
NM_182762chr7175942 5850 5615 5195 4819 4714 4391 4203 4132 4086 4044 4001 3961 3844 3792 2194 907 16239 35346 3786 2495 22355 1784
NM_182763chr182141 2094 1990 1841 1688 767 434 343 1737 2530 254 --
NM_182765chr1021450 1431 1330 11959 --
NM_182789chr5----1773 --
NM_182830chr1451982 561 495 455 328 12072 ----
NM_182898chr796288 6059 5780 5720 1671 946 467 78 34 --35735 5039 4054 --
NM_182899chr796288 6059 5780 5720 1671 946 467 78 34 --35735 5039 4054 --
NM_182943chr32915 285 ------
NM_182944chr141359 ------
NM_182948chr143097 2594 2531 67 ------
NM_182964chr1183092 2851 2253 571 521 389 209 113 ------
NM_182972chr162188 1972 1922 1742 1102 946 ----12534
NM_183050chr652218 1889 1877 1586 1510 ------
NM_183075chr472876 2554 2508 1862 1025 1001 808 12102 2559 440 --
NM_183323chr5----1773 --
NM_183353chrX2936 777 ----11030
NM_183376chr1542390 2269 1642 696 ----12168
NM_183416chr12408 226 --2528 395 --
NM_183422chr134758 688 221 22 --1825 --
NM_184234chr20150 ------
NM_194071chr785225 5064 4754 3544 3490 1425 828 150 ------
NM_194247chr274368 3851 3211 512 374 191 106 24114 694 ----
NM_194282chr462298 480 394 263 216 30 1896 ----
NM_194283chr5103922 3637 3502 2851 2775 1277 956 894 350 299 --13106 24124 760
NM_194285chr1143005 1252 957 33 11170 22575 498 1519
NM_194286chr1275554 5433 4983 4845 3954 1922 1095 --15835 --
NM_194291chr852979 2346 2073 1077 888 ------
NM_194298chr1031974 1686 524 --31628 1330 1238 --
NM_194314chr145486 638 578 496 1503 34428 2220 1164 --
NM_194328chr933278 2406 211 172 ----
NM_194329chr933278 2406 211 172 ----
NM_194330chr933278 2406 211 172 ----
NM_194332chr933278 2406 211 172 ----
NM_194434chr18125595 3583 2014 2008 1908 1513 1400 1322 1121 650 310 273 24501 4300 21974 505 15263
NM_194454chr721630 610 --11691 11721
NM_194455chr721630 610 --11691 11721
NM_194456chr721630 610 --11691 11721
NM_194463chrX31059 1005 45 --11110 11133
NM_197970chr211675 ------
NM_198066chr1453116 2550 2089 1907 990 1185 ----
NM_198077chr12254 156 --1142 --
NM_198081chr662913 2591 1936 1828 870 305 --21853 842 22509 169
NM_198120chr81548 ------
NM_198128chr1832225 1935 292 --22085 751 --
NM_198158chr322599 1136 12825 1158 --
NM_198159chr322599 1136 12825 1158 --
NM_198177chr322599 1136 12825 1158 --
NM_198178chr322599 1136 12825 1158 --
NM_198195chr3----1165 1497
NM_198212chr742221 1746 1660 179 1263 ----
NM_198240chr124922 218 92 21 --11236 --
NM_198243chr15------1327
NM_198268chr154039 3495 1671 971 948 23253 1206 23326 3038 --
NM_198269chr154039 3495 1671 971 948 23253 1206 23326 3038 --
NM_198270chrX113385 3302 3260 3158 2918 2616 1116 659 440 322 130 --176 --
NM_198273chr532369 2213 924 --12668 193
NM_198279chrX----41204 1171 405 303 --
NM_198316chr12----1478 --
NM_198320chr1255248 1791 1151 1048 803 15211 1915 25143 3324
NM_198399chr3177 --11685 134
NM_198400chr1562732 1158 873 815 313 79 ------
NM_198401chr831330 1305 1242 --176 --
NM_198465chrX52092 1807 964 759 363 ------
NM_198468chr673815 3769 1612 990 944 204 164 --33686 3341 835 --
