TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-150-3p
miRNA Sequence: CUGGUACAGGCCUGGGGGACAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1143523 2328 935 707 ------
NM_000081chr121291 1227 ----1539
NM_000084chrX56716 4583 1838 1299 1090 21490 1067 12062 12433
NM_000091chr222131 2002 --11917 32853 2728 1148
NM_000138chr1542356 1955 1887 391 11037 ----
NM_000259chr1535029 2546 235 34330 2315 2215 25301 609 --
NM_000297chr441973 1845 1781 1267 --31793 1718 634 --
NM_000332chr676929 6667 1373 1183 1040 62 48 47212 7195 4533 2169 --22795 2256
NM_000337chr534378 4347 1401 ----22113 481
NM_000390chrX52944 2448 2287 600 471 --12175 12272
NM_000408chr253178 2827 1391 1138 176 --13015 --
NM_000430chr1783465 2930 2752 2553 1073 943 432 215 --23441 1154 13783
NM_000461chr373774 3216 3039 1419 1401 1341 910 --13283 --
NM_000480chr1121177 576 ----11652
NM_000555chrX67634 6052 5882 5686 5649 5508 --26715 2326 --
NM_000618chr1226052 1268 12099 26130 2123 1606
NM_000618chr1226052 1268 12099 26130 2123 1606
NM_000663chr1682905 2741 2119 1146 1093 402 385 93 13021 ----
NM_000719chr1244844 4248 1827 1245 --36372 5323 1948 11640
NM_000826chr462412 2011 1948 1783 776 395 --12536 --
NM_000844chr31349 ----21102 1017
NM_001001664chr254081 2828 2770 1450 268 ----11246
NM_001001890chr2141386 851 825 773 32911 2626 1161 24259 894 --
NM_001003652chr1897785 6670 5783 5768 3097 2269 1902 1627 333 --37720 1773 320 15520
NM_001003681chr2252122 1991 1973 1768 628 1326 11753 --
NM_001003712chr1242788 2699 299 217 23679 1085 23059 2525 --
NM_001003800chr933042 959 826 ----22629 2582
NM_001004304chr1263193 2830 2387 2363 2012 939 --1711 12377
NM_001004306chr1721661 586 12016 1146 11763
NM_001004317chr644189 4013 1497 1335 21215 544 ----
NM_001004328chr1222241 1794 --22265 73 1345
NM_001005473chr556491 6103 5777 1940 1555 16662 ----
NM_001007024chr1744346 3228 1341 506 ----11494
NM_001007025chr1744346 3228 1341 506 ----11494
NM_001007278chr1345148 4826 3687 511 34497 4283 794 14732 15277
NM_001007559chr1822042 1790 ----22067 2023
NM_001007565chr3165 ----1354
NM_001008408chr786340 5361 4991 4590 3877 2396 1764 581 16373 ----
NM_001008925chr442964 2556 1089 770 13315 1296 --
NM_001009899chr3106211 5809 5780 5246 4027 2375 1591 1476 305 213 --24685 2123 25532 663
NM_001010891chr556052 5793 4805 4688 797 15806 24646 2646 --
NM_001010895chr971373 747 726 622 604 386 163 ------
NM_001011513chr463747 3577 3060 2747 1306 763 --13731 --
NM_001012393chr1164913 4720 2055 2020 1333 1009 --1591 25191 5090
NM_001012420chr153895 794 408 --1720 11905
NM_001012751chr1051553 1404 626 230 96 --1320 --
NM_001012761chr52755 396 --22112 1711 21956 204
NM_001012968chrX32731 982 175 --12755 2619 130
NM_001013031chr1072528 2399 1173 1054 1007 929 589 --23488 2711 --
NM_001018065chr9116013 5476 4920 4368 1683 1382 891 740 714 698 214 --1855 12292
NM_001018066chr9116013 5476 4920 4368 1683 1382 891 740 714 698 214 --1855 12292
NM_001018067chr144947 4211 3484 2040 --33266 1868 337 14699
NM_001018068chr144947 4211 3484 2040 --33266 1868 337 14699
NM_001018069chr144947 4211 3484 2040 --33266 1868 337 14699
NM_001024647chr1287692 7451 7361 7333 6265 5765 1484 138 22683 2411 57519 6952 2963 1593 216 17318
NM_001024855chr321909 1358 1254 11888 11421
NM_001024956chr1175018 3995 1905 1269 506 245 115 --11129 21413 1179
NM_001025068chr351546 1474 1220 1155 539 --11187 11780
NM_001025069chr351546 1474 1220 1155 539 --11187 11780
NM_001025077chr1057136 6346 5980 4797 1064 12447 36984 4813 235 --
NM_001025389chr1121177 576 ----11652
NM_001025390chr1121177 576 ----11652
NM_001025595chr441646 1573 1192 1045 --1579 1385
NM_001025616chr421521 1199 11598 --2527 165
NM_001030007chr1653991 3010 2702 1195 1136 11373 21472 94 1996
NM_001030055chr1443334 1506 1192 563 12929 --11133
NM_001031732chr463702 2601 2294 1353 791 161 11343 11361 --
NM_001032221chr91224 --11793 11804
NM_001033557chr21912 ----175
NM_001037164chr721905 226 ----11880
NM_001037174chr242184 1426 701 588 --12042 1626
NM_001037954chr114706 450 428 163 1508 23488 2263 1111
NM_001039577chr1114473 4431 4232 3918 3884 3462 1707 1154 1115 606 253 --1466 --
NM_001039615chr822240 1793 --12264 31470 345 74
NM_001039937chr1373685 3474 3373 3323 3305 1231 202 ------
NM_001040152chr751914 1244 1076 1060 1027 13417 13698 --
NM_001040153chr131264 --1787 1297
NM_001040157chr462844 1962 1936 795 574 430 --12670 --
NM_001040284chr1695772 4812 4410 2319 2186 1613 1085 818 376 --1812 --
NM_001040429chr1332406 2200 1275 13068 --22705 1427
NM_001040441chr134150 159 57 --35419 4857 3429 --
NM_001040665chr754980 4833 3631 1919 1770 2822 777 13049 --
NM_001042355chr1633971 1182 481 --45404 3414 2001 1991 --
NM_001042383chr353342 3168 2582 904 724 --13272 1310
NM_001042412chr1633971 1182 481 --45404 3414 2001 1991 --
NM_001042555chr1274015 3476 3138 3073 1768 1258 525 24180 3365 54000 3671 1400 1187 825 --
NM_001042599chr257735 7015 4784 2147 1607 --24817 1629 --
NM_001042603chr1254107 1847 851 550 452 ----14514
NM_001042604chr344427 4407 3541 284 --2309 91 2622 177
NM_001042669chr421521 1199 11598 --2527 165
NM_001042749chrX31925 1839 1349 ----1372
NM_001042750chrX31925 1839 1349 ----1372
NM_001042751chrX31925 1839 1349 ----1372
NM_001044305chr631224 239 151 --11406 21146 471
NM_001044385chr243302 3158 2950 477 --1625 12727
NM_001048183chr153703 3080 1321 1102 543 13643 --13450
NM_001083620chr462410 2009 1946 1781 775 394 --12534 --
NM_001099678chr3106081 5832 5404 5113 5082 1923 1483 1246 1050 812 --25263 4579 --
NM_001113490chrX83649 3382 3316 2922 2803 2764 2434 1122 --1145 --
NM_001128chr1653991 3010 2702 1195 1136 11373 21472 94 1996
NM_001167chrX96631 5990 5329 4464 4256 2000 1756 1367 616 22071 1018 36420 4900 4457 --
NM_001173chr1443334 1506 1192 563 12929 --11133
NM_001256chr1742674 615 465 290 --31981 930 130 --
NM_001259chr764586 4178 2118 1868 1077 857 14740 11985 14431
NM_001304chr1753709 2594 2562 2432 2396 137 23003 1491 13501
NM_001412chrX53350 3310 3102 2750 1477 13685 ----
NM_001432chr4103821 3382 2393 1545 1524 1088 655 466 124 40 13300 1434 13782
NM_001490chr932564 1269 533 --1487 1365
NM_001527chr684448 4396 3939 3594 1448 1346 563 337 --14754 --
NM_001635chr741033 736 333 262 ----1136
NM_001695chr824273 148 ----1225
NM_001709chr1132208 2063 440 ----22858 1156
NM_001754chr2141386 851 825 773 32911 2626 1161 24259 894 --
NM_001755chr1651747 1563 849 449 152 --1406 11632
NM_001792chr182253 243 --11126 1978
NM_001806chr1922756 2090 12881 11187 21040 791
NM_001839chr12554 114 ----2681 673
NM_001854chr131295 124 50 --168 1355
NM_001918chr188944 8633 7520 3571 3318 2202 1302 108 --48955 5692 2030 64 --
NM_001981chr121893 911 ----175
NM_002015chr1343218 2766 2604 2199 32145 925 270 2473 241 12161
NM_002025chrX97938 7910 7035 6910 6183 6108 1814 1017 472 23700 560 --25828 2400
NM_002040chr2152869 2497 876 544 465 --22794 2708 --
NM_002130chr551605 391 322 226 158 1349 ----
NM_002137chr722231 1632 11641 22149 1976 --
NM_002158chr273751 3417 1330 1270 1195 1163 895 ------
NM_002228chr131176 915 906 ----11076
NM_002247chr1022076 35 --32173 1683 871 1735
NM_002270chr565622 5409 5093 4751 1779 1510 --24890 4227 25473 344
NM_002271chr1332345 1871 1610 --12064 12168
NM_002310chr5106442 6190 5739 5180 4503 1823 1554 1348 596 259 --24372 4078 11956
NM_002387chr5114962 3781 1951 1601 1527 654 456 368 250 190 78 11191 15001 --
NM_002519chr1141320 1197 478 113 --11514 --
NM_002545chr1164913 4720 2055 2020 1333 1009 --1591 25191 5090
NM_002645chr1142328 2150 959 300 22407 593 23133 2020 1742
NM_002687chr141161 --1347 1981
NM_002718chr322316 229 1294 22591 116 1271
NM_002719chr1442375 2289 2213 628 --177 12194
NM_002737chr1775862 5433 5255 4826 4101 1854 831 11308 11454 --
NM_002745chr2273612 3587 3576 1421 1371 1270 247 --1743 --
NM_002837chr1244332 1213 987 86 1563 11786 21721 1191
NM_002843chr1153152 1389 577 521 394 ----11284
NM_002855chr1193727 3709 3351 3304 2846 2455 718 314 250 ----12630
NM_002858chr131291 1211 438 ----1226
NM_002886chr3105058 4879 4286 4135 3630 3396 1538 733 666 170 11078 24731 879 21388 791
NM_002912chr62801 157 --1267 1375
NM_002959chr194403 4215 4098 3853 3819 3596 417 409 393 11543 22708 828 --
NM_003108chr265719 5023 4540 1555 1313 1288 --11294 17090