NM_198503chr141911 1871 1676 874 --1596 11732
NM_198513chr8--31748 1326 535 ----
NM_198549chr142975 2659 2100 91 --12920 --
NM_198569chr642654 1062 884 347 12249 2854 153 --
NM_198578chr1271397 1021 951 943 507 374 189 ----11254
NM_198581chr2107422 6982 5985 5270 2914 2843 1717 1594 1529 430 27551 2139 --12960
NM_198595chr4124972 4951 4648 3840 3492 3212 2013 1707 1565 987 971 503 --21177 397 --
NM_198686chr1472588 2391 2270 2152 1758 937 82 --1898 11927
NM_198793chr374124 3733 3696 3646 2965 2803 536 --12685 --
NM_198794chr141144 --1569 --
NM_198834chr1782271 2027 1796 1590 865 605 261 52 --12240 --
NM_198836chr1782271 2027 1796 1590 865 605 261 52 --12240 --
NM_198837chr1782271 2027 1796 1590 865 605 261 52 --12240 --
NM_198838chr1782271 2027 1796 1590 865 605 261 52 --12240 --
NM_198839chr1782271 2027 1796 1590 865 605 261 52 --12240 --
NM_198859chr3114828 3624 1980 1430 1422 1275 1233 1024 502 490 475 11070 14876 24344 742
NM_198889chr4------1921
NM_198900chr12117279 6885 6570 6462 5967 5806 5762 2021 1951 1425 1011 25191 913 ----
NM_198968chr1343119 3030 2490 328 --13746 --
NM_198989chr134467 441 389 39 ------
NM_199000chr732300 1858 792 1907 1411 --
NM_199005chr96671 347 158 100 93 54 --2855 310 --
NM_199040chr1293647 3635 3387 2776 1092 762 595 210 104 ------
NM_199072chr763239 2878 1099 1048 612 103 --23268 2508 22708 2196
NM_199132chr193668 584 315 ------
NM_199138chr132927 235 ----1344
NM_199168chr1051570 1124 952 386 247 11528 122 --
NM_199188chr1253598 3082 3055 1529 1000 22666 1193 23012 1043 13671
NM_199190chr1253598 3082 3055 1529 1000 22666 1193 23012 1043 13671
NM_199235chr21265 ------
NM_199280chr21123 ------
NM_199320chr472914 2392 1961 623 440 315 60 --3898 763 578 12015
NM_199320chr472914 2392 1961 623 440 315 60 --3898 763 578 12015
NM_199324chr4103440 2625 2501 2286 1494 1030 837 750 681 98 13403 ----
NM_199351chr1------1419
NM_199421chr1464883 3377 3246 1129 1029 760 24655 189 23533 1986 --
NM_199436chr2142931 2885 2861 2733 2425 2406 2212 2101 1988 1923 1051 990 923 846 1831 1104 --
NM_199454chr154729 4248 4122 3685 2899 24769 1398 ----
NM_199461chr1042968 2696 2684 2430 1427 13585 --
NM_199462chr1114739 4308 4129 3749 3583 3467 1393 1243 565 421 109 1438 34462 3352 71 --
NM_199478chrX31921 1267 296 --11652 --
NM_199482chr211336 11889 22102 340 1254
NM_199511chr32727 202 ------
NM_199512chr32727 202 ------
NM_201269chr111129 --11057 --
NM_201413chr212767 163 ----1259
NM_201414chr212767 163 ----1259
NM_201428chr1161624 1268 1086 1076 211 200 ------
NM_201429chr1161624 1268 1086 1076 211 200 ------
NM_201430chr1161550 1194 1012 1002 137 126 ------
NM_201435chr122162 44 ------
NM_201437chr821375 527 ------
NM_201439chr122342 87 ------
NM_201440chr122342 87 ------
NM_201515chr122342 87 ------
NM_201570chr101370 ------
NM_201571chr101370 ------
NM_201572chr101370 ------
NM_201590chr101370 ------
NM_201591chr411221 ------
NM_201592chr411221 ------
NM_201593chr101370 ------