NM_003128chr252683 2073 1047 549 89 --12737 22675 381
NM_003137chr642101 808 583 269 ----11762
NM_003199chr1855254 1915 1093 435 332 1838 45035 4573 3891 1994 --
NM_003203chr21463 1532 --2510 497
NM_003262chr345055 1992 1412 270 --23348 2088 1905
NM_003337chr561060 602 302 170 156 84 ------
NM_003339chr521380 187 ----1197
NM_003342chr1763114 3069 2563 2371 1178 536 1188 13298 22733 328
NM_003392chr374348 3728 1353 1331 1320 1269 960 --14188 --
NM_003410chrX52985 2737 2281 886 851 13062 ----
NM_003412chr332914 542 391 --12380 1576
NM_003453chr132612 120 --1289 1576
NM_003463chr653164 2597 2307 610 388 1352 12147 1247
NM_003474chr1031658 534 415 12175 --31874 1593 78
NM_003583chr12103706 3219 3060 2817 2797 1208 1029 866 530 117 ------
NM_003590chr273697 3651 3635 3405 1575 758 38 --12674 --
NM_003822chr11472 --23017 190 23103 542
NM_003873chr103766 655 465 --12347 1617
NM_003913chr664284 4265 3674 3612 966 756 ------
NM_003958chr623943 373 --33769 2568 588 12972
NM_003966chr587792 7613 7322 7024 2474 2301 1293 54 --2647 306 --
NM_004124chr1463574 2878 2775 795 534 515 --11031 --
NM_004136chr1532699 1115 837 --2691 371 12758
NM_004170chr951437 1394 1249 757 610 ----21530 483
NM_004504chr233047 2058 219 12589 --12979
NM_004505chr1731961 1912 665 ----11931
NM_004586chrX115382 5211 5028 4208 3453 3347 1790 1471 492 428 28 --1438 --
NM_004598chr552912 1115 684 478 69 22511 2245 12599 --
NM_004612chr994536 4350 4038 4017 3507 3151 3054 652 464 --23033 637 13789
NM_004730chr531619 1384 720 ----22044 746
NM_004742chr341600 1315 1187 246 ----1253
NM_004760chr762250 1856 820 379 107 86 1336 11694 --
NM_004859chr1732794 1929 684 1480 --23093 2787
NM_004871chr1744346 3228 1341 506 ----11494
NM_004921chr142372 2308 2237 214 11918 --12294
NM_004956chr743427 1007 732 724 ----23247 934
NM_004985chr1244230 1730 1498 185 14214 34509 3474 2756 11271
NM_004992chrX88474 8261 7701 6939 6907 3305 1392 405 11744 38448 8092 5726 --
NM_004992chrX88474 8261 7701 6939 6907 3305 1392 405 11744 38448 8092 5726 --
NM_004998chr153827 705 179 ----1809
NM_004999chr6104486 4223 4195 3360 1752 1233 469 370 201 62 1630 1865 14341
NM_005023chr541446 1343 1317 316 ----1535
NM_005056chr1264351 2091 1095 794 696 102 ----14758
NM_005063chr1023068 1436 --33374 2716 2698 13850
NM_005065chr1494668 4416 4001 1505 1364 1100 869 298 216 --12083 --
NM_005109chr332223 488 354 ----22459 2327
NM_005121chr1742832 2506 1404 788 --1909 --
NM_005156chr9105407 5133 4879 4614 4125 4070 3732 3595 1055 367 --24154 994 --
NM_005235chr257735 7015 4784 2147 1607 --24817 1629 --
NM_005277chr441960 1951 1529 633 ----21880 1213
NM_005339chr443434 703 457 431 --1670 1301
NM_005342chrX1762 ----22311 212
NM_005359chr1854345 2552 1851 1115 1037 --31485 1248 467 --
NM_005378chr21567 ----1574
NM_005400chr233044 1203 1048 ----13037
NM_005433chr181923 12097 12017 22302 184
NM_005487chr2252122 1991 1973 1768 628 1326 11753 --
NM_005502chr972893 2709 2507 1036 898 611 125 1505 1489 --
NM_005504chr12106214 6186 5881 2492 1994 1574 774 692 675 295 21300 125 12241 --
NM_005596chr986240 5363 5305 5097 5085 4603 2016 1624 ------
NM_005637chr1822042 1790 ----22067 2023
NM_005647chrX33370 862 112 ----2493 351
NM_005738chr721905 226 ----11880
NM_005746chr742731 2478 973 740 --1710 --
NM_005759chr234603 1220 749 13186 24706 2927 24784 4097
NM_005798chr1345148 4826 3687 511 34497 4283 794 14732 15277
NM_005840chrX97137 6230 2886 2367 2243 2108 1571 815 381 11019 47712 4686 2069 1328 --
NM_005898chr1142695 1145 818 740 --153 --
NM_005901chr1897785 6670 5783 5768 3097 2269 1902 1627 333 --37720 1773 320 15520
NM_005935chr494946 4325 4003 3680 3476 3213 1364 758 553 --15200 --
NM_005941chr814178 --13218 11634
NM_006007chr984386 3154 2911 1368 1039 945 680 380 ----1291
NM_006033chr1841645 1611 922 336 11652 31662 868 846 11533
NM_006070chr3165 ----1354
NM_006080chr71478 --22833 660 12059
NM_006108chr1121667 1483 1802 --1250
NM_006154chr1532395 1792 1012 12799 --12888
NM_006252chr136170 5372 203 1871 --26908 4692
NM_006267chr251835 606 446 231 217 --11409 --
NM_006283chr864774 4377 4158 4084 1540 416 11847 --24726 1269
NM_006287chr252131 1027 776 612 129 --1151 1550
NM_006298chr642966 1259 1243 236 --22317 642 179
NM_006306chrX63931 2165 1555 898 700 347 --35015 2184 1969 15153
NM_006380chr1794374 4199 4074 3939 3397 3254 3135 1722 929 1492 1201 --
NM_006393chr1074232 4194 3310 1492 142 111 39 11586 13211 1618
NM_006457chr463747 3577 3060 2747 1306 763 --13731 --
NM_006482chr12103706 3219 3060 2817 2797 1208 1029 866 530 117 ------
NM_006526chr2021948 124 --11566 1198
NM_006544chr1444779 4455 3890 347 --35600 3991 1627 --
NM_006572chr1723180 2574 2341 334 42382 1002 945 775 --
NM_006599chr1677444 6851 6222 6216 5488 2569 2005 17943 26119 1261 --
NM_006603chrX31925 1839 1349 ----1372
NM_006654chr1274015 3476 3138 3073 1768 1258 525 24180 3365 54000 3671 1400 1187 825 --
NM_006717chr962765 2477 2363 396 390 266 12817 --12937
NM_006729chrX45332 5042 4258 2071 --22006 244 --
NM_006731chr995765 5713 5333 4586 3865 3671 3546 1244 657 --34763 613 183 14397
NM_006777chrX32161 1871 892 ----12702
NM_006885chr1643273 1445 1351 268 --12662 14094
NM_006918chr1175018 3995 1905 1269 506 245 115 --11129 21413 1179
NM_006955chr1063421 2783 2320 2178 767 530 --23310 2171 --
NM_006996chr151859 1818 1596 574 353 ------
NM_007007chr12----14443 32971 1763 877
NM_007107chr322056 211 ----22198 1865
NM_007114chr322090 348 ----23157 2882
NM_007145chr1941294 1234 968 152 1122 ----
NM_007218chr8--1110 --3840 601 316
NM_007249chr1388375 6622 5949 5844 3760 2686 2328 1178 17324 48312 6253 2186 1426 16443
NM_007375chr132158 1953 1077 1726 12436 192
NM_012097chr242184 1426 701 588 --12042 1626
NM_012141chr1373685 3474 3373 3323 3305 1231 202 ------
NM_012164chr997449 6958 6431 5786 5329 4923 4839 235 110 ------
NM_012193chr1175380 5274 4684 4591 2010 778 639 ----14932
NM_012214chr266350 4887 4582 2112 1603 65 11561 46373 6173 2454 250 15429
NM_012252chr735310 4607 754 --21976 321 15356
NM_012262chr185229 5037 4692 4017 3383 1320 878 457 ------
NM_012297chr411803 ----1478
NM_012420chr1011541 --1914 1130
NM_013255chr788592 6841 5456 2685 2272 2240 1623 1444 11665 26047 2794 --
NM_013374chr382479 2399 2291 2186 2161 927 153 101 ----172
NM_014021chr163269 2379 2310 1325 1294 932 ------
NM_014028chr632422 2071 412 --23147 2312 --
NM_014033chr1242307 1907 1528 608 ------
NM_014106chr1582901 2616 2343 2335 2287 1826 1039 995 ------
NM_014112chr834804 749 270 24934 4208 22047 1094 --
NM_014155chr11107317 6931 6206 4970 4964 2990 1862 885 873 188 --16906 --
NM_014250chr2252122 1991 1973 1768 628 1326 11753 --
NM_014331chr486897 6575 6274 5978 4877 2815 2809 1589 25274 2437 37115 6429 2823 --
NM_014382chr331748 1144 464 --21772 369 1539
NM_014423chr565545 4380 1887 1420 1377 1238 --1653 --
NM_014447chr441645 1572 1191 1044 --1579 1385
NM_014572chr1351692 1647 1605 1524 1194 11206 ----
NM_014585chr22118 63 --1348 11103
NM_014636chr954055 3035 2999 2848 1000 13988 13775 14287
NM_014682chr842124 1871 258 76 ------
NM_014721chr666898 6847 5221 4815 1444 596 --46525 6280 786 614 15936
NM_014739chr643742 3276 216 187 --12973 13019
NM_014839chr111638 22079 275 12115 1327
NM_014841chr641262 1244 1043 426 1102 1178 --
NM_014877chr1787420 7162 7083 5808 5514 5239 5160 930 --57557 7102 2961 415 50 11095
NM_014897chr1743163 2850 794 455 --1416 1374
NM_014906chr1753082 2953 2563 807 396 --23277 949 13028
NM_014920chr663450 3069 2911 2898 2762 941 1893 13266 1791
NM_014946chr233056 2850 2759 ----1517
NM_014950chr1421523 460 ----11616
NM_014953chr1364114 3985 2774 1644 1599 157 --33325 987 853 --
NM_014982chr1485273 4948 4773 3400 1829 1581 726 93 ------
NM_015020chr1622875 1468 --23116 578 13423
NM_015026chr1284801 4611 4074 3997 3342 1744 416 328 --23633 3183 11842
NM_015032chr1332525 777 527 ----1832
NM_015039chr153677 2752 1714 1067 268 13089 --12819
NM_015074chr163994 3753 3222 978 346 176 ----14886
NM_015138chr1532231 910 705 --1659 12839
NM_015141chr342199 1690 1035 176 1891 22729 2465 --
NM_015172chr151233 1226 1110 1045 202 --21080 173 --
NM_015206chr1562842 2793 2785 910 857 55 --23509 3238 --
NM_015247chr1633971 1182 481 --45404 3414 2001 1991 --
NM_015271chr434299 4215 596 --31664 838 681 --