NM_201596chr101370 ------
NM_201597chr101370 ------
NM_201628chr183375 2457 2135 2109 1283 642 509 213 --1544 --
NM_203282chr191620 11328 ----
NM_203327chr2031594 1215 118 13887 24459 3439 --
NM_203341chr12835 45 --11072 --
NM_203342chr1143499 3395 3231 3070 3002 2879 2867 2680 2552 2333 662 423 380 222 --1198 --
NM_203343chr1143499 3395 3231 3070 3002 2879 2867 2680 2552 2333 662 423 380 222 --1198 --
NM_203372chr231698 1513 388 --1251 31350 1164 1118
NM_203382chr531308 521 419 --1313 --
NM_203391chrX31265 312 36 --11340 --
NM_203403chr92914 38 11240 ----
NM_203406chr542286 598 512 298 ----1446
NM_203437chr2--1703 1612 --
NM_203446chr2151212 868 859 797 318 --22907 2035 --
NM_203447chr931026 966 94 1356 2930 55 --
NM_203451chr1352179 934 824 734 653 --1219 --
NM_203458chr183768 3423 3346 3247 2559 660 424 244 13650 23115 521 --
NM_203459chr12676 290 1709 1972 --
NM_203463chr243319 1207 839 174 --43467 3453 1889 605 14337
NM_203464chr111263 ------
NM_203504chr42226 219 1270 1696 --
NM_203505chr42226 219 1270 1696 --
NM_205768chr152108 2064 1876 1364 431 --1740 --
NM_206594chr142946 1474 1308 540 21100 624 ----
NM_206595chr142946 1474 1308 540 21100 624 ----
NM_206853chr653659 2849 1370 486 323 146 23925 3909 --
NM_206854chr694920 4110 1747 1584 1266 1023 571 431 418 11307 35186 5170 170 --
NM_206855chr6105885 5075 2549 2231 1988 1536 1396 1383 983 513 24111 2272 36151 6135 1135 --
NM_206866chr2172927 2696 2210 797 752 509 131 --12538 22124 866
NM_206876chr233070 579 386 --33468 2782 478 11368
NM_206886chr1138 ------
NM_206907chr553102 2866 979 627 387 12897 12594 1892
NM_206909chr8197532 6888 6778 6762 6655 6004 5896 5209 3338 3148 2944 2795 2315 2107 1883 1690 1485 1311 471 25510 3370 36965 5409 1413 37621 626 363
NM_207012chr1043189 2893 1032 169 --1649 --
NM_207015chr33457 372 241 --1735 1235
NM_207292chr343149 2857 2322 1250 ------
NM_207293chr343149 2857 2322 1250 ------
NM_207294chr343149 2857 2322 1250 ------
NM_207295chr343149 2857 2322 1250 ------
NM_207296chr343149 2857 2322 1250 ------
NM_207297chr343174 2882 2347 1275 --130 --
NM_207299chr93935 776 399 --3900 391 216 --
NM_207303chr1064061 4049 3692 1587 703 373 --44178 3944 2732 2527 --
NM_207311chr1211326 ------
NM_207325chr191259 ----1745
NM_207361chr13125959 5311 5256 4195 4141 1986 1336 1325 875 751 609 513 --36115 4928 1574 46085 2258 1781 1077
NM_207404chr362239 2067 2007 1717 1709 718 --12251 --
NM_207406chr486103 5866 5808 5723 4696 4456 4415 1543 --11005 --
NM_207578chr12726 91 --165 --
NM_207660chr1421375 240 21548 528 176 --
NM_207661chr1421375 240 21548 528 176 --
NM_207662chr1421375 240 21548 528 176 --
NM_212460chr721649 284 ------
NM_212471chr1712085 12155 1837 --
NM_212472chr1712085 12155 1837 --
NM_212543chr35536 296 149 121 32 --1248 --
NM_212558chr9114175 3914 3807 3739 3053 2977 2863 1659 1066 849 824 ------
NM_213589chr2105194 5133 4661 4030 3724 2018 1431 1128 547 224 ------
NM_213593chr111068 ------
NM_213654chr32465 282 1629 ----