NM_015278chr653454 3099 2908 2898 316 13302 --13423
NM_015291chr1----12649 22147 1011
NM_015310chr887933 7826 7673 6738 5357 1563 1495 267 17279 21924 1672 --
NM_015313chr1174677 3811 3679 1912 883 649 308 23560 1169 14793 --
NM_015336chr1242526 1788 1692 334 --11840 12577
NM_015387chr252114 1931 83 49 24 ------
NM_015435chr831491 1378 1167 ----11064
NM_015455chr521455 941 --23176 651 1498
NM_015508chr351321 1315 1026 435 217 1537 21075 546 --
NM_015550chr71678 --12414 13312
NM_015560chr342601 2260 873 656 ----1221
NM_015564chr513202 12625 1406 43222 3179 829 817
NM_015569chr184817 4795 4526 3509 3316 3299 1583 224 --13962 --
NM_015571chr622630 929 ----11832
NM_015640chr144947 4211 3484 2040 --33266 1868 337 14699
NM_015879chr18118576 8557 8235 7471 6673 3184 2115 1901 1146 1034 596 25898 3345 58029 5527 5506 3213 1948 16867
NM_015886chr845455 5346 4492 2106 --25565 4406 --
NM_015888chr151310 1248 663 530 69 --1904 --
NM_015902chr82894 695 ----1763
NM_015906chr154537 4256 4073 3045 757 --23618 3550 --
NM_016018chr842852 2727 2670 2161 ----21782 714
NM_016081chr432162 1731 612 --31817 1408 600 --
NM_016083chr643589 2809 410 379 --23540 454 --
NM_016133chr221080 479 --2320 250 1337
NM_016206chr365491 2735 1818 1667 1082 965 16890 29004 5886 --
NM_016221chr551463 570 330 103 39 ----21487 439
NM_016255chr643170 2713 2251 1054 1681 11324 150
NM_016260chr277507 7329 5003 2548 2390 1786 1317 --1603 --
NM_016277chr621558 1521 ----11504
NM_016315chr231631 1484 1205 11703 ----
NM_016422chr1152898 2769 2741 2191 601 1187 ----
NM_016513chr663450 3069 2911 2898 2762 941 1893 13266 1791
NM_016530chr1534055 2672 1657 --13710 23735 1399
NM_016562chrX21404 1069 --21498 425 1579
NM_016603chr571939 1828 1797 529 135 121 67 --21727 263 --
NM_016953chr255532 5431 4265 3967 1720 --35713 5320 446 14902
NM_017420chr1463607 3558 3443 3210 3043 985 ----1257
NM_017447chr2134027 3318 1311 --1959 11208
NM_017610chr152636 424 1364 21896 225 11929
NM_017628chr434722 1404 185 ----1906
NM_017637chr9149226 9134 8521 8198 7207 6337 3632 3301 3127 2437 2136 1404 392 84 --29339 796 19443
NM_017644chr395167 4484 3810 3589 3412 3248 1901 888 244 13987 193 --
NM_017658chr1474522 4440 4016 1829 1633 835 44 34430 3701 3302 24628 280 --
NM_017709chr133352 210 148 --2651 174 1464
NM_017742chr1831914 1839 1803 ----21216 145
NM_017754chr635028 4956 202 13127 1283 127
NM_018015chrX3736 308 41 ----1937
NM_018084chr243078 2691 1283 263 13313 1488 12746
NM_018133chr321478 871 --11634 1114
NM_018155chr373280 3174 2556 2225 1219 826 21 ------
NM_018243chr423205 911 14063 1990 11270
NM_018351chr1284681 4659 3295 2885 1511 880 505 257 --23267 784 --
NM_018362chr1143065 1300 527 315 12585 13316 --
NM_018364chr143415 2982 611 185 --23761 2654 --
NM_018374chr764748 4707 3676 3434 1899 1253 --25281 192 11321
NM_018440chr898210 7996 6293 5978 5624 3220 2571 1112 201 27566 3466 17379 --
NM_018557chr22464 338 --21493 1151 1664
NM_018566chr184693 4658 4227 3709 3634 1938 1294 725 14454 ----
NM_018638chr1245644 4953 4440 1653 1802 13549 24906 4044
NM_018841chr143915 3851 2959 2898 --23937 418 23059 722
NM_018947chr754655 4025 1304 295 221 --33558 1195 63 15025
NM_018976chr1232810 1965 352 1892 1670 1446
NM_018993chr2051431 1375 1368 1326 1287 ------
NM_018999chr1044352 4019 1514 379 13584 14513 13538
NM_019001chr344427 4407 3541 284 --2309 91 2622 177
NM_019004chr741678 706 527 194 ----1610
NM_019044chr274713 4368 4298 3147 3018 1488 605 --24730 4463 --
NM_019045chrX1311 ----2864 51
NM_019063chr251837 1633 458 373 263 --21440 411 --
NM_019084chr1042519 2433 1812 122 11645 1731 --
NM_019117chrX22655 1361 --1126 1995
NM_019600chr153784 515 203 ----177
NM_020122chr275974 2001 1451 976 743 549 235 --25952 2350 --
NM_020144chr752079 2040 727 578 507 --1434 --
NM_020346chr1131646 1535 517 ----11315
NM_020546chr572670 2223 882 678 657 170 49 11108 --1592
NM_020640chr331862 1524 490 12105 --12309
NM_020673chr2057313 5721 5671 2377 1609 26859 4982 34818 654 433 12241
NM_020686chr1682905 2741 2119 1146 1093 402 385 93 13021 ----
NM_020718chr1686403 6157 2474 2054 1938 1874 634 95 ------
NM_020772chr17118068 7807 7698 7390 6652 6446 5384 5332 1944 849 418 --57827 3238 2569 1893 1827 17781
NM_020774chr1864641 4121 3926 2396 841 36 --44830 2161 1006 143 --
NM_020783chr1852146 1790 917 896 787 --22386 288 --
NM_020810chr1432891 917 108 1303 2744 565 --
NM_020841chr1242788 2699 299 217 23679 1085 23059 2525 --
NM_020918chr10103197 1433 1043 1002 984 829 771 575 86 58 ------
NM_020940chr1052497 2171 1145 943 801 ----12341
NM_020948chr153580 3519 1390 324 318 --13388 --
NM_021038chr353157 2273 2222 669 641 1753 --1590
NM_021202chr2022502 2182 ----12477
NM_021252chr1031534 412 229 1500 11842 --
NM_021255chr1444072 3023 1275 839 13199 11444 --
NM_021629chr321055 261 --35011 1953 1573 13871
NM_021648chr642673 2640 681 441 --4567 361 287 178 --
NM_021935chr32974 379 --31008 981 86 171
NM_021940chr631224 239 151 --11406 21146 471
NM_021961chr1166943 6713 6004 4927 2808 658 17484 --1790
NM_022048chr15105712 5061 2015 1955 1840 1668 1364 538 508 52 ------
NM_022130chr531393 434 87 1963 11247 --
NM_022456chr1287692 7451 7361 7333 6265 5765 1484 138 22683 2411 57519 6952 2963 1593 216 17318
NM_022474chr1472781 2768 2486 2042 1023 539 318 ----12124
NM_022763chr383169 2044 2022 1962 1254 577 424 396 1995 ----
NM_022781chr933298 2592 439 12806 23140 2506 22276 519
NM_022828chr531609 1486 714 ----11091
NM_022841chr1552690 2276 541 234 32 --12587 --
NM_022843chr1331335 1037 395 1206 --11342
NM_022845chr1651701 1517 803 403 106 --1360 11586
NM_022893chr222975 2346 12340 --1637
NM_023016chr272797 2609 2169 502 369 266 207 ------
NM_023923chr153703 3080 1321 1102 543 13643 --13450
NM_023929chr812106 12622 2903 423 --
NM_024665chr364211 4197 3415 3343 235 74 11709 1319 --
NM_024721chr832710 2382 338 1111 1212 1732
NM_024740chr1164123 3993 3915 3750 3355 1552 ----12638
NM_024770chr245714 4618 1826 1232 12194 26726 881 1975
NM_024834chr1031332 663 516 --1294 11578
NM_024884chr1454432 4122 3344 1629 698 --13815 159
NM_024900chr432180 1700 882 --12341 11686
NM_024900chr432180 1700 882 --12341 11686
NM_024915chr842323 2300 1143 759 22317 1957 12011 12817
NM_024947chr367714 6791 5826 3608 2383 2364 32299 2000 1105 16502 23466 3386
NM_025054chr863058 2609 1546 1160 1054 463 24111 3959 ----
NM_025160chr124172 623 12689 --11557
NM_025179chr144944 4891 3570 814 1827 ----
NM_025180chr353341 3168 2582 904 724 --13271 1310
NM_025191chr123457 646 ----13376
NM_025235chr1022226 2195 --32232 1491 422 1251
NM_030647chr743867 3834 1840 1650 23988 2299 21683 158 --
NM_030648chr453677 1990 1046 493 416 --1283 15057
NM_030650chr254252 3866 3339 2665 1660 --23296 112 --
NM_030674chr1265658 2079 1115 994 632 407 --25690 1320 --
NM_030799chr532223 1364 143 ----11527
NM_030806chr189262 6354 6241 6230 3253 2556 2503 2488 --18753 --
NM_030940chr92506 221 1559 --11397
NM_031243chr722231 1632 11641 22149 1976 --
NM_031305chr421521 1199 11598 --2527 165
NM_031362chr222057 1928 --11843 32779 2654 1074
NM_031365chr222193 2064 --11979 22915 2790
NM_031366chr222193 2064 --11979 22915 2790
NM_031435chr121613 ----43400 3107 889 341
NM_031469chr684115 4056 4000 3964 2538 1482 1177 272 12786 ----
NM_032195chr216508 497 491 483 471 343 ------
NM_032199chr1043868 3794 3291 994 13827 1562 --
NM_032228chr1142830 1392 1368 1164 1747 ----
NM_032246chr1521153 322 ----11268
NM_032289chr531824 1684 547 --11900 11909
NM_032373chr1055845 5397 4788 269 188 13767 34308 1508 846 12235
NM_032436chr134964 690 333 309 --1111 11012
NM_032446chr563346 2800 2693 2438 1474 1108 --22905 698 --
NM_032457chr432668 2582 2452 --1833 1749
NM_032505chr352387 510 495 481 283 ------
NM_032521chr2043039 2988 2923 2386 12954 ----
NM_032859chr1343976 3611 3451 87 --1691 11362
NM_032905chr103888 453 210 --1924 21156 470
NM_032968chrX31389 1337 813 ----13771
NM_032969chrX31389 1337 813 ----13771
NM_032973chrY31337 813 266 ----13763
NM_033020chr154537 4256 4073 3045 757 --23618 3550 --
NM_033083chr373323 2789 2271 2214 1106 386 292 --21180 1094 --
NM_033181chr643589 2809 410 379 --23540 454 --
NM_033224chr737070 5714 2128 --36741 2141 1261 --
NM_033285chr844166 3412 3229 2844 --33661 3058 171 --
NM_033360chr1254351 1851 1619 306 135 14335 34630 3595 2877 11392
NM_033425chr114706 450 428 163 1508 23488 2263 1111
NM_033505chr255165 4451 2226 2078 1293 1331 36569 6002 5250 25504 2048
NM_033540chr31109 1249 --1102
NM_052811chr1345148 4826 3687 511 34497 4283 794 14732 15277
NM_052832chr822101 247 --1437 12995
NM_052885chr1264951 4250 4074 1148 843 282 --24795 4108 14831
NM_052904chr621035 385 1234 --11024
NM_052918chr1072727 2598 1372 1253 1206 1128 788 --23687 2910 --
NM_052954chr2131818 1479 487 11416 --2889 29
NM_053016chr997986 7901 7882 5966 5429 5400 2851 289 39 --25480 70 --
NM_053023chr1133073 2957 2411 --22988 761 --
NM_053043chr786340 5361 4991 4590 3877 2396 1764 581 16373 ----
NM_053056chr1192982 2718 2543 2528 2018 1192 1112 559 334 --22624 2089 --
NM_057175chr432662 2302 1976 12329 22308 657 --
NM_058237chr141717 ----1809
NM_080629chr131295 124 50 --168 1355
NM_080630chr131295 124 50 --168 1355
NM_130831chr342601 2260 873 656 ----1221
NM_130832chr342601 2260 873 656 ----1221
NM_130833chr342601 2260 873 656 ----1221
NM_130834chr342601 2260 873 656 ----1221
NM_130835chr342601 2260 873 656 ----1221
NM_130836chr342601 2260 873 656 ----1221
NM_130837chr342601 2260 873 656 ----1221
NM_130847chr1195955 5836 5615 5331 4184 1534 1353 316 294 --45737 5283 1884 1812 1467
NM_133265chrX83649 3382 3316 2922 2803 2764 2434 1122 --1145 --
NM_133334chr465708 4254 2504 1677 840 42 --36206 5971 4667 --
NM_133370chr463702 2601 2294 1353 791 161 11343 11361 --
NM_133496chr164578 1296 1078 610 559 72 --2823 643 --
NM_133646chr223720 1932 1797 24822 1621 15266
NM_138292chr1143523 2328 935 707 ------
NM_138423chr151152 --196 11642
NM_138468chr256289 5979 5552 5350 206 --24495 2518 --
NM_138713chr1677444 6851 6222 6216 5488 2569 2005 17943 26119 1261 --
NM_138714chr1677444 6851 6222 6216 5488 2569 2005 17943 26119 1261 --
NM_138715chr8101936 1916 1910 1898 1880 1874 1862 1804 600 439 ------
NM_138731chr1464260 2897 2677 1425 1123 686 1556 23326 1290 --
NM_138782chr542191 821 794 761 --1500 11682
NM_138959chr196711 4851 4455 2696 1979 1659 1443 753 459 1337 11767 --
NM_139057chr1562809 2772 2589 2570 922 654 --21083 939 --
NM_139316chr741033 736 333 262 ----1136
NM_144571chr476984 6516 6012 5615 5259 1932 165 16108 1861 15450
NM_144578chr1463793 2208 1461 1231 1101 153 13842 23991 739 --
NM_144595chr131264 --1787 1297
NM_144778chr1321816 1779 ----12708
NM_144973chr1295134 4981 4460 4073 3854 2130 860 509 415 ------
NM_145320chr71678 --12414 13312
NM_145321chr71678 --12414 13312
NM_145322chr71678 --12414 13312
NM_145735chr1352309 2092 379 138 39 --22174 777 --
NM_145808chr732772 2384 849 ----12548
NM_152332chr1452784 756 534 383 137 22237 1855 ----
NM_152384chr241994 1968 1722 440 1768 12040 11875
NM_152388chr243302 3158 2950 477 --1625 12727
NM_152594chr1532228 1475 105 --11578 11830
NM_152622chr543479 3389 2842 1167 1467 12428 --
NM_152624chr597249 7242 7211 6503 5212 4508 2677 2262 489 --17444 --
NM_152787chrX53509 3313 2729 2661 1239 --23371 1030 --
NM_152999chr754980 4833 3631 1919 1770 2822 777 13049 --
NM_153188chr565622 5409 5093 4751 1779 1510 --24890 4227 25473 344
NM_153262chr172756 2412 1195 742 709 564 185 12295 ----
NM_153442chr1085986 5104 5073 4745 2298 2277 570 544 1532 15903 12427
NM_153607chr563204 2892 2619 2147 602 470 --22953 2552 1914
NM_153619chr1573623 3498 2607 2533 1428 1175 498 22949 2561 ----
NM_153712chr293788 3527 3327 3251 2773 2588 2562 1132 1021 12696 ----
NM_153810chr1044386 3483 3404 600 11736 1836 14655
NM_170672chr251848 1646 324 272 230 ----11557
NM_170706chr153677 2752 1714 1067 268 13089 --12819
NM_170710chr433116 2449 89 ----23079 2064
NM_170731chr1132208 2063 440 ----22858 1156
NM_170732chr1132208 2063 440 ----22858 1156
NM_170733chr1132208 2063 440 ----22858 1156
NM_170734chr1132208 2063 440 ----22858 1156
NM_170735chr1132208 2063 440 ----22858 1156
NM_172070chr242125 1986 311 28 --11635 --
NM_172071chr167229 6574 5175 2879 2803 523 --12367 --
NM_173214chr1677444 6851 6222 6216 5488 2569 2005 17943 26119 1261 --
NM_173359chr351516 1373 689 511 388 ----11688
NM_173475chr1681718 1461 1377 1161 464 422 251 128 --1154 --
NM_173519chr82349 48 --21541 405 11652
NM_173552chr322462 2414 --11660 1326
NM_173591chr123947 653 398 ----11035
NM_173642chr1159154 9135 8908 8020 7644 6714 6360 5804 5680 3130 2020 1878 1089 928 348 16036 18272 11344
NM_173829chr586018 5988 5886 5134 4782 3826 1589 1113 --55493 4739 2484 2363 795 24900 458
NM_175623chr1287692 7451 7361 7333 6265 5765 1484 138 22683 2411 57519 6952 2963 1593 216 17318
NM_175624chr1287787 7546 7456 7428 6360 5860 1579 233 22778 2506 57614 7047 3058 1688 311 17413
NM_175625chr1287787 7546 7456 7428 6360 5860 1579 233 22778 2506 57614 7047 3058 1688 311 17413
NM_175733chr1162067 1938 1505 651 507 302 2658 294 --128
NM_175736chr1297846 7142 6996 6971 6018 5474 498 490 407 27357 1484 2815 152 26471 658
NM_175861chr1265883 4476 4356 3828 1862 1635 --24344 964 --
NM_176814chr731205 1104 95 1499 11421 11093
NM_177452chr1411573 12525 --21995 346
NM_177531chr8------2279 134
NM_177538chr287271 7252 6391 5937 5586 3484 120 92 --26929 6245 --
NM_177966chr331770 1738 682 ----1747
NM_177974chr151152 --196 11642
NM_177985chr242184 1426 701 588 --12042 1626
NM_178151chrX67634 6052 5882 5686 5649 5508 --26715 2326 --
NM_178152chrX67634 6052 5882 5686 5649 5508 --26715 2326 --
NM_178153chrX67634 6052 5882 5686 5649 5508 --26715 2326 --
NM_178586chr1442375 2289 2213 628 --177 12194
NM_181265chr433116 2449 89 ----23079 2064
NM_181504chr544108 1456 854 614 11509 --21297 756
NM_181523chr544108 1456 854 614 11509 --21297 756
NM_181524chr544108 1456 854 614 11509 --21297 756
NM_181704chr213393 263 61 --3327 233 72 1431
NM_181783chr1241828 1780 184 49 21879 30 --11993
NM_181838chr521380 187 ----1197
NM_181846chr1972999 2178 1116 1110 1102 497 459 --42346 2149 2079 801 --
NM_181897chr322316 229 1294 22591 116 1271
NM_182484chr213393 263 61 --3327 233 72 1431
NM_182485chr423662 3112 --22561 2405 --
NM_182515chr1956538 5991 5736 2230 652 --34237 1166 188 11687
NM_182646chr423662 3112 --22561 2405 --
NM_182758chr1552495 2386 1223 1041 622 23488 3023 ----
NM_182972chr162545 2430 2356 2147 1955 188 --12649 --
NM_183078chr623849 279 --33675 2474 494 12878
NM_183227chr621558 1521 ----11504
NM_183419chr831491 1378 1167 ----11064
NM_194071chr775412 5079 4189 4178 2183 1601 1206 1301 ----
NM_194291chr851961 467 293 194 41 ------
NM_194314chr165611 5204 3963 3911 1012 803 24469 991 ----
NM_194328chr933298 2592 439 12806 23140 2506 22276 519
NM_194329chr933298 2592 439 12806 23140 2506 22276 519
NM_194330chr933298 2592 439 12806 23140 2506 22276 519
NM_194332chr933298 2592 439 12806 23140 2506 22276 519
NM_197968chr132612 120 --1289 1576
NM_198273chr533100 2422 1939 12263 1268 --
NM_198399chr351546 1474 1220 1155 539 --11187 11780
NM_198400chr1532395 1792 1012 12799 --12888
NM_198581chr267266 5900 5756 4987 1608 126 --25284 617 --
NM_198715chr186296 6278 5838 5769 4997 4982 4749 4179 15052 14679 23975 163
NM_198900chr1297846 7142 6996 6971 6018 5474 498 490 407 27357 1484 2815 152 26471 658
NM_198990chr742910 2122 735 650 --13026 13236
NM_199436chr233056 2850 2759 ----1517
NM_199482chr252114 1931 83 49 24 ------
NM_201591chr441960 1951 1529 633 ----21880 1213
NM_201592chr441960 1951 1529 633 ----21880 1213
NM_203406chr511019 --22274 949 12555
NM_203504chr411803 ----1478
NM_203505chr411803 ----1478
NM_205860chr11472 --23017 190 23103 542
NM_206853chr643901 2777 1252 621 13871 34099 1053 234 --
NM_206854chr645162 4038 1882 712 15132 25360 1495 --
NM_206855chr656127 5003 4085 1677 560 16097 26325 2460 --
NM_206909chr887933 7826 7673 6738 5357 1563 1495 267 17279 21924 1672 --
NM_207292chr353157 2273 2222 669 641 1753 --1590
NM_207293chr353157 2273 2222 669 641 1753 --1590
NM_207294chr353157 2273 2222 669 641 1753 --1590
NM_207295chr353157 2273 2222 669 641 1753 --1590
NM_207296chr353157 2273 2222 669 641 1753 --1590
NM_207297chr353182 2298 2247 694 666 1778 --1615
NM_207303chr1042905 1432 1422 32 --1101 --
NM_207304chr1321703 1666 ----12595
NM_207325chr1911528 21960 1596 --1560
NM_212460chr721905 226 ----11880
NM_213589chr285421 5334 4183 3508 2205 1588 1033 499 --15210 --
NM_213590chr1345148 4826 3687 511 34497 4283 794 14732 15277